Nrf2/UBE3B protects against acute lung injury by inhibiting ferritinophagy through the ubiquitination of NCOA4

Nrf2/UBE3B protects against acute lung injury by inhibiting ferritinophagy through the ubiquitination of NCOA4 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Nrf2/UBE3B protects against acute lung injury by inhibiting ferritinophagy through the ubiquitination of NCOA4 Yanjun Wang, Hui Dong, Yunfan Gu, Han Chen, Beibei Hu, Xiangdong Xue, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5229445/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Iron overload and ferroptosis are associated with intestinal ischemia and reperfusion (II/R)-induced acute lung injury (ALI). However, the mechanisms underlying the regulation of iron homeostasis remain unclear. Nrf2 regulates cellular iron homeostasis; however, its impact on ALI pathology and its underlying mechanism of action requires further investigation. Ubiquitin ligase E3B (UBE3B) plays a critical role in the proteasome pathway, which is essential for protein turnover and ubiquitin-mediated signaling. A recent study found that UBE3B plays a role in oxidative stress; however, it remains unknown whether its role is related to Nrf2. Furthermore, the exact role of UBE3B in ALI and its underlying mechanism remain largely uncharacterized. In the present study, immunohistochemical analysis of UBE3B expression in type II alveolar epithelial cells (AECII) was conducted and its expression was found to be increased in II/R-ALI. Western blot analysis indicated that UBE3B hyperactivation may alleviate oxidative stress, thereby protecting against ALI. Moreover, UBE3B was involved in iron metabolism dysfunction and ferroptosis. UBE3B deficiency enhanced the process of nuclear receptor coactivator 4 (NCOA4)-mediated ferritinophagy and increased ferrous ion content, whereas overexpression of UBE3B reversed the harmful effects of Nrf2 knockdown on AECⅡ, which may promote AECⅡ ferroptosis. This study highlights the role of the Nrf2/UBE3B/NCOA4 axis in AECⅡ ferroptosis and II/R-ALI pathogenesis, suggesting that Nrf2 activation may be a promising strategy for ALI treatment. Nrf2 acute lung injury ferroptosis NCOA4 ferritinophagy UBE3B Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Ischemia-reperfusion (IR *) Ferritinophagy, the selective autophagy of ferritin mediated by nuclear receptor coactivator 4 (NCOA4), involves NCOA4 recognizing ferritin and delivering it to the autophagosome. Within autophagosomes, ferritin is degraded, releasing iron into lysosomes (Feng et al., 2024). Notably, excessive iron levels can trigger cell death (Dong et al., 2021). Previous studies revealed that inhibiting ferroptosis in a ferritinophagy-mediated manner could alleviate sepsis-induced ALI (Zhang et al., 2022, Dong et al., 2023). Therefore, the pursuit of targeted ferroptosis has emerged as a potential therapeutic strategy for these diseases. However, the regulatory mechanisms underlying iron metabolism in AECⅡ cells under pathological conditions require further investigation. Nuclear factor E2-related factor 2 (Nrf2) is a key regulator of oxidative homeostasis, activated in response to increased oxidative stress. Nrf2 binds to the antioxidant response element (ARE) in the nucleus, promoting the transcription and translation of antioxidant and anti-inflammatory proteins, thereby providing cellular protection (Loboda et al., 2016, Gañán-Gómez et al., 2013, Fan et al., 2017). These proteins regulate vital cellular defense mechanisms and offer protection against damage to the brain (Zhai et al., 2013), liver (Kudoh et al., 2014), and heart (Shen et al., 2019), as well as against II/R (Zhao et al., 2010, Dong et al., 2020). UBE3B is a calmodulin-regulated, mitochondria-associated E3 ubiquitin ligase (Braganza et al., 2017). Knockdown of Ube3b in mice results in reduced viability, recapitulation of key aspects of human disorders, such as reduced weight and brain size, and downregulation of cholesterol synthesis. Previous research has shown that the probable Caenorhabditis elegans ortholog of UBE3B, oxi-1, functions in the ubiquitin/proteasome system in vivo and plays a key role in oxidative stress-related diseases (Basel-Vanagaite et al., 2012). This highlights the diverse effects of UBE3B deficiency and underscores the physiological importance of ubiquitination in neuronal development and function in mammals. However, it is unknown whether its antioxidant effect interacts with Nrf2 and whether it has a critical role in ferroptosis. The aim of this study was to investigate whether Nrf2 silencing during ischemia induces ferritinophagy via UBE3B and NCOA4 modulation. In this study, we examined ferroptosis and ferritinophagy in an in vitro II/R-ALI model. Moreover, we evaluated whether UBE3B restrained ferritinophagy, normally observed in II/R-ALI, by regulating NCOA4. Our study revealed potential therapeutic targets for managing II/R-ALI. 2. Materials and methods 2.1. Materials Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), penicillin, and streptomycin sulfate were sourced from Gibco Life Technologies Co. (Grand Island, NY). The Cell Counting Kit-8 (CCK-8) and ROS Assay Kit - Photo-oxidation Resistant DCFH-DA were obtained from Dojindo Laboratories (Kumamoto, Japan). Glutathione (GSH) Content Assay Kit was obtained from Cayman Chemical Company (United States). Phosphate-buffered saline (PBS) Buffer Premixed Powder (1X) and 10X Tris-Glycine SDS-PAGE Running Buffer were supplied by Sangon Biotech (Shanghai) Co., Ltd (Kudoh et al.). LipoFiter Transfection Reagent Kit were sourced from Hanbio Technology (Shanghai) Co., Ltd. (Shanghai, China). Hoechst, Malondialdehyde (MDA) Content Assay Kit, and 4’,6-Diamidino-2-phenylindole (DAPI) were sourced from Beyotime Institute of Biotechnology (Shanghai, China). HRP Goat Anti-Rabbit IgG (H + L) (AS014), Anti-Nrf2 rabbit (A21508), Anti-NCOA4 rabbit (A5695), Anti-β-actin rabbit mAb (High Dilution) (AC026), HA-Tag rabbit mAb (AE105), DDDDK-Tag rabbit mAb (AE092), Anti-Ferritin Heavy Chain rabbit mAb (A19544), and Anti-LC3B rabbit mAb (A19665) were procured from ABclonal Technology Co. (Shanghai, China). The plasmid was acquired from Genomeditech Co., Ltd. (Kudoh et al.). Prussian Blue Iron Stain Kit was sourced from Beijing Solarbio Science & Technology Co., Ltd (Kudoh et al.). The PrimeScript™ RT-PCR Kit was obtained from Takara Biomedical Technology (Beijing) Co., Ltd. The 2x SYBR Green qPCR Master Mix (Low ROX) was obtained from Selleck.cn (Kudoh et al.). 2.2. Isolation of primary alveolar epithelial cells type Ⅱ Pregnant C57BL/6J mice at embryonic day 19 (E19) were used for the extraction of primary cells. Under sterile conditions, the uterus was dissected to retrieve the fetal mice. Placing the fetal mice in a laminar flow hood, a horizontal incision was made across the chest of each fetal mouse. The lungs were removed and placed in pre-cooled PBS solution. Care was taken to remove non-lung tissues, such as residual tracheal and connective tissues, as much as possible. The lung tissues were washed three times with PBS, cut into approximately 1 mm3 tissue fragments using ophthalmic scissors, washed once with trypsin solution, and then digested at 37°C for a duration of 20 minutes. To halt the digestion, mix the trypsin with an equal volume of medium with FBS. The mixture was subsequently passed through a 200-mesh sieve. and centrifuged at 1500 revolutions per minute for 5 minutes at low temperature. The liquid above the sediment was removed, and the pellet was retained. The pellet was incubated with 0.1% collagenase I at 37°C for 20 minutes. After digestion, an equal amount of DMEM containing 10% FBS was introduced, with centrifugation for 5 minutes at 1000 rpm. The cell was collected and plated into a culture bottle, which was incubated at 37°C with 5% CO2 for 45 minutes. The liquid above the sediment was then aspirated and transferred to another culture bottle. This same step was repeated for 3 times. Finally, the liquid above the sediment was aspirated, and then centrifuged the cells at 800 rpm for a duration of 5 minutes. After discarding the supernatant, the cell was suspended in a culture medium. and seeded into a culture bottle. After incubating for 24 hours, the medium was exchanged to remove unattached cells, and the culture was continued. The growth and morphology of the cells were examined under an inverted microscope. 2.3. Cell culture The MLE12 cells, obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), were maintained in a conventional cell culture incubator at 37°C with 5% CO2 and maintained humidity. The cells were maintained in DMEM with 10% FBS and 1% penicillin-streptomycin. 2.4. Oxygen-glucose deprivation and reoxygenation (OGD/R) model For the OGD/R model induction, cells underwent an initial phase of 8 hours of glucose deprivation, followed by 12 hours of reoxygenation. During the deprivation phase, cells were cultured in a glucose-free medium inside an anaerobic chamber with an atmosphere of 95% N2 and 5% CO2 for 8 hours. Following this, the cells were transitioned to a high-glucose medium and grown in a conventional cell culture incubator for an additional 12 hours to reoxygenate. 2.5. Cell viability assessment Within a 96-well plate, MLE12 cells were cultured at 1 × 104 cells/well. Once the cells had fully adhered, they were subjected to various treatments. Subsequently, the cells underwent 8 hours of oxygen-glucose deprivation (OGD) followed by 12 hours of reoxygenation to establish the OGD/R model. Upon completion of the model establishment, each well received 10 µL of CCK-8 solution and 90 µL of medium. Following this, the cells were kept for 4 hours in the dark before their optical density (OD) at 450 nm was mrasured by a microplate reader. 2.6. Animals Twenty-four C57BL/6J mice (6–8 weeks) were acquired from the Animal Center of Shanghai Jiao Tong University School of Medical Sciences. They were kept under regulated environmental conditions, and a 12-hour light/dark cycle, with a temperature of 21 ± 2°C. All experimental procedures were performed following the guidelines stipulated by the National Institutes of Health (NIH) and took permission from the Animal Research Ethics Committee at Shanghai Jiao Tong University (ethical approval number A2023114). 2.7. Intestinal ischemia/reperfusion (II/R) mouse model Prior to the experiment, animals underwent a 24-hour fasting period with access to water. The mice were anesthetized intraperitoneally with sodium pentobarbital at a dosage of 50 mg/kg and underwent a midline incision. To induce intestinal ischemia, The superior mesenteric artery was temporarily occluded using non-invasive vascular clips for a duration of 45 minutes followed by a 180-minute reperfusion period. Sham control mice underwent identical procedures without vascular occlusion. After 3 hours of reperfusion, the animals were euthanize, and tissue samples were promptly frozen at -80°C. 2.8. Malondialdehyde (MDA) assay (Rui et al., 2021) Homogenize or lyse the tissues or cells using PBS or lysis buffer. For tissues, the weight of the tissue should constitute 10% of the volume of the homogenization or lysis buffer; for cells, use 0.1 ml of lysis or homogenization buffer per one million cells. After homogenization or lysis, centrifuge at 10,000g to 12,000g for 10 minutes at 4ºC and collect the supernatant. Dilute the appropriate amount of the standard with distilled water to concentrations of 1, 2, 5, 10, 20, and 50µM. In a centrifuge tube or another suitable container, add 0.1 ml of the homogenization buffer, lysis buffer, or PBS as a blank control, 0.1 ml of the standards above different concentrations to create the standard curve, and 0.1 ml of the sample for measurement. Then, add 0.2 ml of the MDA detection working solution. Mix well and heat at 100ºC or in a boiling water bath for 15 minutes. Cool the samples to room temperature in a water bath, then centrifuge at 1000g for 10 minutes. Transfer 200 µl of the supernatant to a 96-well plate, and measure the absorbance at 532 nm using a microplate reader. Calculate the MDA content in the sample solution. 2.9. GSH assay (Wu et al., 2023) The GSH levels were measured using a GSH assay kit (Cayman Chemical, Catalog No. 703002, Ann Arbor, MI, USA). 2.10. Iron ion assay Weigh 0.1 g of fresh tissue and mix 0.9 mL of homogenization reagent. Centrifuge the mixture at 10,000 × g for a duration of 10 minutes, and collect the resulting supernatant. Dilute the sample to a concentration within the linear range of the kit (0.4–50 µmol/L). Prepare standard tubes by transferring 300 µL of different concentrations of the standard solution into corresponding 1.5 mL EP tubes. Similarly, prepare test tubes by transferring 300 µL of the sample into corresponding 1.5 mL tubes. Mix 150 µL of reagent two to each tube, mix thoroughly, and place the mixture in an incubator set at 37°C for a duration of 10 minutes. Centrifuge all tubes at 12,000 × g for 10 minutes. Transfer 300 µL of the supernatant from each tube into the respective wells of a 96-well plate. Their OD were measured at 593 nm in each well by a microplate reader. 2.11. Perls staining After preheating the paraffin sections, deparaffinize twice in xylene for 5 minutes each time. Gradually rehydrate with ethanol, 3 minutes per grade, and rinse with distilled water for 3 minutes. Thaw the frozen sections, allow them to equilibrate at 4°C for 10 minutes, and then rinse them with distilled water for 3 minutes. For cell smears, fix with pre-cooled low-grade alcohol for 3 minutes or 4% tissue cell fixative for 20 minutes, followed by two washes with 70% ethanol for 1 minute each, and two rinses with distilled water for 2 minutes each. Prepare Perls staining working solution before use, add it to cover the sections, stain for a duration of 30 minutes, and rinse with distilled water for 10 minutes. For nuclear fast red staining, stain for 5–10 minutes, rinse quickly with tap water for 2–3 seconds. Dip in 75%, 85%, 95% ethanol for 3–5 seconds each, and twice in 100% ethanol, each time for 1 minute. Clear with xylene or environmentally friendly tissue deparaffinization solution twice, each time for 1–2 minutes. Seal with neutral gum. 2.12. Lung injury score The mice lung tissues underwent fixation in 10% formalin, and embedding in paraffin and sectioning into 5 µm slices. Thereafter, the slices were stained with hematoxylin and eosin (HE) and examined using a Nikon-Ni-U light microscope equipped with an Optronics DEI-470 digital camera. To evaluate acute lung injury (ALI), a five-point scoring system (0–4) was utilized based on several parameters: The scoring criteria included assessment of alveolar and interstitial edema, intra-alveolar inflammatory cell infiltration, alveolar hemorrhage, and atelectasis, which were graded as follows: Grade 0: Normal morphology, with 85% alveolar space occupancy. Grade 1: Mild injury, with 15–25% tissue occupancy and 75–85% alveolar space occupancy. Grade 2: Moderate injury, with 25–50% tissue occupancy and 50–75% alveolar space occupancy. Grade 3: Severe injury, with 50–75% tissue occupancy and 25–50% alveolar space occupancy. Grade 4: Very severe injury, with 75–100% tissue occupancy and 0–25% alveolar space occupancy. 2.13. Co-immunoprecipitation (CO-IP) assay Tissue sample preparation: Rinse the tissue with PBS, add pre-chilled RIPA buffer (mild RIPA, 1000 µL/100 mg tissue, supplemented with 10 µL protease inhibitor/1000 µL RIPA), and keep on ice for 10 minutes. Take two sterilized steel beads and grind the tissue. Centrifuge at 4°C, 12000 rpm for a duration of 15 minutes, and retrieve the liquid. Determine protein concentration using the BCA method. For total protein, take 500 ul and add 10 µL of Nrf2 antibody; take 300 µL and add IgG antibody. Incubate overnight at 4°C with slow inverting. The remaining protein is combined with loading buffer and heated to 100°C, boiling for 15 minutes. Pre-wash Protein A beads: Resuspend Protein A + G magnetic beads by gently pipetting, transfer an appropriate amount into a clean centrifuge tube and adjust to a final volume of approximately 0.5 ml with 1X TBST. Gently resuspend Protein A + G magnetic beads by pipetting. Put the tube on a magnetic rack for 10 seconds to allow the beads to adhere to the magnet, then gently discard the supernatant. Perform this washing step two additional times. Next, perform magnetic separation using the Protein A + G magnetic beads: discard the supernatant, add the sample, resuspend the beads, and allow the mixture to incubate for 30 minutes on a rocking mixer. Add 500 µL of 1X TBST, gently resuspend Protein A + G magnetic beads by pipetting, place on a magnetic stand for 10 seconds, discard the liquid above, and repeat washing three times. For every 10–20 µL of the original magnetic bead volume, mix 10 µL 2X SDS-PAGE loading buffer. Heat the mixture at 100°C for 5 minutes, then place it on a magnetic stand for 10 seconds to separate the beads and collect the supernatant. Analyze by Western Blotting to confirm the binding proteins. 2.14. Western blot Proteins were blended with SDS-PAGE loading buffer and heated at 95°C for about 15 minutes. The proteins underwent electrophoresis on a 10% SDS-PAGE gel and transferred onto a polyvinylidene fluoride (PVDF) membrane. In succession, the membrane was immersed in TBST solution with 10% skimmed milk for 1.5 hours, subsequent to 3 washes with TBST. Primary antibodies against Nrf2 (Rabbit, 1:500), NCOA4 (Rabbit, 1:1000), UBE3B (Rabbit, 1:1000), FTH1 (Rabbit, 1:1000), LC3 (Rabbit, 1:1000), and β-actin (Rabbit, 1:100000) were then incubated with the membrane overnight at 4°C. On the subsequent day, the protein bands were rinsed 3 times with TBST before being exposed to secondary antibodies (HRP-goat anti-rabbit, 1:5000) for 1 hour. Hereinafter 3 washes with TBST, bands were detected with an enhanced ECL chemiluminescent substrate kit and quantified by the Bio-Rad multicolor fluorescence and chemiluminescence imager. 2.15. Immunofluorescence assay Cryosections of the lungs were prepared and treated with 0.3% Triton-100 for 15 minutes to permeabilize them, followed by a 2-hour incubation with 3% BSA. And the sections were exposed separately to primary antibodies targeting NCOA4, UBE3B, FTH1, and LC3, and incubated overnight at 4°C. With overnight exposure, the sections were rinsed with five washes of PBS. To visualize the target proteins, the sections underwent incubation with fluorescently labeled secondary antibodies for 1 hour. Subsequently, three washes with PBS were performed. Finally, the sections were counterstained with DAPI to observe cell nuclei and captured by a confocal laser scanning microscope (Carl Zeiss LSM710, Germany). 2.16. Plasmid transfection To initiate plasmid transfection, cells were seeded in a 6-well plate the previous day at about 1 × 10 6 cells/well. The cells grew until they reached about 70% confluence the following day. Before the transfection procedure described below, the culture medium was changed to 2 mL of fresh culture medium containing serum. In a sterile and clean centrifuge tube, 125 µL of serum-free DMEM culture medium (devoid of antibiotics) was added for each well slated for transfection. Subsequently, 2 µg of plasmid DNA was introduced into each tube, and gentle pipetting facilitated thorough mixing. Following this, 4 µL of LipoFiter transfection reagent was added, and the mixture was gently swirled to ensure homogeneity. Whether dealing with adherent or suspended cells, the 125 µL Lipo8000™ transfection reagent-DNA concoction was evenly dispensed into each well of the six-well plate, with careful swirling to guarantee uniform distribution. The cells were then allowed to incubate for approximately 72 hours before sample collection. 2.17. Quantitative real-time PCR assay Cells or tissues were treated with TRIzol to extract RNA. The isolated RNA was subsequently converted in reverse to generate cDNA by using the PrimeScript™ RT-PCR Kit. Subsequent qPCR was conducted with 2x SYBR Green qPCR Master Mix. The primer sequences for each target are as follows: Mouse_actin, beta (β-actin) Forward primer: GCTCACCATTCACCATCTTGTCTTG Reverse primer: TCCTGCTTGCTGATCCACATCTG Mouse_Nrf2 Forward primer: TTGCCACCGCCAGGACTACA Reverse primer: AACTTGTACCGCCTCGTCTGGA Mouse_nuclear receptor coactivator 4 (Ncoa4) Forward Primer: GCCAGAGCAGAAGTCAGCATCC Reverse Primer: GCCAGTCCTGTGGGTTGGTACT Mouse_ferritin heavy polypeptide 1 (FTH1) Forward primer: CCATCAACCGCCAGATCAACCT Reverse primer: GCAAAGTTCTTCAGAGCCACATCAT Mouse_microtubule-associated protein 1 light chain 3 beta Forward primer: CAAGCCTTCTTCCTCCTGGTGA Reverse primer: TTGCTGTCCCGAATGTCTCCTG 2.18. Transmission electron microscopy (TEM) The mice lung tissues were preserved in 0.05 M sodium cacodylate buffer with 2.5% glutaraldehyde at pH 7.2 at 25°C for a duration of 2 hours. Following this, they were dealt with 2% OsO4 in 0.1 M sodium cacodylate buffer for an additional 2 hours, followed by immersion in 1% aqueous uranyl acetate for a period of 18 hours. With the dehydration in ethanol, the samples were preserved in resin, sectioned using copper grids, and stained with lead citrate and uranyl acetate. Visualization was carried out by a transmission electron microscope (FEI Company, Oregon). 2.19. Statistical Analysis The mean values with their standard deviations (SD) are presented. Statistical analyses were carried out by using Prism software (version 9.0.0), employing one-way analysis of variance (ANOVA) for between-group comparisons. Statistical significance was shown as follows: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. 3. Results 3.1. II/R causes ferroptosis and ferritinophagy in mouse lung tissue Iron plays a key role in ferroptosis initiation and can promote the generation of reactive oxygen species (ROS) through the Fenton reaction. Thus, we determined iron levels in the lung tissues of an II/R-ALI model to evaluate the role of ferroptosis. Iron levels in II/R mice were significantly higher than those in sham mice (Fig. 1 a–b). We then assessed ferroptotic markers. Lipid peroxidation represents a critical characteristic of ferroptosis, culminating in the production of malondialdehyde (MDA) as its final product. As shown in Fig. 1 c, MDA levels increased significantly, whereas glutathione (GSH) levels decreased (Fig. 1 d), both of which are characteristic of ferroptosis. Furthermore, using TEM, we demonstrated that AECⅡ from II/R mice exhibited characteristics more typical of ferroptosis than those of sham mice, including decreased mitochondrial size and reduced cristae size (Fig. 1 e). Utilizing hematoxylin and eosin (HE) staining (Fig. 1 f–g), we further demonstrated that II/R resulted in significant damage to lung tissue (p < 0.05). NCOA4 mediated ferritinophagy has been demonstrated to play a critical role in regulating the intracellular Fe 2+ balance, and emerging evidence has shown that NCOA4 can regulate ferroptosis (Wang et al., 2024, Jiang et al., 2024a, Wang et al., 2023b, Shi et al., 2023). The present study investigated whether NCOA4 is involved in II/R and whether ferroptosis induced by II/R is regulated by ferritinophagy. FTH1 and LC3 showed increased co-localization after II/R (Fig. 1 h). The mRNA levels of NCOA4 and LC3II were observed to be higher in the II/R group than in the control group (Fig. 1 i). Western blotting showed that NCOA4 and LC3Ⅱ protein levels were significantly elevated, whereas levels of FTH1 (a critical protein of ferritinophagy) were markedly diminished in the II/R model compared with those in the sham mice. Notably, we found that the Nrf2 and UBE3B expression levels were increased significantly following II/R (Fig. 1 j–k). Collectively, these data indicated that II/R-ALI mice demonstrated enhanced ferroptosis and ferritinophagy. Nevertheless, the relationship between the two and the role of Nrf2-related pathways in this process requires further exploration. 3.2. Nrf2 knockout accelerates ferroptosis and ferritinophagy and aggravates II/R-ALI To investigate the role of Nrf2 in regulating ferritinophagy in the context of II/R-ALI, we studied Nrf2 conditional knockout (CKO) mice. Nrf2 plays a crucial role in modulating antioxidant stress and ferroptosis. Ferritinophagy increases the cytosolic catalytic Fe(Ⅱ) levels, resulting in ferroptosis (Jiang et al., 2024b). We observed iron deposition using Perls’ staining. Compared to sham mice, the lung tissue of Nrf2 CKO mice showed more severe iron deposition (Fig. 2 a). The lung tissues of Nrf2 CKO mice exhibited higher iron content (Fig. 2 b). Meanwhile, our results revealed pronounced suppression of GSH in the II/R model, which was particularly notable in Nrf2 CKO mice (Fig. 2 c) and found elevated MDA levels in the II/R model, which was particularly pronounced in Nrf2 CKO mice (Fig. 2 d). The pathology of II/R-ALI was more severe in Nrf2 CKO II/R mice than in WT mice (Fig. 2 e–f), indicating that Nrf2 provides protection against ALI, consistent with other studies (Zou et al., 2024). Likewise, our TEM observations demonstrated that the mitochondria were smaller in size, the cristae were either reduced or absent, and the outer membrane was torn in Nrf2 CKO II/R mice compared to that in WT mice (Fig. 2 g). This suggests accelerated iron accumulation and ferroptosis in the absence of Nrf2. To elucidate the Nrf2 regulation of ferritinophagy-associated proteins, we assessed their expression in Nrf2 CKO mice. Thus, Nrf2 levels were significantly elevated in the II/R model compared to those in the sham mice. NCOA4 and LC3Ⅱ protein levels were further increased in Nrf2 CKO mice, whereas FTH1 levels were reduced in the II/R model and further lower in Nrf2 CKO mice (Fig. 2 h–i). Additionally, UBE3B levels, which were high in the II/R model, were significantly reduced in Nrf2 CKO mice, indicating that they may be regulated by Nrf2. Taken together, these results indicate that Nrf2 CKO mice lose their ability to modulate ferritinophagy following II/R. Based on these data, we can deduce that Nrf2 negatively regulates cellular ferritinophagy and ferroptosis in II/R-ALI cells. However, the specific regulatory mechanisms require further investigation. 3.3. Nrf2 deficiency reduces UBE3B expression and accelerates ferritinophagy, while overexpression of UBE3B alleviates cell damage via modulation of NCOA4 in AECII We used AECII cells to further investigate the signaling pathways involved in the Nrf2 regulation of ferritinophagy. These cells were derived from the lung tissue of Nrf2 KO mice. We demonstrated that Fe accumulated in AECII cells after oxygen glucose deprivation/re-oxygenation (OGD/R) induction, but not in non-induced AECII cells. Moreover, its levels significantly increased in the Nrf2 −/− group (Fig. 3 a). Next, we evaluated the levels of oxidative stress markers, such as CCK8, GSH, and MDA. Cell viability and GSH percentage were further reduced, whereas the percentage of MDA levels increased (Fig. 3 a–d). In line with our in vivo studies, Nrf2/UBE3B expression was markedly increased following OGD/R induction in AECII cells, while NCOA4 and LC3II protein levels were further increased in the sh Nrf2 group. Additionally, FTH1 levels were low in the OGD/R group and even lower in the sh Nrf2 group (Fig. 3 e–f). However, UBE3B overexpression reversed the changes caused by Nrf2 deficiency. We simultaneously transfected Nrf2 −/− and OEUBE3B lentiviruses into AEC and performed OGD/R modeling. Nrf2 −/− increased NCOA4 and LC3II, while overexpression of UBE3B reduced this effect and increased the expression of the FTH1 protein (Fig. 3 g–h). In addition, we determined the iron content in the Nrf2 −/− +UBE3B group relative to that in the Nrf2 −/− control group. Iron levels were significantly increased in the Nrf2 −/− group, which was reversed by UBE3B overexpression (Fig. 3 i). Our results showed that cell viability and GSH levels increased, and MDA levels decreased in OGD/R OEUBE3B cells as compared to OGD/R Nrf2 −/− cells (Fig. 3 i–l). UBE3B overexpression significantly reversed the above changes caused by Nrf2 deficiency, indicating that UBE3B overexpression could inhibit NCOA4-mediated ferritinophagy, thereby alleviating ferroptosis. 3.4. UBE3B deficiency promotes NCOA4-mediated ferritinophagy and aggravates cell injury To further delineate the UBE3B-mediated regulation of ferritinophagy, AECⅡ cells were infected with UBE3B-shRNA lentivirus. UBE3B deficiency significantly aggravated ferritinophagy, indicating that NCOA4 and LC3Ⅱ expression (Fig. 4 a-b), cell death (Fig. 4 c), oxidative stress (Fig. 4 d-e), and iron content (Fig. 4 f) were further aggravated by shUBE3B OGD/R. These data indicate that the anti-ferritinophagy role of UBE3B may be produced by modulating NCOA4 levels after OGD/R induction. 3.5. UBE3B binds to NCOA4 and induces ubiquitination degradation, thereby regulating ferritinophagy We further investigated the potential mechanism by which UBE3B mediates NCOA4 protein expression in AECII. Ubiquitin E3 ligases have been well established to play a crucial role in selecting specific substrates for ubiquitination reactions, operating through the interaction between ubiquitin E3 ligases and substrates (Toma-Fukai and Shimizu, 2021). Therefore, we performed co-immunoprecipitation (CO-IP) with an Nrf2 antibody; the immunoblotting results showed an interaction between NCOA4 and UBE3B (Fig. 5 a) and was colocalized in cells (Fig. 5 b). To determine the region of UBE3B that recognizes NCOA4, we cloned and expressed four fragments spanning the UBE3B open reading frame, as shown in Fig. 5 c. Endogenous NCOA4 was combined with fragments 1 and 2 (Fig. 5 d). Additionally, shRNA-mediated depletion of UBE3B significantly increased the half-life of NCOA4 (Fig. 5 e), further supporting the hypothesis that UBE3B-mediated ubiquitination and degradation of NCOA4 suppress ferritinophagy. 4. Discussion Ferroptosis is an iron-dependent form of cell death that involves oxidative processes. It includes the Fenton reaction wherein ferrous iron reacts with hydrogen peroxide to produce ferric iron and ROS. If not promptly neutralized, ROS can harm lipid membranes, ultimately leading to cell death (Stockwell et al., 2017). NCOA4 binds to FTH1 within the autophagosome, facilitating the transfer of ferritin to the lysosome for degradation. This process releases free iron, which serves as a crucial source of intracellular ferrous ions (Wang et al., 2023a). Inhibition of ferritinophagy prevents ferroptosis; several studies have revealed that ferritinophagy-mediated ferroptosis promotes ischemia/reperfusion organ injury (Jin et al., 2023, Li et al., 2021). Therefore, we hypothesized that II/R or OGD/R may play a critical role in promoting ferroptosis and ferritinophagy. To test this hypothesis, we assessed the levels of oxidative stress markers, such as GSH, MDA, and Fe 2+ . We also evaluated the expression of ferritinophagy-related proteins, including NCOA4, FTH1, and LC3Ⅱ. According to our findings, the GSH percentage was dramatically reduced, while the MDA percentage and Fe 2+ levels were markedly elevated. Additionally, evaluation of the ferritinophagy-related proteins NCOA4, FTH1, and LC3Ⅱ indicated that both ferroptosis and ferritinophagy were notably elevated in the II/R and OGD/R groups compared to controls. At the same time, we observed that the co-localization of FTH1 and LC3 increased significantly in type Ⅱ alveolar epithelial cells of II/R mice. Therefore, the epithelium undergoes ferritinophagy during II/R. NCOA4-mediated ferritinophagy plays a crucial role in regulating intracellular Fe 2+ balance, and emerging evidence has shown that NCOA4 can regulate ferroptosis (Ma et al., 2024). In cells, NCOA4 binds to FTH1 and LC3Ⅱ in the lysosome, facilitating the release of ferrous iron and enhancing the Fenton reaction to promote ferritinophagy, thereby triggering ferroptosis (Lee et al., 2022, Man et al., 2022, Masaldan et al., 2018). Nrf2 is a pivotal transcription factor of oxidative stress that stimulates downstream pathways that regulate ferroptosis by modulating GSH, iron and lipid metabolism, and mitochondrial function (Abdalkader et al., 2018). Previous studies have shown that Nrf2 regulates NCOA4-mediated ferritinophagy (Ma et al., 2024, Anandhan et al., 2023). Therefore, Nrf2 affects ferritinophagy-dependent ferroptosis by activating autophagy proteins. However, the precise role of Nrf2 in ferritinophagy associated with II/R-ALI remains to be elucidated. Nrf2 CKO mice exhibited more severe iron deposition, stronger GSH suppression, and higher MDA levels than WT II/R mice (Fig. 2 ). Additionally, examination of the ferritinophagy-related proteins FTH1 and LC3Ⅱ/LC3I suggested that ferritinophagy was significantly enhanced in Nrf2 CKO mice compared to that in WT mice. Simultaneously, we found that Nrf2 negatively regulates NCOA4. However, the specific regulatory mechanisms of these two remain to be investigated. Ubiquitin protein ligases form a vast superfamily, comprising more than 600 genes (George et al., 2018). These enzymes transfer ubiquitin molecules onto target proteins that are earmarked for degradation by the ubiquitin-proteasome system. Within this family, ubiquitin ligase E3B belongs to the HECT-type enzyme subgroup (Ambrozkiewicz and Kawabe, 2015). UBE3B is a mitochondria-associated ubiquitin protein ligase (Braganza et al., 2017). According to a recent study, disruption of mouse Ube3b results in decreased viability and mimics important characteristics of human disorders, including reduced weight and brain size, as well as the downregulation of cholesterol synthesis. UBE3B plays a critical role in oxidative stress responses (Basel-Vanagaite et al., 2012). However, it is unknown whether this antioxidant effect is related to Nrf2. In the present study, we identified high levels of UBE3B in an II/R model, suggesting possible UBE3B involvement in the regulation of ferritinophagy and II/R-ALI. UBE3B expression was significantly lower in Nrf2 CKO mice, suggesting that UBE3B is regulated by Nrf2. Braganza et al . found that silencing UBE3B in human cells led to alterations in mitochondrial morphology and physiology, decreased mitochondrial volume, and markedly inhibited cellular proliferation (Braganza et al., 2017). Mitochondrial damage is one of the characteristic signs of ferroptosis. In our study, we found that UBE3B overexpression reversed the damage caused by the loss of Nrf2, including prevention of AECⅡ cellular injury and reduction of Fe accumulation, NCOA4 proteins, and LC3Ⅱ/LC3I ratios, while promoting FTH1 levels (Fig. 3 ). In contrast, UBE3B inhibition reversed the above-mentioned changes (Fig. 4 ), demonstrating that UBE3B is regulated by Nrf2 and protects against OGD/R-driven ferritinophagy by regulating NCOA4. Upon conducting a literature search, we discovered that no study has yet reported the ubiquitination of NCOA4 or related ubiquitin E3 ligases. We speculated that UBE3B acts as an E3 ubiquitin ligase during the ubiquitination and degradation of NCOA4, thereby regulating ferritinophagy. We identified UBE3B as a novel protein that promoted the ubiquitination and degradation of NCOA4 (Fig. 5 ). This suggests that UBE3B interacts with NCOA4 to regulate its expression, thereby mediating ferritinophagy. This study has some limitations. First, we did not identify other ubiquitin ligases for Nrf2. Hence, it remains unclear whether Nrf2 binds to multiple ubiquitin ligases involved in ferroptosis or ferritinophagy. In addition, we did not identify any potential ubiquitination sites of NCOA4. Future studies should investigate the following aspects: (1) Whether Nrf2 also regulates other ubiquitin ligases and has similar effects, (2) further verification of potential ubiquitination sites of NCOA4, and (3) whether the findings of this study can serve as a reference for developing treatments for other types of acute organ injuries that share similar pathogenesis with ALI. In conclusion, the findings of the present study demonstrated the presence of ferritinophagy in II/R and OGD/R and revealed that Nrf2 regulates iron homeostasis by enhancing the ubiquitination and degradation of NCOA4 mediated by the ubiquitin E3 ligase UBE3B, thus inhibiting ferritinophagy. In contrast, inhibition of Nrf2 expression led to decreased UBE3B expression, which increased the half-life of NCOA4 and promoted ferritinophagy, thereby enhancing the accumulation of Fe and promoting oxidative stress and ferroptotic cell death. Overall, our study has great therapeutic potential to improve the treatment of II/R-driven ALI. Declarations Acknowledgements The authors gratefully acknowledge the support from the National Natural Science Foundation of China (82270080, 82172084, 81803002). Author contributions YW, HD, YG, HC, and BH conducted experiments and analyzed data. YW, HD, and YG prepared the manuscript. XX, RH, and HJ were involved in the conceptualization, review, and editing of the manuscript. XX and RH obtained and provided funding support. All authors have formally endorsed the final version. ‡These authors contributed equally: Yanjun Wang, Hui Dong, and Yunfan Gu. Data statement The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials. Funding sources This work is sponsored by National Natural Science Foundation of China (82270080, 82172084, 81803002). Institutional Review Board Statement All experimental procedures were conducted according to the guidelines set forth by the National Institutes of Health (NIH) and were approved by the Animal Research Ethics Committee of Shanghai Jiao Tong University, under ethical approval number A2023114. Data statement The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials. Declaration of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. All authors have formally endorsed the final version. References ABDALKADER, M., LAMPINEN, R., KANNINEN, K. M., MALM, T. M. & LIDDELL, J. R. 2018. Targeting Nrf2 to Suppress Ferroptosis and Mitochondrial Dysfunction in Neurodegeneration. Frontiers In Neuroscience, 12 , 466. AMBROZKIEWICZ, M. C. & KAWABE, H. 2015. HECT-type E3 ubiquitin ligases in nerve cell development and synapse physiology. FEBS Letters, 589 , 1635-1643. ANANDHAN, A., DODSON, M., SHAKYA, A., CHEN, J., LIU, P., WEI, Y., TAN, H., WANG, Q., JIANG, Z., YANG, K., GARCIA, J. G., CHAMBERS, S. K., CHAPMAN, E., OOI, A., YANG-HARTWICH, Y., STOCKWELL, B. R. & ZHANG, D. D. 2023. NRF2 controls iron homeostasis and ferroptosis through HERC2 and VAMP8. Science Advances, 9 , eade9585. BASEL-VANAGAITE, L., DALLAPICCOLA, B., RAMIREZ-SOLIS, R., SEGREF, A., THIELE, H., EDWARDS, A., ARENDS, M. J., MIRó, X., WHITE, J. K., DéSIR, J., ABRAMOWICZ, M., DENTICI, M. L., LEPRI, F., HOFMANN, K., HAR-ZAHAV, A., RYDER, E., KARP, N. A., ESTABEL, J., GERDIN, A.-K. B., PODRINI, C., INGHAM, N. J., ALTMüLLER, J., NüRNBERG, G., FROMMOLT, P., ABDELHAK, S., PASMANIK-CHOR, M., KONEN, O., KELLEY, R. I., SHOHAT, M., NüRNBERG, P., FLINT, J., STEEL, K. P., HOPPE, T., KUBISCH, C., ADAMS, D. J. & BORCK, G. 2012. Deficiency for the ubiquitin ligase UBE3B in a blepharophimosis-ptosis-intellectual-disability syndrome. American Journal of Human Genetics, 91. BRAGANZA, A., LI, J., ZENG, X., YATES, N. A., DEY, N. B., ANDREWS, J., CLARK, J., ZAMANI, L., WANG, X.-H., ST CROIX, C., O'SULLIVAN, R., GARCIA-EXPOSITO, L., BRODSKY, J. L. & SOBOL, R. W. 2017. UBE3B Is a Calmodulin-regulated, Mitochondrion-associated E3 Ubiquitin Ligase. The Journal of Biological Chemistry, 292 , 2470-2484. CAVRIANI, G., OLIVEIRA-FILHO, R. M., TREZENA, A. G., DA SILVA, Z. L., DOMINGOS, H. V., DE ARRUDA, M. J. C., JANCAR, S. & TAVARES DE LIMA, W. 2004. Lung microvascular permeability and neutrophil recruitment are differently regulated by nitric oxide in a rat model of intestinal ischemia-reperfusion. European Journal of Pharmacology, 494 , 241-249. DENNERY, P. A. & YAO, H. 2024. Emerging role of cellular senescence in normal lung development and perinatal lung injury. Chinese Medical Journal Pulmonary and Critical Care Medicine, 2 , 10-16. DONG, H., QIANG, Z., CHAI, D., PENG, J., XIA, Y., HU, R. & JIANG, H. 2020. Nrf2 inhibits ferroptosis and protects against acute lung injury due to intestinal ischemia reperfusion via regulating SLC7A11 and HO-1. Aging, 12 , 12943-12959. DONG, H., XIA, Y., JIN, S., XUE, C., WANG, Y., HU, R. & JIANG, H. 2021. Nrf2 attenuates ferroptosis-mediated IIR-ALI by modulating TERT and SLC7A11. Cell Death & Disease, 12 , 1027. DONG, X., LI, D., FANG, Z., ZHANG, C., WANG, J. & WAN, X. 2023. Astaxanthin alleviates lipopolysaccharide-induced acute lung injury by suppressing ferroptosis. Food & Function, 14 , 6115-6127. FAN, Z., WIRTH, A. K., CHEN, D., WRUCK, C. J., RAUH, M., BUCHFELDER, M. & SAVASKAN, N. 2017. Nrf2-Keap1 pathway promotes cell proliferation and diminishes ferroptosis. Oncogenesis, 6 , e371. FENG, Z., LUAN, M., ZHU, W., XING, Y., MA, X., WANG, Y. & JIA, Y. 2024. Targeted ferritinophagy in gastrointestinal cancer: from molecular mechanisms to implications. Archives of Toxicology . GAñáN-GóMEZ, I., WEI, Y., YANG, H., BOYANO-ADáNEZ, M. C. & GARCíA-MANERO, G. 2013. Oncogenic functions of the transcription factor Nrf2. Free Radical Biology & Medicine, 65 , 750-764. GEORGE, A. J., HOFFIZ, Y. C., CHARLES, A. J., ZHU, Y. & MABB, A. M. 2018. A Comprehensive Atlas of E3 Ubiquitin Ligase Mutations in Neurological Disorders. Frontiers In Genetics, 9 , 29. JIANG, J., RUAN, Y., LIU, X., MA, J. & CHEN, H. 2024a. Ferritinophagy Is Critical for Deoxynivalenol-Induced Liver Injury in Mice. Journal of Agricultural and Food Chemistry, 72 , 6660-6671. JIANG, L., ZHENG, H., ISHIDA, M., LYU, Q., AKATSUKA, S., MOTOOKA, Y., SATO, K., SEKIDO, Y., NAKAMURA, K., TANAKA, H., ISHIKAWA, K., KAJIYAMA, H., MIZUNO, M., HORI, M. & TOYOKUNI, S. 2024b. Elaborate cooperation of poly(rC)-binding proteins 1/2 and glutathione in ferroptosis induced by plasma-activated Ringer's lactate. Free Radical Biology & Medicine, 214 , 28-41. JIN, L., YU, B., WANG, H., SHI, L., YANG, J., WU, L., GAO, C., PAN, H., HAN, F., LIN, W., LAI, E. Y., WANG, Y.-F. & YANG, Y. 2023. STING promotes ferroptosis through NCOA4-dependent ferritinophagy in acute kidney injury. Free Radical Biology & Medicine, 208 , 348-360. KUDOH, K., UCHINAMI, H., YOSHIOKA, M., SEKI, E. & YAMAMOTO, Y. 2014. Nrf2 activation protects the liver from ischemia/reperfusion injury in mice. Annals of Surgery, 260 , 118-127. LEE, J., YOU, J. H. & ROH, J.-L. 2022. Poly(rC)-binding protein 1 represses ferritinophagy-mediated ferroptosis in head and neck cancer. Redox Biology, 51 , 102276. LI, C., SUN, G., CHEN, B., XU, L., YE, Y., HE, J., BAO, Z., ZHAO, P., MIAO, Z., ZHAO, L., HU, J., YOU, Y., LIU, N., CHAO, H. & JI, J. 2021. Nuclear receptor coactivator 4-mediated ferritinophagy contributes to cerebral ischemia-induced ferroptosis in ischemic stroke. Pharmacological Research, 174 , 105933. LOBODA, A., DAMULEWICZ, M., PYZA, E., JOZKOWICZ, A. & DULAK, J. 2016. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cellular and Molecular Life Sciences : CMLS, 73 , 3221-3247. MA, Z., LU, H., FENG, X., DU, T., LI, J., ZHANG, Q., GU, X., SHAO, Y., JING, X. & SU, C. 2024. Nrf2 protects against cartilage endplate degeneration through inhibiting NCOA4‑mediated ferritinophagy. International Journal of Molecular Medicine, 53. MAN, H., ZHOU, L., ZHU, G., ZHENG, Y., YE, Z., HUANG, Z., TENG, X., AI, C., GE, G. & XIAO, Y. 2022. Super-Resolution Imaging of Autophagy by a Preferred Pair of Self-Labeling Protein Tags and Fluorescent Ligands. Analytical Chemistry, 94 , 15057-15066. MASALDAN, S., CLATWORTHY, S. A. S., GAMELL, C., MEGGYESY, P. M., RIGOPOULOS, A.-T., HAUPT, S., HAUPT, Y., DENOYER, D., ADLARD, P. A., BUSH, A. I. & CATER, M. A. 2018. Iron accumulation in senescent cells is coupled with impaired ferritinophagy and inhibition of ferroptosis. Redox Biology, 14 , 100-115. MENG, Q.-T., CHEN, R., CHEN, C., SU, K., LI, W., TANG, L.-H., LIU, H.-M., XUE, R., SUN, Q., LENG, Y., HOU, J.-B., WU, Y. & XIA, Z.-Y. 2017. Transcription factors Nrf2 and NF-κB contribute to inflammation and apoptosis induced by intestinal ischemia-reperfusion in mice. International Journal of Molecular Medicine, 40 , 1731-1740. MURA, M., ANDRADE, C. F., HAN, B., SETH, R., ZHANG, Y., BAI, X.-H., WADDELL, T. K., HWANG, D., KESHAVJEE, S. & LIU, M. 2007. Intestinal ischemia-reperfusion-induced acute lung injury and oncotic cell death in multiple organs. Shock (Augusta, Ga.), 28 , 227-238. RUI, T., WANG, H., LI, Q., CHENG, Y., GAO, Y., FANG, X., MA, X., CHEN, G., GAO, C., GU, Z., SONG, S., ZHANG, J., WANG, C., WANG, Z., WANG, T., ZHANG, M., MIN, J., CHEN, X., TAO, L., WANG, F. & LUO, C. 2021. Deletion of ferritin H in neurons counteracts the protective effect of melatonin against traumatic brain injury-induced ferroptosis. Journal of Pineal Research, 70 , e12704. SHEN, Y., LIU, X., SHI, J. & WU, X. 2019. Involvement of Nrf2 in myocardial ischemia and reperfusion injury. International Journal of Biological Macromolecules, 125 , 496-502. SHI, H., XIONG, L., YAN, G., DU, S., LIU, J. & SHI, Y. 2023. Susceptibility of cervical cancer to dihydroartemisinin-induced ferritinophagy-dependent ferroptosis. Frontiers In Molecular Biosciences, 10 , 1156062. STALLION, A., KOU, T. D., LATIFI, S. Q., MILLER, K. A., DAHMS, B. B., DUDGEON, D. L. & LEVINE, A. D. 2005. Ischemia/reperfusion: a clinically relevant model of intestinal injury yielding systemic inflammation. Journal of Pediatric Surgery, 40 , 470-477. STOCKWELL, B. R., FRIEDMANN ANGELI, J. P., BAYIR, H., BUSH, A. I., CONRAD, M., DIXON, S. J., FULDA, S., GASCóN, S., HATZIOS, S. K., KAGAN, V. E., NOEL, K., JIANG, X., LINKERMANN, A., MURPHY, M. E., OVERHOLTZER, M., OYAGI, A., PAGNUSSAT, G. C., PARK, J., RAN, Q., ROSENFELD, C. S., SALNIKOW, K., TANG, D., TORTI, F. M., TORTI, S. V., TOYOKUNI, S., WOERPEL, K. A. & ZHANG, D. D. 2017. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell, 171 , 273-285. TOMA-FUKAI, S. & SHIMIZU, T. 2021. Structural Diversity of Ubiquitin E3 Ligase. Molecules (Basel, Switzerland), 26. WANG, F.-Y., YANG, L.-M., WANG, S.-S., LU, H., WANG, X.-S., LU, Y., NI, W.-X., LIANG, H. & HUANG, K.-B. 2024. Cycloplatinated (II) Complex Based on Isoquinoline Alkaloid Elicits Ferritinophagy-Dependent Ferroptosis in Triple-Negative Breast Cancer Cells. Journal of Medicinal Chemistry, 67 , 6738-6748. WANG, J., WU, N., PENG, M., OYANG, L., JIANG, X., PENG, Q., ZHOU, Y., HE, Z. & LIAO, Q. 2023a. Ferritinophagy: research advance and clinical significance in cancers. Cell Death Discovery, 9 , 463. WANG, T., XIONG, T., YANG, Y., CHEN, X., MA, Z., ZUO, B., NING, D., ZHOU, B., SONG, R., LIU, X. & WANG, D. 2023b. Estradiol-mediated small GTP-binding protein GDP dissociation stimulator induction contributes to sex differences in resilience to ferroptosis in takotsubo syndrome. Redox Biology, 68 , 102961. WU, K., YAN, M., LIU, T., WANG, Z., DUAN, Y., XIA, Y., JI, G., SHEN, Y., WANG, L., LI, L., ZHENG, P., DONG, B., WU, Q., XIAO, L., YANG, X., SHEN, H., WEN, T., ZHANG, J., YI, J., DENG, Y., QIAN, X., MA, L., FANG, J., ZHOU, Q., LU, Z. & XU, D. 2023. Creatine kinase B suppresses ferroptosis by phosphorylating GPX4 through a moonlighting function. Nature Cell Biology, 25 , 714-725. ZHAI, X., CHEN, X., SHI, J., SHI, D., YE, Z., LIU, W., LI, M., WANG, Q., KANG, Z., BI, H. & SUN, X. 2013. Lactulose ameliorates cerebral ischemia-reperfusion injury in rats by inducing hydrogen by activating Nrf2 expression. Free Radical Biology & Medicine, 65 , 731-741. ZHANG, F., LI, Z.-L., XU, X.-M., HU, Y., YAO, J.-H., XU, W., JING, H.-R., WANG, S., NING, S.-L. & TIAN, X.-F. 2015. Protective effects of icariin-mediated SIRT1/FOXO3 signaling pathway on intestinal ischemia/reperfusion-induced acute lung injury. Molecular Medicine Reports, 11 , 269-276. ZHANG, J., ZHENG, Y., WANG, Y., WANG, J., SANG, A., SONG, X. & LI, X. 2022. YAP1 alleviates sepsis-induced acute lung injury via inhibiting ferritinophagy-mediated ferroptosis. Frontiers In Immunology, 13 , 884362. ZHAO, H.-D., ZHANG, F., SHEN, G., LI, Y.-B., LI, Y.-H., JING, H.-R., MA, L.-F., YAO, J.-H. & TIAN, X.-F. 2010. Sulforaphane protects liver injury induced by intestinal ischemia reperfusion through Nrf2-ARE pathway. World Journal of Gastroenterology, 16 , 3002-3010. ZOU, J. H., YAN, J. Y., LU, Y. F., YU, Z., ZHANG, K., HAN, Q. Y., HAN, D., GAI, C., CHAI, X., ZHAO, Q., ZHUANG, C. & ZOU, Y. 2024. Cyclic Peptide Keap1-Nrf2 Protein-Protein Interaction Inhibitors: Design, Synthesis, and In Vivo Treatment of Acute Lung Injury. Journal of Medicinal Chemistry, 67 , 4889-4903. Abbreviations * Abbreviations : AECII, type II alveolar epithelial cells; ALI, acute lung injury; ARE, antioxidant response element; CCK-8, cell counting kit-8; CKO, conditional knockout; CO-IP, Co-immunoprecipitation; GSH, glutathione; HE, hematoxylin and eosin; II/R, intestinal ischemia-reperfusion; IR, ischemia reperfusion; MDA, malondialdehyde, NCOA4, nuclear receptor coactivator 4; Nrf2, nuclear factor E2-related factor 2; OGD/R, oxygen glucose deprivation/re-oxygenation; ROS, reactive oxygen species; TEM, transmission electron microscopy; UBE3B, ubiquitin ligase E3. Scheme 1 Scheme 1 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files floatimage1.png Graphical abstract Scheme 1. Nrf2 regulates iron homeostasis by enhancing the ubiquitin E3 ligase UBE3B-mediated ubiquitination and degradation of NCOA4, thus inhibiting ferritinophagy. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5229445","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":364828215,"identity":"8a40a2e5-f5eb-460e-a40d-51bc2803dee0","order_by":0,"name":"Yanjun Wang","email":"","orcid":"","institution":"Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Yanjun","middleName":"","lastName":"Wang","suffix":""},{"id":364828216,"identity":"19851721-8ecf-4118-9435-7a65c44a27c4","order_by":1,"name":"Hui Dong","email":"","orcid":"","institution":"Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Dong","suffix":""},{"id":364828218,"identity":"8bb67b43-b85a-44fa-95dc-0763e3989772","order_by":2,"name":"Yunfan Gu","email":"","orcid":"","institution":"Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Yunfan","middleName":"","lastName":"Gu","suffix":""},{"id":364828221,"identity":"5d6ffa7d-d136-4f03-b851-f4449f2751dc","order_by":3,"name":"Han Chen","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Chen","suffix":""},{"id":364828224,"identity":"119e97e0-adfb-4b16-9730-1d43c679773d","order_by":4,"name":"Beibei Hu","email":"","orcid":"","institution":"Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Beibei","middleName":"","lastName":"Hu","suffix":""},{"id":364828226,"identity":"08dd8e6e-056f-4113-b78a-f127409df6c8","order_by":5,"name":"Xiangdong Xue","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Xiangdong","middleName":"","lastName":"Xue","suffix":""},{"id":364828228,"identity":"97a86328-c1d0-4b9a-8470-aebb8234f8b3","order_by":6,"name":"Rong Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABF0lEQVRIie3QMUvDQBTA8RcO0uVJ1pNK8xVShIgg9KvkiFymzDpouamT4HrSwa+QSRwcLgTSJR8gQ4Zk6dxuDgE9IzpIajKK3B+S4ciPdy8AJtMfzNOPYu3FDCjJPw4QgIghYqlG8FOgNu8IgjVISNqIjAmKPnyOGSBnNK4VeybR4/rOr3dtdbKYpAL2L7fgrPvpuYw8xQo7Tqr8av6w2iIiE5bcboBWqv9iJQcV2BgnNHyaHolM78IEQZWDR4PfCI1cGfhTbDVxmhGErbwAyktNbE1oN+XmMCm2ekoRzJOS8+Nul7IRqVQKaXmAbDjZv16/ua4Mc6r/2GJyH6b1Ti1njuwnP1Nf7wxHff9NdMuxwmQymf5/7wvDaJS6cESIAAAAAElFTkSuQmCC","orcid":"","institution":"Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":true,"prefix":"","firstName":"Rong","middleName":"","lastName":"Hu","suffix":""},{"id":364828229,"identity":"38ab5b1c-5605-46a8-903a-b8984d79e698","order_by":7,"name":"Hong Jiang","email":"","orcid":"","institution":"Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, Jiao Tong University China Hospital Development Institute","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Jiang","suffix":""}],"badges":[],"createdAt":"2024-10-09 05:38:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5229445/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5229445/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":66606487,"identity":"ccb3068e-e542-4555-8c5d-64dd85703ed0","added_by":"auto","created_at":"2024-10-14 18:30:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":638134,"visible":true,"origin":"","legend":"\u003cp\u003eIntestinal ischemia and reperfusion (II/R) induce ferroptosis and ferritinophagy in mouse lung tissue. (a) Prussian blue staining of mouse lung tissue, scale bar: 200 μm. (b) Fe\u003csup\u003e2+\u003c/sup\u003e contents in mouse lung tissue. (c) Malondialdehyde (MDA) concentrations in mouse lung tissue. (d) Glutathione (GSH) concentrations in mouse lung tissue. (e) Transmission electron microscopy observation of lung tissue mitochondria, scale bar: 1 μm. (f) Lung injury score. (g) Hematoxylin and eosin (HE) staining of mouse lung tissue, scale bar: 200 μm. (h) Co-localization of FTH1 (red) and LC3 (green) in mouse lung tissue, scale bar: 50 μm. (i) RNA levels of NCOA4, UBE3B, FTH1, and LC3. (j) Protein content of Nrf2, UBE3B, NCOA4, FTH1, and LC3. (k) Quantification of protein content of Nrf2, UBE3B, NCOA4, FTH1, and LC3 using ImageJ. The results are shown as mean ± SD. (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/55afbfd438b7cf7c58beffaa.png"},{"id":66605945,"identity":"7984e95b-f7ad-4901-ba0a-952b14dfd311","added_by":"auto","created_at":"2024-10-14 18:22:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":839077,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eNrf2\u003c/em\u003e knockout enhances the progression of ferroptosis and ferritinophagy and aggravates IIR-induced acute lung injury (II/R-ALI). (a) Prussian blue staining of mouse lung tissue, scale bar: 200 μm. (b) Fe\u003csup\u003e2+\u003c/sup\u003e concentrations in mouse lung tissue. (c) GSH concentrations in the lung tissue of mice. (d) MDA concentrations in the lung tissue of mice. (e) Lung injury score. (f) Staining of mouse lung tissue with HE, scale bar: 200 μm. (g) Transmission electron microscopy observation of lung tissue mitochondria, scale bar: 1 μm. (h) Protein concentrations of Nrf2, UBE3B, NCOA4, FTH1, and LC3. (i) Quantification of protein concentrations of Nrf2, UBE3B, NCOA4, FTH1, and LC3 using ImageJ. Data are presented as mean ± SD (* \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/6328f2e5eb501bd109f6e305.png"},{"id":66605940,"identity":"f081260f-6639-44d7-818e-32a6cfb4334f","added_by":"auto","created_at":"2024-10-14 18:22:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":428681,"visible":true,"origin":"","legend":"\u003cp\u003eNrf2 deficiency reduces UBE3B expression and accelerates ferritinophagy, while overexpression of UBE3B alleviates cell damage via modulation of NCOA4 in type II alveolar epithelial cells (AECII). (a) Content of Fe\u003csup\u003e2+\u003c/sup\u003e in cells. (b) Concentrations of MDA in cells. (c) Concentrations of GSH in cells. (d) Cell counting kit-8 (CCK-8) assay was used to determine cell viability. (e) Protein content of Nrf2, UBE3B, NCOA4, FTH1, and LC3. (f) Quantification of protein content of Nrf2, UBE3B, NCOA4, FTH1, and LC3 using ImageJ. (g) Protein content of Nrf2, UBE3B, NCOA4, FTH1, and LC3 in UBE3B-overexpressing cells. (h) Quantitative analysis of protein content in (g) using ImageJ. (i) Fe\u003csup\u003e2+\u003c/sup\u003e content in UBE3B-overexpressing cells. (j) MDA content in UBE3B-overexpressing cells. (k) GSH content in UBE3B-overexpressing cells. (l) Cell survival rate in UBE3B-overexpressing cells determined by the CCK-8 assay. Data are presented as mean ± SD (* \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/c5e4d273a160992069942f95.png"},{"id":66606486,"identity":"92e3608f-1a76-4e04-bd8f-b3f77911541c","added_by":"auto","created_at":"2024-10-14 18:30:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":296618,"visible":true,"origin":"","legend":"\u003cp\u003eUBE3B deficiency promotes NCOA4-mediated ferritinophagy and aggravates cell injury. (a) Protein content of Nrf2, UBE3B, NCOA4, FTH1, and LC3 was reduced in cells with \u003cem\u003eUBE3B\u003c/em\u003e knockout. (b) Quantitative analysis of protein content was performed using ImageJ. (c) Cell viability in \u003cem\u003eUBE3B\u003c/em\u003e knockout cells was evaluated via the CCK-8 assay. (d) MDA content in UBE3B knockout cells isolated from mice lung tissue. (e) GSH content in UBE3B knockout cells derived from mice lung tissue. (f) Fe\u003csup\u003e2+\u003c/sup\u003e content in \u003cem\u003eUBE3B\u003c/em\u003e knockout cells isolated from mouse lung tissue. Data are reported as mean ± SD (* \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/9345c5cc6ee4aaf6f68c217b.png"},{"id":66605942,"identity":"7f0abdd5-6c0b-4454-87be-6a69c9d52458","added_by":"auto","created_at":"2024-10-14 18:22:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":267757,"visible":true,"origin":"","legend":"\u003cp\u003eUBE3B binds to NCOA4 and induces ubiquitination degradation, thereby regulating ferritinophagy. (a) Co-immunoprecipitation (CO-IP)of NCOA4 was performed in AECⅡ cells, with untreated samples used as lysate input for the control IgG immunoprecipitation. The interaction between NCOA4 and UBE3B was evaluated using immunoblotting. (b) Co-localization of UBE3B (red) and NCOA4 (green) in cells, scale bar: 20 μm. (c) Schematic of UBE3B functional domains. To investigate the binding of NCOA4 to UBE3B, four fragments (F1-4) spanning the UBE3B protein were subcloned and expressed in 293T cells. (d) Express HA-tagged fragments F1–4 of UBE3B in 293T cells, followed by HA immunoprecipitation (HA-IP), and immunoblotting with the indicated antibodies. (e) Upon depletion of UBE3B, the half-life of NCOA4 was extended. Immunoblotting of NCOA4 protein content in cells following control or UBE3B knockdown and cycloheximide (CHX) treatment as indicated.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/6ad8282478b796647b1fc874.png"},{"id":72864173,"identity":"1ea450c8-95a7-4a11-82cd-2143adc2da6d","added_by":"auto","created_at":"2025-01-03 04:46:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3220009,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/657a80b4-8dad-4132-92ad-fc755cbc0032.pdf"},{"id":66606484,"identity":"9283b768-f375-47c0-96d9-8610a1169fc3","added_by":"auto","created_at":"2024-10-14 18:30:31","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":172570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScheme 1. \u003c/strong\u003eNrf2 regulates iron homeostasis by enhancing the ubiquitin E3 ligase UBE3B-mediated ubiquitination and degradation of NCOA4, thus inhibiting ferritinophagy.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5229445/v1/312d1a8ad51ccc0befc62e25.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Nrf2/UBE3B protects against acute lung injury by inhibiting ferritinophagy through the ubiquitination of NCOA4","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIschemia-reperfusion (IR\u003ca class=\"FNLink\" href=\"#Fn1\" id=\"#FNLinkFn1\"\u003e\u003c/a\u003e\u003csup\u003e*)\u0026nbsp;\u003c/sup\u003eFerritinophagy, the selective autophagy of ferritin mediated by nuclear receptor coactivator 4 (NCOA4), involves NCOA4 recognizing ferritin and delivering it to the autophagosome. Within autophagosomes, ferritin is degraded, releasing iron into lysosomes (Feng et al., 2024). Notably, excessive iron levels can trigger cell death (Dong et al., 2021). Previous studies revealed that inhibiting ferroptosis in a ferritinophagy-mediated manner could alleviate sepsis-induced ALI (Zhang et al., 2022, Dong et al., 2023). Therefore, the pursuit of targeted ferroptosis has emerged as a potential therapeutic strategy for these diseases. However, the regulatory mechanisms underlying iron metabolism in AECⅡ cells under pathological conditions require further investigation. Nuclear factor E2-related factor 2 (Nrf2) is a key regulator of oxidative homeostasis, activated in response to increased oxidative stress. Nrf2 binds to the antioxidant response element (ARE) in the nucleus, promoting the transcription and translation of antioxidant and anti-inflammatory proteins, thereby providing cellular protection (Loboda et al., 2016, Ga\u0026ntilde;\u0026aacute;n-G\u0026oacute;mez et al., 2013, Fan et al., 2017). These proteins regulate vital cellular defense mechanisms and offer protection against damage to the brain (Zhai et al., 2013), liver (Kudoh et al., 2014), and heart (Shen et al., 2019), as well as against II/R (Zhao et al., 2010, Dong et al., 2020).\u003c/p\u003e\n\u003cp\u003eUBE3B is a calmodulin-regulated, mitochondria-associated E3 ubiquitin ligase (Braganza et al., 2017). Knockdown of Ube3b in mice results in reduced viability, recapitulation of key aspects of human disorders, such as reduced weight and brain size, and downregulation of cholesterol synthesis. Previous research has shown that the probable Caenorhabditis elegans ortholog of UBE3B, oxi-1, functions in the ubiquitin/proteasome system \u003cem\u003ein vivo\u003c/em\u003e and plays a key role in oxidative stress-related diseases (Basel-Vanagaite et al., 2012). This highlights the diverse effects of UBE3B deficiency and underscores the physiological importance of ubiquitination in neuronal development and function in mammals. However, it is unknown whether its antioxidant effect interacts with Nrf2 and whether it has a critical role in ferroptosis.\u003c/p\u003e\n\u003cp\u003eThe aim of this study was to investigate whether Nrf2 silencing during ischemia induces ferritinophagy via UBE3B and NCOA4 modulation. In this study, we examined ferroptosis and ferritinophagy in an \u003cem\u003ein vitro\u003c/em\u003e II/R-ALI model. Moreover, we evaluated whether UBE3B restrained ferritinophagy, normally observed in II/R-ALI, by regulating NCOA4. Our study revealed potential therapeutic targets for managing II/R-ALI.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials\u003c/h2\u003e \u003cp\u003eDulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM), fetal bovine serum (FBS), penicillin, and streptomycin sulfate were sourced from Gibco Life Technologies Co. (Grand Island, NY). The Cell Counting Kit-8 (CCK-8) and ROS Assay Kit - Photo-oxidation Resistant DCFH-DA were obtained from Dojindo Laboratories (Kumamoto, Japan). Glutathione (GSH) Content Assay Kit was obtained from Cayman Chemical Company (United States). Phosphate-buffered saline (PBS) Buffer Premixed Powder (1X) and 10X Tris-Glycine SDS-PAGE Running Buffer were supplied by Sangon Biotech (Shanghai) Co., Ltd (Kudoh et al.). LipoFiter Transfection Reagent Kit were sourced from Hanbio Technology (Shanghai) Co., Ltd. (Shanghai, China). Hoechst, Malondialdehyde (MDA) Content Assay Kit, and 4\u0026rsquo;,6-Diamidino-2-phenylindole (DAPI) were sourced from Beyotime Institute of Biotechnology (Shanghai, China). HRP Goat Anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (AS014), Anti-Nrf2 rabbit (A21508), Anti-NCOA4 rabbit (A5695), Anti-β-actin rabbit mAb (High Dilution) (AC026), HA-Tag rabbit mAb (AE105), DDDDK-Tag rabbit mAb (AE092), Anti-Ferritin Heavy Chain rabbit mAb (A19544), and Anti-LC3B rabbit mAb (A19665) were procured from ABclonal Technology Co. (Shanghai, China). The plasmid was acquired from Genomeditech Co., Ltd. (Kudoh et al.). Prussian Blue Iron Stain Kit was sourced from Beijing Solarbio Science \u0026amp; Technology Co., Ltd (Kudoh et al.). The PrimeScript\u0026trade; RT-PCR Kit was obtained from Takara Biomedical Technology (Beijing) Co., Ltd. The 2x SYBR Green qPCR Master Mix (Low ROX) was obtained from Selleck.cn (Kudoh et al.).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Isolation of primary alveolar epithelial cells type Ⅱ\u003c/h2\u003e \u003cp\u003ePregnant C57BL/6J mice at embryonic day 19 (E19) were used for the extraction of primary cells. Under sterile conditions, the uterus was dissected to retrieve the fetal mice. Placing the fetal mice in a laminar flow hood, a horizontal incision was made across the chest of each fetal mouse. The lungs were removed and placed in pre-cooled PBS solution. Care was taken to remove non-lung tissues, such as residual tracheal and connective tissues, as much as possible. The lung tissues were washed three times with PBS, cut into approximately 1 mm3 tissue fragments using ophthalmic scissors, washed once with trypsin solution, and then digested at 37\u0026deg;C for a duration of 20 minutes. To halt the digestion, mix the trypsin with an equal volume of medium with FBS. The mixture was subsequently passed through a 200-mesh sieve. and centrifuged at 1500 revolutions per minute for 5 minutes at low temperature. The liquid above the sediment was removed, and the pellet was retained. The pellet was incubated with 0.1% collagenase I at 37\u0026deg;C for 20 minutes. After digestion, an equal amount of DMEM containing 10% FBS was introduced, with centrifugation for 5 minutes at 1000 rpm. The cell was collected and plated into a culture bottle, which was incubated at 37\u0026deg;C with 5% CO2 for 45 minutes. The liquid above the sediment was then aspirated and transferred to another culture bottle. This same step was repeated for 3 times. Finally, the liquid above the sediment was aspirated, and then centrifuged the cells at 800 rpm for a duration of 5 minutes. After discarding the supernatant, the cell was suspended in a culture medium. and seeded into a culture bottle. After incubating for 24 hours, the medium was exchanged to remove unattached cells, and the culture was continued. The growth and morphology of the cells were examined under an inverted microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Cell culture\u003c/h2\u003e \u003cp\u003eThe MLE12 cells, obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), were maintained in a conventional cell culture incubator at 37\u0026deg;C with 5% CO2 and maintained humidity. The cells were maintained in DMEM with 10% FBS and 1% penicillin-streptomycin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Oxygen-glucose deprivation and reoxygenation (OGD/R) model\u003c/h2\u003e \u003cp\u003eFor the OGD/R model induction, cells underwent an initial phase of 8 hours of glucose deprivation, followed by 12 hours of reoxygenation. During the deprivation phase, cells were cultured in a glucose-free medium inside an anaerobic chamber with an atmosphere of 95% N2 and 5% CO2 for 8 hours. Following this, the cells were transitioned to a high-glucose medium and grown in a conventional cell culture incubator for an additional 12 hours to reoxygenate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Cell viability assessment\u003c/h2\u003e \u003cp\u003eWithin a 96-well plate, MLE12 cells were cultured at 1 \u0026times; 104 cells/well. Once the cells had fully adhered, they were subjected to various treatments. Subsequently, the cells underwent 8 hours of oxygen-glucose deprivation (OGD) followed by 12 hours of reoxygenation to establish the OGD/R model. Upon completion of the model establishment, each well received 10 \u0026micro;L of CCK-8 solution and 90 \u0026micro;L of medium. Following this, the cells were kept for 4 hours in the dark before their optical density (OD) at 450 nm was mrasured by a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Animals\u003c/h2\u003e \u003cp\u003eTwenty-four C57BL/6J mice (6\u0026ndash;8 weeks) were acquired from the Animal Center of Shanghai Jiao Tong University School of Medical Sciences. They were kept under regulated environmental conditions, and a 12-hour light/dark cycle, with a temperature of 21\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C. All experimental procedures were performed following the guidelines stipulated by the National Institutes of Health (NIH) and took permission from the Animal Research Ethics Committee at Shanghai Jiao Tong University (ethical approval number A2023114).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Intestinal ischemia/reperfusion (II/R) mouse model\u003c/h2\u003e \u003cp\u003ePrior to the experiment, animals underwent a 24-hour fasting period with access to water. The mice were anesthetized intraperitoneally with sodium pentobarbital at a dosage of 50 mg/kg and underwent a midline incision. To induce intestinal ischemia, The superior mesenteric artery was temporarily occluded using non-invasive vascular clips for a duration of 45 minutes followed by a 180-minute reperfusion period. Sham control mice underwent identical procedures without vascular occlusion. After 3 hours of reperfusion, the animals were euthanize, and tissue samples were promptly frozen at -80\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.8. Malondialdehyde (MDA) assay\u003c/b\u003e(Rui et al., 2021)\u003c/h2\u003e \u003cp\u003eHomogenize or lyse the tissues or cells using PBS or lysis buffer. For tissues, the weight of the tissue should constitute 10% of the volume of the homogenization or lysis buffer; for cells, use 0.1 ml of lysis or homogenization buffer per one million cells. After homogenization or lysis, centrifuge at 10,000g to 12,000g for 10 minutes at 4\u0026ordm;C and collect the supernatant. Dilute the appropriate amount of the standard with distilled water to concentrations of 1, 2, 5, 10, 20, and 50\u0026micro;M. In a centrifuge tube or another suitable container, add 0.1 ml of the homogenization buffer, lysis buffer, or PBS as a blank control, 0.1 ml of the standards above different concentrations to create the standard curve, and 0.1 ml of the sample for measurement. Then, add 0.2 ml of the MDA detection working solution. Mix well and heat at 100\u0026ordm;C or in a boiling water bath for 15 minutes. Cool the samples to room temperature in a water bath, then centrifuge at 1000g for 10 minutes. Transfer 200 \u0026micro;l of the supernatant to a 96-well plate, and measure the absorbance at 532 nm using a microplate reader. Calculate the MDA content in the sample solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.9. GSH assay\u003c/b\u003e(Wu et al., 2023)\u003c/h2\u003e \u003cp\u003eThe GSH levels were measured using a GSH assay kit (Cayman Chemical, Catalog No. 703002, Ann Arbor, MI, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Iron ion assay\u003c/h2\u003e \u003cp\u003eWeigh 0.1 g of fresh tissue and mix 0.9 mL of homogenization reagent. Centrifuge the mixture at 10,000 \u0026times; g for a duration of 10 minutes, and collect the resulting supernatant. Dilute the sample to a concentration within the linear range of the kit (0.4\u0026ndash;50 \u0026micro;mol/L). Prepare standard tubes by transferring 300 \u0026micro;L of different concentrations of the standard solution into corresponding 1.5 mL EP tubes. Similarly, prepare test tubes by transferring 300 \u0026micro;L of the sample into corresponding 1.5 mL tubes. Mix 150 \u0026micro;L of reagent two to each tube, mix thoroughly, and place the mixture in an incubator set at 37\u0026deg;C for a duration of 10 minutes. Centrifuge all tubes at 12,000 \u0026times; g for 10 minutes. Transfer 300 \u0026micro;L of the supernatant from each tube into the respective wells of a 96-well plate. Their OD were measured at 593 nm in each well by a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Perls staining\u003c/h2\u003e \u003cp\u003eAfter preheating the paraffin sections, deparaffinize twice in xylene for 5 minutes each time. Gradually rehydrate with ethanol, 3 minutes per grade, and rinse with distilled water for 3 minutes.\u003c/p\u003e \u003cp\u003eThaw the frozen sections, allow them to equilibrate at 4\u0026deg;C for 10 minutes, and then rinse them with distilled water for 3 minutes. For cell smears, fix with pre-cooled low-grade alcohol for 3 minutes or 4% tissue cell fixative for 20 minutes, followed by two washes with 70% ethanol for 1 minute each, and two rinses with distilled water for 2 minutes each. Prepare Perls staining working solution before use, add it to cover the sections, stain for a duration of 30 minutes, and rinse with distilled water for 10 minutes. For nuclear fast red staining, stain for 5\u0026ndash;10 minutes, rinse quickly with tap water for 2\u0026ndash;3 seconds. Dip in 75%, 85%, 95% ethanol for 3\u0026ndash;5 seconds each, and twice in 100% ethanol, each time for 1 minute. Clear with xylene or environmentally friendly tissue deparaffinization solution twice, each time for 1\u0026ndash;2 minutes. Seal with neutral gum.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Lung injury score\u003c/h2\u003e \u003cp\u003eThe mice lung tissues underwent fixation in 10% formalin, and embedding in paraffin and sectioning into 5 \u0026micro;m slices. Thereafter, the slices were stained with hematoxylin and eosin (HE) and examined using a Nikon-Ni-U light microscope equipped with an Optronics DEI-470 digital camera. To evaluate acute lung injury (ALI), a five-point scoring system (0\u0026ndash;4) was utilized based on several parameters: The scoring criteria included assessment of alveolar and interstitial edema, intra-alveolar inflammatory cell infiltration, alveolar hemorrhage, and atelectasis, which were graded as follows:\u003c/p\u003e \u003cp\u003eGrade 0: Normal morphology, with \u0026lt;\u0026thinsp;15% tissue occupancy and \u0026gt;\u0026thinsp;85% alveolar space occupancy.\u003c/p\u003e \u003cp\u003eGrade 1: Mild injury, with 15\u0026ndash;25% tissue occupancy and 75\u0026ndash;85% alveolar space occupancy.\u003c/p\u003e \u003cp\u003eGrade 2: Moderate injury, with 25\u0026ndash;50% tissue occupancy and 50\u0026ndash;75% alveolar space occupancy.\u003c/p\u003e \u003cp\u003eGrade 3: Severe injury, with 50\u0026ndash;75% tissue occupancy and 25\u0026ndash;50% alveolar space occupancy.\u003c/p\u003e \u003cp\u003eGrade 4: Very severe injury, with 75\u0026ndash;100% tissue occupancy and 0\u0026ndash;25% alveolar space occupancy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Co-immunoprecipitation (CO-IP) assay\u003c/h2\u003e \u003cp\u003eTissue sample preparation: Rinse the tissue with PBS, add pre-chilled RIPA buffer (mild RIPA, 1000 \u0026micro;L/100 mg tissue, supplemented with 10 \u0026micro;L protease inhibitor/1000 \u0026micro;L RIPA), and keep on ice for 10 minutes. Take two sterilized steel beads and grind the tissue. Centrifuge at 4\u0026deg;C, 12000 rpm for a duration of 15 minutes, and retrieve the liquid. Determine protein concentration using the BCA method. For total protein, take 500 ul and add 10 \u0026micro;L of Nrf2 antibody; take 300 \u0026micro;L and add IgG antibody. Incubate overnight at 4\u0026deg;C with slow inverting. The remaining protein is combined with loading buffer and heated to 100\u0026deg;C, boiling for 15 minutes. Pre-wash Protein A beads: Resuspend Protein A\u0026thinsp;+\u0026thinsp;G magnetic beads by gently pipetting, transfer an appropriate amount into a clean centrifuge tube and adjust to a final volume of approximately 0.5 ml with 1X TBST. Gently resuspend Protein A\u0026thinsp;+\u0026thinsp;G magnetic beads by pipetting. Put the tube on a magnetic rack for 10 seconds to allow the beads to adhere to the magnet, then gently discard the supernatant. Perform this washing step two additional times. Next, perform magnetic separation using the Protein A\u0026thinsp;+\u0026thinsp;G magnetic beads: discard the supernatant, add the sample, resuspend the beads, and allow the mixture to incubate for 30 minutes on a rocking mixer. Add 500 \u0026micro;L of 1X TBST, gently resuspend Protein A\u0026thinsp;+\u0026thinsp;G magnetic beads by pipetting, place on a magnetic stand for 10 seconds, discard the liquid above, and repeat washing three times. For every 10\u0026ndash;20 \u0026micro;L of the original magnetic bead volume, mix 10 \u0026micro;L 2X SDS-PAGE loading buffer. Heat the mixture at 100\u0026deg;C for 5 minutes, then place it on a magnetic stand for 10 seconds to separate the beads and collect the supernatant. Analyze by Western Blotting to confirm the binding proteins.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14. Western blot\u003c/h2\u003e \u003cp\u003eProteins were blended with SDS-PAGE loading buffer and heated at 95\u0026deg;C for about 15 minutes. The proteins underwent electrophoresis on a 10% SDS-PAGE gel and transferred onto a polyvinylidene fluoride (PVDF) membrane. In succession, the membrane was immersed in TBST solution with 10% skimmed milk for 1.5 hours, subsequent to 3 washes with TBST. Primary antibodies against Nrf2 (Rabbit, 1:500), NCOA4 (Rabbit, 1:1000), UBE3B (Rabbit, 1:1000), FTH1 (Rabbit, 1:1000), LC3 (Rabbit, 1:1000), and β-actin (Rabbit, 1:100000) were then incubated with the membrane overnight at 4\u0026deg;C. On the subsequent day, the protein bands were rinsed 3 times with TBST before being exposed to secondary antibodies (HRP-goat anti-rabbit, 1:5000) for 1 hour. Hereinafter 3 washes with TBST, bands were detected with an enhanced ECL chemiluminescent substrate kit and quantified by the Bio-Rad multicolor fluorescence and chemiluminescence imager.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.15. Immunofluorescence assay\u003c/h2\u003e \u003cp\u003eCryosections of the lungs were prepared and treated with 0.3% Triton-100 for 15 minutes to permeabilize them, followed by a 2-hour incubation with 3% BSA. And the sections were exposed separately to primary antibodies targeting NCOA4, UBE3B, FTH1, and LC3, and incubated overnight at 4\u0026deg;C. With overnight exposure, the sections were rinsed with five washes of PBS. To visualize the target proteins, the sections underwent incubation with fluorescently labeled secondary antibodies for 1 hour. Subsequently, three washes with PBS were performed. Finally, the sections were counterstained with DAPI to observe cell nuclei and captured by a confocal laser scanning microscope (Carl Zeiss LSM710, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.16. Plasmid transfection\u003c/h2\u003e \u003cp\u003eTo initiate plasmid transfection, cells were seeded in a 6-well plate the previous day at about 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well. The cells grew until they reached about 70% confluence the following day. Before the transfection procedure described below, the culture medium was changed to 2 mL of fresh culture medium containing serum. In a sterile and clean centrifuge tube, 125 \u0026micro;L of serum-free DMEM culture medium (devoid of antibiotics) was added for each well slated for transfection. Subsequently, 2 \u0026micro;g of plasmid DNA was introduced into each tube, and gentle pipetting facilitated thorough mixing. Following this, 4 \u0026micro;L of LipoFiter transfection reagent was added, and the mixture was gently swirled to ensure homogeneity. Whether dealing with adherent or suspended cells, the 125 \u0026micro;L Lipo8000\u0026trade; transfection reagent-DNA concoction was evenly dispensed into each well of the six-well plate, with careful swirling to guarantee uniform distribution. The cells were then allowed to incubate for approximately 72 hours before sample collection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e2.17. Quantitative real-time PCR assay\u003c/h2\u003e \u003cp\u003eCells or tissues were treated with TRIzol to extract RNA. The isolated RNA was subsequently converted in reverse to generate cDNA by using the PrimeScript\u0026trade; RT-PCR Kit. Subsequent qPCR was conducted with 2x SYBR Green qPCR Master Mix. The primer sequences for each target are as follows:\u003c/p\u003e \u003cp\u003eMouse_actin, beta (β-actin)\u003c/p\u003e \u003cp\u003eForward primer: GCTCACCATTCACCATCTTGTCTTG\u003c/p\u003e \u003cp\u003eReverse primer: TCCTGCTTGCTGATCCACATCTG\u003c/p\u003e \u003cp\u003eMouse_Nrf2\u003c/p\u003e \u003cp\u003eForward primer: TTGCCACCGCCAGGACTACA\u003c/p\u003e \u003cp\u003eReverse primer: AACTTGTACCGCCTCGTCTGGA\u003c/p\u003e \u003cp\u003eMouse_nuclear receptor coactivator 4 (Ncoa4)\u003c/p\u003e \u003cp\u003eForward Primer: GCCAGAGCAGAAGTCAGCATCC\u003c/p\u003e \u003cp\u003eReverse Primer: GCCAGTCCTGTGGGTTGGTACT\u003c/p\u003e \u003cp\u003eMouse_ferritin heavy polypeptide 1 (FTH1)\u003c/p\u003e \u003cp\u003eForward primer: CCATCAACCGCCAGATCAACCT\u003c/p\u003e \u003cp\u003eReverse primer: GCAAAGTTCTTCAGAGCCACATCAT\u003c/p\u003e \u003cp\u003eMouse_microtubule-associated protein 1 light chain 3 beta\u003c/p\u003e \u003cp\u003eForward primer: CAAGCCTTCTTCCTCCTGGTGA\u003c/p\u003e \u003cp\u003eReverse primer: TTGCTGTCCCGAATGTCTCCTG\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e2.18. Transmission electron microscopy (TEM)\u003c/h2\u003e \u003cp\u003eThe mice lung tissues were preserved in 0.05 M sodium cacodylate buffer with 2.5% glutaraldehyde at pH 7.2 at 25\u0026deg;C for a duration of 2 hours. Following this, they were dealt with 2% OsO4 in 0.1 M sodium cacodylate buffer for an additional 2 hours, followed by immersion in 1% aqueous uranyl acetate for a period of 18 hours. With the dehydration in ethanol, the samples were preserved in resin, sectioned using copper grids, and stained with lead citrate and uranyl acetate. Visualization was carried out by a transmission electron microscope (FEI Company, Oregon).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e2.19. Statistical Analysis\u003c/h2\u003e \u003cp\u003eThe mean values with their standard deviations (SD) are presented. Statistical analyses were carried out by using Prism software (version 9.0.0), employing one-way analysis of variance (ANOVA) for between-group comparisons. Statistical significance was shown as follows: * p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, **** p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.1. II/R causes ferroptosis and ferritinophagy in mouse lung tissue\u003c/h2\u003e \u003cp\u003eIron plays a key role in ferroptosis initiation and can promote the generation of reactive oxygen species (ROS) through the Fenton reaction. Thus, we determined iron levels in the lung tissues of an II/R-ALI model to evaluate the role of ferroptosis. Iron levels in II/R mice were significantly higher than those in sham mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea\u0026ndash;b). We then assessed ferroptotic markers. Lipid peroxidation represents a critical characteristic of ferroptosis, culminating in the production of malondialdehyde (MDA) as its final product. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, MDA levels increased significantly, whereas glutathione (GSH) levels decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed), both of which are characteristic of ferroptosis. Furthermore, using TEM, we demonstrated that AECⅡ from II/R mice exhibited characteristics more typical of ferroptosis than those of sham mice, including decreased mitochondrial size and reduced cristae size (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). Utilizing hematoxylin and eosin (HE) staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef\u0026ndash;g), we further demonstrated that II/R resulted in significant damage to lung tissue (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). NCOA4 mediated ferritinophagy has been demonstrated to play a critical role in regulating the intracellular Fe\u003csup\u003e2+\u003c/sup\u003e balance, and emerging evidence has shown that NCOA4 can regulate ferroptosis (Wang et al., 2024, Jiang et al., 2024a, Wang et al., 2023b, Shi et al., 2023). The present study investigated whether NCOA4 is involved in II/R and whether ferroptosis induced by II/R is regulated by ferritinophagy. FTH1 and LC3 showed increased co-localization after II/R (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh). The mRNA levels of NCOA4 and LC3II were observed to be higher in the II/R group than in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ei). Western blotting showed that NCOA4 and LC3Ⅱ protein levels were significantly elevated, whereas levels of FTH1 (a critical protein of ferritinophagy) were markedly diminished in the II/R model compared with those in the sham mice. Notably, we found that the Nrf2 and UBE3B expression levels were increased significantly following II/R (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ej\u0026ndash;k). Collectively, these data indicated that II/R-ALI mice demonstrated enhanced ferroptosis and ferritinophagy. Nevertheless, the relationship between the two and the role of Nrf2-related pathways in this process requires further exploration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Nrf2 knockout accelerates ferroptosis and ferritinophagy and aggravates II/R-ALI\u003c/h2\u003e \u003cp\u003eTo investigate the role of Nrf2 in regulating ferritinophagy in the context of II/R-ALI, we studied Nrf2 conditional knockout (CKO) mice. Nrf2 plays a crucial role in modulating antioxidant stress and ferroptosis. Ferritinophagy increases the cytosolic catalytic Fe(Ⅱ) levels, resulting in ferroptosis (Jiang et al., 2024b). We observed iron deposition using Perls\u0026rsquo; staining. Compared to sham mice, the lung tissue of Nrf2 CKO mice showed more severe iron deposition (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The lung tissues of Nrf2 CKO mice exhibited higher iron content (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Meanwhile, our results revealed pronounced suppression of GSH in the II/R model, which was particularly notable in Nrf2 CKO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec) and found elevated MDA levels in the II/R model, which was particularly pronounced in Nrf2 CKO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). The pathology of II/R-ALI was more severe in Nrf2 CKO II/R mice than in WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee\u0026ndash;f), indicating that Nrf2 provides protection against ALI, consistent with other studies (Zou et al., 2024). Likewise, our TEM observations demonstrated that the mitochondria were smaller in size, the cristae were either reduced or absent, and the outer membrane was torn in Nrf2 CKO II/R mice compared to that in WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg). This suggests accelerated iron accumulation and ferroptosis in the absence of Nrf2.\u003c/p\u003e \u003cp\u003eTo elucidate the Nrf2 regulation of ferritinophagy-associated proteins, we assessed their expression in Nrf2 CKO mice. Thus, Nrf2 levels were significantly elevated in the II/R model compared to those in the sham mice. NCOA4 and LC3Ⅱ protein levels were further increased in Nrf2 CKO mice, whereas FTH1 levels were reduced in the II/R model and further lower in Nrf2 CKO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh\u0026ndash;i). Additionally, UBE3B levels, which were high in the II/R model, were significantly reduced in Nrf2 CKO mice, indicating that they may be regulated by Nrf2. Taken together, these results indicate that Nrf2 CKO mice lose their ability to modulate ferritinophagy following II/R. Based on these data, we can deduce that Nrf2 negatively regulates cellular ferritinophagy and ferroptosis in II/R-ALI cells. However, the specific regulatory mechanisms require further investigation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3. Nrf2 deficiency reduces UBE3B expression and accelerates ferritinophagy, while overexpression of UBE3B alleviates cell damage via modulation of NCOA4 in AECII\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe used AECII cells to further investigate the signaling pathways involved in the Nrf2 regulation of ferritinophagy. These cells were derived from the lung tissue of Nrf2 KO mice. We demonstrated that Fe accumulated in AECII cells after oxygen glucose deprivation/re-oxygenation (OGD/R) induction, but not in non-induced AECII cells. Moreover, its levels significantly increased in the Nrf2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Next, we evaluated the levels of oxidative stress markers, such as CCK8, GSH, and MDA. Cell viability and GSH percentage were further reduced, whereas the percentage of MDA levels increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea\u0026ndash;d). In line with our \u003cem\u003ein vivo\u003c/em\u003e studies, Nrf2/UBE3B expression was markedly increased following OGD/R induction in AECII cells, while NCOA4 and LC3II protein levels were further increased in the sh\u003cem\u003eNrf2\u003c/em\u003e group. Additionally, FTH1 levels were low in the OGD/R group and even lower in the sh\u003cem\u003eNrf2\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee\u0026ndash;f).\u003c/p\u003e \u003cp\u003eHowever, UBE3B overexpression reversed the changes caused by Nrf2 deficiency. We simultaneously transfected \u003cem\u003eNrf2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e and OEUBE3B lentiviruses into AEC and performed OGD/R modeling. \u003cem\u003eNrf2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e increased NCOA4 and LC3II, while overexpression of UBE3B reduced this effect and increased the expression of the FTH1 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg\u0026ndash;h). In addition, we determined the iron content in the Nrf2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e+UBE3B group relative to that in the Nrf2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e control group. Iron levels were significantly increased in the Nrf2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e group, which was reversed by UBE3B overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei). Our results showed that cell viability and GSH levels increased, and MDA levels decreased in OGD/R OEUBE3B cells as compared to OGD/R Nrf2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei\u0026ndash;l). UBE3B overexpression significantly reversed the above changes caused by Nrf2 deficiency, indicating that UBE3B overexpression could inhibit NCOA4-mediated ferritinophagy, thereby alleviating ferroptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.4. UBE3B deficiency promotes NCOA4-mediated ferritinophagy and aggravates cell injury\u003c/h2\u003e \u003cp\u003eTo further delineate the UBE3B-mediated regulation of ferritinophagy, AECⅡ cells were infected with UBE3B-shRNA lentivirus. UBE3B deficiency significantly aggravated ferritinophagy, indicating that NCOA4 and LC3Ⅱ expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-b), cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec), oxidative stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed-e), and iron content (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef) were further aggravated by shUBE3B OGD/R. These data indicate that the anti-ferritinophagy role of UBE3B may be produced by modulating NCOA4 levels after OGD/R induction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.5. UBE3B binds to NCOA4 and induces ubiquitination degradation, thereby regulating ferritinophagy\u003c/h2\u003e \u003cp\u003eWe further investigated the potential mechanism by which UBE3B mediates NCOA4 protein expression in AECII. Ubiquitin E3 ligases have been well established to play a crucial role in selecting specific substrates for ubiquitination reactions, operating through the interaction between ubiquitin E3 ligases and substrates (Toma-Fukai and Shimizu, 2021). Therefore, we performed co-immunoprecipitation (CO-IP) with an Nrf2 antibody; the immunoblotting results showed an interaction between NCOA4 and UBE3B (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea) and was colocalized in cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). To determine the region of UBE3B that recognizes NCOA4, we cloned and expressed four fragments spanning the UBE3B open reading frame, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec. Endogenous NCOA4 was combined with fragments 1 and 2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). Additionally, shRNA-mediated depletion of UBE3B significantly increased the half-life of NCOA4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee), further supporting the hypothesis that UBE3B-mediated ubiquitination and degradation of NCOA4 suppress ferritinophagy.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eFerroptosis is an iron-dependent form of cell death that involves oxidative processes. It includes the Fenton reaction wherein ferrous iron reacts with hydrogen peroxide to produce ferric iron and ROS. If not promptly neutralized, ROS can harm lipid membranes, ultimately leading to cell death (Stockwell et al., 2017). NCOA4 binds to FTH1 within the autophagosome, facilitating the transfer of ferritin to the lysosome for degradation. This process releases free iron, which serves as a crucial source of intracellular ferrous ions (Wang et al., 2023a). Inhibition of ferritinophagy prevents ferroptosis; several studies have revealed that ferritinophagy-mediated ferroptosis promotes ischemia/reperfusion organ injury (Jin et al., 2023, Li et al., 2021). Therefore, we hypothesized that II/R or OGD/R may play a critical role in promoting ferroptosis and ferritinophagy. To test this hypothesis, we assessed the levels of oxidative stress markers, such as GSH, MDA, and Fe\u003csup\u003e2+\u003c/sup\u003e. We also evaluated the expression of ferritinophagy-related proteins, including NCOA4, FTH1, and LC3Ⅱ. According to our findings, the GSH percentage was dramatically reduced, while the MDA percentage and Fe\u003csup\u003e2+\u003c/sup\u003e levels were markedly elevated. Additionally, evaluation of the ferritinophagy-related proteins NCOA4, FTH1, and LC3Ⅱ indicated that both ferroptosis and ferritinophagy were notably elevated in the II/R and OGD/R groups compared to controls. At the same time, we observed that the co-localization of FTH1 and LC3 increased significantly in type Ⅱ alveolar epithelial cells of II/R mice. Therefore, the epithelium undergoes ferritinophagy during II/R.\u003c/p\u003e \u003cp\u003eNCOA4-mediated ferritinophagy plays a crucial role in regulating intracellular Fe\u003csup\u003e2+\u003c/sup\u003e balance, and emerging evidence has shown that NCOA4 can regulate ferroptosis (Ma et al., 2024). In cells, NCOA4 binds to FTH1 and LC3Ⅱ in the lysosome, facilitating the release of ferrous iron and enhancing the Fenton reaction to promote ferritinophagy, thereby triggering ferroptosis (Lee et al., 2022, Man et al., 2022, Masaldan et al., 2018). Nrf2 is a pivotal transcription factor of oxidative stress that stimulates downstream pathways that regulate ferroptosis by modulating GSH, iron and lipid metabolism, and mitochondrial function (Abdalkader et al., 2018). Previous studies have shown that Nrf2 regulates NCOA4-mediated ferritinophagy (Ma et al., 2024, Anandhan et al., 2023). Therefore, Nrf2 affects ferritinophagy-dependent ferroptosis by activating autophagy proteins. However, the precise role of Nrf2 in ferritinophagy associated with II/R-ALI remains to be elucidated. Nrf2 CKO mice exhibited more severe iron deposition, stronger GSH suppression, and higher MDA levels than WT II/R mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Additionally, examination of the ferritinophagy-related proteins FTH1 and LC3Ⅱ/LC3I suggested that ferritinophagy was significantly enhanced in Nrf2 CKO mice compared to that in WT mice. Simultaneously, we found that Nrf2 negatively regulates NCOA4. However, the specific regulatory mechanisms of these two remain to be investigated.\u003c/p\u003e \u003cp\u003eUbiquitin protein ligases form a vast superfamily, comprising more than 600 genes (George et al., 2018). These enzymes transfer ubiquitin molecules onto target proteins that are earmarked for degradation by the ubiquitin-proteasome system. Within this family, ubiquitin ligase E3B belongs to the HECT-type enzyme subgroup (Ambrozkiewicz and Kawabe, 2015). UBE3B is a mitochondria-associated ubiquitin protein ligase (Braganza et al., 2017). According to a recent study, disruption of mouse Ube3b results in decreased viability and mimics important characteristics of human disorders, including reduced weight and brain size, as well as the downregulation of cholesterol synthesis. UBE3B plays a critical role in oxidative stress responses (Basel-Vanagaite et al., 2012). However, it is unknown whether this antioxidant effect is related to Nrf2. In the present study, we identified high levels of UBE3B in an II/R model, suggesting possible UBE3B involvement in the regulation of ferritinophagy and II/R-ALI. UBE3B expression was significantly lower in Nrf2 CKO mice, suggesting that UBE3B is regulated by Nrf2. Braganza \u003cem\u003eet al\u003c/em\u003e. found that silencing UBE3B in human cells led to alterations in mitochondrial morphology and physiology, decreased mitochondrial volume, and markedly inhibited cellular proliferation (Braganza et al., 2017). Mitochondrial damage is one of the characteristic signs of ferroptosis. In our study, we found that UBE3B overexpression reversed the damage caused by the loss of Nrf2, including prevention of AECⅡ cellular injury and reduction of Fe accumulation, NCOA4 proteins, and LC3Ⅱ/LC3I ratios, while promoting FTH1 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In contrast, UBE3B inhibition reversed the above-mentioned changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), demonstrating that UBE3B is regulated by Nrf2 and protects against OGD/R-driven ferritinophagy by regulating NCOA4. Upon conducting a literature search, we discovered that no study has yet reported the ubiquitination of NCOA4 or related ubiquitin E3 ligases. We speculated that UBE3B acts as an E3 ubiquitin ligase during the ubiquitination and degradation of NCOA4, thereby regulating ferritinophagy. We identified UBE3B as a novel protein that promoted the ubiquitination and degradation of NCOA4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This suggests that UBE3B interacts with NCOA4 to regulate its expression, thereby mediating ferritinophagy.\u003c/p\u003e \u003cp\u003eThis study has some limitations. First, we did not identify other ubiquitin ligases for Nrf2. Hence, it remains unclear whether Nrf2 binds to multiple ubiquitin ligases involved in ferroptosis or ferritinophagy. In addition, we did not identify any potential ubiquitination sites of NCOA4. Future studies should investigate the following aspects: (1) Whether Nrf2 also regulates other ubiquitin ligases and has similar effects, (2) further verification of potential ubiquitination sites of NCOA4, and (3) whether the findings of this study can serve as a reference for developing treatments for other types of acute organ injuries that share similar pathogenesis with ALI.\u003c/p\u003e \u003cp\u003eIn conclusion, the findings of the present study demonstrated the presence of ferritinophagy in II/R and OGD/R and revealed that Nrf2 regulates iron homeostasis by enhancing the ubiquitination and degradation of NCOA4 mediated by the ubiquitin E3 ligase UBE3B, thus inhibiting ferritinophagy. In contrast, inhibition of Nrf2 expression led to decreased UBE3B expression, which increased the half-life of NCOA4 and promoted ferritinophagy, thereby enhancing the accumulation of Fe and promoting oxidative stress and ferroptotic cell death. Overall, our study has great therapeutic potential to improve the treatment of II/R-driven ALI.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eThe authors gratefully acknowledge the support from the National Natural Science Foundation of China (82270080, 82172084, 81803002).\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eYW, HD, YG, HC, and BH conducted experiments and analyzed data. YW, HD, and YG prepared the manuscript. XX, RH, and HJ were involved in the conceptualization, review, and editing of the manuscript. XX and RH obtained and provided funding support. All authors have formally endorsed the final version. \u0026Dagger;These authors contributed equally: Yanjun Wang, Hui Dong, and Yunfan Gu.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eData statement\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eThe authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eThis work is sponsored by National Natural Science Foundation of China (82270080, 82172084, 81803002).\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eAll experimental procedures were conducted according to the guidelines set forth by the National Institutes of Health (NIH) and were approved by the Animal Research Ethics Committee of Shanghai Jiao Tong University, under ethical approval number A2023114.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eData statement\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eThe authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eDeclaration of interest\u003c/strong\u003e\u003c/p\u003e \u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. All authors have formally endorsed the final version.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eABDALKADER, M., LAMPINEN, R., KANNINEN, K. M., MALM, T. M. \u0026amp; LIDDELL, J. R. 2018. Targeting Nrf2 to Suppress Ferroptosis and Mitochondrial Dysfunction in Neurodegeneration. \u003cem\u003eFrontiers In Neuroscience,\u003c/em\u003e 12\u003cstrong\u003e,\u003c/strong\u003e 466.\u003c/li\u003e\n\u003cli\u003eAMBROZKIEWICZ, M. C. \u0026amp; KAWABE, H. 2015. HECT-type E3 ubiquitin ligases in nerve cell development and synapse physiology. \u003cem\u003eFEBS Letters,\u003c/em\u003e 589\u003cstrong\u003e,\u003c/strong\u003e 1635-1643.\u003c/li\u003e\n\u003cli\u003eANANDHAN, A., DODSON, M., SHAKYA, A., CHEN, J., LIU, P., WEI, Y., TAN, H., WANG, Q., JIANG, Z., YANG, K., GARCIA, J. G., CHAMBERS, S. K., CHAPMAN, E., OOI, A., YANG-HARTWICH, Y., STOCKWELL, B. R. \u0026amp; ZHANG, D. D. 2023. NRF2 controls iron homeostasis and ferroptosis through HERC2 and VAMP8. \u003cem\u003eScience Advances,\u003c/em\u003e 9\u003cstrong\u003e,\u003c/strong\u003e eade9585.\u003c/li\u003e\n\u003cli\u003eBASEL-VANAGAITE, L., DALLAPICCOLA, B., RAMIREZ-SOLIS, R., SEGREF, A., THIELE, H., EDWARDS, A., ARENDS, M. J., MIR\u0026oacute;, X., WHITE, J. K., D\u0026eacute;SIR, J., ABRAMOWICZ, M., DENTICI, M. L., LEPRI, F., HOFMANN, K., HAR-ZAHAV, A., RYDER, E., KARP, N. A., ESTABEL, J., GERDIN, A.-K. B., PODRINI, C., INGHAM, N. J., ALTM\u0026uuml;LLER, J., N\u0026uuml;RNBERG, G., FROMMOLT, P., ABDELHAK, S., PASMANIK-CHOR, M., KONEN, O., KELLEY, R. I., SHOHAT, M., N\u0026uuml;RNBERG, P., FLINT, J., STEEL, K. P., HOPPE, T., KUBISCH, C., ADAMS, D. J. \u0026amp; BORCK, G. 2012. Deficiency for the ubiquitin ligase UBE3B in a blepharophimosis-ptosis-intellectual-disability syndrome. \u003cem\u003eAmerican Journal of Human Genetics,\u003c/em\u003e 91.\u003c/li\u003e\n\u003cli\u003eBRAGANZA, A., LI, J., ZENG, X., YATES, N. A., DEY, N. B., ANDREWS, J., CLARK, J., ZAMANI, L., WANG, X.-H., ST CROIX, C., O\u0026apos;SULLIVAN, R., GARCIA-EXPOSITO, L., BRODSKY, J. L. \u0026amp; SOBOL, R. W. 2017. UBE3B Is a Calmodulin-regulated, Mitochondrion-associated E3 Ubiquitin Ligase. \u003cem\u003eThe Journal of Biological Chemistry,\u003c/em\u003e 292\u003cstrong\u003e,\u003c/strong\u003e 2470-2484.\u003c/li\u003e\n\u003cli\u003eCAVRIANI, G., OLIVEIRA-FILHO, R. M., TREZENA, A. G., DA SILVA, Z. L., DOMINGOS, H. V., DE ARRUDA, M. J. C., JANCAR, S. \u0026amp; TAVARES DE LIMA, W. 2004. Lung microvascular permeability and neutrophil recruitment are differently regulated by nitric oxide in a rat model of intestinal ischemia-reperfusion. \u003cem\u003eEuropean Journal of Pharmacology,\u003c/em\u003e 494\u003cstrong\u003e,\u003c/strong\u003e 241-249.\u003c/li\u003e\n\u003cli\u003eDENNERY, P. A. \u0026amp; YAO, H. 2024. Emerging role of cellular senescence in normal lung development and perinatal lung injury. \u003cem\u003eChinese Medical Journal Pulmonary and Critical Care Medicine,\u003c/em\u003e 2\u003cstrong\u003e,\u003c/strong\u003e 10-16.\u003c/li\u003e\n\u003cli\u003eDONG, H., QIANG, Z., CHAI, D., PENG, J., XIA, Y., HU, R. \u0026amp; JIANG, H. 2020. Nrf2 inhibits ferroptosis and protects against acute lung injury due to intestinal ischemia reperfusion via regulating SLC7A11 and HO-1. \u003cem\u003eAging,\u003c/em\u003e 12\u003cstrong\u003e,\u003c/strong\u003e 12943-12959.\u003c/li\u003e\n\u003cli\u003eDONG, H., XIA, Y., JIN, S., XUE, C., WANG, Y., HU, R. \u0026amp; JIANG, H. 2021. Nrf2 attenuates ferroptosis-mediated IIR-ALI by modulating TERT and SLC7A11. \u003cem\u003eCell Death \u0026amp; Disease,\u003c/em\u003e 12\u003cstrong\u003e,\u003c/strong\u003e 1027.\u003c/li\u003e\n\u003cli\u003eDONG, X., LI, D., FANG, Z., ZHANG, C., WANG, J. \u0026amp; WAN, X. 2023. Astaxanthin alleviates lipopolysaccharide-induced acute lung injury by suppressing ferroptosis. \u003cem\u003eFood \u0026amp; Function,\u003c/em\u003e 14\u003cstrong\u003e,\u003c/strong\u003e 6115-6127.\u003c/li\u003e\n\u003cli\u003eFAN, Z., WIRTH, A. K., CHEN, D., WRUCK, C. J., RAUH, M., BUCHFELDER, M. \u0026amp; SAVASKAN, N. 2017. Nrf2-Keap1 pathway promotes cell proliferation and diminishes ferroptosis. \u003cem\u003eOncogenesis,\u003c/em\u003e 6\u003cstrong\u003e,\u003c/strong\u003e e371.\u003c/li\u003e\n\u003cli\u003eFENG, Z., LUAN, M., ZHU, W., XING, Y., MA, X., WANG, Y. \u0026amp; JIA, Y. 2024. Targeted ferritinophagy in gastrointestinal cancer: from molecular mechanisms to implications. \u003cem\u003eArchives of Toxicology\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eGA\u0026ntilde;\u0026aacute;N-G\u0026oacute;MEZ, I., WEI, Y., YANG, H., BOYANO-AD\u0026aacute;NEZ, M. C. \u0026amp; GARC\u0026iacute;A-MANERO, G. 2013. Oncogenic functions of the transcription factor Nrf2. \u003cem\u003eFree Radical Biology \u0026amp; Medicine,\u003c/em\u003e 65\u003cstrong\u003e,\u003c/strong\u003e 750-764.\u003c/li\u003e\n\u003cli\u003eGEORGE, A. J., HOFFIZ, Y. C., CHARLES, A. J., ZHU, Y. \u0026amp; MABB, A. M. 2018. A Comprehensive Atlas of E3 Ubiquitin Ligase Mutations in Neurological Disorders. \u003cem\u003eFrontiers In Genetics,\u003c/em\u003e 9\u003cstrong\u003e,\u003c/strong\u003e 29.\u003c/li\u003e\n\u003cli\u003eJIANG, J., RUAN, Y., LIU, X., MA, J. \u0026amp; CHEN, H. 2024a. Ferritinophagy Is Critical for Deoxynivalenol-Induced Liver Injury in Mice. \u003cem\u003eJournal of Agricultural and Food Chemistry,\u003c/em\u003e 72\u003cstrong\u003e,\u003c/strong\u003e 6660-6671.\u003c/li\u003e\n\u003cli\u003eJIANG, L., ZHENG, H., ISHIDA, M., LYU, Q., AKATSUKA, S., MOTOOKA, Y., SATO, K., SEKIDO, Y., NAKAMURA, K., TANAKA, H., ISHIKAWA, K., KAJIYAMA, H., MIZUNO, M., HORI, M. \u0026amp; TOYOKUNI, S. 2024b. Elaborate cooperation of poly(rC)-binding proteins 1/2 and glutathione in ferroptosis induced by plasma-activated Ringer\u0026apos;s lactate. \u003cem\u003eFree Radical Biology \u0026amp; Medicine,\u003c/em\u003e 214\u003cstrong\u003e,\u003c/strong\u003e 28-41.\u003c/li\u003e\n\u003cli\u003eJIN, L., YU, B., WANG, H., SHI, L., YANG, J., WU, L., GAO, C., PAN, H., HAN, F., LIN, W., LAI, E. Y., WANG, Y.-F. \u0026amp; YANG, Y. 2023. STING promotes ferroptosis through NCOA4-dependent ferritinophagy in acute kidney injury. \u003cem\u003eFree Radical Biology \u0026amp; Medicine,\u003c/em\u003e 208\u003cstrong\u003e,\u003c/strong\u003e 348-360.\u003c/li\u003e\n\u003cli\u003eKUDOH, K., UCHINAMI, H., YOSHIOKA, M., SEKI, E. \u0026amp; YAMAMOTO, Y. 2014. Nrf2 activation protects the liver from ischemia/reperfusion injury in mice. \u003cem\u003eAnnals of Surgery,\u003c/em\u003e 260\u003cstrong\u003e,\u003c/strong\u003e 118-127.\u003c/li\u003e\n\u003cli\u003eLEE, J., YOU, J. H. \u0026amp; ROH, J.-L. 2022. Poly(rC)-binding protein 1 represses ferritinophagy-mediated ferroptosis in head and neck cancer. \u003cem\u003eRedox Biology,\u003c/em\u003e 51\u003cstrong\u003e,\u003c/strong\u003e 102276.\u003c/li\u003e\n\u003cli\u003eLI, C., SUN, G., CHEN, B., XU, L., YE, Y., HE, J., BAO, Z., ZHAO, P., MIAO, Z., ZHAO, L., HU, J., YOU, Y., LIU, N., CHAO, H. \u0026amp; JI, J. 2021. Nuclear receptor coactivator 4-mediated ferritinophagy contributes to cerebral ischemia-induced ferroptosis in ischemic stroke. \u003cem\u003ePharmacological Research,\u003c/em\u003e 174\u003cstrong\u003e,\u003c/strong\u003e 105933.\u003c/li\u003e\n\u003cli\u003eLOBODA, A., DAMULEWICZ, M., PYZA, E., JOZKOWICZ, A. \u0026amp; DULAK, J. 2016. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. \u003cem\u003eCellular and Molecular Life Sciences : CMLS,\u003c/em\u003e 73\u003cstrong\u003e,\u003c/strong\u003e 3221-3247.\u003c/li\u003e\n\u003cli\u003eMA, Z., LU, H., FENG, X., DU, T., LI, J., ZHANG, Q., GU, X., SHAO, Y., JING, X. \u0026amp; SU, C. 2024. Nrf2 protects against cartilage endplate degeneration through inhibiting NCOA4‑mediated ferritinophagy. \u003cem\u003eInternational Journal of Molecular Medicine,\u003c/em\u003e 53.\u003c/li\u003e\n\u003cli\u003eMAN, H., ZHOU, L., ZHU, G., ZHENG, Y., YE, Z., HUANG, Z., TENG, X., AI, C., GE, G. \u0026amp; XIAO, Y. 2022. Super-Resolution Imaging of Autophagy by a Preferred Pair of Self-Labeling Protein Tags and Fluorescent Ligands. \u003cem\u003eAnalytical Chemistry,\u003c/em\u003e 94\u003cstrong\u003e,\u003c/strong\u003e 15057-15066.\u003c/li\u003e\n\u003cli\u003eMASALDAN, S., CLATWORTHY, S. A. S., GAMELL, C., MEGGYESY, P. M., RIGOPOULOS, A.-T., HAUPT, S., HAUPT, Y., DENOYER, D., ADLARD, P. A., BUSH, A. I. \u0026amp; CATER, M. A. 2018. Iron accumulation in senescent cells is coupled with impaired ferritinophagy and inhibition of ferroptosis. \u003cem\u003eRedox Biology,\u003c/em\u003e 14\u003cstrong\u003e,\u003c/strong\u003e 100-115.\u003c/li\u003e\n\u003cli\u003eMENG, Q.-T., CHEN, R., CHEN, C., SU, K., LI, W., TANG, L.-H., LIU, H.-M., XUE, R., SUN, Q., LENG, Y., HOU, J.-B., WU, Y. \u0026amp; XIA, Z.-Y. 2017. Transcription factors Nrf2 and NF-\u0026kappa;B contribute to inflammation and apoptosis induced by intestinal ischemia-reperfusion in mice. \u003cem\u003eInternational Journal of Molecular Medicine,\u003c/em\u003e 40\u003cstrong\u003e,\u003c/strong\u003e 1731-1740.\u003c/li\u003e\n\u003cli\u003eMURA, M., ANDRADE, C. F., HAN, B., SETH, R., ZHANG, Y., BAI, X.-H., WADDELL, T. K., HWANG, D., KESHAVJEE, S. \u0026amp; LIU, M. 2007. Intestinal ischemia-reperfusion-induced acute lung injury and oncotic cell death in multiple organs. \u003cem\u003eShock (Augusta, Ga.),\u003c/em\u003e 28\u003cstrong\u003e,\u003c/strong\u003e 227-238.\u003c/li\u003e\n\u003cli\u003eRUI, T., WANG, H., LI, Q., CHENG, Y., GAO, Y., FANG, X., MA, X., CHEN, G., GAO, C., GU, Z., SONG, S., ZHANG, J., WANG, C., WANG, Z., WANG, T., ZHANG, M., MIN, J., CHEN, X., TAO, L., WANG, F. \u0026amp; LUO, C. 2021. Deletion of ferritin H in neurons counteracts the protective effect of melatonin against traumatic brain injury-induced ferroptosis. \u003cem\u003eJournal of Pineal Research,\u003c/em\u003e 70\u003cstrong\u003e,\u003c/strong\u003e e12704.\u003c/li\u003e\n\u003cli\u003eSHEN, Y., LIU, X., SHI, J. \u0026amp; WU, X. 2019. Involvement of Nrf2 in myocardial ischemia and reperfusion injury. \u003cem\u003eInternational Journal of Biological Macromolecules,\u003c/em\u003e 125\u003cstrong\u003e,\u003c/strong\u003e 496-502.\u003c/li\u003e\n\u003cli\u003eSHI, H., XIONG, L., YAN, G., DU, S., LIU, J. \u0026amp; SHI, Y. 2023. Susceptibility of cervical cancer to dihydroartemisinin-induced ferritinophagy-dependent ferroptosis. \u003cem\u003eFrontiers In Molecular Biosciences,\u003c/em\u003e 10\u003cstrong\u003e,\u003c/strong\u003e 1156062.\u003c/li\u003e\n\u003cli\u003eSTALLION, A., KOU, T. D., LATIFI, S. Q., MILLER, K. A., DAHMS, B. B., DUDGEON, D. L. \u0026amp; LEVINE, A. D. 2005. Ischemia/reperfusion: a clinically relevant model of intestinal injury yielding systemic inflammation. \u003cem\u003eJournal of Pediatric Surgery,\u003c/em\u003e 40\u003cstrong\u003e,\u003c/strong\u003e 470-477.\u003c/li\u003e\n\u003cli\u003eSTOCKWELL, B. R., FRIEDMANN ANGELI, J. P., BAYIR, H., BUSH, A. I., CONRAD, M., DIXON, S. J., FULDA, S., GASC\u0026oacute;N, S., HATZIOS, S. K., KAGAN, V. E., NOEL, K., JIANG, X., LINKERMANN, A., MURPHY, M. E., OVERHOLTZER, M., OYAGI, A., PAGNUSSAT, G. C., PARK, J., RAN, Q., ROSENFELD, C. S., SALNIKOW, K., TANG, D., TORTI, F. M., TORTI, S. V., TOYOKUNI, S., WOERPEL, K. A. \u0026amp; ZHANG, D. D. 2017. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. \u003cem\u003eCell,\u003c/em\u003e 171\u003cstrong\u003e,\u003c/strong\u003e 273-285.\u003c/li\u003e\n\u003cli\u003eTOMA-FUKAI, S. \u0026amp; SHIMIZU, T. 2021. Structural Diversity of Ubiquitin E3 Ligase. \u003cem\u003eMolecules (Basel, Switzerland),\u003c/em\u003e 26.\u003c/li\u003e\n\u003cli\u003eWANG, F.-Y., YANG, L.-M., WANG, S.-S., LU, H., WANG, X.-S., LU, Y., NI, W.-X., LIANG, H. \u0026amp; HUANG, K.-B. 2024. Cycloplatinated (II) Complex Based on Isoquinoline Alkaloid Elicits Ferritinophagy-Dependent Ferroptosis in Triple-Negative Breast Cancer Cells. \u003cem\u003eJournal of Medicinal Chemistry,\u003c/em\u003e 67\u003cstrong\u003e,\u003c/strong\u003e 6738-6748.\u003c/li\u003e\n\u003cli\u003eWANG, J., WU, N., PENG, M., OYANG, L., JIANG, X., PENG, Q., ZHOU, Y., HE, Z. \u0026amp; LIAO, Q. 2023a. Ferritinophagy: research advance and clinical significance in cancers. \u003cem\u003eCell Death Discovery,\u003c/em\u003e 9\u003cstrong\u003e,\u003c/strong\u003e 463.\u003c/li\u003e\n\u003cli\u003eWANG, T., XIONG, T., YANG, Y., CHEN, X., MA, Z., ZUO, B., NING, D., ZHOU, B., SONG, R., LIU, X. \u0026amp; WANG, D. 2023b. Estradiol-mediated small GTP-binding protein GDP dissociation stimulator induction contributes to sex differences in resilience to ferroptosis in takotsubo syndrome. \u003cem\u003eRedox Biology,\u003c/em\u003e 68\u003cstrong\u003e,\u003c/strong\u003e 102961.\u003c/li\u003e\n\u003cli\u003eWU, K., YAN, M., LIU, T., WANG, Z., DUAN, Y., XIA, Y., JI, G., SHEN, Y., WANG, L., LI, L., ZHENG, P., DONG, B., WU, Q., XIAO, L., YANG, X., SHEN, H., WEN, T., ZHANG, J., YI, J., DENG, Y., QIAN, X., MA, L., FANG, J., ZHOU, Q., LU, Z. \u0026amp; XU, D. 2023. Creatine kinase B suppresses ferroptosis by phosphorylating GPX4 through a moonlighting function. \u003cem\u003eNature Cell Biology,\u003c/em\u003e 25\u003cstrong\u003e,\u003c/strong\u003e 714-725.\u003c/li\u003e\n\u003cli\u003eZHAI, X., CHEN, X., SHI, J., SHI, D., YE, Z., LIU, W., LI, M., WANG, Q., KANG, Z., BI, H. \u0026amp; SUN, X. 2013. Lactulose ameliorates cerebral ischemia-reperfusion injury in rats by inducing hydrogen by activating Nrf2 expression. \u003cem\u003eFree Radical Biology \u0026amp; Medicine,\u003c/em\u003e 65\u003cstrong\u003e,\u003c/strong\u003e 731-741.\u003c/li\u003e\n\u003cli\u003eZHANG, F., LI, Z.-L., XU, X.-M., HU, Y., YAO, J.-H., XU, W., JING, H.-R., WANG, S., NING, S.-L. \u0026amp; TIAN, X.-F. 2015. Protective effects of icariin-mediated SIRT1/FOXO3 signaling pathway on intestinal ischemia/reperfusion-induced acute lung injury. \u003cem\u003eMolecular Medicine Reports,\u003c/em\u003e 11\u003cstrong\u003e,\u003c/strong\u003e 269-276.\u003c/li\u003e\n\u003cli\u003eZHANG, J., ZHENG, Y., WANG, Y., WANG, J., SANG, A., SONG, X. \u0026amp; LI, X. 2022. YAP1 alleviates sepsis-induced acute lung injury via inhibiting ferritinophagy-mediated ferroptosis. \u003cem\u003eFrontiers In Immunology,\u003c/em\u003e 13\u003cstrong\u003e,\u003c/strong\u003e 884362.\u003c/li\u003e\n\u003cli\u003eZHAO, H.-D., ZHANG, F., SHEN, G., LI, Y.-B., LI, Y.-H., JING, H.-R., MA, L.-F., YAO, J.-H. \u0026amp; TIAN, X.-F. 2010. Sulforaphane protects liver injury induced by intestinal ischemia reperfusion through Nrf2-ARE pathway. \u003cem\u003eWorld Journal of Gastroenterology,\u003c/em\u003e 16\u003cstrong\u003e,\u003c/strong\u003e 3002-3010.\u003c/li\u003e\n\u003cli\u003eZOU, J. H., YAN, J. Y., LU, Y. F., YU, Z., ZHANG, K., HAN, Q. Y., HAN, D., GAI, C., CHAI, X., ZHAO, Q., ZHUANG, C. \u0026amp; ZOU, Y. 2024. Cyclic Peptide Keap1-Nrf2 Protein-Protein Interaction Inhibitors: Design, Synthesis, and In Vivo Treatment of Acute Lung Injury. \u003cem\u003eJournal of Medicinal Chemistry,\u003c/em\u003e 67\u003cstrong\u003e,\u003c/strong\u003e 4889-4903.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e* Abbreviations : AECII, type II alveolar epithelial cells; ALI, acute lung injury; ARE, antioxidant response element; CCK-8, cell counting kit-8; CKO, conditional knockout; CO-IP, Co-immunoprecipitation; GSH, glutathione; HE, hematoxylin and eosin; II/R, intestinal ischemia-reperfusion; IR, ischemia reperfusion; MDA, malondialdehyde, NCOA4, nuclear receptor coactivator 4; Nrf2, nuclear factor E2-related factor 2; OGD/R, oxygen glucose deprivation/re-oxygenation; ROS, reactive oxygen species; TEM, transmission electron microscopy; UBE3B, ubiquitin ligase E3.\u003c/p\u003e"},{"header":"Scheme 1","content":"\u003cp\u003eScheme 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Nrf2, acute lung injury, ferroptosis, NCOA4, ferritinophagy, UBE3B","lastPublishedDoi":"10.21203/rs.3.rs-5229445/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5229445/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIron overload and ferroptosis are associated with intestinal ischemia and reperfusion (II/R)-induced acute lung injury (ALI). However, the mechanisms underlying the regulation of iron homeostasis remain unclear. Nrf2 regulates cellular iron homeostasis; however, its impact on ALI pathology and its underlying mechanism of action requires further investigation. Ubiquitin ligase E3B (UBE3B) plays a critical role in the proteasome pathway, which is essential for protein turnover and ubiquitin-mediated signaling. A recent study found that UBE3B plays a role in oxidative stress; however, it remains unknown whether its role is related to Nrf2. Furthermore, the exact role of UBE3B in ALI and its underlying mechanism remain largely uncharacterized. In the present study, immunohistochemical analysis of UBE3B expression in type II alveolar epithelial cells (AECII) was conducted and its expression was found to be increased in II/R-ALI. Western blot analysis indicated that UBE3B hyperactivation may alleviate oxidative stress, thereby protecting against ALI. Moreover, UBE3B was involved in iron metabolism dysfunction and ferroptosis. UBE3B deficiency enhanced the process of nuclear receptor coactivator 4 (NCOA4)-mediated ferritinophagy and increased ferrous ion content, whereas overexpression of UBE3B reversed the harmful effects of Nrf2 knockdown on AECⅡ, which may promote AECⅡ ferroptosis. This study highlights the role of the Nrf2/UBE3B/NCOA4 axis in AECⅡ ferroptosis and II/R-ALI pathogenesis, suggesting that Nrf2 activation may be a promising strategy for ALI treatment.\u003c/p\u003e","manuscriptTitle":"Nrf2/UBE3B protects against acute lung injury by inhibiting ferritinophagy through the ubiquitination of NCOA4","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-14 18:22:26","doi":"10.21203/rs.3.rs-5229445/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9a053fbd-6cbd-492b-b3c6-eeb0ce57286c","owner":[],"postedDate":"October 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-03T04:38:37+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-14 18:22:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5229445","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5229445","identity":"rs-5229445","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}