KIT-c-Jun Signaling Up-regulated HMGCS1 to Promote Colorectal Cancer Development

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by qwen3.7-flash, 2026-09-15 · read from full text

This preprint investigates the molecular mechanisms driving colorectal cancer by examining the interaction between KIT signaling and the enzyme HMGCS1. The researchers found that KIT activates the JNK-c-Jun pathway, which subsequently up-regulates HMGCS1 expression to promote tumor cell proliferation and invasion while inhibiting apoptosis. These findings were validated through in vitro experiments using various colorectal cancer cell lines and in vivo studies involving c-kit loss-of-function mutant mice. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Purpose: Colorectal cancer (CRC) ranks 2nd in morbidity and 3rd in mortality among all cancers worldwide. 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) is ubiquitously expressed in humans. Remarkably, the mevalonate pathway is often dysregulated in many cancers, suggesting tumor dependency on this classic metabolic pathway. In addition to altered substrates in the mevalonate pathway, it was recently found that HMGCS1 was highly expressed in prostate, melanoma and breast cancers. The transmembrane glycoprotein KIT is critical for the survival and development of various cells through activating downstream pathways and targets. Our previous research has proved that KIT is hyper-expressed in CRC and promotes CRC progression. However, whether HMGCS1 mediates the tumor-promoting effect of KIT signaling has not been unclosed. Material and Methods We investigated the regulatory mechanism of KIT signaling on HMGCS1 expression and the role of increased HMGCS1 in CRC development by the use of gene over-expression and knock-down techniques in CRC cells, biological function tests, protein-DNA binding detection, bioinformatics, database analysis and c-kit loss-of-function mutant mice (Wads m/m ). Results HMGCS1 was up-regulated by KIT-JNK-c-Jun signaling in CRC cells and could be a biomarker for CRC. Highly expressed HMCGS1 promoted CRC cell proliferation and invasion while inhibiting apoptosis. Our results provided evidence for the role of HMGCS1 in CRC progression and suggested that blocking KIT-JNK-c-Jun-HMGCS1 might be a new strategy for treating CRC patients. Conclusion Our results indicated that KIT signaling could up-regulate HMGCS1 in CRC mediated by Ap-1/c-Jun. Hyper-expressed HMGCS1 promotes CRC cell proliferation and invasion while inhibiting apoptosis.
Full text 108,808 characters · extracted from preprint-html · click to expand
KIT-c-Jun Signaling Up-regulated HMGCS1 to Promote Colorectal Cancer Development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article KIT-c-Jun Signaling Up-regulated HMGCS1 to Promote Colorectal Cancer Development Muhammad Khawar Abbas, Liu Yang, Haimei Sun, Tingyi Sun, Bo Wu, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1508182/v2 This work is licensed under a CC BY 4.0 License Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Abstract Purpose Colorectal cancer (CRC) ranks 2nd in morbidity and 3rd in mortality among all cancers worldwide. 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) is ubiquitously expressed in humans. Remarkably, the mevalonate pathway is often dysregulated in many cancers, suggesting tumor dependency on this classic metabolic pathway. In addition to altered substrates in the mevalonate pathway, it was recently found that HMGCS1 was highly expressed in prostate, melanoma and breast cancers. The transmembrane glycoprotein KIT is critical for the survival and development of various cells through activating downstream pathways and targets. Our previous research has proved that KIT is hyper-expressed in CRC and promotes CRC progression. However, whether HMGCS1 mediates the tumor-promoting effect of KIT signaling has not been unclosed. Material and Methods We investigated the regulatory mechanism of KIT signaling on HMGCS1 expression and the role of increased HMGCS1 in CRC development by the use of gene over-expression and knock-down techniques in CRC cells, biological function tests, protein-DNA binding detection, bioinformatics, database analysis and c-kit loss-of-function mutant mice (Wads m/m ). Results HMGCS1 was up-regulated by KIT-JNK-c-Jun signaling in CRC cells and could be a biomarker for CRC. Highly expressed HMCGS1 promoted CRC cell proliferation and invasion while inhibiting apoptosis. Our results provided evidence for the role of HMGCS1 in CRC progression and suggested that blocking KIT-JNK-c-Jun-HMGCS1 might be a new strategy for treating CRC patients. Conclusion Our results indicated that KIT signaling could up-regulate HMGCS1 in CRC mediated by Ap-1/c-Jun. Hyper-expressed HMGCS1 promotes CRC cell proliferation and invasion while inhibiting apoptosis. HMGCS1 Ap-1/c-Jun KIT Colorectal Cancer Proliferation Invasion Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Cancer is one of the leading causes of death and one of the biggest challenges to increasing life expectancy. It is also one of the costliest diseases, for more than 133 billion dollars was spent on treatment and supportive care worldwide in 2017. Colorectal cancer (CRC) ranks 2nd in morbidity and 3rd in mortality among all cancers worldwide. According to estimates from GLOBOCAN, over 1.8 million new CRC cases and 881,000 deaths are estimated to occur in 2018 [ 1 ]. CRC incidence and mortality are rapidly growing worldwide, especially in China. With the high-speed socio-economic development, CRC incidence and mortality in China have been above the global average, being a severe threat to people's health and a heavy burden on medical care. Proctocolectomy and adjuvant chemotherapy, radiotherapy, targeted therapy, and supportive care are currently the main treatments for CRC patients. Unfortunately, the CRC patient's overall survival has not improved significantly due to frequent relapse and metastasis, closely related to oncogenes aberrant expression and activation. Therefore, it is essential to explore the critical molecules in CRC development, which helps research and develop effective and precise targeted therapeutic drugs. Despite serial breakthroughs in CRC studies, the molecular mechanism underlying the tumorigenesis and progress of CRC remains largely unknown. For the last decades, cholesterol metabolism in cancers has attracted many researchers. Cholesterol is vital for the survival and growth of mammalian cells, which is synthesized mainly through the mevalonate pathway. More than a membrane constituent, cholesterol can initiate or promote cancers by being a precursor to bile acids and steroid hormones, modulating signaling pathways involved in tumorigenesis and progression, and facilitating the formation of specialized membrane microdomains [ 2 ]. Cholesterol level is intensively correlated with CRC incidence [ 3 ]. Red meat consumption, a significant source of dietary cholesterol, is suggested as causative in CRC, possibly explaining the increasing CRC. It is well-documented that the mevalonate pathway is often dysregulated in many cancers, guiding tumor dependency on this classic metabolic pathway [ 4 ]. In addition to the altered substrates in the mevalonate pathway, 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) was the rate-limiting enzyme within the mevalonate pathway was over-expressed, contributing to the oncogenic progression and poor prognosis [ 5 , 6 ]. Besides HMGCR, 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) plays a vital role in cholesterol biosynthesis. Also, HMGCS1 was highly expressed in prostate, melanoma, and breast cancers [ 7 , 8 ]. However, research on the expression, regulation, and role of HMGCS1 in CRC is lacking. One study on the transcriptome network approach suggested that HMGCS1 was up-regulated in CRC samples. It could be a novel testable target to eliminate CRC cells directly or potentially through lipid-lowering drugs associated with selected anticancer drugs [ 9 ]. The transmembrane glycoprotein KIT (also known as c-KIT or CD117) is a member of the sub-family of receptor tyrosine kinases (RTKs), which is essential for the survival and development of various cells, including gastrointestinal pacemaker cells (interstitial cells of Cajal, ICC), mast cells, melanocytes, germ cells and erythrocytes [ 10 ] KIT is activated by binding to its ligand stem cell factor (SCF), resulting in various downstream pathways such as MAPK, SRC, JAK/STAT and PI3K/AKT that promote cell proliferation, survival and inhibit apoptosis [ 11 ]. Yet, over-expressed or over-activated KIT/SCF signaling is implicated in the onset and progression of multiple cancers, including sinonasal lymphoma, seminomas, systemic mastocytosis, melanomas, acute myeloid leukemia, and gastrointestinal stromal tumors [ 12 , 13 ]. The role of KIT/SCF signaling has also been evaluated in CRC. Up to 51% of CRC patients are KIT high, and the hyper-activated KIT/SCF signaling promotes the growth of colon xenograft tumors [ 14 , 15 ]. Consistently, our previous research showed that c-kit loss-of-function mutant mice (Wads m/m ) had much fewer and smaller colon tumors induced by AOM + DSS treatment than wild-type (WT) mice did. Activating KIT/SCF signaling in vitro accelerated CRC cell proliferation and invasion, reversed by RTK inhibitor Imatinib [ 16 ]. Therefore, we wonder whether HMGCS1 mediates the tumor-promoting effect of KIT/SCF signaling in CRC. Material And Methods Bioinformatics analysis The University of California, Santa Cruz (UCSC) database was used to find the sites 2000 bp upstream and 100 bp downstream of Ap-1 TSS [17]. PROMO program has projected possible TFs capable of binding to the HMGCS1 promoter [18,19]. The cBioPortal results from The Cancer Genome Atlas (TCGA) have been used to analyze HMGCS1 and AP-1 expression levels in patients with or without recurrences of CRC [20,21]. The GEPIA2 server was used to study mRNA expression and the association between the two genes in HMGCS1 and Ap-1 in CRC and normal tissues [22]. Cell culture & treatment The CRC cell lines used in the experiment include HCT-116, Caco-2, RKO, LAS174T, HT-29, and HEK293T were grown in Dulbecco's Modified Eagle Medium (DMEM, Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100mU/ml of Penicillin (Gibco) and 100µg/ml of Streptomycin (Gibco) at 37ºC in a Humidified incubator of 5% CO 2 . The medium was changed every 24hr. All cell lines were purchased from American Tissue Culture (ATCC). Reagents included 50 ng/ml recombinant human stem cell factor (rhSCF, 255-SC, R&D Systems, USA) added for 15 minutes, 2 µmol/L Imatinib (STI571, S1026, Selleck, Shanghai, China) added for 2.5 hr and 30 µmol/L ISCK03 (ab145066, Abcam) added for 2.5 hr. Over-expression of AP-1 by plasmid transfection AP-1 over-expression and its negative control plasmid were constructed by GeneChem Technology Co., Ltd (Shanghai, China). We co-transfected the reporter plasmids with AP-1 overexpressing plasmid into Caco-2 cells using Lipofectamine TM 2000 (Thermo Scientific). The vector scheme is shown in Figure S1. Over-expression of KIT by lentivirus infection Lentivirus used for KIT stable over-expression was constructed by Shanghai GeneChem Technology Co., Ltd (Shanghai, China) and transfected into CRC cells using Lipofectamine TM 2000 (Thermo Scientific). Knock-down of HMGCS1 by siRNA Both siRNA siHMGCS1 and siNC were purchased from The RiboBio (Guangzhou, Guangdong, China). According to the manufacturer's protocol, all the transfection was performed using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Inc.). Cells were cultured into a 60mm dish when the cells were in 80% to 90% confluency. Then, the complete DMEM into antibiotic and FBS-free DMEM for 24 hours. To prepare Lipofectamine reagent, take 250µl of Opti-MEM and 10µl Lipofectamine reagent per well and put them for 5 minutes at room temperature. For the preparation of siRNA solution taken, 250µl of Opti-MEM and 2500-5000ng siRNA per well. Then gently mix Lipofectamine reagent and DNA at room temperature for 20 minutes. After this, discarded DMEM and added Lipofectamine reagent DNA mixture into the dish. Add 1.5ml of Opti-MEM to make the volume up to 2ml per well. After 24/48 hrs., check the inflorescence intensity to evaluate transfection efficiency. If transfection was successful, then harvest cells. The vector scheme is shown in Figure S2. Chromatin immunoprecipitation (ChIP) ChIP assay was performed according to the manufacturer's instructions (EZ-Magna ChIP TM A Kit, #17-408, Merck-Millipore, USA). Chromatin was immunoprecipitated for 24hr at 4 ̊C using rabbit monoclonal anti-Ap1. Primers are shown in Table 1. Table 1. Primers sequences Genes qRT-PCR Primer Sequences KIT Forward: 5’-CAGGCAACGTTGACTATCAGT-3’ Reverse: 5’-ATTCTCAGACTTGGGATAATC-3’ HMGCS1 Forward: 5’-GCTCTTGGGATGGACGGTAT-3’ Reverse: 5’-GCGGTCTAATGCACTGAGGT-3’ c-Jun Forward: 5’-TATGAAGTGAGTCATGGGCAA-3’ Reverse: 5’-TATGAAGCAGACACTGGGCAA-3’ GAPDH Forward: 5’- CCTGCACCACCAACTGCTTA -3’ Reverse: 5’- AGTGATGGCATGGACTGTGG -3’ ChIP- qPCR primer sequences Ap1 promoter Forward:5’-TATGAAGTGAGTCATGGGCAA-3’ Reverse: 5’-TATGAAGCAGACACTGGGCAA-3’ Real-time cellular analyzer (RTCA) RTCA (ACEA Biosciences, USA) was used to monitor cell proliferation, and invasion as previously described [23]. Cell apoptosis detection by flow cytometry (FCM) The cells were fixed with 70% ethanol in PBS and routinely kept at -20C overnight. The cells were washed with PBS and permeabilized with PBS, 4% fetal bovine serum, and 0.1% Triton X-100 for 10 min ice. Then cells were incubated within 1:200 dilutions in PBS, 4% fetal bovine serum for 2hr. Cells were washed twice with PBS-T and incubated with 1:200 dilutions of fluorescein-tagged goat anti-mouse secondary antibody. After washing with PBS-T, cells will be suspended in PBS and analyzed using a flow cytometer. Western blot A mixture of Pierce RAPI Lysate (Applygen, Beijing, China) and Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific, Inc.) was used to lyse cells at a ratio of 100:1. The protein concentration was measured using the BCA method using NanoDrop 2000c (Thermo Scientific, Gene Company Limited). The proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). The membranes were blocked with 5% bovine serum albumin (BSA) and incubated with primary antibodies against HMGCS1 (1:1000), p-c-JUN (1:1000), C-JUN (1:1000), C-KIT (1:1000), P-KIT (1:1000), and GAPDH (1:5000) for overnight at 4ºC. Then membranes were incubated with goat anti-rabbit secondary antibody (1:5000) for 2 hours at 37ºC. Super Signal West Pico Chemiluminescent substrate (Thermo Fisher Scientific, Inc.) visualized the protein bands. ImageJ 1.50i (National Institutes of Health, Bethesda, MD, USA) was used to quantify the protein bands. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from cell lines or tissues using TRIzol (Invitrogen, Thermo Fisher Scientific, Inc.) and reverse transcribed into cDNA using the 5x All In One RT Master Mix (ABM, Canada). The expression was measured using the SYBR Green Script miRNA RT-PCR kit (Takara) with the AB1 7500 Real-time PCR system (Bio-Rad Laboratories Inc., Hercules, CA, USA). All of these steps were operated according to the manufacturer's protocol. The oligonucleotide sequences of the qRT-PCR primers are listed in Table 1. Cell proliferation measured by CCK8 cell viability assay Following the manufacturer's protocol, cell proliferation was measured using the CCK8 assay Kit (Dojindo Laboratories, Japan). The cell was plated in 96-well plates and treated with drugs. After 72 hrs. Incubation of 10µl CCK8 was added to each well for an additional 2 hrs. Then absorbance was measured by a Multiskan FC photometer at 450nm. c-Kit loss of functional mutant mice (Wads m/m ) Five c-kit loss of functional mice (Wads m/m ) and %WT littermates were used on the C57BL/6 background and used in a previous study [24]. Animal studies were performed under strict protocols approved by the Animal Care and Use Committee of Capital Medical University. Tissue specimen and clinicopathological information Specimen of tumor and adjacent normal tissues of the colon were obtained from 30 patients who had been pathologically diagnosed with colorectal cancer and underwent surgical resection. Tissue specimens were ground then sonicated in the lysis buffer (50 mM Tris-HCL, pH 7,4, 1mM EGTA, 150 mM Nack, 5% Triton X-100) with protease inhibitors. The samples were micro centrifuged to remove the large debris and subjected to western analysis. All patient-derived specimens were collected from Beijing Friendship Hospital, Capital Medical University Beijing, and archived under complete protocols approved by the Research Board of Capital Medical University. Statistical analysis The student's t-test (two-tailed) was performed for comparisons between groups in cell proliferation assay and gene expression analysis by GraphPad Prism 5. Significance was presented as a p-value <0.005 (*), <0.01 (**) and <0.001 (***), non-significant differences were presented as NS. Results HMGCS1 was hyper-expressed in CRC tissues HMGCS1 expression was detected by qPCR and Western blot in the 30 pairs of CRC tissues and corresponding para-tumoral mucosa. The results showed that HMGCS1 was overexpressed in tumors compared with that in para-tumoral normal mucosa (Fig. 1a and b), which was consistent with the analysis on the TCGA database (Fig. 1c). These results suggested a potential role of aberrant HMGCS1 in CRC development. AP-1/c-Jun was a candidate for HMGCS1 transcription Protein expression is controlled by a distinct regulatory network, among which transcriptional regulation is one of the fundamental and general mechanisms. Predicted transcription factors (TFs) that can bind to the HMGCS1 promoter using bioinformatics analysis. The maximum matrix dissimilarity is zero, with 18 output TFs (Fig. 2a). In this study, we had a particular interest in the transcription factor (TF) AP-1/c-Jun due to the reasons: ① AP-1/c-Jun was able to bind to the HMGCS1 promoter indicated by UCSC, and ALLGEN-PROMO bioinformatics (Fig. 2b and c). ② AP-1/c-Jun was highly expressed and activated in CRC compared with para-tumoral mucosa (Fig. 2d). AP-1/c-Jun accelerated HMGCS1 transcription by binding to its promoter To confirm the regulatory role of AP-1/c-Jun on HMGCS1 transcription, we analyzed the mRNA (FPKM value) level of AP-1/c-Jun and HMGCS1 in 275 CRC patients from the TCGA database, which revealed a significant positive correlation between them (Fig. 3a). We performed ChIP to determine whether the AP-1/c-Jun can bind to the predicted site within the HMGCS1 promoter. After activating AP-1/c-Jun by 12-O-Tetradecanoylphorbol 13-acetate (TPA), a PKC activator can also activate AP-1, the binding of Ap-1/c-Jun to the HMGCS1 promoter was significantly increased compared with the IgG group (Fig. 3b and c). Moreover, we evaluated the effect of Ap-1/c-Jun in HMGCS1 expression. Ap-1/c-Jun was over-expressed in Caco-2 cells, which in addition to that, had significantly up-regulated HMGCS1 (Fig. 3d). KIT-c-Jun signaling pathway up-regulated HMGCS1 We previously reported that KIT was highly-expressed in CRC (Fig. 4a and b), and AP-1/c-Jun was regulated by KIT signaling via the JNK pathway in CRC cells (Fig. 4c) [25]. To determine the effect of KIT signaling on HMGCS1 expression, KIT signaling was over-activated by lentivirus mediation or blocked by its inhibitor Imatinib, an RTK inhibitor, or ISCK03, a specific KIT/SCF signaling inhibitor, in HCT-116 cells. Figures 4d and 2 show that KIT over-activated cells had highly activated AP-1/c-Jun and HMGCS1. While the activity of AP-1/c-Jun was inhibited, the expression of HMGCS1 was reduced in cells treated with either Imatinib or ISCK03. In addition, we compared expressions of AP-1/c-Jun and HMGCS1 in the c-kit loss-of-function mutant Wads m/m mice and WT littermates in vivo. The results showed that along with the reduced KIT activity, the expression of AP-1/c-Jun and HMGCS1 significantly decreased (Fig. 4f). These results confirmed that in CRC cells, the hyper-activated KIT signaling elevated HMGCS1 expression via activating AP-1/c-Jun. Knock-down of HMGCS1 reduced CRC cell proliferation and invasion Finally, we evaluated the role of HMGCS1 in the biological functions of CRC cells. HMGCS1 was knocked down by introducing its specific siRNA (Fig. 5a and b). The cell proliferation was significantly inhibited in CRC cells as measured by CCK8 assays and a real-time cellular analyzer (RTCA) (Fig. 5c and 5). Likewise, the invasiveness hindered HMGCS1 knocked-down cells (Fig. 5e and 5). Knock-down of HMGCS1 increased apoptosis of CRC cells The CRC cell apoptosis was detected by flow cytometry. The knock-down of HMGCS1 resulted in a marked increase in cell apoptosis (Fig. 6). Discussion In this study, we, for the first time, reveal that the KIT-JNK-c-Jun signaling pathway up-regulates the HMGCS1 in CRC cells, which promotes CRC progression. Reprogramming of various metabolic pathways has been implicated in the multistep development of tumors. The first discovered metabolic reprogramming is the shift from catabolic to anabolic metabolism, known as the Warburg effect, which is considered a classic hallmark of cancer cells [ 26 ]. As early as a century ago, cholesterol accumulated in malignant tissues [ 27 ], spotlighting the cholesterol metabolic reprogramming in cancer biology. Reprogrammed cholesterol metabolism is also recognized as a hallmark feature in cancer cells. Many cancer cells exhibit dysregulation of the mevalonate pathway, the fundamental way for cholesterol biosynthesis [ 28 – 30 ]. A clear association between CRC and cholesterol accumulation prompted researchers to investigate the mevalonate pathway genes. For example, increased HMGCR, the rate-limiting enzyme in the mevalonate pathway, was frequently found in various cancer, including CRC [ 5 , 6 ]. This study focused on HMGCS1, the immediately upstream enzyme of HMGCR in the mevalonate pathway, condensing acetyl-CoA and acetoacetyl-CoA to HMG-CoA [ 31 ]. The Association of HMGCS1 with other cancers has been described [ 7 , 30 , 32 ]; neither the role nor the regulation of HMGCS1 has not been wholly illuminated in CRC. Like HMGCR, there was a significant increase of HMGCS1 in CRC samples suggesting a possible tumor-promoting role of HMGCS1 in CRC progression. We verified that HMGCS1 could promote CRC cell proliferation and invasion using knock-down gene technology while inhibiting apoptosis. Our results were consistent with a new publication demonstrating that HMGCS1 could enhance cell proliferation, migration, and invasion of CRC cells [ 33 ]. The next question was how the expression of HMGCS1 was up-regulated in CRC. As bioinformatics technology develops rapidly, screening out the TFs that can bind to their potential target genes and control their transcription becomes easier. Here, we predicted that AP-1/c-Jun was one of the candidates for HMGCS1 transcription using UCSC and PROMO. ChIP assays further confirmed the prediction. The AP-1 consists of principal homodimers of the Jun family members with the Fos family members (c-Jun, Jun-B, Jun-D, c-Fos, Fos-B, Fra-1, and Fra-2) [ 34 ]. AP-1 activity is regulated by its dimer composition, determined by the differential expression of Jun and Fos families through the sequence of AP-1 binding sites. AP-1 has gotten attention due to its essential role in the basic biological process and cellular feedback to stimuli that regulate apoptosis, proliferation, oncogenic factor, and differentiation [ 35 ]. AP-1 controls both basal and inducible transcription of several genes containing AP-1 binding sites. AP-1 activity in the cells is regulated by a broad range of physiological and pathological stimulation along with oncogenic stimuli growth factors, cytokines, infection, and stress signals. Among all of these members, c-Jun is the fundamental component of the AP-1 complex and becomes transcriptionally active upon phosphorylation at Ser63 and Ser73 within its N-terminal transactivation domain by JNK [ 36 ]. C-Jun is frequently overexpressed in human cancers. Increased c-Jun transcriptional activity and medicated gene expression are related to ras-transformation [ 37 ]. The activity of AP-1/c-Jun was under the control of KIT signaling, as we previously demonstrated. KIT is a key member of RTKs, responsible for multiple cellular functions. More importantly, aberrant KIT has been found in many tumors. Over-expression or hyper-activated KIT signaling promotes cancer progression, including CRC. KIT elicits the tumor-promoting effect by mediating its targets via downstream pathways. In this study, we suggested that HMGCS1 was a new target of the KIT-JNK-c-Jun signaling pathway and the hyper-activated pathway was able to accelerate CRC progression. Statins, the HMGCR inhibitors, have been prescribed for the treatment of various tumors in addition to cardiovascular diseases for their cholesterol-lowering property. However, recent clinical studies showed different efficacies of low-dose or high-dose statins combined with chemotherapeutics or targeted drugs [ 38 – 41 ]. HMGCR or HMGCS1 expression was even elevated post-atorvastatin/simvastatin treatment due to a restorative feedback response [ 42 ]. We hypothesized that blocking the feedback response to statins, for instance, inhibiting KIT-c-Jun, could potentiate anticancer efficacy. We concluded that HMGCS1 was up-regulated by KIT-JNK-c-Jun signaling in CRC cells and could be a biomarker for CRC. Highly expressed HMCGS1 promoted CRC cell proliferation and invasion while inhibiting apoptosis. Our results provided evidence for the role of HMGCS1 in CRC progression and suggested that blocking KIT-JNK-c-Jun-HMGCS1 might be a new strategy for treating CRC patients. Conclusion In conclusion, our results indicated that KIT signaling could up-regulate HMGCS1 in CRC mediated by Ap-1/c-Jun. Hyper-expressed HMGCS1 promotes CRC cell proliferation and invasion while inhibiting apoptosis. Our research provided an experimental reference for developing KIT-Ap-1/c-Jun-HMGCS1 targeted therapeutics to treat CRC patients. Declarations Author Contributions Conceptualization, S.Y., and D.Z., Methodology, M.K.A., L.Y., H.S., T.S., B.W., J.M., X.L., H.C. and S.Y., Validation, S.Y. and D.Z., Formal Analysis, M.K.A., L.Y., and S.Y., Writing-Original Draft Preparation, M.K.A., Writing-Review & Editing, S.Y., and D.Z., Supervision, S.Y., and D.Z., Project Administration, S.Y. and D.Z., Funding Acquisition, T.S., B.W., S.Y., and D.Z. Funding This study was supported by the Beijing Natural Science Foundation (5222003, 5222004, 7172021, and 5202007), the National Natural Science Foundation of China (32071180 and 31801011), and the Support Project of High-level Teachers in Beijing Municipal Universities in the Period of 13th Five-year plan (IDHT20170516). Ethics Approval: The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board of the Capital Medical University Ethical Committee. Conflict of Interests: The authors declare no conflicts of interest. References Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394–424. https://doi.org/10.3322/caac.21492 Huang B, Song BL, Xu C. Cholesterol metabolism in cancer: mechanisms and therapeutic opportunities. Nat. Metab. 2020;2:132–41. https://doi.org/10.1038/s42255-020-0174-0 Jacobs RJ, Voorneveld PW, Kodach LL, Hardwick JC. Cholesterol metabolism and colorectal cancers. Curr Opin Pharmacol. 2012;12:690–5. https://doi.org/10.1016/j.coph.2012.07.010 Pandyra AA, Mullen PJ, Goard CA, Ericson E, Sharma P, Kalkat M, Yu R, Pong JT, Brown KR, Hart T, Gebbia M. Genome-wide RNAi analysis reveals that simultaneous inhibition of specific mevalonate pathway genes potentiates tumor cell death. Oncotarget. 2015;6:26909. https://doi.org/10.18632/oncotarget.4817 Clendening JW, Pandyra A, Boutros PC, El Ghamrasni S, Khosravi F, Trentin GA, Martirosyan A, Hakem A, Hakem R, Jurisica I, Penn LZ. Dysregulation of the mevalonate pathway promotes transformation. Proc Natl Acad Sci USA. 2010;107:15051–6. https://doi.org/10.1073/pnas.0910258107 Mullen PJ, Yu R, Longo J, Archer MC, Penn LZ. The interplay between cell signaling and the mevalonate pathway in cancer. Nat Rev Cancer. 2016;16:718–31. https://doi.org/10.1038/nrc.2016.76 Ashida S, Kawada C, Inoue K. Stromal regulation of prostate cancer cell growth by mevalonate pathway enzymes HMGCS1 and HMGCR. Oncol Lett. 2017;14:6533–42. https://doi.org/10.3892/ol.2017.7025 Zhao L, Fan J, Xia S, Pan Y, Liu S, Qian G, Qian Z, Kang HB, Arbiser JL, Pollack BP, Kudchadkar RR. HMG-CoA synthase 1 is a synthetic lethal partner of BRAFV600E in human cancers. J Biol Chem. 2017;292:10142–52. https://doi.org/10.1074/jbc.M117.788778 Durand S, Trillet K, Uguen A, Saint-Pierre A, Le Jossic-Corcos C, Corcos L. A cancer. transcriptome-based protein network that identifies new therapeutic targets in colorectal BMC genomics. 2017;18:1–22. https://doi.org/10.1186/s12864-017-4139-y Kaitsiotou H, Keul M, Hardick J, Mühlenberg T, Ketzer J, Ehrt C, Krüll J, Medda F, Koch O, Giordanetto F, Bauer S. Inhibitors to overcome secondary mutations in the stem cell factor receptor KIT. J Med Chem. 2017;60:8801–15. https://doi.org/10.1021/acs.jmedchem.7b00841 Cardoso HJ, Figueira MI, Socorro S. The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer. J cell commun signal. 2017;11:297–307. https://doi.org/10.1007/s12079-017-0399-1 Roberts R, Govender D. Gene of the month: KIT. J Clin Pathol. 2015;68:671–4. https://doi.org/10.1136/jclinpath-2015-203207 Shah YM, Van den Brink GR. c-Kit as a Novel Potential Therapeutic Target in Colorectal Cancer. Gastroenterology. 2015;149:534–7. https://doi.org/10.1053/j.gastro.2015.07.027 Chen EC, Karl TA, Kalisky T, Gupta SK, O'Brien CA, Longacre TA, van de Rijn M, Quake SR, Clarke MF, Rothenberg ME. KIT signaling promotes the growth of colon xenograft tumors in mice and is up-regulated in a subset of human colon cancers. Gastroenterology. 2015;149:705–17. https://doi.org/10.1053/j.gastro.2015.05.042 Fatrai S, Van Schelven SJ, Ubink I, Govaert KM, Raats D, Koster J, Verheem A, Rinkes IH, Kranenburg O. Maintenance of clonogenic KIT + human colon tumor cells requires secretion of stem cell factor by differentiated tumor cells. Gastroenterology. 2015;149:692–704. https://doi.org/10.1053/j.gastro.2015.05.003 Tan J, Yang S, Shen P, Sun H, Xiao J, Wang Y, Wu B, Ji F, Yan J, Xue H, Zhou D. c-Kit signaling promotes proliferation and invasion of colorectal mucinous adenocarcinoma in a murine model. Oncotarget. 2015;6:27037. https://doi.org/10.18632/oncotarget.4815 Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D. The human genome browser at UCSC. Genome Res. 2002;12:996–1006. https://doi.org/10.1101/gr.229102 Messeguer X, Escudero R, Farré D, Nuñez O, Martínez J, Albà MM. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics. 2002;18:333–4. https://doi.org/10.1093/bioinformatics/18.2.333 Farré D, Roset R, Huerta M, Adsuara JE, Roselló L, Albà MM, Messeguer X. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003;31:3651–3. https://doi.org/10.1093/nar/gkg605 Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, Heuer ML, Larsson E, Antipin Y. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012;:401–404. https://doi.org/10.1158/2159-8290.CD-12-0095 Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E, Cerami E. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6(269):pl1. https://doi.org/10.1126/scisignal.2004088 Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic acids Res. 2017;45(W1): W98-102. https://doi.org/10.1093/nar/gkx247 Yang S, Li W, Sun H, Wu B, Ji F, Sun T, Chang H, Shen P, Wang Y, Zhou D. Resveratrol elicits anti-colorectal cancer effect by activating miR-34c-KITLG in vitro and in vivo. BMC Cancer. 2015;15(1):1–1. https://doi.org/10.1186/s12885-015-1958-6 Li G, Yang S, Shen P, Wu B, Sun T, Sun H, Ji F, Zhou D. SCF/c-KIT signaling promotes mucus secretion of colonic goblet cells and development of mucinous colorectal adenocarcinoma. Am. J. Cancer Res. 2018;8(6):1064. PMCID: PMC6048403 Wang Y, Sun T, Sun H, Yang S, Li D, Zhou D. SCF/C-Kit/JNK/AP-1 signaling pathway promotes claudin-3 expression in colonic epithelium and colorectal carcinoma. Int J Mol Sci. 2017;18:765. https://doi.org/10.3390/ijms18040765 Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646–74. https://doi.org/10.1016/j.cell.2011.02.013 Murai T. Cholesterol lowering: role in cancer prevention and treatment. Biol Chem. 2015;396:1–1. https://doi.org/10.1515/hsz-2014-0194 Thurnher M, Gruenbacher G, Nussbaumer O. Regulation of mevalonate metabolism in cancer and immune cells. Biochim Biophys Acta Mol Cell Biol Lipids. 2013 Jun;1831:1009–15. https://doi.org/10.1016/j.bbalip.2013.03.003 Ginestier C, Monville F, Wicinski J, Cabaud O, Cervera N, Josselin E, Finetti P, Guille A, Larderet G, Viens P, Sebti S. Mevalonate metabolism regulates Basal breast cancer stem cells and is a potential therapeutic target. Stem Cells. 2012;30:1327–37. https://doi.org/10.1002/stem.1122 Wang IH, Huang TT, Chen JL, Chu LW, Ping YH, Hsu KW, Huang KH, Fang WL, Lee HC, Chen CF, Liao CC. Mevalonate pathway enzyme HMGCS1 contributes to gastric cancer progression. Cancers. 2020;12:1088. https://doi.org/10.3390/cancers12051088 Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature. 1990;343:425–30. https://doi.org/10.1038/343425a0 Zhao L, Fan J, Xia S, Pan Y, Liu S, Qian G, Qian Z, Kang HB, Arbiser JL, Pollack BP, Kudchadkar RR. HMG-CoA synthase 1 is a synthetic lethal partner of BRAFV600E in human cancers. J Biol Chem. 2017;292:10142–52. https://doi.org/10.1074/jbc.M117.788778 Zhou S, Xu H, Tang Q, Xia H, Bi F. Dipyridamole enhances the cytotoxicities of trametinib against colon cancer cells through combined targeting of HMGCS1 and MEK pathway. Mol Cancer Ther. 2020;19:135–46. https://doi.org/10.1158/1535-7163.MCT-19-0413 Hess J, Angel P, Schorpp-Kistner M. AP-1 subunits: quarrel and harmony among siblings. J Cell Sci. 2004;117:5965–73. https://doi.org/10.1242/jcs.01589 Guo SY, Zhu XD, Ge LY, Qu S, Li L, Su F, Guo Y. RNAi-mediated knock-down of the c-jun gene sensitizes radioresistant human nasopharyngeal carcinoma cell line CNE-2R to radiation. Oncol Rep. 2015;33:1155–60. https://doi.org/10.3892/or.2014.3692 Luo A, Yu X, Li G, Ma G, Chen H, Ding F, Li Y, Liu Z. Differentiation-associated genes regulated by c-Jun and decreased in the progression of esophageal squamous cell carcinoma. PLoS One. 2014;9:e96610. https://doi.org/10.1371/journal.pone.0096610 Zhang Y, Pu X, Shi M, Chen L, Song Y, Qian L, Yuan G, Zhang H, Yu M, Hu M, Shen B. Critical role of c-Jun overexpression in liver metastasis of human breast cancer xenograft model. BMC Cancer. 2007;7:1–8. https://doi.org/10.1186/1471-2407-7-145 Lee Y, Lee KH, Lee GK, Lee SH, Lim KY, Joo J, Go YJ, Lee JS, Han JY. Randomized phase II study of afatinib plus simvastatin versus afatinib alone in previously treated patients with advanced nonadenocarcinomatous non-small cell lung cancer. Cancer Res Treat. 2017 O;49:1001. https://doi.org/10.4143/crt.2016.546 Goss GD, Jonker DJ, Laurie SA, Weberpals JI, Oza AM, Spaans JN, la Porte C, Dimitroulakos J. A phase I study of high-dose rosuvastatin with standard dose erlotinib in patients with advanced solid malignancies. J Transl Med. 2016;14:1–1. https://doi.org/10.1186/s12967-016-0836-6 Lim SH, Kim TW, Hong YS, Han SW, Lee KH, Kang HJ, Hwang IG, Lee JY, Kim HS, Kim ST, Lee J. A randomised, double-blind, placebo-controlled multi-centre phase III trial of XELIRI/FOLFIRI plus simvastatin for patients with metastatic colorectal cancer. Br J Cancer. 2015;113:1421–6. https://doi.org/10.1038/bjc.2015.371 Hong JY, Nam EM, Lee J, Park JO, Lee SC, Song SY, Choi SH, Heo JS, Park SH, Lim HY, Kang WK. Randomized double-blinded, placebo-controlled phase II trial of simvastatin and gemcitabine in advanced pancreatic cancer patients. Cancer Chemother Pharmacol. 2014;73:125–30. https://doi.org/10.1007/s00280-013-2328-1 Pandyra A, Mullen PJ, Kalkat M, Yu R, Pong JT, Li Z, Trudel S, Lang KS, Minden MD, Schimmer AD, Penn LZ. Immediate utility of two approved agents to target both the metabolic mevalonate pathway and its restorative feedback loop. Cancer Res. 2014;74:4772–82. https://doi.org/10.1158/0008-5472.CAN-14-0130 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigures.docx Cite Share Download PDF Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1508182","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":99475214,"identity":"b94fdc32-a67e-4b4c-9433-6bfc2b6debf0","order_by":0,"name":"Muhammad Khawar Abbas","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Khawar","lastName":"Abbas","suffix":""},{"id":99475215,"identity":"922787c7-6a64-4ebe-9673-157e71851957","order_by":1,"name":"Liu Yang","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Liu","middleName":"","lastName":"Yang","suffix":""},{"id":99475216,"identity":"02832905-bc1b-4617-86a9-f3ed85d3e0d7","order_by":2,"name":"Haimei Sun","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haimei","middleName":"","lastName":"Sun","suffix":""},{"id":99475217,"identity":"b486e9ba-eb41-4229-ba6c-08e432d0622d","order_by":3,"name":"Tingyi Sun","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tingyi","middleName":"","lastName":"Sun","suffix":""},{"id":99475218,"identity":"1e454177-333e-425c-8522-8dc96def64da","order_by":4,"name":"Bo Wu","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Wu","suffix":""},{"id":99475219,"identity":"b3a76966-e313-4268-b9a0-cf9c69d153c6","order_by":5,"name":"Jian Ma","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Ma","suffix":""},{"id":99475220,"identity":"f1f68cc6-6fc6-4096-8d8c-5c1279eafd0f","order_by":6,"name":"Xiaohui Liu","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaohui","middleName":"","lastName":"Liu","suffix":""},{"id":99475221,"identity":"a2ef19d2-71a9-47c3-bf51-7af3a78dead4","order_by":7,"name":"Hong Chen","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Chen","suffix":""},{"id":99475222,"identity":"42f714b0-93b6-412a-b08a-42b476194400","order_by":8,"name":"Shu Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYLACxgYGOSiTmXgtxqRrSWwgWovB8bOHX/7ccTi9v/10mgRDhXViA/vZA/i1nMlLs+Y9czh3xpncbRIMZ9ITG3jyEvBrOZBjZszYdjh3gwTvNgkgI7FBgscAv5bzb8wMf7YdTjcAa/lHjJYbOcYPeNsOJ0C0NBChRfLGGzNm3rZ0Q6BfNlskHEs3buPJwa+F73yO8cefbdby/O1nN974UGMt289+Br8WhQMMbBJwXgIQs+FVDwTyDQzMHwgpGgWjYBSMghEOAE4vRyf1eDtnAAAAAElFTkSuQmCC","orcid":"","institution":"Capital Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Shu","middleName":"","lastName":"Yang","suffix":""},{"id":99475223,"identity":"d69463fb-8205-43fd-afa8-8d7a9523da4d","order_by":9,"name":"Deshan Zhou","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Deshan","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2022-03-31 08:14:20","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.3.rs-1508182/v2","doiUrl":"https://doi.org/10.21203/rs.3.rs-1508182/v2","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":20499653,"identity":"a6d3aa67-d073-4eba-a4a9-b0137f61c7a6","added_by":"auto","created_at":"2022-04-19 13:54:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":71464,"visible":true,"origin":"","legend":"\u003cp\u003eHMGCS1 hyper-expressed in CRC tissues\u003cstrong\u003e \u003c/strong\u003e(a) qPCR results show that the HMGCS1 mRNA in CRC tissues is significantly higher than in para-tumoral mucosa. (n=30, ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). (b) Western blot results show that HMGCS1 protein is more highly expressed in CRC tissues than in para-tumoral mucosa. GAPDH is used as an internal control. (c) Analysis of TCGA data shows that HMGCS1 mRNA is significantly higher in CRC tissues than in normal tissues. (* \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/6ecc3a492b83fbb7be06a8a9.png"},{"id":20499655,"identity":"e69fb3a8-9b7a-456a-8aa0-c7da23e02e79","added_by":"auto","created_at":"2022-04-19 13:54:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":232524,"visible":true,"origin":"","legend":"\u003cp\u003eAP-1/c-Jun is a candidate for HMGCS1 transcription\u003cstrong\u003e \u003c/strong\u003e(a)\u003cstrong\u003e \u003c/strong\u003ePredicted transcription factors (TFs) that have the capability to bind to the HMGCS1 promoter using bioinformatics analysis. The maximum matrix dissimilarity is zero, with 18 output TFs. (b)\u003cstrong\u003e \u003c/strong\u003eThe predicted binding site of AP-1/c-Jun within the HMGCS1 promoter by TF network analysis and (c) ALLGEN-PROMO. The binding site (in red) is located between -1536~-1530 bp upstream of the HMGCS1 transcription start site (TSS). ATG indicates the start codon. (d) Western blot results show that c-Jun is highly expressed and activated in the form of phosphorylated-c-Jun (p-c-Jun) in CRC tissues compared with those in para-tumoral mucosa. GAPDH is used as an internal control.\u0026nbsp;\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/ffc40a2282dcb3620ce2d5e4.png"},{"id":20499659,"identity":"6d649e7a-e45c-4cf4-8d75-326627105549","added_by":"auto","created_at":"2022-04-19 13:54:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":148757,"visible":true,"origin":"","legend":"\u003cp\u003eAP-1/c-Jun accelerated HMGCS1 transcription by binding to its promoter (a) GEPIA2 analysis shows a significant positive correlation between c-Jun and HMGCS1 mRNA expressions. (N=275, R=0.16, \u003cem\u003eP=\u003c/em\u003e0.0069). (b)\u003cstrong\u003e \u003c/strong\u003eAP-1/c-Jun is activated in LS174T cells by treating TPA (1 µM, 24h). Cells are then lysed by sonication into fragments of about 500 bp, indicated by agarose gel electrophoresis. (c) ChIP-qPCR results show that compared with IgG control, activated AP-1/c-Jun strongly binds to the HMGCS1 promoter. AcH3 is set as the positive control, no antibody and no DNA are negative controls, and GAPDH is internal control. (**\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01). (d)\u003cstrong\u003e \u003c/strong\u003eAP-1/c-Jun is over-expressed in Caco-2 cells by an introduction of the plasmid. HMGCS1 is remarkably increased in AP-1/c-Jun over-expressed and hyper-activated cells detected by Western blot. GAPDH is used as an internal control.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/cbba1c309c3434807c12d84f.png"},{"id":20500403,"identity":"b1c89d30-1d39-41e3-b085-8a90011fa52b","added_by":"auto","created_at":"2022-04-19 13:59:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":523165,"visible":true,"origin":"","legend":"\u003cp\u003eKIT-c-Jun signaling pathway up-regulated HMGCS1\u003cstrong\u003e \u003c/strong\u003e(a) Western blot results show that KIT is hyper-expressed in CRC cells compared with para-tumoral mucosa. GAPDH is used as an internal control. (b)\u003cstrong\u003e \u003c/strong\u003eIHC results show that KIT is strongly expressed in CRC cells, indicated by dark brown staining in the cytoplasm of CRC cells. Representative views are zoomed-in in the lower-right frames. (c)\u003cstrong\u003e \u003c/strong\u003eKIT signaling is activated by its ligand rhSCF in HT-29 and DLD-1 CRC cells. C-Jun is activated, indicated by increased p-c-Jun. However, upon the treatment of JNK inhibitor SP600125, the activation of c-Jun is blocked. β-actin is used as an internal control. (d)\u003cstrong\u003e \u003c/strong\u003eLentivirus-mediation technology was used to over-express KIT in HCT-116 cells, and the ligand rhSCF of KIT was added concurrently. With the activation of KIT, c-Jun and p-c-Jun are increased. HMGCS1, the target of c-Jun, is significantly increased consequently. GAPDH is used as an internal control. (e) On the contrary, after the blockage of KIT signaling by Imatinib or ISCK03 in HCT-116 cells, the activation of c-Jun was inhibited, and the expression of HMGCS1 was reduced. GAPDH is used as an internal control. (f)\u003cstrong\u003e \u003c/strong\u003eCompared with WT mice, Wads\u003csup\u003em/m\u003c/sup\u003e mice who have a loss-of-function mutation in \u003cem\u003ec-kit\u003c/em\u003e had much fewer expressions of c-Jun, p-c-Jun and HMGCS1 in colonic mucosa. GAPDH is used as an internal control.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/10ed1427b6fd3a0cfd02c3b6.png"},{"id":20499654,"identity":"d469bf75-d9ca-42d8-b472-222866ee1be1","added_by":"auto","created_at":"2022-04-19 13:54:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":224306,"visible":true,"origin":"","legend":"\u003cp\u003eKnock-down of HMGCS1 reduced CRC cell proliferation and invasion (a-b).\u003cstrong\u003e \u003c/strong\u003eThree types of siRNAs predicted to bind to HMGCS1 were introduced into CRC cells individually. The knock-down efficiency was examined by qPCR and Western blot. SiHMGCS1-1 showed significant knock-down capacity and was used in future experiments. siGAPDH was used as a positive control. (*** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001). \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eCell proliferation was detected upon the knock-down of HMGCS1 in HCT-116 cells with persistently activated KIT signaling. (c) CCK8 assays show a clear increase in cell proliferation after being treated with rhSCF. However, the cell proliferation is reduced by the treatment of siHMGCS1, and the effect can be partly reversed by additional rhSCF. (d) RTCA detection suggests similar results. (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.5, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, *** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001). (E-F)\u003cstrong\u003e \u003c/strong\u003eKnock-down of HMGCS1 inhibits the cell invasion in Caco-2 and HCT-116 cells detected by RTCA. (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.5, *** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/db9bc128b810d4412940f601.png"},{"id":20500402,"identity":"e1e44231-e8d9-4c8c-a3d4-9721c25d7547","added_by":"auto","created_at":"2022-04-19 13:59:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":162716,"visible":true,"origin":"","legend":"\u003cp\u003eKnock-down of HMGCS1 increases the cell apoptosis in Caco-2 and HCT-116 cells detected by FCM. The upper panel is the representative quadrant charts differentiating dead cells (Q1), late apoptotic cells (Q2), living cells (Q3), and early apoptotic cells (Q4). The lower panel shows the analysis result of the early apoptotic cells. (*** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/756c8c9f59df5dac309bd5bf.png"},{"id":20500412,"identity":"d001fb5f-2665-4119-b09c-6048cd6f32b4","added_by":"auto","created_at":"2022-04-19 13:59:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1892557,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/ac774278-e302-487a-a112-44da0be478d0.pdf"},{"id":20500411,"identity":"064253ec-2eea-4d65-8494-3f11e498f019","added_by":"auto","created_at":"2022-04-19 13:59:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":933693,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/d1a4ac56-c489-41a6-963e-8ce46c5072d0.pdf"},{"id":20499657,"identity":"14093f0d-04b2-4724-b2d9-bee7eed7a71c","added_by":"auto","created_at":"2022-04-19 13:54:33","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":145608,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-1508182/v2/03035ecc557f2040db34db86.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"KIT-c-Jun Signaling Up-regulated HMGCS1 to Promote Colorectal Cancer Development","fulltext":[{"header":"Background","content":"\u003cp\u003eCancer is one of the leading causes of death and one of the biggest challenges to increasing life expectancy. It is also one of the costliest diseases, for more than 133\u0026nbsp;billion dollars was spent on treatment and supportive care worldwide in 2017. Colorectal cancer (CRC) ranks 2nd in morbidity and 3rd in mortality among all cancers worldwide. According to estimates from GLOBOCAN, over 1.8\u0026nbsp;million new CRC cases and 881,000 deaths are estimated to occur in 2018 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. CRC incidence and mortality are rapidly growing worldwide, especially in China. With the high-speed socio-economic development, CRC incidence and mortality in China have been above the global average, being a severe threat to people's health and a heavy burden on medical care. Proctocolectomy and adjuvant chemotherapy, radiotherapy, targeted therapy, and supportive care are currently the main treatments for CRC patients. Unfortunately, the CRC patient's overall survival has not improved significantly due to frequent relapse and metastasis, closely related to oncogenes aberrant expression and activation. Therefore, it is essential to explore the critical molecules in CRC development, which helps research and develop effective and precise targeted therapeutic drugs.\u003c/p\u003e \u003cp\u003eDespite serial breakthroughs in CRC studies, the molecular mechanism underlying the tumorigenesis and progress of CRC remains largely unknown. For the last decades, cholesterol metabolism in cancers has attracted many researchers. Cholesterol is vital for the survival and growth of mammalian cells, which is synthesized mainly through the mevalonate pathway. More than a membrane constituent, cholesterol can initiate or promote cancers by being a precursor to bile acids and steroid hormones, modulating signaling pathways involved in tumorigenesis and progression, and facilitating the formation of specialized membrane microdomains [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Cholesterol level is intensively correlated with CRC incidence [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Red meat consumption, a significant source of dietary cholesterol, is suggested as causative in CRC, possibly explaining the increasing CRC. It is well-documented that the mevalonate pathway is often dysregulated in many cancers, guiding tumor dependency on this classic metabolic pathway [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition to the altered substrates in the mevalonate pathway, 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) was the rate-limiting enzyme within the mevalonate pathway was over-expressed, contributing to the oncogenic progression and poor prognosis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Besides HMGCR, 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) plays a vital role in cholesterol biosynthesis. Also, HMGCS1 was highly expressed in prostate, melanoma, and breast cancers [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, research on the expression, regulation, and role of HMGCS1 in CRC is lacking. One study on the transcriptome network approach suggested that HMGCS1 was up-regulated in CRC samples. It could be a novel testable target to eliminate CRC cells directly or potentially through lipid-lowering drugs associated with selected anticancer drugs [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe transmembrane glycoprotein KIT (also known as c-KIT or CD117) is a member of the sub-family of receptor tyrosine kinases (RTKs), which is essential for the survival and development of various cells, including gastrointestinal pacemaker cells (interstitial cells of Cajal, ICC), mast cells, melanocytes, germ cells and erythrocytes [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] KIT is activated by binding to its ligand stem cell factor (SCF), resulting in various downstream pathways such as MAPK, SRC, JAK/STAT and PI3K/AKT that promote cell proliferation, survival and inhibit apoptosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Yet, over-expressed or over-activated KIT/SCF signaling is implicated in the onset and progression of multiple cancers, including sinonasal lymphoma, seminomas, systemic mastocytosis, melanomas, acute myeloid leukemia, and gastrointestinal stromal tumors [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The role of KIT/SCF signaling has also been evaluated in CRC. Up to 51% of CRC patients are KIT\u003csup\u003ehigh,\u003c/sup\u003e and the hyper-activated KIT/SCF signaling promotes the growth of colon xenograft tumors [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Consistently, our previous research showed that c-kit loss-of-function mutant mice (Wads\u003csup\u003em/m\u003c/sup\u003e) had much fewer and smaller colon tumors induced by AOM\u0026thinsp;+\u0026thinsp;DSS treatment than wild-type (WT) mice did. Activating KIT/SCF signaling in vitro accelerated CRC cell proliferation and invasion, reversed by RTK inhibitor Imatinib [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Therefore, we wonder whether HMGCS1 mediates the tumor-promoting effect of KIT/SCF signaling in CRC.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cp\u003e\u003cstrong\u003eBioinformatics analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe University of California, Santa Cruz (UCSC) database was used to find the sites 2000 bp upstream and 100 bp downstream of Ap-1 TSS [17]. PROMO program has projected possible TFs capable of binding to the HMGCS1 promoter [18,19]. The cBioPortal results from The Cancer Genome Atlas (TCGA) have been used to analyze HMGCS1 and AP-1 expression levels in patients with or without recurrences of CRC [20,21]. The GEPIA2 server was used to study mRNA expression and the association between the two genes in HMGCS1 and Ap-1 in CRC and normal tissues [22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture \u0026amp; treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CRC cell lines used in the experiment include HCT-116, Caco-2, RKO, LAS174T, HT-29, and HEK293T were grown in Dulbecco\u0026apos;s Modified Eagle Medium (DMEM, Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100mU/ml of Penicillin (Gibco) and 100\u0026micro;g/ml of Streptomycin (Gibco) at 37\u0026ordm;C in a Humidified incubator of 5% CO\u003csub\u003e2\u003c/sub\u003e. The medium was changed every 24hr. All cell lines were purchased from American Tissue Culture (ATCC).\u003c/p\u003e\n\u003cp\u003eReagents included 50 ng/ml recombinant human stem cell factor (rhSCF, 255-SC, R\u0026amp;D Systems, USA) added for 15 minutes, 2 \u0026micro;mol/L Imatinib (STI571, S1026, Selleck, Shanghai, China) added for 2.5 hr and 30 \u0026micro;mol/L ISCK03 (ab145066, Abcam) added for 2.5 hr.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOver-expression of AP-1 by plasmid transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAP-1 over-expression and its negative control plasmid were constructed by\u0026nbsp;GeneChem Technology Co., Ltd (Shanghai, China). We co-transfected the reporter plasmids with AP-1 overexpressing plasmid into Caco-2 cells using Lipofectamine \u003csup\u003eTM\u003c/sup\u003e 2000 (Thermo Scientific). The vector scheme is shown in Figure S1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOver-expression of KIT by lentivirus infection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLentivirus used for KIT stable over-expression was constructed by\u0026nbsp;Shanghai GeneChem Technology Co., Ltd (Shanghai, China) and transfected into CRC cells using Lipofectamine \u003csup\u003eTM\u003c/sup\u003e 2000 (Thermo Scientific).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKnock-down of HMGCS1 by siRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBoth siRNA siHMGCS1 and siNC were purchased from The RiboBio (Guangzhou, Guangdong, China). According to the manufacturer\u0026apos;s protocol, all the transfection was performed using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Inc.). Cells were cultured into a 60mm dish when the cells were in 80% to 90% confluency. Then, the complete DMEM into antibiotic and FBS-free DMEM for 24 hours. To prepare Lipofectamine reagent, take 250\u0026micro;l of Opti-MEM and 10\u0026micro;l Lipofectamine reagent per well and put them for 5 minutes at room temperature. For the preparation of siRNA solution taken, 250\u0026micro;l of Opti-MEM and 2500-5000ng siRNA per well. Then gently mix Lipofectamine reagent and DNA at room temperature for 20 minutes. After this, discarded DMEM and added Lipofectamine reagent DNA mixture into the dish. Add 1.5ml of Opti-MEM to make the volume up to 2ml per well. After 24/48 hrs., check the inflorescence intensity to evaluate transfection efficiency. If transfection was successful, then harvest cells. The vector scheme is shown in Figure S2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChromatin immunoprecipitation (ChIP)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChIP assay was performed according to the manufacturer\u0026apos;s instructions (EZ-Magna ChIP\u003csup\u003eTM\u003c/sup\u003e A Kit, #17-408, Merck-Millipore, USA). Chromatin was immunoprecipitated for 24hr at 4 ̊C using rabbit monoclonal anti-Ap1. Primers are shown in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. Primers sequences\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.097087378640776%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"69.90291262135922%\"\u003e\n \u003cp\u003e\u003cstrong\u003eqRT-PCR Primer Sequences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.097087378640776%\"\u003e\n \u003cp\u003e\u003cstrong\u003eKIT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"69.90291262135922%\"\u003e\n \u003cp\u003eForward: 5\u0026rsquo;-CAGGCAACGTTGACTATCAGT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eReverse: 5\u0026rsquo;-ATTCTCAGACTTGGGATAATC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.097087378640776%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHMGCS1 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"69.90291262135922%\"\u003e\n \u003cp\u003eForward: 5\u0026rsquo;-GCTCTTGGGATGGACGGTAT-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eReverse: 5\u0026rsquo;-GCGGTCTAATGCACTGAGGT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.097087378640776%\"\u003e\n \u003cp\u003e\u003cstrong\u003ec-Jun\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"69.90291262135922%\"\u003e\n \u003cp\u003eForward: 5\u0026rsquo;-TATGAAGTGAGTCATGGGCAA-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eReverse:\u0026nbsp;5\u0026rsquo;-TATGAAGCAGACACTGGGCAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.097087378640776%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"69.90291262135922%\"\u003e\n \u003cp\u003eForward: 5\u0026rsquo;- CCTGCACCACCAACTGCTTA -3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eReverse: 5\u0026rsquo;- AGTGATGGCATGGACTGTGG -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eChIP- qPCR primer sequences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.097087378640776%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAp1 promoter\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"69.90291262135922%\"\u003e\n \u003cp\u003eForward:5\u0026rsquo;-TATGAAGTGAGTCATGGGCAA-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eReverse: 5\u0026rsquo;-TATGAAGCAGACACTGGGCAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003c/strong\u003e\u003cstrong\u003eReal-time cellular analyzer (RTCA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRTCA (ACEA Biosciences, USA) was used to monitor cell proliferation, and invasion as previously described [23].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell apoptosis detection by flow cytometry (FCM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells were fixed with 70% ethanol in PBS and routinely kept at -20C overnight. The cells were washed with PBS and permeabilized with PBS, 4% fetal bovine serum, and 0.1% Triton X-100 for 10 min ice. Then cells were incubated within 1:200 dilutions in PBS, 4% fetal bovine serum for 2hr. Cells were washed twice with PBS-T and incubated with 1:200 dilutions of fluorescein-tagged goat anti-mouse secondary antibody. After washing with PBS-T, cells will be suspended in PBS and analyzed using a flow cytometer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA mixture of Pierce RAPI Lysate (Applygen, Beijing, China) and Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific, Inc.) was used to lyse cells at a ratio of 100:1. The protein concentration was measured using the BCA method using NanoDrop 2000c (Thermo Scientific, Gene Company Limited). The proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). The membranes were blocked with 5% bovine serum albumin (BSA) and incubated with primary antibodies against HMGCS1 (1:1000), p-c-JUN (1:1000), C-JUN (1:1000), C-KIT (1:1000), P-KIT (1:1000), and GAPDH (1:5000) for overnight at 4\u0026ordm;C. Then membranes were incubated with goat anti-rabbit secondary antibody (1:5000) for 2 hours at 37\u0026ordm;C. Super Signal West Pico Chemiluminescent substrate\u0026nbsp;(Thermo Fisher Scientific, Inc.) visualized the protein bands. ImageJ 1.50i (National Institutes of Health, Bethesda, MD, USA) was used to quantify the protein bands.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from cell lines or tissues using TRIzol (Invitrogen, Thermo Fisher Scientific, Inc.) and reverse transcribed into cDNA using the 5x All In One RT Master Mix (ABM, Canada). The expression was measured using the SYBR Green Script miRNA RT-PCR kit (Takara) with the AB1 7500 Real-time PCR system (Bio-Rad Laboratories Inc., Hercules, CA, USA). All of these steps were operated according to the manufacturer\u0026apos;s protocol. The oligonucleotide sequences of the qRT-PCR primers are listed in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell proliferation measured by CCK8 cell viability assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing the manufacturer\u0026apos;s protocol, cell proliferation was measured using the CCK8 assay Kit (Dojindo Laboratories, Japan). The cell was plated in 96-well plates and treated with drugs. After 72 hrs. Incubation of 10\u0026micro;l CCK8 was added to each well for an additional 2 hrs. Then absorbance was measured by a Multiskan FC photometer at 450nm.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec-Kit loss of functional mutant mice (Wads\u003csup\u003em/m\u003c/sup\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFive c-kit loss of functional mice (Wads\u003csup\u003em/m\u003c/sup\u003e) and %WT littermates were used on the C57BL/6 background and used in a previous study [24]. Animal studies were performed under strict protocols approved by the Animal Care and Use Committee of Capital Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTissue specimen and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eclinicopathological\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecimen of tumor and adjacent normal tissues of the colon were obtained from 30 patients who had been pathologically diagnosed with colorectal cancer and underwent surgical resection. Tissue specimens were ground then sonicated in the lysis buffer (50 mM Tris-HCL, pH 7,4, 1mM EGTA, 150 mM Nack, 5% Triton X-100) with protease inhibitors. The samples were micro centrifuged to remove the large debris and subjected to western analysis. All patient-derived specimens were collected from Beijing Friendship Hospital, Capital Medical University Beijing, and archived under complete protocols approved by the Research Board of Capital Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe student\u0026apos;s t-test (two-tailed) was performed for comparisons between groups in cell proliferation assay and gene expression analysis by GraphPad Prism 5. Significance was presented as a p-value \u0026lt;0.005 (*), \u0026lt;0.01 (**) and \u0026lt;0.001 (***), non-significant differences were presented as NS.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eHMGCS1 was hyper-expressed in CRC tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHMGCS1 expression was detected by qPCR and Western blot in the 30 pairs of CRC tissues and corresponding para-tumoral mucosa. The results showed that HMGCS1 was overexpressed in tumors compared with that in para-tumoral normal mucosa (Fig. 1a and b), which was consistent with the analysis on the TCGA database (Fig. 1c). These results suggested a potential role of aberrant HMGCS1 in CRC development.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAP-1/c-Jun was a candidate for HMGCS1 transcription\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein expression is controlled by a distinct regulatory network, among which transcriptional regulation is one of the fundamental and general mechanisms. Predicted transcription factors (TFs) that can bind to the HMGCS1 promoter using bioinformatics analysis. The maximum matrix dissimilarity is zero, with 18 output TFs (Fig. 2a). In this study, we had a particular interest in the transcription factor (TF) AP-1/c-Jun due to the reasons: ① AP-1/c-Jun was able to bind to the HMGCS1 promoter indicated by UCSC, and ALLGEN-PROMO bioinformatics (Fig. 2b and c). ② AP-1/c-Jun was highly expressed and activated in CRC compared with para-tumoral mucosa (Fig. 2d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAP-1/c-Jun accelerated HMGCS1 transcription by binding to its promoter\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm the regulatory role of AP-1/c-Jun on HMGCS1 transcription, we analyzed the mRNA (FPKM value) level of AP-1/c-Jun and HMGCS1 in 275 CRC patients from the TCGA database, which revealed a significant positive correlation between them (Fig. 3a). We performed ChIP to determine whether the AP-1/c-Jun can bind to the predicted site within the HMGCS1 promoter. After activating AP-1/c-Jun by 12-O-Tetradecanoylphorbol 13-acetate (TPA), a PKC activator can also activate AP-1, the binding of Ap-1/c-Jun to the HMGCS1 promoter was significantly increased compared with the IgG group (Fig. 3b and c). Moreover, we evaluated the effect of Ap-1/c-Jun in HMGCS1 expression. Ap-1/c-Jun was over-expressed in Caco-2 cells, which in addition to that, had significantly up-regulated HMGCS1 (Fig. 3d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKIT-c-Jun signaling pathway up-regulated HMGCS1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe previously reported that KIT was highly-expressed in CRC (Fig. 4a and b), and AP-1/c-Jun was regulated by KIT signaling via the JNK pathway in CRC cells (Fig. 4c) [25]. To determine the effect of KIT signaling on HMGCS1 expression, KIT signaling was over-activated by lentivirus mediation or blocked by its inhibitor Imatinib, an RTK inhibitor, or ISCK03, a specific KIT/SCF signaling inhibitor, in HCT-116 cells. Figures 4d and 2 show that KIT over-activated cells had highly activated AP-1/c-Jun and HMGCS1. While the activity of AP-1/c-Jun was inhibited, the expression of HMGCS1 was reduced in cells treated with either Imatinib or ISCK03. In addition, we compared expressions of AP-1/c-Jun and HMGCS1 in the c-kit loss-of-function mutant Wads\u003csup\u003em/m\u003c/sup\u003e mice and WT littermates in vivo. The results showed that along with the reduced KIT activity, the expression of AP-1/c-Jun and HMGCS1 significantly decreased (Fig. 4f). These results confirmed that in CRC cells, the hyper-activated KIT signaling elevated HMGCS1 expression via activating AP-1/c-Jun.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKnock-down of HMGCS1 reduced CRC cell proliferation and invasion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFinally, we evaluated the role of HMGCS1 in the biological functions of CRC cells. HMGCS1 was knocked down by introducing its specific siRNA (Fig. 5a and b). The cell proliferation was significantly inhibited in CRC cells as measured by CCK8 assays and a real-time cellular analyzer (RTCA) (Fig. 5c and 5). Likewise, the invasiveness hindered HMGCS1 knocked-down cells (Fig. 5e and 5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKnock-down of HMGCS1 increased apoptosis of CRC cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CRC cell apoptosis was detected by flow cytometry. The knock-down of HMGCS1 resulted in a marked increase in cell apoptosis (Fig. 6).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we, for the first time, reveal that the KIT-JNK-c-Jun signaling pathway up-regulates the HMGCS1 in CRC cells, which promotes CRC progression.\u003c/p\u003e \u003cp\u003eReprogramming of various metabolic pathways has been implicated in the multistep development of tumors. The first discovered metabolic reprogramming is the shift from catabolic to anabolic metabolism, known as the Warburg effect, which is considered a classic hallmark of cancer cells [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. As early as a century ago, cholesterol accumulated in malignant tissues [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], spotlighting the cholesterol metabolic reprogramming in cancer biology. Reprogrammed cholesterol metabolism is also recognized as a hallmark feature in cancer cells. Many cancer cells exhibit dysregulation of the mevalonate pathway, the fundamental way for cholesterol biosynthesis [\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. A clear association between CRC and cholesterol accumulation prompted researchers to investigate the mevalonate pathway genes. For example, increased HMGCR, the rate-limiting enzyme in the mevalonate pathway, was frequently found in various cancer, including CRC [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This study focused on HMGCS1, the immediately upstream enzyme of HMGCR in the mevalonate pathway, condensing acetyl-CoA and acetoacetyl-CoA to HMG-CoA [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The Association of HMGCS1 with other cancers has been described [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]; neither the role nor the regulation of HMGCS1 has not been wholly illuminated in CRC. Like HMGCR, there was a significant increase of HMGCS1 in CRC samples suggesting a possible tumor-promoting role of HMGCS1 in CRC progression. We verified that HMGCS1 could promote CRC cell proliferation and invasion using knock-down gene technology while inhibiting apoptosis. Our results were consistent with a new publication demonstrating that HMGCS1 could enhance cell proliferation, migration, and invasion of CRC cells [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe next question was how the expression of HMGCS1 was up-regulated in CRC. As bioinformatics technology develops rapidly, screening out the TFs that can bind to their potential target genes and control their transcription becomes easier. Here, we predicted that AP-1/c-Jun was one of the candidates for HMGCS1 transcription using UCSC and PROMO. ChIP assays further confirmed the prediction. The AP-1 consists of principal homodimers of the Jun family members with the Fos family members (c-Jun, Jun-B, Jun-D, c-Fos, Fos-B, Fra-1, and Fra-2) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. AP-1 activity is regulated by its dimer composition, determined by the differential expression of Jun and Fos families through the sequence of AP-1 binding sites. AP-1 has gotten attention due to its essential role in the basic biological process and cellular feedback to stimuli that regulate apoptosis, proliferation, oncogenic factor, and differentiation [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. AP-1 controls both basal and inducible transcription of several genes containing AP-1 binding sites. AP-1 activity in the cells is regulated by a broad range of physiological and pathological stimulation along with oncogenic stimuli growth factors, cytokines, infection, and stress signals. Among all of these members, c-Jun is the fundamental component of the AP-1 complex and becomes transcriptionally active upon phosphorylation at Ser63 and Ser73 within its N-terminal transactivation domain by JNK [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. C-Jun is frequently overexpressed in human cancers. Increased c-Jun transcriptional activity and medicated gene expression are related to ras-transformation [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe activity of AP-1/c-Jun was under the control of KIT signaling, as we previously demonstrated. KIT is a key member of RTKs, responsible for multiple cellular functions. More importantly, aberrant KIT has been found in many tumors. Over-expression or hyper-activated KIT signaling promotes cancer progression, including CRC. KIT elicits the tumor-promoting effect by mediating its targets via downstream pathways. In this study, we suggested that HMGCS1 was a new target of the KIT-JNK-c-Jun signaling pathway and the hyper-activated pathway was able to accelerate CRC progression.\u003c/p\u003e \u003cp\u003eStatins, the HMGCR inhibitors, have been prescribed for the treatment of various tumors in addition to cardiovascular diseases for their cholesterol-lowering property. However, recent clinical studies showed different efficacies of low-dose or high-dose statins combined with chemotherapeutics or targeted drugs [\u003cspan additionalcitationids=\"CR39 CR40\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. HMGCR or HMGCS1 expression was even elevated post-atorvastatin/simvastatin treatment due to a restorative feedback response [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. We hypothesized that blocking the feedback response to statins, for instance, inhibiting KIT-c-Jun, could potentiate anticancer efficacy.\u003c/p\u003e \u003cp\u003eWe concluded that HMGCS1 was up-regulated by KIT-JNK-c-Jun signaling in CRC cells and could be a biomarker for CRC. Highly expressed HMCGS1 promoted CRC cell proliferation and invasion while inhibiting apoptosis. Our results provided evidence for the role of HMGCS1 in CRC progression and suggested that blocking KIT-JNK-c-Jun-HMGCS1 might be a new strategy for treating CRC patients.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our results indicated that KIT signaling could up-regulate HMGCS1 in CRC mediated by Ap-1/c-Jun. Hyper-expressed HMGCS1 promotes CRC cell proliferation and invasion while inhibiting apoptosis. Our research provided an experimental reference for developing KIT-Ap-1/c-Jun-HMGCS1 targeted therapeutics to treat CRC patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, S.Y., and D.Z., Methodology, M.K.A., L.Y., H.S., T.S., B.W., J.M., X.L., H.C. and S.Y., Validation, S.Y. and D.Z., Formal Analysis, M.K.A., L.Y., and S.Y., Writing-Original Draft Preparation, M.K.A., Writing-Review \u0026amp; Editing, S.Y., and D.Z., Supervision, S.Y., and D.Z., Project Administration, S.Y. and D.Z., Funding Acquisition, T.S., B.W., S.Y., and D.Z.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Beijing Natural Science Foundation (5222003, 5222004, 7172021, and 5202007), the National Natural Science Foundation of China (32071180 and 31801011),\u0026nbsp;and the Support Project of High-level Teachers in Beijing Municipal Universities in the Period of 13th Five-year plan (IDHT20170516).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board of the Capital Medical University Ethical Committee.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interests:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394\u0026ndash;424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3322/caac.21492\u003c/span\u003e\u003cspan address=\"10.3322/caac.21492\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang B, Song BL, Xu C. Cholesterol metabolism in cancer: mechanisms and therapeutic opportunities. Nat. Metab. 2020;2:132\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s42255-020-0174-0\u003c/span\u003e\u003cspan address=\"10.1038/s42255-020-0174-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacobs RJ, Voorneveld PW, Kodach LL, Hardwick JC. Cholesterol metabolism and colorectal cancers. Curr Opin Pharmacol. 2012;12:690\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.coph.2012.07.010\u003c/span\u003e\u003cspan address=\"10.1016/j.coph.2012.07.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandyra AA, Mullen PJ, Goard CA, Ericson E, Sharma P, Kalkat M, Yu R, Pong JT, Brown KR, Hart T, Gebbia M. Genome-wide RNAi analysis reveals that simultaneous inhibition of specific mevalonate pathway genes potentiates tumor cell death. Oncotarget. 2015;6:26909. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/oncotarget.4817\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.4817\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClendening JW, Pandyra A, Boutros PC, El Ghamrasni S, Khosravi F, Trentin GA, Martirosyan A, Hakem A, Hakem R, Jurisica I, Penn LZ. Dysregulation of the mevalonate pathway promotes transformation. Proc Natl Acad Sci USA. 2010;107:15051\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0910258107\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0910258107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMullen PJ, Yu R, Longo J, Archer MC, Penn LZ. The interplay between cell signaling and the mevalonate pathway in cancer. Nat Rev Cancer. 2016;16:718\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrc.2016.76\u003c/span\u003e\u003cspan address=\"10.1038/nrc.2016.76\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshida S, Kawada C, Inoue K. Stromal regulation of prostate cancer cell growth by mevalonate pathway enzymes HMGCS1 and HMGCR. Oncol Lett. 2017;14:6533\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ol.2017.7025\u003c/span\u003e\u003cspan address=\"10.3892/ol.2017.7025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao L, Fan J, Xia S, Pan Y, Liu S, Qian G, Qian Z, Kang HB, Arbiser JL, Pollack BP, Kudchadkar RR. HMG-CoA synthase 1 is a synthetic lethal partner of BRAFV600E in human cancers. J Biol Chem. 2017;292:10142\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M117.788778\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M117.788778\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurand S, Trillet K, Uguen A, Saint-Pierre A, Le Jossic-Corcos C, Corcos L. A cancer. transcriptome-based protein network that identifies new therapeutic targets in colorectal BMC genomics. 2017;18:1\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12864-017-4139-y\u003c/span\u003e\u003cspan address=\"10.1186/s12864-017-4139-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaitsiotou H, Keul M, Hardick J, M\u0026uuml;hlenberg T, Ketzer J, Ehrt C, Kr\u0026uuml;ll J, Medda F, Koch O, Giordanetto F, Bauer S. Inhibitors to overcome secondary mutations in the stem cell factor receptor KIT. J Med Chem. 2017;60:8801\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.jmedchem.7b00841\u003c/span\u003e\u003cspan address=\"10.1021/acs.jmedchem.7b00841\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCardoso HJ, Figueira MI, Socorro S. The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer. J cell commun signal. 2017;11:297\u0026ndash;307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12079-017-0399-1\u003c/span\u003e\u003cspan address=\"10.1007/s12079-017-0399-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts R, Govender D. Gene of the month: KIT. J Clin Pathol. 2015;68:671\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/jclinpath-2015-203207\u003c/span\u003e\u003cspan address=\"10.1136/jclinpath-2015-203207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShah YM, Van den Brink GR. c-Kit as a Novel Potential Therapeutic Target in Colorectal Cancer. Gastroenterology. 2015;149:534\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1053/j.gastro.2015.07.027\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2015.07.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen EC, Karl TA, Kalisky T, Gupta SK, O'Brien CA, Longacre TA, van de Rijn M, Quake SR, Clarke MF, Rothenberg ME. KIT signaling promotes the growth of colon xenograft tumors in mice and is up-regulated in a subset of human colon cancers. Gastroenterology. 2015;149:705\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1053/j.gastro.2015.05.042\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2015.05.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFatrai S, Van Schelven SJ, Ubink I, Govaert KM, Raats D, Koster J, Verheem A, Rinkes IH, Kranenburg O. Maintenance of clonogenic KIT + human colon tumor cells requires secretion of stem cell factor by differentiated tumor cells. Gastroenterology. 2015;149:692\u0026ndash;704.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1053/j.gastro.2015.05.003\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2015.05.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan J, Yang S, Shen P, Sun H, Xiao J, Wang Y, Wu B, Ji F, Yan J, Xue H, Zhou D. c-Kit signaling promotes proliferation and invasion of colorectal mucinous adenocarcinoma in a murine model. Oncotarget. 2015;6:27037. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/oncotarget.4815\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.4815\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D. The human genome browser at UCSC. Genome Res. 2002;12:996\u0026ndash;1006. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gr.229102\u003c/span\u003e\u003cspan address=\"10.1101/gr.229102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMesseguer X, Escudero R, Farr\u0026eacute; D, Nu\u0026ntilde;ez O, Mart\u0026iacute;nez J, Alb\u0026agrave; MM. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics. 2002;18:333\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/18.2.333\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/18.2.333\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarr\u0026eacute; D, Roset R, Huerta M, Adsuara JE, Rosell\u0026oacute; L, Alb\u0026agrave; MM, Messeguer X. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003;31:3651\u0026ndash;3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gkg605\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkg605\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, Heuer ML, Larsson E, Antipin Y. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012;:401\u0026ndash;404. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/2159-8290.CD-12-0095\u003c/span\u003e\u003cspan address=\"10.1158/2159-8290.CD-12-0095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E, Cerami E. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6(269):pl1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/scisignal.2004088\u003c/span\u003e\u003cspan address=\"10.1126/scisignal.2004088\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic acids Res. 2017;45(W1): W98-102. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gkx247\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkx247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang S, Li W, Sun H, Wu B, Ji F, Sun T, Chang H, Shen P, Wang Y, Zhou D. Resveratrol elicits anti-colorectal cancer effect by activating miR-34c-KITLG in vitro and in vivo. BMC Cancer. 2015;15(1):1\u0026ndash;1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12885-015-1958-6\u003c/span\u003e\u003cspan address=\"10.1186/s12885-015-1958-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Yang S, Shen P, Wu B, Sun T, Sun H, Ji F, Zhou D. SCF/c-KIT signaling promotes mucus secretion of colonic goblet cells and development of mucinous colorectal adenocarcinoma. Am. J. Cancer Res. 2018;8(6):1064. PMCID: PMC6048403\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Sun T, Sun H, Yang S, Li D, Zhou D. SCF/C-Kit/JNK/AP-1 signaling pathway promotes claudin-3 expression in colonic epithelium and colorectal carcinoma. Int J Mol Sci. 2017;18:765. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms18040765\u003c/span\u003e\u003cspan address=\"10.3390/ijms18040765\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2011.02.013\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2011.02.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurai T. Cholesterol lowering: role in cancer prevention and treatment. Biol Chem. 2015;396:1\u0026ndash;1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1515/hsz-2014-0194\u003c/span\u003e\u003cspan address=\"10.1515/hsz-2014-0194\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThurnher M, Gruenbacher G, Nussbaumer O. Regulation of mevalonate metabolism in cancer and immune cells. Biochim Biophys Acta Mol Cell Biol Lipids. 2013 Jun;1831:1009\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbalip.2013.03.003\u003c/span\u003e\u003cspan address=\"10.1016/j.bbalip.2013.03.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGinestier C, Monville F, Wicinski J, Cabaud O, Cervera N, Josselin E, Finetti P, Guille A, Larderet G, Viens P, Sebti S. Mevalonate metabolism regulates Basal breast cancer stem cells and is a potential therapeutic target. Stem Cells. 2012;30:1327\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/stem.1122\u003c/span\u003e\u003cspan address=\"10.1002/stem.1122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang IH, Huang TT, Chen JL, Chu LW, Ping YH, Hsu KW, Huang KH, Fang WL, Lee HC, Chen CF, Liao CC. Mevalonate pathway enzyme HMGCS1 contributes to gastric cancer progression. Cancers. 2020;12:1088. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cancers12051088\u003c/span\u003e\u003cspan address=\"10.3390/cancers12051088\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature. 1990;343:425\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/343425a0\u003c/span\u003e\u003cspan address=\"10.1038/343425a0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao L, Fan J, Xia S, Pan Y, Liu S, Qian G, Qian Z, Kang HB, Arbiser JL, Pollack BP, Kudchadkar RR. HMG-CoA synthase 1 is a synthetic lethal partner of BRAFV600E in human cancers. J Biol Chem. 2017;292:10142\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M117.788778\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M117.788778\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou S, Xu H, Tang Q, Xia H, Bi F. Dipyridamole enhances the cytotoxicities of trametinib against colon cancer cells through combined targeting of HMGCS1 and MEK pathway. Mol Cancer Ther. 2020;19:135\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1535-7163.MCT-19-0413\u003c/span\u003e\u003cspan address=\"10.1158/1535-7163.MCT-19-0413\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHess J, Angel P, Schorpp-Kistner M. AP-1 subunits: quarrel and harmony among siblings. J Cell Sci. 2004;117:5965\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.01589\u003c/span\u003e\u003cspan address=\"10.1242/jcs.01589\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo SY, Zhu XD, Ge LY, Qu S, Li L, Su F, Guo Y. RNAi-mediated knock-down of the c-jun gene sensitizes radioresistant human nasopharyngeal carcinoma cell line CNE-2R to radiation. Oncol Rep. 2015;33:1155\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/or.2014.3692\u003c/span\u003e\u003cspan address=\"10.3892/or.2014.3692\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo A, Yu X, Li G, Ma G, Chen H, Ding F, Li Y, Liu Z. Differentiation-associated genes regulated by c-Jun and decreased in the progression of esophageal squamous cell carcinoma. PLoS One. 2014;9:e96610. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0096610\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0096610\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Pu X, Shi M, Chen L, Song Y, Qian L, Yuan G, Zhang H, Yu M, Hu M, Shen B. Critical role of c-Jun overexpression in liver metastasis of human breast cancer xenograft model. BMC Cancer. 2007;7:1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2407-7-145\u003c/span\u003e\u003cspan address=\"10.1186/1471-2407-7-145\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee Y, Lee KH, Lee GK, Lee SH, Lim KY, Joo J, Go YJ, Lee JS, Han JY. Randomized phase II study of afatinib plus simvastatin versus afatinib alone in previously treated patients with advanced nonadenocarcinomatous non-small cell lung cancer. Cancer Res Treat. 2017 O;49:1001. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4143/crt.2016.546\u003c/span\u003e\u003cspan address=\"10.4143/crt.2016.546\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoss GD, Jonker DJ, Laurie SA, Weberpals JI, Oza AM, Spaans JN, la Porte C, Dimitroulakos J. A phase I study of high-dose rosuvastatin with standard dose erlotinib in patients with advanced solid malignancies. J Transl Med. 2016;14:1\u0026ndash;1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12967-016-0836-6\u003c/span\u003e\u003cspan address=\"10.1186/s12967-016-0836-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim SH, Kim TW, Hong YS, Han SW, Lee KH, Kang HJ, Hwang IG, Lee JY, Kim HS, Kim ST, Lee J. A randomised, double-blind, placebo-controlled multi-centre phase III trial of XELIRI/FOLFIRI plus simvastatin for patients with metastatic colorectal cancer. Br J Cancer. 2015;113:1421\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/bjc.2015.371\u003c/span\u003e\u003cspan address=\"10.1038/bjc.2015.371\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong JY, Nam EM, Lee J, Park JO, Lee SC, Song SY, Choi SH, Heo JS, Park SH, Lim HY, Kang WK. Randomized double-blinded, placebo-controlled phase II trial of simvastatin and gemcitabine in advanced pancreatic cancer patients. Cancer Chemother Pharmacol. 2014;73:125\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00280-013-2328-1\u003c/span\u003e\u003cspan address=\"10.1007/s00280-013-2328-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandyra A, Mullen PJ, Kalkat M, Yu R, Pong JT, Li Z, Trudel S, Lang KS, Minden MD, Schimmer AD, Penn LZ. Immediate utility of two approved agents to target both the metabolic mevalonate pathway and its restorative feedback loop. Cancer Res. 2014;74:4772\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.CAN-14-0130\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-14-0130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"HMGCS1, Ap-1/c-Jun, KIT, Colorectal Cancer, Proliferation, Invasion, Apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-1508182/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1508182/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eColorectal cancer (CRC) ranks 2nd in morbidity and 3rd in mortality among all cancers worldwide. 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) is ubiquitously expressed in humans. Remarkably, the mevalonate pathway is often dysregulated in many cancers, suggesting tumor dependency on this classic metabolic pathway. In addition to altered substrates in the mevalonate pathway, it was recently found that HMGCS1 was highly expressed in prostate, melanoma and breast cancers. The transmembrane glycoprotein KIT is critical for the survival and development of various cells through activating downstream pathways and targets. Our previous research has proved that KIT is hyper-expressed in CRC and promotes CRC progression. However, whether HMGCS1 mediates the tumor-promoting effect of KIT signaling has not been unclosed.\u003c/p\u003e\u003ch2\u003eMaterial and Methods\u003c/h2\u003e \u003cp\u003eWe investigated the regulatory mechanism of KIT signaling on HMGCS1 expression and the role of increased HMGCS1 in CRC development by the use of gene over-expression and knock-down techniques in CRC cells, biological function tests, protein-DNA binding detection, bioinformatics, database analysis and \u003cem\u003ec-kit\u003c/em\u003e loss-of-function mutant mice (Wads\u003csup\u003em/m\u003c/sup\u003e).\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eHMGCS1 was up-regulated by KIT-JNK-c-Jun signaling in CRC cells and could be a biomarker for CRC. Highly expressed HMCGS1 promoted CRC cell proliferation and invasion while inhibiting apoptosis. Our results provided evidence for the role of HMGCS1 in CRC progression and suggested that blocking KIT-JNK-c-Jun-HMGCS1 might be a new strategy for treating CRC patients.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur results indicated that KIT signaling could up-regulate HMGCS1 in CRC mediated by Ap-1/c-Jun. Hyper-expressed HMGCS1 promotes CRC cell proliferation and invasion while inhibiting apoptosis.\u003c/p\u003e","manuscriptTitle":"KIT-c-Jun Signaling Up-regulated HMGCS1 to Promote Colorectal Cancer Development","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2022-04-19 13:54:31","doi":"10.21203/rs.3.rs-1508182/v2","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2022-04-01 20:28:09","doi":"10.21203/rs.3.rs-1508182/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cbd0de9c-37ae-4512-8864-d2420d64e175","owner":[],"postedDate":"April 19th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-04-19T13:59:32+00:00","versionOfRecord":[],"versionCreatedAt":"2022-04-19 13:54:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v2","identity":"rs-1508182","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1508182","identity":"rs-1508182","version":["v2"]},"buildId":"omnImTCwR2MFx8CMYfrG7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00