Impact of rs7528684 (-169T/C) on FCRL3, FOXP3, IL-35 Gene Expression and RF correlation: Insights into Rheumatoid Arthritis Pathogenesis

Impact of rs7528684 (-169T/C) on FCRL3, FOXP3, IL-35 Gene Expression and RF correlation: Insights into Rheumatoid Arthritis Pathogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of rs7528684 (-169T/C) on FCRL3, FOXP3, IL-35 Gene Expression and RF correlation: Insights into Rheumatoid Arthritis Pathogenesis Mohamed Muzammil S, Asha Devi S This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7393465/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Fc Receptor-Like Protein 3 ( FCRL3 ) gene encodes for transmembrane receptor, that predominantly expressed on the surface of the Regulatory T cells (Tregs). The receptor owns two crucial motifs in its cytoplasmic domain, which downregulates the signal transduction of T - cell Receptor (TCR) mediated Tregs activation and proliferation. Single Nucleotide Polymorphism (SNP) in FCRL3 gene (rs7528684 -169 T/C) is hypothesised to enhance its expression, that leads to the loss of self-tolerance and dysfunction of Tregs. This, in turn, induces rapid proliferation of autoreactive T cells and other immune cells, exacerbating the progression of Rheumatoid Arthritis (RA) and other autoimmune diseases. Methods In the current study, we screened the FCRL3 SNP rs7528684 at -169 (T/C) position of the gene using High-Resolution Melting Analysis (HRMA) and confirmed the findings with Sanger sequencing technique to predict its link with RA in the Indian ethnicity. We further analysed the impact of SNP rs7528684 on FCRL3 , Fork head Box Protein 3 ( FOXP3) , and Interleukin − 35 ( IL-35 ) gene expression. Furthermore, we also evaluated the inflammatory biomarkers Rheumatoid Factor (RF) and C-Reactive Protein (CRP) in RA patients. Results It was observed that the FCRL3 SNP rs7528684 with C/C genotype significantly increased ( p < 0.0005) RA risk in the Indian ethnicity compared to T/T and C/T genotypes (Odd Ratio (OR) = 2.63; 95% Confidence Interval (C.I) = 1.78 to 3.86 and Relative Risk (RR) = 1.82). Moreover, the C allele frequency was significantly higher in the RA group (58.6%). Similarly, RA samples carrying C/C genotype exhibited significantly higher FCRL3 mRNA expression levels than controls ( p < 0.0072). Additionally, a downregulation of FOXP3 and IL-35 mRNA expression was observed in RA patients carrying C/C genotype. The results also exhibited a significant link between C/C genotype and RF-positive RA cases. Conclusion In summary, our findings suggest that the C/C genotype of FCRL3 SNP rs7528684 was strongly associated with RA in the Indian ethnicity. This genotype was characterised with positive RF, upregulated FCRL3 , and downregulated FOXP3 and IL-35 , a key anti-inflammatory cytokine. FCRL3 rs7528684 regulatory T cells NF-κB FOXP3 IL-35 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Rheumatoid Arthritis (RA) is a multi-factorial complex autoimmune disease that causes joint deformity, destruction of cartilage, bone erosions and disability [ 1 ] [ 2 ]. The prevalence of RA in worldwide is 0.4% – 2%, while in India, it is 0.7% and women are two to three times more at risk than men [ 2 ] [ 3 ] [ 4 ]. It has been acknowledged that understanding the etiology of RA is intricate due to more than one causative factors, including environment, genetics, age, sex and lifestyle etc. [ 5 ] [ 6 ] [ 7 ]. Genetic contribution to RA is almost 60%, which underlines the importance of understanding the genetic variants within genes that critically involved in RA pathogenesis [ 8 ] [ 9 ]. In past decades, association of non-HLA genes and RA have been less studied than HLA genes. Therefore, studies on non-HLA genes are in demand. [ 10 ] Fc receptor-like protein 3 ( FCRL3 ), a members of the Fc receptor-like molecules ( FCRLs ) family isoforms ( FCRL1 - 6 , FCRLA , and FCRLB) located on the chromosome 1 q21-23, which encodes for a large family of receptor proteins that share sequence homology with receptors binds to the Fc region of immunoglobulins. [ 11 ] [ 12 ] [ 13 ]. These cluster of genes are categorized based on their cytoplasmic motifs, different cell surface expressions, and based on their binding abilities towards the Fc region of Immunoglobulins [ 14 ] [ 15 ]. FCRL3 acts as an immunoregulator protein, expressed on CD4 + FOXP3 + Regulatory T cell (Tregs) surface but not on conventional CD4 + T cells. [ 16 ] [ 15 ] [ 11 ]. Its immunoregulatory activity is due to the motifs present in the cytoplasmic region of FCRL3 protein i.e. Immunoreceptor Tyrosine-Based Activation Motifs (ITAM) and Immunoreceptor Tyrosine-Based Inhibition Motifs (ITIM) [ 15 ]. These motifs downregulate the signal transduction involved in T Cell Receptor (TCR) mediated Tregs proliferation and activation. Single Nucleotide Polymorphisms (SNPs) in FCRL3 gene leads to the dysfunction and loss of self-tolerance of Tregs, which, in turn, induces abnormal proliferation of the autoreactive T cells and other immune cells that leads to the development of RA and other autoimmune diseases such as Multiple Sclerosis (MS), Systemic Lupus Erythematosus, Graves’s Disease and Pancreatitis[ 11 ] [ 17 ]. SNP rs7528684 (-169T/C) present at the promoter site of FCRL3 gene [ 18 ] [ 19 ] enhances the binding affinity of a transcriptional factor, Nuclear Factor-Kappa B (NF-κB) towards the regulatory region of the gene, which helps in rapid transcription of FCRL3. [ 20 ] Overexpression of FCRL3 disturbs the normal immune suppressive ability of Tregs by dysregulating their TCR signalling. [ 17 ] [ 16 ] [ 11 ]. Tregs are crucial orchestrators of immune tolerance, exerting maximum suppressive function to prevent autoimmunity. Their suppressive ability is critically associated with the expression of Forkhead Box Protein 3 ( FOXP3 ) gene in. FOXP3 is a transcriptional factor, uniquely expressed in Tregs and regulates the expression of genes involved in suppressive activity of Tregs such as [ 21 ] Interleukin-35 ( IL-35 ), Transforming Growth Factor-beta and Interleukin 10. These cytokines downregulate, auto-reactive T cells, B cells and other immune cell populations, maintains immune homeostasis and prevents autoimmunity [ 22 ]. Emerging evidence suggests that the FCRL3 protein, particularly when over expressed due to SNP rs7528684, could compromise Tregs suppressive capacity. This occurs, in part through the dysregulation of TCR signalling [ 23 ]. Over expressed FCRL3 protein involves in the inactivation of protein tyrosine kinases such as SYK , LCK , FYN and ZAP70 , a pivotal enzyme in the TCR signalling pathway. Activation of these kinases is indispensable for robust TCR signalling, which in turn, required for optimal FOXP3 production and to maintain Treg function, however TCR signalling induces epigenetic modifications that facilitate FOXP3 production [ 24 ][ 25 ] [ 26 ] [ 27 ]. Consequently, disrupted TCR signalling mediated by FCRL3 overexpression leads to downregulation of FOXP3 [ 28 ] [ 11 ] [ 29 ] [ 30 ] [ 31 ]. The impact of FOXP3 downregulation may extend to the downstream effector molecules like IL- 35 and other immune-suppressive cytokines, since their expression is mediated by FOXP3 transcription factor. IL-35 , heterodimeric cytokine, made up of P35 (also known as IL-2α ) and Epstein-Barr Virus Induced Gene 3 ( EBI3) subunits, play a significant anti-inflammatory role. [ 31 ]. IL-35 actively supresses auto-reactive T cells [ 32 ]. Therefore, dysregulated TCR signalling in Tregs because of FCRL3 SNP rs7528684 may downregulate FOXP3 and IL-35 genes, that exacerbate RA severity. Based on this mechanistic rationale, we aimed to explore the link between RA and FCRL3 SNP rs7528684 (-169T/C) in the Indian ethnicity and subsequently its impact on mRNA expression patterns of FCRL3, FOXP3 and IL-35 ( EBI3 and P35 ) genes. Concurrently, we aimed to elucidate its correlation with established RA serum biomarkers, including Rheumatoid Factor (RF) and C-Reactive Protein (CRP) concentrations in the serum of RA patients. Materials and methods Study participants and sample collection 226 RA patients and 239 healthy volunteers, ages ranging from 30–60 years from Sri Narayani Hospital and Research Centre, Vellore, Tamil Nadu were participated in the study. This study included the patients who had travelled from various parts of India for RA treatment at the hospital. The American College of Rheumatology (ACR) / European League Against Rheumatism (EULAR) criteria was followed for the sample collections. Patients with other comorbidities were excluded. The study approval was granted by the Institutional Ethical Committee (IEC/IRB No.29/08/07/2022). After getting informed consent, peripheral blood samples were collected by a phlebotomist using Ethylenediaminetetraacetic Acid (EDTA) as an anticoagulant. 5 ml of blood sample was processed for whole genomic DNA isolation using Miller’s salting-out method, a widely used non-toxic simple method for high quality DNA isolation from blood samples [ 33 ] [ 34 ]. For mRNA expression analysis, another 5ml of peripheral blood sample was collected from healthy volunteers and RA patients. From the blood samples Peripheral Blood Mononuclear Cells (PBMCs) were isolated using density gradient centrifugation. Total RNA was extracted from PBMCs using an RNAiso Plus kit (Takara, USA). The extracted DNA and RNA samples quality and quantity were assessed by Nanodrop spectrophotometer. Amplification of FCRL3 gene The extracted DNA from the blood samples were diluted at 40 ng/µl concentrations to bring a uniform quantity in all the DNA samples and used as template for FCRL3 gene amplification. All the primers were manually designed to meet specific criteria, including optimal size, GC contents, annealing temperature and self-complementary to prevent primer-dimer formation. For the amplification of 430 bp target region containing the FCRL3 SNP rs7528684 loci, the following primers were used: (NCBI accession number (AN): NG_023241) forward 5′- GCGGGGGATATAAGGGGTAAG-3′ and reverse 5′- CCTTGTCTTCACACAGCCT-3′. Each Polymerase chain reactions (PCR) comprised, 3µl of template DNA (~ 50ng/µl), 0.5µl of each (forward and reverse) primers, 0.1µl of PrimeSTAR HS DNA Polymerase and nuclease-free water was added to bring the reaction mixture to10 µl. Table.1A shows the PCR conditions used for the amplification of SNP rs7528684 target region (430bp). Further, the amplicons length was confirmed by the gel electrophoresis. Genotyping SNP rs7528684 High-Resolution Melting Analysis (HRMA), a robust post PCR genotyping technique for SNP screening, which utilizes saturating fluorescent dye. This dye intercalates into double-stranded DNA (dsDNA) throughout the amplification process. As temperature rises gradually, the dsDNA denatures into single-stranded DNA (ssDNA), this unwinding process releases the intercalated dye, resulting in a distinct reduction in fluorescence, which is precisely monitored by the system to generate a high-resolution melting curve based on characteristic of the DNA sequence. This technique precisely detects even subtle differences in the melting curve behaviour and does not require any labelled probe like in other traditional methods. For HRMA, PCR amplicons (diluted 1:20) of the 430 bp containing target SNP rs7528684 region were used as template. Genotyping of rs7528684 by HRMA was performed on a Bio-Rad real-time PCR (qPCR) instrument. Each reaction comprised 2 µl of DNA template, 5 µl of Qiagen Eva green master mix, 1µl of each internal primers (forward 5′- GATCTGGGTGAGATTACGGG − 3′ and reverse 5′- CACAGTCAAGGTGTCAAGC − 3′) that targets the region of 119 bp of FCRL3 DNA containing SNP rs7528684 loci and nuclease free water to make up the final volume of 10 µl. The qPCR conditions are detailed in Table 1 B. To ensure the accuracy, all the samples were analysed in duplicates and the resulting melt curves were interpreted using Bio-Rad Precision Melt Analysis™ program. Samples with variations in the melt curve were indeed validated by Sanger sequencing to confirm the presence of the specific SNP within the DNA locus [ 35 ]. Table 1 PCR and qPCR conditions for FCRL3 DNA amplification and genotyping A. PCR conditions to amplify FCRL3 gene Initial Denaturation Denaturation Annealing Extension Final Extension No. of Cycles Temperature (Tm) 98°C 98°C 60°C 72°C 72°C 40 Duration (mins/sec) 1 min 10sec 5sec 25sec 5 min B. qPCR conditions for HRMA Initial Denaturation Denaturation Annealing Melting curve (1sec Tm intervals) No. of Cycles Temperature (Tm) 95°C 95°C 58°C 75°C to 85°C 45 Duration (mins/sec) 5 min 15 sec 40 sec 5 sec C. qPCR conditions to quantify gene expression Initial Denaturation Denaturation Annealing Melting curve (1sec Tm intervals) No. of Cycles Temperature (Tm) 95°C 95°C 60°C 65°C to 85°C 39 Duration (mins/sec) 30sec 10sec 30sec 5 sec FCRL3, FOXP3 and IL-35 gene expression study The mRNA extracted from PBMCs was converted into complementary DNA (cDNA) using an RT reagent (PrimeScript™ Takara, USA), following manufacture’s protocol. The reaction conditions followed for cDNA synthesis includes 15 mins at 37°C for primers annealing and cDNA synthesis, 5 sec at 85°C for enzyme deactivation. FCRL3 , FOXP3 and IL-35 ( EBI3 and P35 ) gene expression levels were analysed from the cDNA by qPCR using SYBR Green kit. Each reaction comprised of 0.7 µl of cDNA (~ 1000 ng/µl), 1µl of each primers, 5 µl of SYBR Green master mix and nuclease free water was added to bring the reaction mixture to 10 µl. The qPCR conditions for mRNA expression studies are detailed in Table 1 (C). Simultaneously, a stable housekeeping gene, Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) mRNA expression levels were used as a reference to normalize the target gene expression, GAPDH expresses in numerous metabolically active cells, including PBMCs under various physiological conditions which ensures its consistent, hence utilized as a control gene [ 36 ] [ 37 ]. Following primers were used for mRNA analyses, FCRL3 (NCBI cDNA AN: BC028933), forward 5′- CCCCAAAAGCTGTACTTCTC-3′ and reverse 5′-GCTAGGGAATGTGATATGCTG- 3′, FOXP3 (AN: NP_054728), forward 5′-GAGAAGGAGAAGCTGAGTG-3′ and reverse 5′-GGAGCCCTTGTCGGATGAT- 3′, EBI3 (AN: NP_005746), forward: 5′-GCAGCTTCGTGCCTTTCATA-3′ and reverse 5′-CTACTTGCCCAGGCTCATTGT-3′, P35 (AN: NP_000873), forward 5′-CTGGACCACCTCAGTTTGGC-3′ and reverse 5′-GGTGAAGGCATGGGAACATTC-3′ and GAPDH (AN: NP_001276674), forward: 5′-ATCGTGGAAGGACTCATGAC-3′ and reverse: 5′-GCAGGGATGATGTTCTGGA-3′. Measurements of RF and CRP levels in RA serum Serum samples were obtained from 226 RA patients by centrifugation of blood samples at 3000 rpm for 10 mins. RF of the IgG isotype (RF-IgG) levels were measured in the serum samples using a commercially available Human rheumatoid factor antibody ELISA Kit from Cusabio, China. The assay was performed as per manufacturer’s protocol and the RF value of < 20 IU/L was considered as negative, and ≥ 20 IU/L as positive. Serum CRP levels were quantified using high sensitivity CRP Kit from Cusabio, China, and value ≤ 1.0 mg/L was defined as normal CRP level. The RF and CRP values were interpreted based on the ACR/EULAR criteria [ 38 ] Statistical Analysis Allele and genotypes frequencies of FCRL3 SNP rs7528684 in both controls and RA patients were calculated within the Indian ethnicity. The association of the variants with RA risk were assessed by calculating Odd Ratio (OR), 95% Confidence Interval (CI) and Relative Risk (RR) for all three (TT, CT, CC) genotypes by MedCalc software (version 23.0.2) and P - value < 0.05 was considered as significant based on Hardy–Weinberg equilibrium. Statistical tools, Unpaired Student’s t-tests and One-way Analysis of Variance (ANOVA) were used to calculate statistical differences in mRNA expressions in all the target genes. Data representation and graphs were plotted using GraphPad Software (GraphPad Prism version 10), and the data was presented as mean ± SEM. P - value < 0.05 was considered as significant. The RF and CRP levels were first categorized into clinically relevant positive (+ ve) and negative (-ve) groups. Their association with SNP rs7528684 genotypes was determined by calculating the OR and 95% CI and P - value < 0.05 was taken as significant. Results SNP Genotyping SNP rs7528684 (-169T/C), located within the regulatory region of the FCRL3 gene was screened in 239 healthy controls and 226 RA patient samples. As an initial step, FCRL3 SNP containing region was amplified from the isolated DNA in both RA and control samples. Figure 1 A illustrates the PCR product of the FCRL3 SNP rs7528684 target region (430 bp). Further, the amplicons were analysed in HRMA for genotyping. HRMA results revealed three distinct clusters in normalized melting curve (Fig. 1 B) and difference melting curve (Fig. 1 C), indicating the presence of T/T, C/T, and C/C genotype in SNP rs7528684 base pair window. Subsequently Sanger sequencing was performed to the samples with deviated curves to confirm the presence of different genotypes. Sanger sequencing results revealed the presence of wild (T/T) and variant (C/C & C/T) genotypes in the rs7528684 loci of FCRL3 gene (Fig. 2 A, B and C). Table 2 shows the genotype frequencies of SNP rs7528684 in controls and RA patients, C/C genotype was significantly higher in RA patients compared to controls. The genotype frequencies in controls were T/T = 41%, C/T = 31.8%, and C/C = 27.2%, while in RA patients, T/T = 33.3%, C/T = 18.1% and C/C = 49.5%. Significantly higher OR was observed for the C/C genotype (CC vs CT + TT = 2.63, CI = 1.78 to 3.86) in RA patients than the controls ( P < 0.0001) (Table 2). Table 2. Genotypes of FCRL3 SNP rs7528684 - Odds ratio and Relative risk Genotypes (rs7528684) Odds ratio 95% C. I z-statistics p-value Relative risk 95% C. I p-value TT vs CT + CC 0.68 0.46 to 1.00 1.94 0.0522 0.78 0.61 to 1.00 0.0537 CT vs CC + TT 0.47 0.30 to 0.73 3.35 0.0008 0.57 0.40 to 0.79 0.0010 CC vs CT + TT 2.63 1.78 to 3.86 4.90 0.0001 1.82 1.42 to 2.32 0.0005 Similarly, the RR was also higher for the variant C/C genotype (RR = 1.82, CI = 1.42 to 2.32) in the RA samples compared to controls ( P < 0.0005). The genotype frequencies in the controls are consistent with the Hardy-Weinberg equilibrium. Thus, a significant association was found between FCRL3 SNP rs7528684 (-169C) and RA among the Indian ethnicity. As shown in Table 3, 58.6% of RA patients carried the C allele (43.1% in controls), and remaining 41.4% carried the T allele (56.9% in controls) in rs7528684 loci on the FCRL3 gene. Table 3. FCRL3 SNP rs7528684 genotype and allele frequencies SNP rs7528684 f(TT) f(CT) f(CC) f(T) f(C) Control sample (n = 239) 41.0 31.8 27.2 56.9 43.1 RA patient sample (n = 226) 33.3 18.1 49.5 41.4 58.6 FCRL3 expression levels To study the link between FCRL3 SNP rs7528684 and RA pathogenesis, mRNA expression levels of the FCRL3 gene in controls and RA patients were quantified and the comparison was carried out within different genotypes of SNP rs7528684. To quantify the expression levels, mRNA expression fold changes were calculated using qPCR data, and a P -value < 0.05 was considered as significant. As depicted in Fig. 3 A, FCRL3 mRNA expression levels were significantly higher (4.7 ± 0.74) in RA samples compared to controls (1.9 ± 0.6, t = 2.803, ** p < 0.0072). Figure 3 B indicates the FCRL3 mRNA expression levels within different genotypes of SNP rs7528684. In RA samples, the FCRL3 expression level found to be higher in the C/C genotype (5.3 ± 0.8) than T/T genotype (1.2 ± 0.1, ** P < 0.0002), as well as C/C genotype of controls (3.1 ± 1.06, ** P < 0.0324). This result clearly indicates the higher expression of the FCRL3 gene in RA patients carrying C/C genotype in FCRL3 SNP rs7528684. FOXP3 mRNA expression levels The impact of FCRL3 overexpression on Tregs due to SNP rs7528684 (-169C) was analysed through FOXP3 gene expression pattern in RA patients, since FOXP3 is uniquely expressed by Tregs. FOXP3 , a transcription factor regulates the immune-suppressive cytokines produced by Tregs during normal immune homeostasis. Additionally, to correlate the negative impact of high FCRL3 protein on Tregs suppressive function, we measured the mRNA expression levels of the FOXP3 gene in RA and control samples. From the qPCR result it was observed that the levels of FOXP3 mRNA expression was significantly reduced in RA samples (0.1 ± 0.03) in comparison with controls (1.4 ± 0.4, t = 3.100, ** P < 0.0056) (Fig. 3 C). Similarly, when FOXP3 mRNA expression levels were compared within genotypes of SNP rs7528684, the C/C genotype in RA patients showed a significantly decreased expression levels (0.03 ± 0.005) than wild (T/T) genotypes (2.1 ± 0.7, ** P 0.8311) (Fig. 3 D). IL-35 (EBI3 & P35) mRNA expression levels An insufficiency of immune-suppressive cytokines is the recognised characteristics of RA. Recent studies have consistently reported the abnormal expression of immune-suppressive cytokines are linked with most of the autoimmune disorders, including RA, which leads to the persistent inflammation and tissue damage. IL-35 is one such vital immune-suppressive cytokines consisting of EBI3 and P35 subunits that help in decreasing autoreactive immune cells to prevent autoimmunity. To analyse the impact of SNP rs7528684 on suppressive cytokines, EBI3 and P35 mRNA expression levels were evaluated. As indicated in Fig. 4 A, a significant decrease in the EBI3 gene mRNA expression levels in RA patients (0.1 ± 0.06) were observed over controls (1.1 ± 0.2, t = 4.042 ** p < 0.0012). The EBI3 mRNA expression levels were compared within rs7528684 genotypes, RA patients carrying C/C genotype exhibited a significantly decreased EBI3 mRNA levels (0.07 ± 0.001) compared to T/T (1.5 ± 0.2) ( **P < 0.0047) and C/C genotype (0.7 ± 0.05) ( **P < 0.0337) of controls (Fig. 4 B). Similarly, the P35 mRNA expression levels were also decreased in RA patients (0.2 ± 0.08) compared to the controls (1.0 ± 0.03, t = 8.545 **P < 0.0001) (Fig. 4 C). While comparing within rs7528684 genotypes for P35 expression levels, RA patients carrying C/C genotype showed a significantly decreased in P35 expression levels ( 0.07 ± 0.05) compared to T/T genotype (0.9 ± 0.05) ( ** p < 0.0192) and C/C genotype (0.9 ± 0.01) ( **P < 0.045) of control samples. However, we observed no significant difference in P35 expression between C/C and T/T genotypes in controls (Fig. 4 D). RF and CRP levels in RA patient serum sample RF and CRP are well-established serum biomarkers for RA diagnosis. Both the biomarkers are highly associated with inflammatory conditions, and their link with auto-reactive immune cells has been documented in previous studies [ 39 ].We explored the impact of FCRL3 SNP rs7528684 genotypes on RF and CRP levels in RA serum samples and the results revealed that higher number of RF-positive cases were significantly associated with C/C genotype of SNP rs7528684 (OR = 2.21, 95% CI = 1.09 to 4.82 with p value, 0.0445) compared to other genotypes, CT and TT as detailed in Table 4 , but no significant link was observed between CRP and SNP rs7528684 genotypes. Table 4 FCRL3 SNP rs7528684 genotype frequencies in RA patients, stratified by RF and CRP status Inflammatory markers Genotypes of SNP rs7528684 Genotype TT vs CT + CC Genotype CT vs TT + CC Genotype CC vs CT + TT TT CT CC OR (95%CI) p value OR (95%CI) p value OR (95%CI) p value RF + ve (n = 189) 58 (79.4%) 34 (82.9%) 102 (91.1%) 0.51 (0.24 to 1.08) 1.0804 0.78 (0.31 to 1.96) 0.6115 2.21 (1.01 to 4.82) 0.0445 RF -ve (n = 37) 15 (20.6%) 7 (17.1%) 11 (9.9%) CRP + ve (n = 190) 61 (83.6%) 32 (78.1%) 97 (86.6%) 0.94 (0.44 to 2.01) 0.8851 0.60 (0.26 to 1.41) 0.2476 1.46 (0.71 to 3.00) 0.3035 CRP -ve (n = 36) 12 (16.4%) 9 (21.9%) 15 (13.4%) Discussion RA is a chronic autoimmune condition characterized by pain in joints, swelling, inflammation and degradation of cartilage and destruction of synovial joints, which results in permanent disability. Most autoimmune diseases are associated with proteins synthesized from immunoregulatory genes that modulates T-cell activity. FCRL3 is one such immunoregulatory gene, encodes for a transmembrane receptor, expressed on the surface of regulatory T cells to inhibit its proliferation. FCRL3 receptor has two crucial domains in the cytoplasmic region, namely ITAM and ITIM, which play an essential role in the regulation of Tregs [ 17 ]. The ITIM domain recruits the binding of SHP-1 and SHP-2 protein tyrosine phosphatase (a negative regulator of downstream signalling) [ 40 ], which dephosphorylate intracellular protein kinases Fyn , Lck, SYK and Zap70 molecules. These protein kinases rapidly gets activated upon TCR engagement with self-antigen, which are continuously displayed by major histocompatibility complex molecules on antigen-presenting cells to initiate positive signalling cascades for immune suppressive cytokine secretion and to maintain normal immune homeostasis by Tregs [ 27 ] [ 41 ] [ 42 ] [ 26 ]. Thus, the FCRL3 cytoplasmic ITIM domain regulates downstream TCR signal transduction involved in Tregs expansion and activation. However, polymorphism in the FCRL3 gene induces dysfunction of Tregs cells, which leads to rapid autoreactive T cell proliferation, that causes autoimmune diseases. The link between FCRL3 gene polymorphism and RA susceptibility has been significantly progressed in many population studies [ 11 ] [ 43 ] [ 44 ]. In this study, we investigated the association of FCRL3 SNP rs7528684 (-169 C/T) with RA in the Indian ethnicity. The study confirms that FCRL3 SNP rs7528684 (-169C) was closely associated with RA in the Indian ethnicity. Statistical analysis (OR and RR) also suggests that the C/C genotype in rs7528684 locus increases the risk of RA compared to T/T and T/C genotypes. Similarly, the C allele frequency of rs7528684 was higher in RA patients than in controls (58.6% vs. 43.1%) (Table 3). Similar results were reported in other population, including Dutch, Japan, and Taiwan. Studies in the Dutch and Japanese ethnic groups reveals that the C/C genotype of FCRL3 SNP rs7528684 was associated with RA and other autoimmune diseases [ 43 ] [ 45 ] [ 46 ]. In the Taiwan ethnicity, C/C genotype frequency was high in destructive RA [ 47 ], while in the Iran ethnicity, the C allele was associated with Hashimoto’s thyroiditis [ 48 ] and Behcet’s Disease [ 44 ]. However, in Spain population, the C allele was found to be a protective allele against MS [ 49 ]. We further investigated the impact of SNP rs7528684 -169 C on FCRL3 gene expression in both controls and RA patients. For this, mRNA was isolated from PBMCs of controls and RA patients, and reverse transcribed into cDNA and the expression levels were quantified by qPCR. The result showed significantly higher FCRL3 mRNA expression levels in RA patients than controls. In the same way, a comparison within genotypes (C/C vs T/T) revealed significantly higher mRNA expression in RA patients with C/C genotype than wild genotype (T/T) in controls. The promoter region of a gene has an essential role in prompting the binding of transcription factors that affects target gene expression. The SNP, rs7528684 -169 T > C in the FCRL3 promotor region (-169 away from the transcription initiation site) particularly the C/C genotype, induces the stronger binding affinity of NF-κb family transcriptional factors and enhances the FCRL3 expression on the surface of Tregs [ 25 ] [ 17 ] [ 28 ]. Thus, elevated FCRL3 expression disturbs the mmune suppressive role of Tregs via its cytoplasmic motif (ITIM) and causes autoimmune diseases, including RA. Finally, to analyze whether the over-expression of FCRL3 on Tregs influences its suppressive cytokines levels in RA patients via FOXP3 transcriptional factor, we measured the FOXP3 expression levels in controls and RA patients. The results showed a significantly low mRNA expression of FOXP3 in RA patients compared to controls. Similarly, comparison within SNP rs7528684 genotypes showed significantly lower FOXP3 levels in the RA patients carrying C/C genotype. Upon TCR engagement, LCK, SYK, FYN and ZAP70 , a SRC family kinases involve in the initial TCR signal activation that triggers a downstream signalling cascade [ 27 ] [ 50 ], which activates phospholipase C (PLC γ). PLC γ hydrolyses phosphatidylinositol-3,4-bisphosphate to produce secondary messengers, diacylglycerol and Inositol-1,4,5-triphosphate (IP3). IP3 binds to IP3 receptor on the endoplasmic reticulum to release of intracellular calcium (Ca 2+ ) into cytosol of Tregs. Ca 2+ helps in binding of calmodulin (CaM) to calcineurin phosphatase [ 51 ]. Activated calcineurin phosphatase dephosphorylates Nuclear Factor of Activated T cells (NFAT), and translocate NFAT into the nucleus, where it directly binds to the promotor region of FOXP3 and initiates its transcription in Tregs [ 52 ] [ 32 ].Thus, dysfunction of Tregs due to SNPs in FCRL3 may directly decline FOXP3 expression. The stability and expression of FOXP3 depends on multiple factors which includes FCRL3's impact on Treg proliferation, potential signalling pathway interactions, and contributions to an inflammatory environment. Therefore, the precise mechanism involved in down regulation of FOXP3 need further investigation. Given that FOXP3 is a pivotal transcription factor, regulating the synthesis of anti-inflammatory cytokines within Tregs [ 53 ], we further measured the expression levels of EBI3 and P35 (subunits of IL-35 ). This was done to evaluate the functional impact of the observed decline in FOXP3 expression, as both EBI3 and P35 are known to directly transcribed by the FOXP3 transcription factor. Results revealed a significant decrease in IL-35 ( EBI3 and P35) mRNA levels in RA patients with the C/C genotype. IL-35 is one of the major anti-inflammatory cytokines secreted by Tregs, which halts the development of RA and other autoimmune diseases by giving maximum suppression to autoreactive T cells and other immune cells [ 54 ] [ 55 ]. Recent studies reported that the abnormal expression of IL-35 is directly associated with autoimmune diseases like SLE, MS, and type 1 diabetes (T1D). IL-35 helps to restore the balance of immune cells in RA and potentially reduces inflammation and joint damage. Additionally, the influence of SNP rs7528684 genotypes on serum RF and CRP levels were evaluated. RF and CRP are well-known biomarkers of inflammation, commonly detected in the serum of RA patients. RF is an autoantibody generated due to increased proliferation of autoreactive T and B cells and reacts against Fc region of IgG [ 39 ][ 56 ]. In the present study, we observed that the RF positive cases were significantly associated with C/C genotype of FCRL3 SNP rs7528684. This association may be attributed due dysregulation of Tregs caused by the C/C genotype of SNP rs7528684, that results in higher number of auto-reactive immune cells. CRP produced in the early stages of inflammation by macrophages and other immune cells in autoimmune condition, which then leads to the production of pro-inflammatory cytokines [ 57 ]. However, the result suggest that FCRL3 SNP rs7528684 has no significant association with CRP production. This research study proves that C/C genotype of the FCRL3 SNP rs7528684 leads to upregulation of FCRL3 gene, downregulation of FOXP3 , and IL35 expression and increased level of RF, suggesting the mechanism that underlines the development of RA pathogenesis in the Indian ethnicity. Conclusion Our study reveals the association between FCRL3 SNP rs7528684 and RA in the Indian ethnicity. Especially the C/C genotype of rs7528684 increases the risk of RA susceptibility by upregulating FCRL3 gene expression and downregulation of FOXP3 and anti-inflammatory cytokine IL-35 (EBI3 and P35. Additionally, we observed a high prevalence of serum RF-positive cases among RA patients with C/C genotype of rs7528684. Collectively, these findings suggest that the C/C genotype of the FCRL3 SNP rs7528684 contributes to RA pathogenesis via generating the auto-reactive immune cells through the dysregulation of immune-suppressive cytokines production in Tregs. Declarations Credit authorship contribution statement Mohamed Muzammil S: Methodology, Investigation, Writing - original draft. S. Asha Devi: Conceptualization, Supervision, Writing - review & editing. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments The authors would like to thank Vellore Institute of Technology, Tamil Nadu, India for providing a lab facility to carry out the research work. The authors are also thankful to Dr. Anand Anbarasu, and Dr. Sudha Ramaiah Vellore Institute of Technology, Tamil Nadu, for their support. Also thankful to Dr. Balaji Nandagopal, Director, Sri Narayani Hospital and Research Center, Tamil Nadu, India, Dr. N. Raja consultant Rheumatologist, and Dr. M.Y. Bharathraj, consultant Rheumatologist, for their support in carrying out the research work. Data Availability Statement Data will be made available on request Ethics approval and consent to participate This study has been approved by the Sri Narayani Hospital and Research Centre in Vellore, Tamil Nadu, India. All the volunteers gave their consent to participate in the study. References N. M. Said, N. Ezzeldin, D. Said, A. M. Ebaid, D. M. Atef, and R. M. Atef, “HLA-DRB1, IRF5, and CD28 gene polymorphisms in Egyptian patients with rheumatoid arthritis: susceptibility and disease activity,” Genes Immun. , vol. 22, no. 2, pp. 93–100, 2021, doi: 10.1038/s41435-021-00134-8. Y. J. Lin, M. Anzaghe, and S. Schülke, “Update on the Pathomechanism, Diagnosis, and Treatment Options for Rheumatoid Arthritis,” Cells , vol. 9, no. 4, 2020, doi: 10.3390/cells9040880. Y. V. Muravyev, “Extra-articular manifestations of rheumatoid arthritis,” Nauchno-Prakticheskaya Revmatol. , vol. 56, no. 3, pp. 356–362, 2018, doi: 10.14412/1995-4484-2018-356-362. B. S. Bagepally, S. S. Kumar, A. Sasidharan, M. Haridoss, and K. Venkataraman, “Household catastrophic health expenditures for rheumatoid arthritis: a single centre study from South India,” Sci. Rep. , vol. 13, no. 1, pp. 1–8, 2023, doi: 10.1038/s41598-023-42623-y. K. P. Liao, L. Alfredsson, and E. W. Karlson, “Environmental influences on risk for rheumatoid arthritis,” Curr. Opin. Rheumatol. , vol. 21, no. 3, pp. 279–283, 2009, doi: 10.1097/BOR.0b013e32832a2e16. D. Ye, Y. Mao, Y. Xu, X. Xu, Z. Xie, and C. Wen, “Lifestyle factors associated with incidence of rheumatoid arthritis in US adults: Analysis of National Health and Nutrition Examination Survey database and meta-analysis,” BMJ Open , vol. 11, no. 1, pp. 1–9, 2021, doi: 10.1136/bmjopen-2020-038137. J. J. Goronzy, L. Shao, and C. M. Weyand, “Immune aging and rheumatoid arthritis,” Rheum. Dis. Clin. North Am. , vol. 36, no. 2, pp. 297–310, 2010, doi: 10.1016/j.rdc.2010.03.001. D. E. De Almeida, S. Ling, and J. Holoshitz, “New insights into the functional role of the rheumatoid arthritis shared epitope,” FEBS Lett. , vol. 585, no. 23, pp. 3619–3626, 2011, doi: 10.1016/j.febslet.2011.03.035. A. H. M. Van Der Helm-van Mil, R. E. M. Toes, and T. W. J. Huizinga, “Genetic variants in the prediction of rheumatoid arthritis,” Ann. Rheum. Dis. , vol. 69, no. 9, pp. 1694–1696, 2010, doi: 10.1136/ard.2009.123828. X. Lin, Y. Zhang, and Q. Chen, “FCRL3 gene polymorphisms as risk factors for rheumatoid arthritis,” Hum. Immunol. , vol. 77, no. 2, pp. 223–229, 2016, doi: 10.1016/j.humimm.2015.12.007. U. D. Bajpai, L. A. Swainson, J. E. Mold, J. D. Graf, J. B. Imboden, and J. M. McCune, “A functional variant in FCRl3 is associated with higher fc receptor-like 3 expression on T cell subsets and rheumatoid arthritis disease activity,” Arthritis Rheum. , vol. 64, no. 8, pp. 2451–2459, 2012, doi: 10.1002/art.34457. M. C. Matos, A. Pinheiro, J. Melo-Ferreira, R. S. Davis, and P. J. Esteves, “Evolution of Fc Receptor-Like Scavenger in Mammals,” Front. Immunol. , vol. 11, no. February, pp. 1–12, 2021, doi: 10.3389/fimmu.2020.590280. D. Rostamzadeh, T. Kazemi, Z. Amirghofran, and M. Shabani, “Update on Fc receptor-like (FCRL) family: new immunoregulatory players in health and diseases,” Expert Opin. Ther. Targets , vol. 22, no. 6, pp. 487–502, 2018, doi: 10.1080/14728222.2018.1472768. F. J. Li et al. , “Emerging roles for the FCRL family members in lymphocyte biology and disease,” Curr. Top. Microbiol. Immunol. , vol. 382, pp. 29–50, 2014, doi: 10.1007/978-3-319-07911-0_2. R. S. Davis, “Fc receptor-like molecules,” Annu. Rev. Immunol. , vol. 25, pp. 525–560, 2007, doi: 10.1146/annurev.immunol.25.022106.141541. H. Zhang, Y. He, X. He, L. Wang, T. Jin, and D. Yuan, “Three SNPs of FCRL3 and one SNP of MTMR3 are associated with immunoglobulin A nephropathy risk,” Immunobiology , vol. 225, no. 1, pp. 1–6, 2020, doi: 10.1016/j.imbio.2019.11.004. S. Agarwal, Z. Kraus, J. Dement-Brown, O. Alabi, K. Starost, and M. Tolnay, “Human Fc Receptor-like 3 Inhibits Regulatory T Cell Function and Binds Secretory IgA,” Cell Rep. , vol. 30, no. 5, pp. 1292-1299.e3, 2020, doi: 10.1016/j.celrep.2019.12.099. E. Report, “FCRL3 promoter 169 CC homozygosity is associated with,” vol. 56, no. 16, pp. 803–806, 2007, doi: 10.1136/ard.2006.064949. A. W. Gibson et al. , “The FCRL3 -169CT promoter single-nucleotide polymorphism, which is associated with systemic lupus erythematosus in a Japanese population, predicts expression of receptor protein on CD19+ B cells,” Arthritis Rheum. , vol. 60, no. 11, pp. 3510–3512, 2009, doi: 10.1002/art.24915. A. Martínez et al. , “Epistatic interaction between FCRL3 and NFκB1 genes in Spanish patients with rheumatoid arthritis,” Ann. Rheum. Dis. , vol. 65, no. 9, pp. 1188–1191, 2006, doi: 10.1136/ard.2005.048454. Y. Zheng and A. Y. Rudensky, “Foxp3 in control of the regulatory T cell lineage,” Nat. Immunol. , vol. 8, no. 5, pp. 457–462, 2007, doi: 10.1038/ni1455. M. Attias, T. Al-Aubodah, and C. A. Piccirillo, “Mechanisms of human FoxP3+ Treg cell development and function in health and disease,” Clin. Exp. Immunol. , vol. 197, no. 1, pp. 36–51, 2019, doi: 10.1111/cei.13290. S. Sakaguchi, T. Yamaguchi, T. Nomura, and M. Ono, “Regulatory T Cells and Immune Tolerance,” Cell , vol. 133, no. 5, pp. 775–787, 2008, doi: 10.1016/j.cell.2008.05.009. A. Walker, P. Rablen, and A. Schepartz, “乳鼠心肌提取 HHS Public Access,” Physiol. Behav. , vol. 176, no. 1, pp. 139–148, 2016, doi: 10.1146/annurev.immunol.25.022106.141623.Regulatory. Y. Kochi et al. , “A functional variant in FCRL3, encoding Fc receptor-like 3, is associated with rheumatoid arthritis and several autoimmunities,” Nat. Genet. , vol. 37, no. 5, pp. 478–485, 2005, doi: 10.1038/ng1540. S. Ben Mkaddem et al. , “Lyn and Fyn function as molecular switches that control immunoreceptors to direct homeostasis or inflammation,” Nat. Commun. , vol. 8, no. 1, 2017, doi: 10.1038/s41467-017-00294-0. L. M. Fernández-Aguilar, I. Vico-Barranco, M. M. Arbulo-Echevarria, and E. Aguado, “A Story of Kinases and Adaptors: The Role of Lck, ZAP-70 and LAT in Switch Panel Governing T-Cell Development and Activation,” Biology (Basel). , vol. 12, no. 9, 2023, doi: 10.3390/biology12091163. L. A. Swainson, J. E. Mold, U. D. Bajpai, and J. M. McCune, “Expression of the Autoimmune Susceptibility Gene FcRL3 on Human Regulatory T Cells Is Associated with Dysfunction and High Levels of Programmed Cell Death-1,” J. Immunol. , vol. 184, no. 7, pp. 3639–3647, 2010, doi: 10.4049/jimmunol.0903943. A. E. Moran et al. , “T cell receptor signal strength in Treg and iNKT cell development demonstrated by a novel fluorescent reporter mouse,” J. Exp. Med. , vol. 208, no. 6, pp. 1279–1289, 2011, doi: 10.1084/jem.20110308. R. J. Brownlie, L. A. Miosge, D. Vassilakos, L. M. Svensson, A. Cope, and R. Zamoyska, “Europe PMC Funders Group Lack of PTPN22 increases LFA-1-dependent adhesion of Murine Regulatory T Cells improving their regulatory Function,” vol. 5, no. 252, pp. 1–30, 2018, doi: 10.1126/scisignal.2003365.Lack. W. Xue, D. Yan, and Q. Kan, “Interleukin-35 as an emerging player in tumor microenvironment,” J. Cancer , vol. 10, no. 9, pp. 2074–2082, 2019, doi: 10.7150/jca.29170. A. Scthmid, N. Oberle, and P. H. Krammer, “Molecular mechanisms oftreg-mediatedt cell suppression,” Front. Immunol. , vol. 3, no. MAR, pp. 1–20, 2012, doi: 10.3389/fimmu.2012.00051. S. A. Miller, D. D. Dykes, and H. F. Polesky, “A simple salting out procedure for extracting DNA from human nucleated cells,” Nucleic Acids Res. , vol. 16, no. 3, p. 1215, 1988, doi: 10.1093/nar/16.3.1215. P. Desjardins and D. Conklin, “NanoDrop microvolume quantitation of nucleic acids,” J. Vis. Exp. , no. 45, pp. 1–4, 2010, doi: 10.3791/2565. M. Shri Preethi and S. Asha Devi, “An attempt to unravel the association of TAGAP gene SNPs with rheumatoid arthritis in the Indian population using high-resolution melting analysis,” Gene , vol. 834, no. May, p. 146584, 2022, doi: 10.1016/j.gene.2022.146584. B. Kozera and M. Rapacz, “Reference genes in real-time PCR,” Journal of Applied Genetics , vol. 54, no. 4. pp. 391–406, 2013, doi: 10.1007/s13353-013-0173-x. K. Fundel, J. Haag, P. M. Gebhard, R. Zimmer, and T. Aigner, “Normalization strategies for mRNA expression data in cartilage research,” Osteoarthr. Cartil. , vol. 16, no. 8, pp. 947–955, 2008, doi: 10.1016/j.joca.2007.12.007. V. P. Bykerk and E. M. Massarotti, “The new ACR/EULAR classification criteria for RA: How are the new criteria performing in the clinic?,” Rheumatol. (United Kingdom) , vol. 51, no. SUPPL. 6, pp. 10–15, 2012, doi: 10.1093/rheumatology/kes280. Y. Tanaka, “What is rheumatoid factor? from screening to personalized management,” Rheumatology , vol. 64, no. Supplement_2, pp. ii9–ii14, 2025, doi: 10.1093/rheumatology/keaf003. M. jiang Xu, R. Zhao, H. Cao, and Z. J. Zhao, “SPAP2, an Ig family receptor containing both ITIMs and ITAMs,” Biochem. Biophys. Res. Commun. , vol. 293, no. 3, pp. 1037–1046, 2002, doi: 10.1016/S0006-291X(02)00332-7. J. C. Vahl et al. , “Continuous T Cell Receptor Signals Maintain a Functional Regulatory T Cell Pool,” Immunity , vol. 41, no. 5, pp. 722–736, 2014, doi: 10.1016/j.immuni.2014.10.012. Y. Kochi, A. Suzuki, R. Yamada, and K. Yamamoto, “Ethnogenetic heterogeneity of rheumatoid arthritisimplications for pathogenesis,” Nat. Rev. Rheumatol. , vol. 6, no. 5, pp. 290–295, 2010, doi: 10.1038/nrrheum.2010.23. M. M. Thabet, J. Wesoly, P. E. Slagboom, R. E. M. Toes, and T. W. J. Huizinga, “FCRL3 promoter 169 CC homozygosity is associated with susceptibility to rheumatoid arthritis in Dutch Caucasians,” Ann. Rheum. Dis. , vol. 66, no. 6, pp. 803–806, 2007, doi: 10.1136/ard.2006.064949. F. Shahram, J. Kazemi, M. Mahmoudi, and Z. Jadali, “Single nucleotide polymorphisms of FCRL3 in Iranian patients with behcet’s disease,” Iran. J. Public Health , vol. 48, no. 6, pp. 1133–1139, Jun. 2019, doi: 10.18502/ijph.v48i6.2926. C. Report, “arthritis,” vol. 3, no. Ci, pp. 671–674, 2006, doi: 10.1136/ard.2005.043489. K. Kalantar et al. , “ur na,” Meta Gene , p. 100663, 2020, doi: 10.1016/j.mgene.2020.100663. J. Chen et al. , “Disease Phenotypes and Gender Association of FCRL3 Single-Nucleotide Polymorphism – 169T / C in Taiwanese Patients with Systemic Lupus Erythematosus and Rheumatoid Arthritis,” pp. 1–7, 2010, doi: 10.3899/jrheum.100437. K. Kalantar et al. , “Association of FCRL3 rs7528684 polymorphism with risk of Hashimoto’s thyroiditis in Iranian patients,” Meta Gene , vol. 24, no. November 2019, p. 100663, 2020, doi: 10.1016/j.mgene.2020.100663. F. Matesanz et al. , “The high producer variant of the Fc-receptor like-3 (FCRL3) gene is involved in protection against multiple sclerosis,” J. Neuroimmunol. , vol. 195, no. 1–2, pp. 146–150, 2008, doi: 10.1016/j.jneuroim.2008.01.004. Q. Yan et al. , “Structural Basis for Activation of ZAP-70 by Phosphorylation of the SH2-Kinase Linker,” Mol. Cell. Biol. , vol. 33, no. 11, pp. 2188–2201, 2013, doi: 10.1128/mcb.01637-12. I. Sana, M. E. Mantione, P. Angelillo, and M. Muzio, “Role of NFAT in Chronic Lymphocytic Leukemia and Other B-Cell Malignancies,” Front. Oncol. , vol. 11, no. April, pp. 1–11, 2021, doi: 10.3389/fonc.2021.651057. T. Maruyama, J. E. Konkel, B. F. Zamarron, and W. Chen, “Foxp3 gene regulation 的分子机制.pdf,” vol. 23, no. 6, pp. 418–423, 2012, doi: 10.1016/j.smim.2011.06.005.The. O. Goldmann, O. V. Nwofor, Q. Chen, and E. Medina, “Mechanisms underlying immunosuppression by regulatory cells,” Front. Immunol. , vol. 15, no. February, pp. 1–12, 2024, doi: 10.3389/fimmu.2024.1328193. Y. Shao et al. , “IL-35 promotes CD4+Foxp3+ Tregs and inhibits atherosclerosis via maintaining CCR5-amplified Treg-suppressive mechanisms,” JCI Insight , vol. 6, no. 19, 2021, doi: 10.1172/jci.insight.152511. D. M. Gravano and D. A. A. Vignali, “The battle against immunopathology: Infectious tolerance mediated by regulatory T cells,” Cell. Mol. Life Sci. , vol. 69, no. 12, pp. 1997–2008, 2012, doi: 10.1007/s00018-011-0907-z. K. Ikari et al. , “Supportive evidence for a genetic association of the FCRL3 promoter polymorphism with rheumatoid arthritis,” Ann. Rheum. Dis. , vol. 65, no. 5, pp. 671–673, 2006, doi: 10.1136/ard.2005.043489. J. E. Pope and E. H. Choy, “C-reactive protein and implications in rheumatoid arthritis and associated comorbidities,” Semin. Arthritis Rheum. , vol. 51, no. 1, pp. 219–229, 2021, doi: 10.1016/j.semarthrit.2020.11.005. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7393465","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":503311304,"identity":"05fceb34-ff2a-4436-a5b5-874af6024a7b","order_by":0,"name":"Mohamed Muzammil S","email":"","orcid":"","institution":"Vellore Institute of Technology","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Muzammil","lastName":"S","suffix":""},{"id":503311307,"identity":"e6edcf88-59c9-4903-a0ee-7f7516eee8ad","order_by":1,"name":"Asha Devi S","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYHACNghib2A4AOYzE62F5wDDgQMkaWGQSGCAWkMAyLcff/bgR5lNYp/kG8PDHxjs5BnYefHrNDiTY27Ycy4tsU06xwDosGTDBma+BPxaGHLYJHjbDhuzSaclALUwJzAw8xjgd1j/82eSf9v+G7NJHgNpqSesheFGgpk0b9sBOTYJ5gNALYcJazG48cZMWuZcshwbT/KBA2cMjhu2EXZY+jPJN2V2PPLtB5s/VFRUy/PznyHgMDRLIXE0CkbBKBgFo4BCAADhrD4ivjdALgAAAABJRU5ErkJggg==","orcid":"","institution":"Vellore Institute of Technology","correspondingAuthor":true,"prefix":"","firstName":"Asha","middleName":"Devi","lastName":"S","suffix":""}],"badges":[],"createdAt":"2025-08-17 16:08:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7393465/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7393465/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90307808,"identity":"efa34e5a-30c2-4a6e-968b-f321913e7689","added_by":"auto","created_at":"2025-09-01 09:35:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":344788,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e PCR amplicons of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 target region (430bp) from controls and RA patients \u003cstrong\u003e(B)\u003c/strong\u003e Represents the normalized melting curves of SNP rs7528684 \u003cstrong\u003e(C)\u003c/strong\u003e Difference curve showing three different genotypes.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7393465/v1/a516c44b6c1f2fa1cfc2b54b.png"},{"id":90310279,"identity":"7a6ec647-e5a9-421a-acae-ccecaaa217c6","added_by":"auto","created_at":"2025-09-01 09:43:13","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":387081,"visible":true,"origin":"","legend":"\u003cp\u003eSanger’s sequencing, chromatogram representing SNP rs7528684 region: \u003cstrong\u003e(A)\u003c/strong\u003eHomozygous dominant - T allele. \u003cstrong\u003e(B)\u003c/strong\u003e Homozygous recessive - C allele \u003cstrong\u003e(C)\u003c/strong\u003eHeterozygous C/T - alleles.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7393465/v1/45e5bb143160d781acc053ee.jpeg"},{"id":90307814,"identity":"9d64632c-83ad-42ef-a327-405ac5750904","added_by":"auto","created_at":"2025-09-01 09:35:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":109797,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e \u003cem\u003eFCRL3\u003c/em\u003e relative mRNA expression levels between controls and RA patients \u003cstrong\u003e(B)\u003c/strong\u003e Comparison of \u003cem\u003eFCRL3\u003c/em\u003e mRNA expression levels between different genotypes of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684. \u003cstrong\u003e(C)\u003c/strong\u003e \u003cem\u003eFOXP3\u003c/em\u003erelative mRNA expression levels in controls and RA patients \u003cstrong\u003e(D) \u003c/strong\u003eComparison of \u003cem\u003eFOXP3\u003c/em\u003e mRNA expression levels between different genotypes of \u003cem\u003eFCRL3\u003c/em\u003eSNP rs7528684.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7393465/v1/191070bcb8f90a433057b482.png"},{"id":90310278,"identity":"e2ec2c65-b9ca-4669-86cd-4ce6016404c8","added_by":"auto","created_at":"2025-09-01 09:43:13","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":254390,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e \u003cem\u003eEBI3\u003c/em\u003e relative mRNA expression levels in controls and RA patients \u003cstrong\u003e(B)\u003c/strong\u003e Comparison of \u003cem\u003eEBI3\u003c/em\u003e mRNA expression levels between different genotypes of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 \u003cstrong\u003e(C)\u003c/strong\u003e \u003cem\u003eP35\u003c/em\u003e relative mRNA expression levels between controls and RA patients \u003cstrong\u003e(D)\u003c/strong\u003e Comparison of \u003cem\u003eP35\u003c/em\u003emRNA expression levels between different genotypes of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7393465/v1/6ede58d8a1e7bed6d4985490.jpeg"},{"id":92643843,"identity":"6e616abd-576f-4e2d-9039-da8ff9f7906b","added_by":"auto","created_at":"2025-10-02 09:17:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2197599,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7393465/v1/d44172c6-d1b6-469b-ae8c-ec7fefed7e35.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of rs7528684 (-169T/C) on FCRL3, FOXP3, IL-35 Gene Expression and RF correlation: Insights into Rheumatoid Arthritis Pathogenesis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRheumatoid Arthritis (RA) is a multi-factorial complex autoimmune disease that causes joint deformity, destruction of cartilage, bone erosions and disability [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The prevalence of RA in worldwide is 0.4% \u0026ndash; 2%, while in India, it is 0.7% and women are two to three times more at risk than men [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It has been acknowledged that understanding the etiology of RA is intricate due to more than one causative factors, including environment, genetics, age, sex and lifestyle etc. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Genetic contribution to RA is almost 60%, which underlines the importance of understanding the genetic variants within genes that critically involved in RA pathogenesis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In past decades, association of non-HLA genes and RA have been less studied than HLA genes. Therefore, studies on non-HLA genes are in demand. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] Fc receptor-like protein 3 (\u003cem\u003eFCRL3\u003c/em\u003e), a members of the Fc receptor-like molecules (\u003cem\u003eFCRLs\u003c/em\u003e) family isoforms (\u003cem\u003eFCRL1\u003c/em\u003e-\u003cem\u003e6\u003c/em\u003e, \u003cem\u003eFCRLA\u003c/em\u003e, and \u003cem\u003eFCRLB)\u003c/em\u003e located on the chromosome 1 q21-23, which encodes for a large family of receptor proteins that share sequence homology with receptors binds to the Fc region of immunoglobulins. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. These cluster of genes are categorized based on their cytoplasmic motifs, different cell surface expressions, and based on their binding abilities towards the Fc region of Immunoglobulins [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. FCRL3 acts as an immunoregulator protein, expressed on CD4\u0026thinsp;+\u0026thinsp;\u003cem\u003eFOXP3\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Regulatory T cell (Tregs) surface but not on conventional CD4\u0026thinsp;+\u0026thinsp;T cells. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Its immunoregulatory activity is due to the motifs present in the cytoplasmic region of FCRL3 protein i.e. Immunoreceptor Tyrosine-Based Activation Motifs (ITAM) and Immunoreceptor Tyrosine-Based Inhibition Motifs (ITIM) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. These motifs downregulate the signal transduction involved in T Cell Receptor (TCR) mediated Tregs proliferation and activation. Single Nucleotide Polymorphisms (SNPs) in \u003cem\u003eFCRL3\u003c/em\u003e gene leads to the dysfunction and loss of self-tolerance of Tregs, which, in turn, induces abnormal proliferation of the autoreactive T cells and other immune cells that leads to the development of RA and other autoimmune diseases such as Multiple Sclerosis (MS), Systemic Lupus Erythematosus, Graves\u0026rsquo;s Disease and Pancreatitis[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSNP rs7528684 (-169T/C) present at the promoter site of \u003cem\u003eFCRL3\u003c/em\u003e gene [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] enhances the binding affinity of a transcriptional factor, Nuclear Factor-Kappa B (NF-κB) towards the regulatory region of the gene, which helps in rapid transcription of \u003cem\u003eFCRL3.\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] Overexpression of FCRL3 disturbs the normal immune suppressive ability of Tregs by dysregulating their TCR signalling. [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Tregs are crucial orchestrators of immune tolerance, exerting maximum suppressive function to prevent autoimmunity. Their suppressive ability is critically associated with the expression of Forkhead Box Protein 3 (\u003cem\u003eFOXP3\u003c/em\u003e) gene in. FOXP3 is a transcriptional factor, uniquely expressed in Tregs and regulates the expression of genes involved in suppressive activity of Tregs such as [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] Interleukin-35 (\u003cem\u003eIL-35\u003c/em\u003e), Transforming Growth Factor-beta and Interleukin 10. These cytokines downregulate, auto-reactive T cells, B cells and other immune cell populations, maintains immune homeostasis and prevents autoimmunity [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Emerging evidence suggests that the FCRL3 protein, particularly when over expressed due to SNP rs7528684, could compromise Tregs suppressive capacity. This occurs, in part through the dysregulation of TCR signalling [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Over expressed FCRL3 protein involves in the inactivation of protein tyrosine kinases such as \u003cem\u003eSYK\u003c/em\u003e, \u003cem\u003eLCK\u003c/em\u003e, \u003cem\u003eFYN\u003c/em\u003e and \u003cem\u003eZAP70\u003c/em\u003e, a pivotal enzyme in the TCR signalling pathway. Activation of these kinases is indispensable for robust TCR signalling, which in turn, required for optimal \u003cem\u003eFOXP3\u003c/em\u003e production and to maintain Treg function, however TCR signalling induces epigenetic modifications that facilitate \u003cem\u003eFOXP3\u003c/em\u003e production [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e][\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Consequently, disrupted TCR signalling mediated by \u003cem\u003eFCRL3\u003c/em\u003e overexpression leads to downregulation of \u003cem\u003eFOXP3\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The impact of \u003cem\u003eFOXP3\u003c/em\u003e downregulation may extend to the downstream effector molecules like \u003cem\u003eIL-\u003c/em\u003e35 and other immune-suppressive cytokines, since their expression is mediated by \u003cem\u003eFOXP3\u003c/em\u003e transcription factor. \u003cem\u003eIL-35\u003c/em\u003e, heterodimeric cytokine, made up of \u003cem\u003eP35\u003c/em\u003e (also known as \u003cem\u003eIL-2α\u003c/em\u003e) and Epstein-Barr Virus Induced Gene 3 (\u003cem\u003eEBI3)\u003c/em\u003e subunits, play a significant anti-inflammatory role. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. \u003cem\u003eIL-35\u003c/em\u003e actively supresses auto-reactive T cells [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Therefore, dysregulated TCR signalling in Tregs because of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 may downregulate \u003cem\u003eFOXP3\u003c/em\u003e and \u003cem\u003eIL-35\u003c/em\u003e genes, that exacerbate RA severity. Based on this mechanistic rationale, we aimed to explore the link between RA and \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 (-169T/C) in the Indian ethnicity and subsequently its impact on mRNA expression patterns of \u003cem\u003eFCRL3, FOXP3\u003c/em\u003e and \u003cem\u003eIL-35\u003c/em\u003e (\u003cem\u003eEBI3 and P35\u003c/em\u003e) genes. Concurrently, we aimed to elucidate its correlation with established RA serum biomarkers, including Rheumatoid Factor (RF) and C-Reactive Protein (CRP) concentrations in the serum of RA patients.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStudy participants and sample collection\u003c/h2\u003e\u003cp\u003e 226 RA patients and 239 healthy volunteers, ages ranging from 30–60 years from Sri Narayani Hospital and Research Centre, Vellore, Tamil Nadu were participated in the study. This study included the patients who had travelled from various parts of India for RA treatment at the hospital. The American College of Rheumatology (ACR) / European League Against Rheumatism (EULAR) criteria was followed for the sample collections. Patients with other comorbidities were excluded. The study approval was granted by the Institutional Ethical Committee (IEC/IRB No.29/08/07/2022). After getting informed consent, peripheral blood samples were collected by a phlebotomist using Ethylenediaminetetraacetic Acid (EDTA) as an anticoagulant. 5 ml of blood sample was processed for whole genomic DNA isolation using Miller’s salting-out method, a widely used non-toxic simple method for high quality DNA isolation from blood samples [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. For mRNA expression analysis, another 5ml of peripheral blood sample was collected from healthy volunteers and RA patients. From the blood samples Peripheral Blood Mononuclear Cells (PBMCs) were isolated using density gradient centrifugation. Total RNA was extracted from PBMCs using an RNAiso Plus kit (Takara, USA). The extracted DNA and RNA samples quality and quantity were assessed by Nanodrop spectrophotometer.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAmplification of FCRL3 gene\u003c/h3\u003e\n\u003cp\u003eThe extracted DNA from the blood samples were diluted at 40 ng/µl concentrations to bring a uniform quantity in all the DNA samples and used as template for \u003cem\u003eFCRL3\u003c/em\u003e gene amplification. All the primers were manually designed to meet specific criteria, including optimal size, GC contents, annealing temperature and self-complementary to prevent primer-dimer formation. For the amplification of 430 bp target region containing the \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 loci, the following primers were used: (NCBI accession number (AN): NG_023241) forward 5′- GCGGGGGATATAAGGGGTAAG-3′ and reverse 5′- CCTTGTCTTCACACAGCCT-3′. Each Polymerase chain reactions (PCR) comprised, 3µl of template DNA (~ 50ng/µl), 0.5µl of each (forward and reverse) primers, 0.1µl of PrimeSTAR HS DNA Polymerase and nuclease-free water was added to bring the reaction mixture to10 µl. Table.1A shows the PCR conditions used for the amplification of SNP rs7528684 target region (430bp). Further, the amplicons length was confirmed by the gel electrophoresis.\u003c/p\u003e\n\u003ch3\u003eGenotyping SNP rs7528684\u003c/h3\u003e\n\u003cp\u003eHigh-Resolution Melting Analysis (HRMA), a robust post PCR genotyping technique for SNP screening, which utilizes saturating fluorescent dye. This dye intercalates into double-stranded DNA (dsDNA) throughout the amplification process. As temperature rises gradually, the dsDNA denatures into single-stranded DNA (ssDNA), this unwinding process releases the intercalated dye, resulting in a distinct reduction in fluorescence, which is precisely monitored by the system to generate a high-resolution melting curve based on characteristic of the DNA sequence. This technique precisely detects even subtle differences in the melting curve behaviour and does not require any labelled probe like in other traditional methods. For HRMA, PCR amplicons (diluted 1:20) of the 430 bp containing target SNP rs7528684 region were used as template. Genotyping of rs7528684 by HRMA was performed on a Bio-Rad real-time PCR (qPCR) instrument. Each reaction comprised 2 µl of DNA template, 5 µl of Qiagen Eva green master mix, 1µl of each internal primers (forward 5′- GATCTGGGTGAGATTACGGG − 3′ and reverse 5′- CACAGTCAAGGTGTCAAGC − 3′) that targets the region of 119 bp of \u003cem\u003eFCRL3\u003c/em\u003e DNA containing SNP rs7528684 loci and nuclease free water to make up the final volume of 10 µl. The qPCR conditions are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB. To ensure the accuracy, all the samples were analysed in duplicates and the resulting melt curves were interpreted using Bio-Rad Precision Melt Analysis™ program. Samples with variations in the melt curve were indeed validated by Sanger sequencing to confirm the presence of the specific SNP within the DNA locus [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePCR and qPCR conditions for FCRL3 DNA amplification and genotyping\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eA. PCR conditions to amplify \u003cem\u003eFCRL3\u003c/em\u003e gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInitial Denaturation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDenaturation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAnnealing\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eExtension\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eFinal Extension\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eNo. of Cycles\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTemperature (Tm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e98°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e98°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e60°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e72°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e72°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDuration (mins/sec)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e5sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e25sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e5 min\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eB. qPCR conditions\u003c/p\u003e\u003cp\u003efor HRMA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eInitial Denaturation\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eDenaturation\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003eAnnealing\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e\u003cb\u003eMelting curve\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e(1sec Tm intervals)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003eNo. of Cycles\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTemperature (Tm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e95°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e95°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e58°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e75°C to 85°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e45\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDuration (mins/sec)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15 sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e40 sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e5 sec\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eC. qPCR conditions to quantify gene expression\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eInitial Denaturation\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eDenaturation\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003eAnnealing\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e\u003cb\u003eMelting curve\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e(1sec Tm intervals)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003eNo. of Cycles\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTemperature (Tm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e95°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e95°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e60°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e65°C to 85°C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e39\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDuration (mins/sec)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e30sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e30sec\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e5 sec\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eFCRL3, FOXP3 and IL-35 gene expression study\u003c/h3\u003e\n\u003cp\u003eThe mRNA extracted from PBMCs was converted into complementary DNA (cDNA) using an RT reagent (PrimeScript™ Takara, USA), following manufacture’s protocol. The reaction conditions followed for cDNA synthesis includes 15 mins at 37°C for primers annealing and cDNA synthesis, 5 sec at 85°C for enzyme deactivation. \u003cem\u003eFCRL3\u003c/em\u003e, \u003cem\u003eFOXP3\u003c/em\u003e and \u003cem\u003eIL-35\u003c/em\u003e (\u003cem\u003eEBI3 and P35\u003c/em\u003e) gene expression levels were analysed from the cDNA by qPCR using SYBR Green kit. Each reaction comprised of 0.7 µl of cDNA (~ 1000 ng/µl), 1µl of each primers, 5 µl of SYBR Green master mix and nuclease free water was added to bring the reaction mixture to 10 µl. The qPCR conditions for mRNA expression studies are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (C). Simultaneously, a stable housekeeping gene, Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) mRNA expression levels were used as a reference to normalize the target gene expression, GAPDH expresses in numerous metabolically active cells, including PBMCs under various physiological conditions which ensures its consistent, hence utilized as a control gene [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Following primers were used for mRNA analyses, \u003cem\u003eFCRL3\u003c/em\u003e (NCBI cDNA AN: BC028933), forward 5′- CCCCAAAAGCTGTACTTCTC-3′ and reverse 5′-GCTAGGGAATGTGATATGCTG- 3′, \u003cem\u003eFOXP3\u003c/em\u003e (AN: NP_054728), forward 5′-GAGAAGGAGAAGCTGAGTG-3′ and reverse 5′-GGAGCCCTTGTCGGATGAT- 3′, \u003cem\u003eEBI3\u003c/em\u003e (AN: NP_005746), forward: 5′-GCAGCTTCGTGCCTTTCATA-3′ and reverse 5′-CTACTTGCCCAGGCTCATTGT-3′, \u003cem\u003eP35\u003c/em\u003e (AN: NP_000873), forward 5′-CTGGACCACCTCAGTTTGGC-3′ and reverse 5′-GGTGAAGGCATGGGAACATTC-3′ and GAPDH (AN: NP_001276674), forward: 5′-ATCGTGGAAGGACTCATGAC-3′ and reverse: 5′-GCAGGGATGATGTTCTGGA-3′.\u003c/p\u003e\n\u003ch3\u003eMeasurements of RF and CRP levels in RA serum\u003c/h3\u003e\n\u003cp\u003eSerum samples were obtained from 226 RA patients by centrifugation of blood samples at 3000 rpm for 10 mins. RF of the IgG isotype (RF-IgG) levels were measured in the serum samples using a commercially available Human rheumatoid factor antibody ELISA Kit from Cusabio, China. The assay was performed as per manufacturer’s protocol and the RF value of \u0026lt; 20 IU/L was considered as negative, and ≥ 20 IU/L as positive. Serum CRP levels were quantified using high sensitivity CRP Kit from Cusabio, China, and value ≤ 1.0 mg/L was defined as normal CRP level. The RF and CRP values were interpreted based on the ACR/EULAR criteria [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAllele and genotypes frequencies of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 in both controls and RA patients were calculated within the Indian ethnicity. The association of the variants with RA risk were assessed by calculating Odd Ratio (OR), 95% Confidence Interval (CI) and Relative Risk (RR) for all three (TT, CT, CC) genotypes by MedCalc software (version 23.0.2) and \u003cem\u003eP\u003c/em\u003e - value \u003cem\u003e\u0026lt;\u003c/em\u003e 0.05 was considered as significant based on Hardy–Weinberg equilibrium. Statistical tools, Unpaired Student’s t-tests and One-way Analysis of Variance (ANOVA) were used to calculate statistical differences in mRNA expressions in all the target genes. Data representation and graphs were plotted using GraphPad Software (GraphPad Prism version 10), and the data was presented as mean ± SEM. \u003cem\u003eP -\u003c/em\u003e value \u003cem\u003e\u0026lt;\u003c/em\u003e 0.05 was considered as significant. The RF and CRP levels were first categorized into clinically relevant positive (+ ve) and negative (-ve) groups. Their association with SNP rs7528684 genotypes was determined by calculating the OR and 95% CI and \u003cem\u003eP\u003c/em\u003e - value \u003cem\u003e\u0026lt;\u003c/em\u003e 0.05 was taken as significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003ch2\u003eSNP Genotyping\u003c/h2\u003e\u003cp\u003eSNP rs7528684 (-169T/C), located within the regulatory region of the \u003cem\u003eFCRL3\u003c/em\u003e gene was screened in 239 healthy controls and 226 RA patient samples. As an initial step, \u003cem\u003eFCRL3\u003c/em\u003e SNP containing region was amplified from the isolated DNA in both RA and control samples. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA illustrates the PCR product of the \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 target region (430 bp). Further, the amplicons were analysed in HRMA for genotyping.\u003c/p\u003e\u003cp\u003eHRMA results revealed three distinct clusters in normalized melting curve (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and difference melting curve (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), indicating the presence of T/T, C/T, and C/C genotype in SNP rs7528684 base pair window. Subsequently Sanger sequencing was performed to the samples with deviated curves to confirm the presence of different genotypes.\u003c/p\u003e\u003cp\u003eSanger sequencing results revealed the presence of wild (T/T) and variant (C/C \u0026amp; C/T) genotypes in the rs7528684 loci of \u003cem\u003eFCRL3\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B and C). Table\u0026nbsp;2 shows the genotype frequencies of SNP rs7528684 in controls and RA patients, C/C genotype was significantly higher in RA patients compared to controls. The genotype frequencies in controls were T/T = 41%, C/T = 31.8%, and C/C = 27.2%, while in RA patients, T/T = 33.3%, C/T = 18.1% and C/C = 49.5%. Significantly higher OR was observed for the C/C genotype (CC vs CT + TT = 2.63, CI = 1.78 to 3.86) in RA patients than the controls (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001) (Table\u0026nbsp;2).\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"8\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e\u003cp\u003eTable\u0026nbsp;2. Genotypes of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 - Odds ratio and Relative risk\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenotypes\u003c/p\u003e\u003cp\u003e(rs7528684)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eOdds ratio\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e95% C. I\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003ez-statistics\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003ep-value\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eRelative risk\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003e95% C. I\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e\u003cb\u003ep-value\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTT vs CT + CC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.46 to 1.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.0522\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.61 to 1.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.0537\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCT vs CC + TT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.30 to 0.73\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3.35\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.0008\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.40 to 0.79\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.0010\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCC vs CT + TT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2.63\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.78 to 3.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4.90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.0001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1.82\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1.42 to 2.32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.0005\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003eSimilarly, the RR was also higher for the variant C/C genotype (RR = 1.82, CI = 1.42 to 2.32) in the RA samples compared to controls (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0005). The genotype frequencies in the controls are consistent with the Hardy-Weinberg equilibrium. Thus, a significant association was found between \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 (-169C) and RA among the Indian ethnicity. As shown in Table\u0026nbsp;3, 58.6% of RA patients carried the C allele (43.1% in controls), and remaining 41.4% carried the T allele (56.9% in controls) in rs7528684 loci on the \u003cem\u003eFCRL3\u003c/em\u003e gene.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e\u003ccolgroup cols=\"6\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003eTable\u0026nbsp;3. \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 genotype and allele frequencies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSNP rs7528684\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003ef(TT)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003ef(CT)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003ef(CC)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003ef(T)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003ef(C)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eControl sample (n = 239)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e41.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e31.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e56.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e43.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRA patient sample (n = 226)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e33.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e18.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e49.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e41.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e58.6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003ch2\u003eFCRL3 expression levels\u003c/h2\u003e\u003cp\u003eTo study the link between \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 and RA pathogenesis, mRNA expression levels of the \u003cem\u003eFCRL3\u003c/em\u003e gene in controls and RA patients were quantified and the comparison was carried out within different genotypes of SNP rs7528684. To quantify the expression levels, mRNA expression fold changes were calculated using qPCR data, and a \u003cem\u003eP\u003c/em\u003e -value \u003cem\u003e\u0026lt;\u003c/em\u003e 0.05 was considered as significant. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cem\u003eFCRL3\u003c/em\u003e mRNA expression levels were significantly higher (4.7 ± 0.74) in RA samples compared to controls (1.9 ± 0.6, \u003cem\u003et =\u003c/em\u003e 2.803, \u003cem\u003e** p \u0026lt;\u003c/em\u003e 0.0072). Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB indicates the \u003cem\u003eFCRL3\u003c/em\u003e mRNA expression levels within different genotypes of SNP rs7528684. In RA samples, the \u003cem\u003eFCRL3\u003c/em\u003e expression level found to be higher in the C/C genotype (5.3 ± 0.8) than T/T genotype (1.2 ± 0.1, \u003cem\u003e** P \u0026lt;\u003c/em\u003e 0.0002), as well as C/C genotype of controls (3.1 ± 1.06, \u003cem\u003e** P \u0026lt;\u003c/em\u003e 0.0324). This result clearly indicates the higher expression of the \u003cem\u003eFCRL3\u003c/em\u003e gene in RA patients carrying C/C genotype in \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFOXP3\u003c/b\u003e \u003cb\u003emRNA expression levels\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe impact of \u003cem\u003eFCRL3\u003c/em\u003e overexpression on Tregs due to SNP rs7528684 (-169C) was analysed through \u003cem\u003eFOXP3\u003c/em\u003e gene expression pattern in RA patients, since \u003cem\u003eFOXP3\u003c/em\u003e is uniquely expressed by Tregs. \u003cem\u003eFOXP3\u003c/em\u003e, a transcription factor regulates the immune-suppressive cytokines produced by Tregs during normal immune homeostasis. Additionally, to correlate the negative impact of high FCRL3 protein on Tregs suppressive function, we measured the mRNA expression levels of the \u003cem\u003eFOXP3\u003c/em\u003e gene in RA and control samples. From the qPCR result it was observed that the levels of \u003cem\u003eFOXP3\u003c/em\u003e mRNA expression was significantly reduced in RA samples (0.1 ± 0.03) in comparison with controls (1.4 ± 0.4, \u003cem\u003et =\u003c/em\u003e 3.100, \u003cem\u003e** P \u0026lt;\u003c/em\u003e 0.0056) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Similarly, when \u003cem\u003eFOXP3\u003c/em\u003e mRNA expression levels were compared within genotypes of SNP rs7528684, the C/C genotype in RA patients showed a significantly decreased expression levels (0.03 ± 0.005) than wild (T/T) genotypes (2.1 ± 0.7, \u003cem\u003e** P \u0026lt;\u003c/em\u003e 0.0158). In contrast, no significant difference was found between C/C genotype of controls and RA patients (0.4 ± 0.01 \u003cem\u003e* P\u003c/em\u003e \u0026gt; 0.8311) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\u003ch2\u003eIL-35 (EBI3 \u0026amp; P35) mRNA expression levels\u003c/h2\u003e\u003cp\u003eAn insufficiency of immune-suppressive cytokines is the recognised characteristics of RA. Recent studies have consistently reported the abnormal expression of immune-suppressive cytokines are linked with most of the autoimmune disorders, including RA, which leads to the persistent inflammation and tissue damage. \u003cem\u003eIL-35\u003c/em\u003e is one such vital immune-suppressive cytokines consisting of \u003cem\u003eEBI3\u003c/em\u003e and \u003cem\u003eP35\u003c/em\u003e subunits that help in decreasing autoreactive immune cells to prevent autoimmunity. To analyse the impact of SNP rs7528684 on suppressive cytokines, \u003cem\u003eEBI3\u003c/em\u003e and \u003cem\u003eP35\u003c/em\u003e mRNA expression levels were evaluated. As indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, a significant decrease in the \u003cem\u003eEBI3\u003c/em\u003e gene mRNA expression levels in RA patients (0.1 ± 0.06) were observed over controls (1.1 ± 0.2, \u003cem\u003et =\u003c/em\u003e 4.042 \u003cem\u003e** p\u003c/em\u003e \u0026lt; 0.0012). The \u003cem\u003eEBI3\u003c/em\u003e mRNA expression levels were compared within rs7528684 genotypes, RA patients carrying C/C genotype exhibited a significantly decreased \u003cem\u003eEBI3\u003c/em\u003e mRNA levels (0.07 ± 0.001) compared to T/T (1.5 ± 0.2) (\u003cem\u003e**P \u0026lt;\u003c/em\u003e 0.0047) and C/C genotype (0.7 ± 0.05) (\u003cem\u003e**P \u0026lt;\u003c/em\u003e 0.0337) of controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Similarly, the \u003cem\u003eP35\u003c/em\u003e mRNA expression levels were also decreased in RA patients (0.2 ± 0.08) compared to the controls (1.0 ± 0.03, \u003cem\u003et =\u003c/em\u003e 8.545 \u003cem\u003e**P\u003c/em\u003e \u0026lt; 0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). While comparing within rs7528684 genotypes for \u003cem\u003eP35\u003c/em\u003e expression levels, RA patients carrying C/C genotype showed a significantly decreased in \u003cem\u003eP35\u003c/em\u003e expression levels \u003cem\u003e(\u003c/em\u003e0.07 ± 0.05) compared to T/T genotype (0.9 ± 0.05) (\u003cem\u003e** p \u0026lt;\u003c/em\u003e 0.0192) and C/C genotype (0.9 ± 0.01) (\u003cem\u003e**P \u0026lt;\u003c/em\u003e 0.045) of control samples. However, we observed no significant difference in \u003cem\u003eP35\u003c/em\u003e expression between C/C and T/T genotypes in controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e\u003ch2\u003eRF and CRP levels in RA patient serum sample\u003c/h2\u003e\u003cp\u003eRF and CRP are well-established serum biomarkers for RA diagnosis. Both the biomarkers are highly associated with inflammatory conditions, and their link with auto-reactive immune cells has been documented in previous studies [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].We explored the impact of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 genotypes on RF and CRP levels in RA serum samples and the results revealed that higher number of RF-positive cases were significantly associated with C/C genotype of SNP rs7528684 (OR = 2.21, 95% CI = 1.09 to 4.82 with p value, 0.0445) compared to other genotypes, CT and TT as detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e4\u003c/span\u003e, but no significant link was observed between CRP and SNP rs7528684 genotypes.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eFCRL3 SNP rs7528684 genotype frequencies in RA patients, stratified by RF and CRP status\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"10\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eInflammatory\u003c/p\u003e\u003cp\u003emarkers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eGenotypes of SNP rs7528684\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eGenotype TT vs CT + CC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c8\" namest=\"c7\"\u003e\u003cp\u003eGenotype CT vs TT + CC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e\u003cp\u003eGenotype CC vs CT + TT\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eTT CT CC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOR (95%CI)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003ep value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eOR (95%CI)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003ep value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003eOR (95%CI)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003ep value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRF + ve (n = 189)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e58 (79.4%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e34 (82.9%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e102 (91.1%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.51\u003c/p\u003e\u003cp\u003e(0.24 to 1.08)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e1.0804\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.78\u003c/p\u003e\u003cp\u003e(0.31 to 1.96)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.6115\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e2.21\u003c/p\u003e\u003cp\u003e(1.01 to 4.82)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.0445\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRF -ve (n = 37)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e15 (20.6%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e7\u003c/p\u003e\u003cp\u003e(17.1%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e11\u003c/p\u003e\u003cp\u003e(9.9%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCRP + ve (n = 190)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e61\u003c/p\u003e\u003cp\u003e(83.6%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e32 (78.1%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e97\u003c/p\u003e\u003cp\u003e(86.6%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.94\u003c/p\u003e\u003cp\u003e(0.44 to 2.01)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.8851\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.60\u003c/p\u003e\u003cp\u003e(0.26 to 1.41)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.2476\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e1.46\u003c/p\u003e\u003cp\u003e(0.71 to 3.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e0.3035\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCRP -ve (n = 36)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e12 (16.4%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9\u003c/p\u003e\u003cp\u003e(21.9%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15\u003c/p\u003e\u003cp\u003e(13.4%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eRA is a chronic autoimmune condition characterized by pain in joints, swelling, inflammation and degradation of cartilage and destruction of synovial joints, which results in permanent disability. Most autoimmune diseases are associated with proteins synthesized from immunoregulatory genes that modulates T-cell activity. \u003cem\u003eFCRL3\u003c/em\u003e is one such immunoregulatory gene, encodes for a transmembrane receptor, expressed on the surface of regulatory T cells to inhibit its proliferation. FCRL3 receptor has two crucial domains in the cytoplasmic region, namely ITAM and ITIM, which play an essential role in the regulation of Tregs [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The ITIM domain recruits the binding of SHP-1 and SHP-2 protein tyrosine phosphatase (a negative regulator of downstream signalling) [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], which dephosphorylate intracellular protein kinases \u003cem\u003eFyn\u003c/em\u003e, \u003cem\u003eLck, SYK\u003c/em\u003e and \u003cem\u003eZap70\u003c/em\u003e molecules. These protein kinases rapidly gets activated upon TCR engagement with self-antigen, which are continuously displayed by major histocompatibility complex molecules on antigen-presenting cells to initiate positive signalling cascades for immune suppressive cytokine secretion and to maintain normal immune homeostasis by Tregs [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Thus, the FCRL3 cytoplasmic ITIM domain regulates downstream TCR signal transduction involved in Tregs expansion and activation. However, polymorphism in the \u003cem\u003eFCRL3\u003c/em\u003e gene induces dysfunction of Tregs cells, which leads to rapid autoreactive T cell proliferation, that causes autoimmune diseases.\u003c/p\u003e\u003cp\u003eThe link between \u003cem\u003eFCRL3\u003c/em\u003e gene polymorphism and RA susceptibility has been significantly progressed in many population studies [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In this study, we investigated the association of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 (-169 C/T) with RA in the Indian ethnicity. The study confirms that \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 (-169C) was closely associated with RA in the Indian ethnicity. Statistical analysis (OR and RR) also suggests that the C/C genotype in rs7528684 locus increases the risk of RA compared to T/T and T/C genotypes. Similarly, the C allele frequency of rs7528684 was higher in RA patients than in controls (58.6% vs. 43.1%) (Table\u0026nbsp;3). Similar results were reported in other population, including Dutch, Japan, and Taiwan. Studies in the Dutch and Japanese ethnic groups reveals that the C/C genotype of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 was associated with RA and other autoimmune diseases [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In the Taiwan ethnicity, C/C genotype frequency was high in destructive RA [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], while in the Iran ethnicity, the C allele was associated with Hashimoto\u0026rsquo;s thyroiditis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] and Behcet\u0026rsquo;s Disease [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. However, in Spain population, the C allele was found to be a protective allele against MS [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. We further investigated the impact of SNP rs7528684 -169 C on \u003cem\u003eFCRL3\u003c/em\u003e gene expression in both controls and RA patients. For this, mRNA was isolated from PBMCs of controls and RA patients, and reverse transcribed into cDNA and the expression levels were quantified by qPCR. The result showed significantly higher \u003cem\u003eFCRL3\u003c/em\u003e mRNA expression levels in RA patients than controls. In the same way, a comparison within genotypes (C/C vs T/T) revealed significantly higher mRNA expression in RA patients with C/C genotype than wild genotype (T/T) in controls. The promoter region of a gene has an essential role in prompting the binding of transcription factors that affects target gene expression. The SNP, rs7528684 -169 T\u0026thinsp;\u0026gt;\u0026thinsp;C in the \u003cem\u003eFCRL3\u003c/em\u003e promotor region (-169 away from the transcription initiation site) particularly the C/C genotype, induces the stronger binding affinity of NF-κb family transcriptional factors and enhances the \u003cem\u003eFCRL3\u003c/em\u003e expression on the surface of Tregs [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Thus, elevated \u003cem\u003eFCRL3\u003c/em\u003e expression disturbs the mmune suppressive role of Tregs via its cytoplasmic motif (ITIM) and causes autoimmune diseases, including RA.\u003c/p\u003e\u003cp\u003eFinally, to analyze whether the over-expression of \u003cem\u003eFCRL3\u003c/em\u003e on Tregs influences its suppressive cytokines levels in RA patients via FOXP3 transcriptional factor, we measured the \u003cem\u003eFOXP3\u003c/em\u003e expression levels in controls and RA patients. The results showed a significantly low mRNA expression of \u003cem\u003eFOXP3\u003c/em\u003e in RA patients compared to controls. Similarly, comparison within SNP rs7528684 genotypes showed significantly lower \u003cem\u003eFOXP3\u003c/em\u003e levels in the RA patients carrying C/C genotype. Upon TCR engagement, \u003cem\u003eLCK, SYK, FYN\u003c/em\u003e and \u003cem\u003eZAP70\u003c/em\u003e, a SRC family kinases involve in the initial TCR signal activation that triggers a downstream signalling cascade [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], which activates phospholipase C (PLC γ). PLC γ hydrolyses phosphatidylinositol-3,4-bisphosphate to produce secondary messengers, diacylglycerol and Inositol-1,4,5-triphosphate (IP3). IP3 binds to IP3 receptor on the endoplasmic reticulum to release of intracellular calcium (Ca\u003csup\u003e2+\u003c/sup\u003e) into cytosol of Tregs. Ca\u003csup\u003e2+\u003c/sup\u003e helps in binding of calmodulin (CaM) to calcineurin phosphatase [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Activated calcineurin phosphatase dephosphorylates Nuclear Factor of Activated T cells (NFAT), and translocate NFAT into the nucleus, where it directly binds to the promotor region of \u003cem\u003eFOXP3\u003c/em\u003e and initiates its transcription in Tregs [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].Thus, dysfunction of Tregs due to SNPs in FCRL3 may directly decline \u003cem\u003eFOXP3\u003c/em\u003e expression. The stability and expression of \u003cem\u003eFOXP3\u003c/em\u003e depends on multiple factors which includes FCRL3's impact on Treg proliferation, potential signalling pathway interactions, and contributions to an inflammatory environment. Therefore, the precise mechanism involved in down regulation of \u003cem\u003eFOXP3\u003c/em\u003e need further investigation. Given that \u003cem\u003eFOXP3\u003c/em\u003e is a pivotal transcription factor, regulating the synthesis of anti-inflammatory cytokines within Tregs [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], we further measured the expression levels of \u003cem\u003eEBI3\u003c/em\u003e and \u003cem\u003eP35\u003c/em\u003e (subunits of \u003cem\u003eIL-35\u003c/em\u003e). This was done to evaluate the functional impact of the observed decline in \u003cem\u003eFOXP3\u003c/em\u003e expression, as both \u003cem\u003eEBI3\u003c/em\u003e and \u003cem\u003eP35\u003c/em\u003e are known to directly transcribed by the \u003cem\u003eFOXP3\u003c/em\u003e transcription factor. Results revealed a significant decrease in \u003cem\u003eIL-35\u003c/em\u003e (\u003cem\u003eEBI3\u003c/em\u003e and \u003cem\u003eP35)\u003c/em\u003e mRNA levels in RA patients with the C/C genotype. \u003cem\u003eIL-35\u003c/em\u003e is one of the major anti-inflammatory cytokines secreted by Tregs, which halts the development of RA and other autoimmune diseases by giving maximum suppression to autoreactive T cells and other immune cells [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Recent studies reported that the abnormal expression of \u003cem\u003eIL-35\u003c/em\u003e is directly associated with autoimmune diseases like SLE, MS, and type 1 diabetes (T1D). \u003cem\u003eIL-35\u003c/em\u003e helps to restore the balance of immune cells in RA and potentially reduces inflammation and joint damage. Additionally, the influence of SNP rs7528684 genotypes on serum RF and CRP levels were evaluated. RF and CRP are well-known biomarkers of inflammation, commonly detected in the serum of RA patients. RF is an autoantibody generated due to increased proliferation of autoreactive T and B cells and reacts against Fc region of IgG [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e][\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In the present study, we observed that the RF positive cases were significantly associated with C/C genotype of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684. This association may be attributed due dysregulation of Tregs caused by the C/C genotype of SNP rs7528684, that results in higher number of auto-reactive immune cells. CRP produced in the early stages of inflammation by macrophages and other immune cells in autoimmune condition, which then leads to the production of pro-inflammatory cytokines [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. However, the result suggest that \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 has no significant association with CRP production. This research study proves that C/C genotype of the \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 leads to upregulation of \u003cem\u003eFCRL3\u003c/em\u003e gene, downregulation of \u003cem\u003eFOXP3\u003c/em\u003e, and \u003cem\u003eIL35\u003c/em\u003e expression and increased level of RF, suggesting the mechanism that underlines the development of RA pathogenesis in the Indian ethnicity.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study reveals the association between \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 and RA in the Indian ethnicity. Especially the C/C genotype of rs7528684 increases the risk of RA susceptibility by upregulating \u003cem\u003eFCRL3\u003c/em\u003e gene expression and downregulation of \u003cem\u003eFOXP3\u003c/em\u003e and anti-inflammatory cytokine \u003cem\u003eIL-35 (EBI3\u003c/em\u003e and \u003cem\u003eP35.\u003c/em\u003e Additionally, we observed a high prevalence of serum RF-positive cases among RA patients with C/C genotype of rs7528684. Collectively, these findings suggest that the C/C genotype of the \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 contributes to RA pathogenesis via generating the auto-reactive immune cells through the dysregulation of immune-suppressive cytokines production in Tregs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCredit authorship contribution statement \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMohamed Muzammil S: Methodology, Investigation, Writing - original draft. S. Asha Devi: Conceptualization, Supervision, Writing - review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Vellore Institute of Technology, Tamil Nadu, India for providing a lab facility to carry out the research work. The authors are also thankful to Dr. Anand Anbarasu, and Dr. Sudha Ramaiah Vellore Institute of Technology, Tamil Nadu, for their support. Also thankful to Dr. Balaji Nandagopal, Director, Sri Narayani Hospital and Research Center, Tamil Nadu, India, Dr. N. Raja consultant Rheumatologist, and Dr. M.Y. Bharathraj, consultant Rheumatologist, for their support in carrying out the research work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has been approved by the Sri Narayani Hospital and Research Centre in Vellore, Tamil Nadu, India. All the volunteers gave their consent to participate in the study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eN. M. Said, N. Ezzeldin, D. Said, A. M. Ebaid, D. M. Atef, and R. M. Atef, \u0026ldquo;HLA-DRB1, IRF5, and CD28 gene polymorphisms in Egyptian patients with rheumatoid arthritis: susceptibility and disease activity,\u0026rdquo; \u003cem\u003eGenes Immun.\u003c/em\u003e, vol. 22, no. 2, pp. 93\u0026ndash;100, 2021, doi: 10.1038/s41435-021-00134-8.\u003c/li\u003e\n\u003cli\u003eY. J. Lin, M. Anzaghe, and S. Sch\u0026uuml;lke, \u0026ldquo;Update on the Pathomechanism, Diagnosis, and Treatment Options for Rheumatoid Arthritis,\u0026rdquo; \u003cem\u003eCells\u003c/em\u003e, vol. 9, no. 4, 2020, doi: 10.3390/cells9040880.\u003c/li\u003e\n\u003cli\u003eY. V. Muravyev, \u0026ldquo;Extra-articular manifestations of rheumatoid arthritis,\u0026rdquo; \u003cem\u003eNauchno-Prakticheskaya Revmatol.\u003c/em\u003e, vol. 56, no. 3, pp. 356\u0026ndash;362, 2018, doi: 10.14412/1995-4484-2018-356-362.\u003c/li\u003e\n\u003cli\u003eB. S. Bagepally, S. S. Kumar, A. Sasidharan, M. Haridoss, and K. Venkataraman, \u0026ldquo;Household catastrophic health expenditures for rheumatoid arthritis: a single centre study from South India,\u0026rdquo; \u003cem\u003eSci. Rep.\u003c/em\u003e, vol. 13, no. 1, pp. 1\u0026ndash;8, 2023, doi: 10.1038/s41598-023-42623-y.\u003c/li\u003e\n\u003cli\u003eK. P. Liao, L. Alfredsson, and E. W. Karlson, \u0026ldquo;Environmental influences on risk for rheumatoid arthritis,\u0026rdquo; \u003cem\u003eCurr. Opin. Rheumatol.\u003c/em\u003e, vol. 21, no. 3, pp. 279\u0026ndash;283, 2009, doi: 10.1097/BOR.0b013e32832a2e16.\u003c/li\u003e\n\u003cli\u003eD. Ye, Y. Mao, Y. Xu, X. Xu, Z. Xie, and C. Wen, \u0026ldquo;Lifestyle factors associated with incidence of rheumatoid arthritis in US adults: Analysis of National Health and Nutrition Examination Survey database and meta-analysis,\u0026rdquo; \u003cem\u003eBMJ Open\u003c/em\u003e, vol. 11, no. 1, pp. 1\u0026ndash;9, 2021, doi: 10.1136/bmjopen-2020-038137.\u003c/li\u003e\n\u003cli\u003eJ. J. Goronzy, L. Shao, and C. M. Weyand, \u0026ldquo;Immune aging and rheumatoid arthritis,\u0026rdquo; \u003cem\u003eRheum. Dis. Clin. North Am.\u003c/em\u003e, vol. 36, no. 2, pp. 297\u0026ndash;310, 2010, doi: 10.1016/j.rdc.2010.03.001.\u003c/li\u003e\n\u003cli\u003eD. E. De Almeida, S. Ling, and J. Holoshitz, \u0026ldquo;New insights into the functional role of the rheumatoid arthritis shared epitope,\u0026rdquo; \u003cem\u003eFEBS Lett.\u003c/em\u003e, vol. 585, no. 23, pp. 3619\u0026ndash;3626, 2011, doi: 10.1016/j.febslet.2011.03.035.\u003c/li\u003e\n\u003cli\u003eA. H. M. Van Der Helm-van Mil, R. E. M. Toes, and T. W. J. Huizinga, \u0026ldquo;Genetic variants in the prediction of rheumatoid arthritis,\u0026rdquo; \u003cem\u003eAnn. Rheum. Dis.\u003c/em\u003e, vol. 69, no. 9, pp. 1694\u0026ndash;1696, 2010, doi: 10.1136/ard.2009.123828.\u003c/li\u003e\n\u003cli\u003eX. Lin, Y. Zhang, and Q. Chen, \u0026ldquo;FCRL3 gene polymorphisms as risk factors for rheumatoid arthritis,\u0026rdquo; \u003cem\u003eHum. Immunol.\u003c/em\u003e, vol. 77, no. 2, pp. 223\u0026ndash;229, 2016, doi: 10.1016/j.humimm.2015.12.007.\u003c/li\u003e\n\u003cli\u003eU. D. Bajpai, L. A. Swainson, J. E. Mold, J. D. Graf, J. B. Imboden, and J. M. McCune, \u0026ldquo;A functional variant in FCRl3 is associated with higher fc receptor-like 3 expression on T cell subsets and rheumatoid arthritis disease activity,\u0026rdquo; \u003cem\u003eArthritis Rheum.\u003c/em\u003e, vol. 64, no. 8, pp. 2451\u0026ndash;2459, 2012, doi: 10.1002/art.34457.\u003c/li\u003e\n\u003cli\u003eM. C. Matos, A. Pinheiro, J. Melo-Ferreira, R. S. Davis, and P. J. Esteves, \u0026ldquo;Evolution of Fc Receptor-Like Scavenger in Mammals,\u0026rdquo; \u003cem\u003eFront. Immunol.\u003c/em\u003e, vol. 11, no. February, pp. 1\u0026ndash;12, 2021, doi: 10.3389/fimmu.2020.590280.\u003c/li\u003e\n\u003cli\u003eD. Rostamzadeh, T. Kazemi, Z. Amirghofran, and M. Shabani, \u0026ldquo;Update on Fc receptor-like (FCRL) family: new immunoregulatory players in health and diseases,\u0026rdquo; \u003cem\u003eExpert Opin. Ther. Targets\u003c/em\u003e, vol. 22, no. 6, pp. 487\u0026ndash;502, 2018, doi: 10.1080/14728222.2018.1472768.\u003c/li\u003e\n\u003cli\u003eF. J. Li \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Emerging roles for the FCRL family members in lymphocyte biology and disease,\u0026rdquo; \u003cem\u003eCurr. Top. Microbiol. Immunol.\u003c/em\u003e, vol. 382, pp. 29\u0026ndash;50, 2014, doi: 10.1007/978-3-319-07911-0_2.\u003c/li\u003e\n\u003cli\u003eR. S. Davis, \u0026ldquo;Fc receptor-like molecules,\u0026rdquo; \u003cem\u003eAnnu. Rev. Immunol.\u003c/em\u003e, vol. 25, pp. 525\u0026ndash;560, 2007, doi: 10.1146/annurev.immunol.25.022106.141541.\u003c/li\u003e\n\u003cli\u003eH. Zhang, Y. He, X. He, L. Wang, T. Jin, and D. Yuan, \u0026ldquo;Three SNPs of FCRL3 and one SNP of MTMR3 are associated with immunoglobulin A nephropathy risk,\u0026rdquo; \u003cem\u003eImmunobiology\u003c/em\u003e, vol. 225, no. 1, pp. 1\u0026ndash;6, 2020, doi: 10.1016/j.imbio.2019.11.004.\u003c/li\u003e\n\u003cli\u003eS. Agarwal, Z. Kraus, J. Dement-Brown, O. Alabi, K. Starost, and M. Tolnay, \u0026ldquo;Human Fc Receptor-like 3 Inhibits Regulatory T Cell Function and Binds Secretory IgA,\u0026rdquo; \u003cem\u003eCell Rep.\u003c/em\u003e, vol. 30, no. 5, pp. 1292-1299.e3, 2020, doi: 10.1016/j.celrep.2019.12.099.\u003c/li\u003e\n\u003cli\u003eE. Report, \u0026ldquo;FCRL3 promoter 169 CC homozygosity is associated with,\u0026rdquo; vol. 56, no. 16, pp. 803\u0026ndash;806, 2007, doi: 10.1136/ard.2006.064949.\u003c/li\u003e\n\u003cli\u003eA. W. Gibson \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The FCRL3 -169CT promoter single-nucleotide polymorphism, which is associated with systemic lupus erythematosus in a Japanese population, predicts expression of receptor protein on CD19+ B cells,\u0026rdquo; \u003cem\u003eArthritis Rheum.\u003c/em\u003e, vol. 60, no. 11, pp. 3510\u0026ndash;3512, 2009, doi: 10.1002/art.24915.\u003c/li\u003e\n\u003cli\u003eA. Mart\u0026iacute;nez \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Epistatic interaction between FCRL3 and NF\u0026kappa;B1 genes in Spanish patients with rheumatoid arthritis,\u0026rdquo; \u003cem\u003eAnn. Rheum. Dis.\u003c/em\u003e, vol. 65, no. 9, pp. 1188\u0026ndash;1191, 2006, doi: 10.1136/ard.2005.048454.\u003c/li\u003e\n\u003cli\u003eY. Zheng and A. Y. Rudensky, \u0026ldquo;Foxp3 in control of the regulatory T cell lineage,\u0026rdquo; \u003cem\u003eNat. Immunol.\u003c/em\u003e, vol. 8, no. 5, pp. 457\u0026ndash;462, 2007, doi: 10.1038/ni1455.\u003c/li\u003e\n\u003cli\u003eM. Attias, T. Al-Aubodah, and C. A. Piccirillo, \u0026ldquo;Mechanisms of human FoxP3+ Treg cell development and function in health and disease,\u0026rdquo; \u003cem\u003eClin. Exp. Immunol.\u003c/em\u003e, vol. 197, no. 1, pp. 36\u0026ndash;51, 2019, doi: 10.1111/cei.13290.\u003c/li\u003e\n\u003cli\u003eS. Sakaguchi, T. Yamaguchi, T. Nomura, and M. Ono, \u0026ldquo;Regulatory T Cells and Immune Tolerance,\u0026rdquo; \u003cem\u003eCell\u003c/em\u003e, vol. 133, no. 5, pp. 775\u0026ndash;787, 2008, doi: 10.1016/j.cell.2008.05.009.\u003c/li\u003e\n\u003cli\u003eA. Walker, P. Rablen, and A. Schepartz, \u0026ldquo;乳鼠心肌提取 HHS Public Access,\u0026rdquo; \u003cem\u003ePhysiol. Behav.\u003c/em\u003e, vol. 176, no. 1, pp. 139\u0026ndash;148, 2016, doi: 10.1146/annurev.immunol.25.022106.141623.Regulatory.\u003c/li\u003e\n\u003cli\u003eY. Kochi \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A functional variant in FCRL3, encoding Fc receptor-like 3, is associated with rheumatoid arthritis and several autoimmunities,\u0026rdquo; \u003cem\u003eNat. Genet.\u003c/em\u003e, vol. 37, no. 5, pp. 478\u0026ndash;485, 2005, doi: 10.1038/ng1540.\u003c/li\u003e\n\u003cli\u003eS. Ben Mkaddem \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Lyn and Fyn function as molecular switches that control immunoreceptors to direct homeostasis or inflammation,\u0026rdquo; \u003cem\u003eNat. Commun.\u003c/em\u003e, vol. 8, no. 1, 2017, doi: 10.1038/s41467-017-00294-0.\u003c/li\u003e\n\u003cli\u003eL. M. Fern\u0026aacute;ndez-Aguilar, I. Vico-Barranco, M. M. Arbulo-Echevarria, and E. Aguado, \u0026ldquo;A Story of Kinases and Adaptors: The Role of Lck, ZAP-70 and LAT in Switch Panel Governing T-Cell Development and Activation,\u0026rdquo; \u003cem\u003eBiology (Basel).\u003c/em\u003e, vol. 12, no. 9, 2023, doi: 10.3390/biology12091163.\u003c/li\u003e\n\u003cli\u003eL. A. Swainson, J. E. Mold, U. D. Bajpai, and J. M. McCune, \u0026ldquo;Expression of the Autoimmune Susceptibility Gene FcRL3 on Human Regulatory T Cells Is Associated with Dysfunction and High Levels of Programmed Cell Death-1,\u0026rdquo; \u003cem\u003eJ. Immunol.\u003c/em\u003e, vol. 184, no. 7, pp. 3639\u0026ndash;3647, 2010, doi: 10.4049/jimmunol.0903943.\u003c/li\u003e\n\u003cli\u003eA. E. Moran \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;T cell receptor signal strength in Treg and iNKT cell development demonstrated by a novel fluorescent reporter mouse,\u0026rdquo; \u003cem\u003eJ. Exp. Med.\u003c/em\u003e, vol. 208, no. 6, pp. 1279\u0026ndash;1289, 2011, doi: 10.1084/jem.20110308.\u003c/li\u003e\n\u003cli\u003eR. J. Brownlie, L. A. Miosge, D. Vassilakos, L. M. Svensson, A. Cope, and R. Zamoyska, \u0026ldquo;Europe PMC Funders Group Lack of PTPN22 increases LFA-1-dependent adhesion of Murine Regulatory T Cells improving their regulatory Function,\u0026rdquo; vol. 5, no. 252, pp. 1\u0026ndash;30, 2018, doi: 10.1126/scisignal.2003365.Lack.\u003c/li\u003e\n\u003cli\u003eW. Xue, D. Yan, and Q. Kan, \u0026ldquo;Interleukin-35 as an emerging player in tumor microenvironment,\u0026rdquo; \u003cem\u003eJ. Cancer\u003c/em\u003e, vol. 10, no. 9, pp. 2074\u0026ndash;2082, 2019, doi: 10.7150/jca.29170.\u003c/li\u003e\n\u003cli\u003eA. Scthmid, N. Oberle, and P. H. Krammer, \u0026ldquo;Molecular mechanisms oftreg-mediatedt cell suppression,\u0026rdquo; \u003cem\u003eFront. Immunol.\u003c/em\u003e, vol. 3, no. MAR, pp. 1\u0026ndash;20, 2012, doi: 10.3389/fimmu.2012.00051.\u003c/li\u003e\n\u003cli\u003eS. A. Miller, D. D. Dykes, and H. F. Polesky, \u0026ldquo;A simple salting out procedure for extracting DNA from human nucleated cells,\u0026rdquo; \u003cem\u003eNucleic Acids Res.\u003c/em\u003e, vol. 16, no. 3, p. 1215, 1988, doi: 10.1093/nar/16.3.1215.\u003c/li\u003e\n\u003cli\u003eP. Desjardins and D. Conklin, \u0026ldquo;NanoDrop microvolume quantitation of nucleic acids,\u0026rdquo; \u003cem\u003eJ. Vis. Exp.\u003c/em\u003e, no. 45, pp. 1\u0026ndash;4, 2010, doi: 10.3791/2565.\u003c/li\u003e\n\u003cli\u003eM. Shri Preethi and S. Asha Devi, \u0026ldquo;An attempt to unravel the association of TAGAP gene SNPs with rheumatoid arthritis in the Indian population using high-resolution melting analysis,\u0026rdquo; \u003cem\u003eGene\u003c/em\u003e, vol. 834, no. May, p. 146584, 2022, doi: 10.1016/j.gene.2022.146584.\u003c/li\u003e\n\u003cli\u003eB. Kozera and M. Rapacz, \u0026ldquo;Reference genes in real-time PCR,\u0026rdquo; \u003cem\u003eJournal of Applied Genetics\u003c/em\u003e, vol. 54, no. 4. pp. 391\u0026ndash;406, 2013, doi: 10.1007/s13353-013-0173-x.\u003c/li\u003e\n\u003cli\u003eK. Fundel, J. Haag, P. M. Gebhard, R. Zimmer, and T. Aigner, \u0026ldquo;Normalization strategies for mRNA expression data in cartilage research,\u0026rdquo; \u003cem\u003eOsteoarthr. Cartil.\u003c/em\u003e, vol. 16, no. 8, pp. 947\u0026ndash;955, 2008, doi: 10.1016/j.joca.2007.12.007.\u003c/li\u003e\n\u003cli\u003eV. P. Bykerk and E. M. Massarotti, \u0026ldquo;The new ACR/EULAR classification criteria for RA: How are the new criteria performing in the clinic?,\u0026rdquo; \u003cem\u003eRheumatol. (United Kingdom)\u003c/em\u003e, vol. 51, no. SUPPL. 6, pp. 10\u0026ndash;15, 2012, doi: 10.1093/rheumatology/kes280.\u003c/li\u003e\n\u003cli\u003eY. Tanaka, \u0026ldquo;What is rheumatoid factor? from screening to personalized management,\u0026rdquo; \u003cem\u003eRheumatology\u003c/em\u003e, vol. 64, no. Supplement_2, pp. ii9\u0026ndash;ii14, 2025, doi: 10.1093/rheumatology/keaf003.\u003c/li\u003e\n\u003cli\u003eM. jiang Xu, R. Zhao, H. Cao, and Z. J. Zhao, \u0026ldquo;SPAP2, an Ig family receptor containing both ITIMs and ITAMs,\u0026rdquo; \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e, vol. 293, no. 3, pp. 1037\u0026ndash;1046, 2002, doi: 10.1016/S0006-291X(02)00332-7.\u003c/li\u003e\n\u003cli\u003eJ. C. Vahl \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Continuous T Cell Receptor Signals Maintain a Functional Regulatory T Cell Pool,\u0026rdquo; \u003cem\u003eImmunity\u003c/em\u003e, vol. 41, no. 5, pp. 722\u0026ndash;736, 2014, doi: 10.1016/j.immuni.2014.10.012.\u003c/li\u003e\n\u003cli\u003eY. Kochi, A. Suzuki, R. Yamada, and K. Yamamoto, \u0026ldquo;Ethnogenetic heterogeneity of rheumatoid arthritisimplications for pathogenesis,\u0026rdquo; \u003cem\u003eNat. Rev. Rheumatol.\u003c/em\u003e, vol. 6, no. 5, pp. 290\u0026ndash;295, 2010, doi: 10.1038/nrrheum.2010.23.\u003c/li\u003e\n\u003cli\u003eM. M. Thabet, J. Wesoly, P. E. Slagboom, R. E. M. Toes, and T. W. J. Huizinga, \u0026ldquo;FCRL3 promoter 169 CC homozygosity is associated with susceptibility to rheumatoid arthritis in Dutch Caucasians,\u0026rdquo; \u003cem\u003eAnn. Rheum. Dis.\u003c/em\u003e, vol. 66, no. 6, pp. 803\u0026ndash;806, 2007, doi: 10.1136/ard.2006.064949.\u003c/li\u003e\n\u003cli\u003eF. Shahram, J. Kazemi, M. Mahmoudi, and Z. Jadali, \u0026ldquo;Single nucleotide polymorphisms of FCRL3 in Iranian patients with behcet\u0026rsquo;s disease,\u0026rdquo; \u003cem\u003eIran. J. Public Health\u003c/em\u003e, vol. 48, no. 6, pp. 1133\u0026ndash;1139, Jun. 2019, doi: 10.18502/ijph.v48i6.2926.\u003c/li\u003e\n\u003cli\u003eC. Report, \u0026ldquo;arthritis,\u0026rdquo; vol. 3, no. Ci, pp. 671\u0026ndash;674, 2006, doi: 10.1136/ard.2005.043489.\u003c/li\u003e\n\u003cli\u003eK. Kalantar \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;ur na,\u0026rdquo; \u003cem\u003eMeta Gene\u003c/em\u003e, p. 100663, 2020, doi: 10.1016/j.mgene.2020.100663.\u003c/li\u003e\n\u003cli\u003eJ. Chen \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Disease Phenotypes and Gender Association of FCRL3 Single-Nucleotide Polymorphism \u0026ndash; 169T / C in Taiwanese Patients with Systemic Lupus Erythematosus and Rheumatoid Arthritis,\u0026rdquo; pp. 1\u0026ndash;7, 2010, doi: 10.3899/jrheum.100437.\u003c/li\u003e\n\u003cli\u003eK. Kalantar \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Association of FCRL3 rs7528684 polymorphism with risk of Hashimoto\u0026rsquo;s thyroiditis in Iranian patients,\u0026rdquo; \u003cem\u003eMeta Gene\u003c/em\u003e, vol. 24, no. November 2019, p. 100663, 2020, doi: 10.1016/j.mgene.2020.100663.\u003c/li\u003e\n\u003cli\u003eF. Matesanz \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The high producer variant of the Fc-receptor like-3 (FCRL3) gene is involved in protection against multiple sclerosis,\u0026rdquo; \u003cem\u003eJ. Neuroimmunol.\u003c/em\u003e, vol. 195, no. 1\u0026ndash;2, pp. 146\u0026ndash;150, 2008, doi: 10.1016/j.jneuroim.2008.01.004.\u003c/li\u003e\n\u003cli\u003eQ. Yan \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Structural Basis for Activation of ZAP-70 by Phosphorylation of the SH2-Kinase Linker,\u0026rdquo; \u003cem\u003eMol. Cell. Biol.\u003c/em\u003e, vol. 33, no. 11, pp. 2188\u0026ndash;2201, 2013, doi: 10.1128/mcb.01637-12.\u003c/li\u003e\n\u003cli\u003eI. Sana, M. E. Mantione, P. Angelillo, and M. Muzio, \u0026ldquo;Role of NFAT in Chronic Lymphocytic Leukemia and Other B-Cell Malignancies,\u0026rdquo; \u003cem\u003eFront. Oncol.\u003c/em\u003e, vol. 11, no. April, pp. 1\u0026ndash;11, 2021, doi: 10.3389/fonc.2021.651057.\u003c/li\u003e\n\u003cli\u003eT. Maruyama, J. E. Konkel, B. F. Zamarron, and W. Chen, \u0026ldquo;Foxp3 gene regulation 的分子机制.pdf,\u0026rdquo; vol. 23, no. 6, pp. 418\u0026ndash;423, 2012, doi: 10.1016/j.smim.2011.06.005.The.\u003c/li\u003e\n\u003cli\u003eO. Goldmann, O. V. Nwofor, Q. Chen, and E. Medina, \u0026ldquo;Mechanisms underlying immunosuppression by regulatory cells,\u0026rdquo; \u003cem\u003eFront. Immunol.\u003c/em\u003e, vol. 15, no. February, pp. 1\u0026ndash;12, 2024, doi: 10.3389/fimmu.2024.1328193.\u003c/li\u003e\n\u003cli\u003eY. Shao \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;IL-35 promotes CD4+Foxp3+ Tregs and inhibits atherosclerosis via maintaining CCR5-amplified Treg-suppressive mechanisms,\u0026rdquo; \u003cem\u003eJCI Insight\u003c/em\u003e, vol. 6, no. 19, 2021, doi: 10.1172/jci.insight.152511.\u003c/li\u003e\n\u003cli\u003eD. M. Gravano and D. A. A. Vignali, \u0026ldquo;The battle against immunopathology: Infectious tolerance mediated by regulatory T cells,\u0026rdquo; \u003cem\u003eCell. Mol. Life Sci.\u003c/em\u003e, vol. 69, no. 12, pp. 1997\u0026ndash;2008, 2012, doi: 10.1007/s00018-011-0907-z.\u003c/li\u003e\n\u003cli\u003eK. Ikari \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Supportive evidence for a genetic association of the FCRL3 promoter polymorphism with rheumatoid arthritis,\u0026rdquo; \u003cem\u003eAnn. Rheum. Dis.\u003c/em\u003e, vol. 65, no. 5, pp. 671\u0026ndash;673, 2006, doi: 10.1136/ard.2005.043489.\u003c/li\u003e\n\u003cli\u003eJ. E. Pope and E. H. Choy, \u0026ldquo;C-reactive protein and implications in rheumatoid arthritis and associated comorbidities,\u0026rdquo; \u003cem\u003eSemin. Arthritis Rheum.\u003c/em\u003e, vol. 51, no. 1, pp. 219\u0026ndash;229, 2021, doi: 10.1016/j.semarthrit.2020.11.005.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"FCRL3, rs7528684, regulatory T cells, NF-κB, FOXP3, IL-35","lastPublishedDoi":"10.21203/rs.3.rs-7393465/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7393465/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eFc Receptor-Like Protein 3 (\u003cem\u003eFCRL3\u003c/em\u003e) gene encodes for transmembrane receptor, that predominantly expressed on the surface of the Regulatory T cells (Tregs). The receptor owns two crucial motifs in its cytoplasmic domain, which downregulates the signal transduction of T - cell Receptor (TCR) mediated Tregs activation and proliferation. Single Nucleotide Polymorphism (SNP) in \u003cem\u003eFCRL3\u003c/em\u003e gene (rs7528684 -169 T/C) is hypothesised to enhance its expression, that leads to the loss of self-tolerance and dysfunction of Tregs. This, in turn, induces rapid proliferation of autoreactive T cells and other immune cells, exacerbating the progression of Rheumatoid Arthritis (RA) and other autoimmune diseases.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eIn the current study, we screened the \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 at -169 (T/C) position of the gene using High-Resolution Melting Analysis (HRMA) and confirmed the findings with Sanger sequencing technique to predict its link with RA in the Indian ethnicity. We further analysed the impact of SNP rs7528684 on \u003cem\u003eFCRL3\u003c/em\u003e, Fork head Box Protein 3 (\u003cem\u003eFOXP3)\u003c/em\u003e, and Interleukin \u003cem\u003e\u0026minus;\u0026thinsp;35\u003c/em\u003e (\u003cem\u003eIL-35\u003c/em\u003e) gene expression. Furthermore, we also evaluated the inflammatory biomarkers Rheumatoid Factor (RF) and C-Reactive Protein (CRP) in RA patients.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eIt was observed that the \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 with C/C genotype significantly increased (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.0005) RA risk in the Indian ethnicity compared to T/T and C/T genotypes (Odd Ratio (OR)\u0026thinsp;=\u0026thinsp;2.63; 95% Confidence Interval (C.I)\u0026thinsp;=\u0026thinsp;1.78 to 3.86 and Relative Risk (RR)\u0026thinsp;=\u0026thinsp;1.82). Moreover, the C allele frequency was significantly higher in the RA group (58.6%). Similarly, RA samples carrying C/C genotype exhibited significantly higher \u003cem\u003eFCRL3\u003c/em\u003e mRNA expression levels than controls (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.0072). Additionally, a downregulation of \u003cem\u003eFOXP3\u003c/em\u003e and \u003cem\u003eIL-35\u003c/em\u003e mRNA expression was observed in RA patients carrying C/C genotype. The results also exhibited a significant link between C/C genotype and RF-positive RA cases.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eIn summary, our findings suggest that the C/C genotype of \u003cem\u003eFCRL3\u003c/em\u003e SNP rs7528684 was strongly associated with RA in the Indian ethnicity. This genotype was characterised with positive RF, upregulated \u003cem\u003eFCRL3\u003c/em\u003e, and downregulated \u003cem\u003eFOXP3\u003c/em\u003e and \u003cem\u003eIL-35\u003c/em\u003e, a key anti-inflammatory cytokine.\u003c/p\u003e","manuscriptTitle":"Impact of rs7528684 (-169T/C) on FCRL3, FOXP3, IL-35 Gene Expression and RF correlation: Insights into Rheumatoid Arthritis Pathogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-01 09:35:08","doi":"10.21203/rs.3.rs-7393465/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f3b5a666-6926-434b-9bf5-cd0020cad950","owner":[],"postedDate":"September 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-02T09:09:09+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-01 09:35:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7393465","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7393465","identity":"rs-7393465","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}