Evaluation of genomic markers mrkD, pgaC and wcaJ involved in biofilm formation to aid in rapid screening of K. pneumoniae biofilms from endotracheal aspirates and bronchoalveolar lavage | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Evaluation of genomic markers mrkD, pgaC and wcaJ involved in biofilm formation to aid in rapid screening of K. pneumoniae biofilms from endotracheal aspirates and bronchoalveolar lavage Naveen Kumar Devanga Ragupathi, Dhiviya Prabaa Muthuirulandi Sethuvel, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3758116/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Oct, 2024 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Klebsiella pneumoniae has been identified as one of the most important opportunistic pathogens responsible for nosocomial infections. Antibiotic resistance and ability to form biofilms are the two main factors involved in the persistence of infections. Conventional detection methods involve culture isolation and identification followed by biofilm assay that takes 48–72 hrs. Timely detection of biofilm-forming resistant pathogens is essential to appropriately treat the infection with the right dose and combinations. The present study focusses on evaluating an RT-PCR panel using mrk D, pga C and wca J genes to screen for biofilm-forming K. pneumoniae from ETA/BAL specimens. The assay accurately identified K. pneumoniae harboring samples with a limit of detection (LOD) of 1 ng/µl total RNA. Representative culture-negative-PCR-positive samples were subjected to metagenomics which identified K. pneumoniae reads in these samples confirming the specificity of RT-PCR. mrk D and pga C acts as K. pneumoniae specific identification, whereas wca J act as negative marker for biofilm-forming K. pneumoniae . In addition, RT-PCR results correlated well with the phenotypic biofilm forming assay. This RT-PCR assay is the first of its kind for rapid identification of biofilm-forming K. pneumoniae . The result of this study highlights that the rapid detection of K. pneumoniae biofilms based on the RT-PCR results coupled with clinical conditions would be appropriate to treat emerging infections or to prevent re-infections in the clinical settings. Health sciences/Biomarkers/Diagnostic markers Health sciences/Diseases/Infectious diseases Biological sciences/Microbiology/Bacteria Biological sciences/Microbiology/Biofilms biofilms diagnosis AMR biomarker nosocomial K. pneumoniae Figures Figure 1 Figure 2 Introduction Klebsiella pneumoniae is an opportunistic Gram-negative pathogen frequently implicated in catheter associated and urinary tract infection. K. pneumoniae promotes colonization of gastrointestinal and respiratory tracts that leads to weakened immune functions and involves in the development of invasive infections in hospitalized patients. This has become a serious threat worldwide due to the spread of hypervirulent and antibiotic resistance strains presenting high mortality and morbidity rate. K. pneumoniae is one of the important nosocomial pathogens with potential to form biofilms in vitro and in vivo and are clinically significant in patients associated with devices. K. pneumoniae biofilms developed on the solid surfaces promote cell adherence, formation of microcolonies, maturation and finally dispersal as free-living cells. Capsular polysaccharides and fimbriae (type 3) are factors that play vital roles in forming important surface structures. Fimbriae maintain the stable adherence, whereas capsular polysaccharides affect the communication between cells and the structure of biofilm. Immune defences against cells of K. pneumoniae are protected partially by biofilms which contributes to the drug resistance 1 . The clinical K. pneumoniae biofilm formation mechanism is associated with a series of genes, includes allantoin ( allS ), capsular polysaccharide (CPS) ( treC , cpsD , wzc , wabG , wcaG , rmpA / A2 , wzyk2 and magA ), aerobactin ( iutA ), polysaccharides and adhesins ( pgaA , pgaB , pgaC , and bcsA ), type 1 ( fimA and fimH ) and type 3 fimbriae ( mrkD and mrkA ), quorum sensing (QS) ( luxS ) and colonic acid 2,3,4,5,6,7 . Eradication of the biofilm cells is challenging when compared with planktonic cells. K. pneumoniae biofilms are highly resistant to almost all commonly used antibiotics 8 . Antimicrobial susceptibility testing (AST) is difficult in biofilm situations. Biofilms and the analysis of the increased requirement of drug concentrations for their eradication need special equipment and expertise. However, limited data are available on the effectiveness of ceftazidime/avibactam, aztreonam and colistin against biofilm infections unlike beta-lactams which have poor penetration capacity in biofilm structures 9 . The rapid detection of K. pneumoniae biofilm can achieve early isolation and treatment to prevent further spread. Specific biomarkers to screen for K. pneumoniae biofilms using real-time (RT) PCR method will ensure early detection with utmost sensitivity and specificity. Timely detection of biofilm-forming pathogens is essential to appropriately treat the infection with the right dose and combinations. The present study focusses on evaluating the markers mrk D, pga C and wca J to screen for biofilm-forming K. pneumoniae from clinical specimens. Results Among 351 isolates of K. pneumoniae tested from blood stream infected patients, ∼60% were found to be carbapenem susceptible, followed by minocycline and chloramphenicol, with 65 and 60% susceptibility, respectively. Amikacin and netilmicin found to be 59% susceptible. In contrast, most of other tested antimicrobials showed < 55% susceptibility. Among 114 isolates of K. pneumoniae tested from patients with respiratory infections (ETA/BAL), 46% were carbapenem susceptible, followed by gentamicin and tobramycin, with 89 and 47% susceptibility, respectively. In contrast, most of other tested antimicrobials showed < 45% susceptibility. 33 ETA, 9 BAL samples and 66 clinical K. pneumoniae isolates (blood and ETA/BAL) were included for RT-PCR assay standardization. mrk D, pga C and wca J genes as evaluated by RT-PCR exhibited decrease in Ct values with increasing concentration of RNA (Figure S1). Biofilm forming capacity Out of 66 isolates screened for the biofilm formation, 20 K. pneumoniae isolates were strong biofilm producers, 16 isolates were moderate biofilm producers and 30 isolates were weak biofilm producers (Fig. 1 ). RT-PCR based identification of K. pneumoniae from isolates The samples that contain K. pneumoniae biofilm producers express mrk D and pga C with low Ct values, whereas the samples with other pathogens are undetermined or ≥ 30 Ct for mrk D and > 30 for pga C genes, respectively. The RT-PCR interpretative criteria for biofilm/non-biofilm K. pneumoniae are shown in Table 1 . Using RT-PCR, all clinical K. pneumoniae isolates were positive for mrk D and pga C, while borderline for wca J. This showed 100% sensitivity and specificity in comparison to conventional microbiological tests (CMT) for identification of K. pneumoniae . RT-PCR based identification of K. pneumoniae from direct samples For evaluation, 76 ETA/BAL samples were subjected to RT-PCR assay. Of which, 44 were culture positive and 32 were culture negative for K. pneumoniae . All culture-positive samples were also positive for marker genes mrk D and pga C in RT-PCR. However, 20 culture-negative samples were also picked as positives by RT-PCR. The sensitivity and specificity calculated in comparison to the culture method as gold standard is given in Table 2 . The sensitivity of the assay to detect K. pneumoniae in samples has a limit of detection as low as 1 ng/µl total RNA. Table 1 Interpretative criteria for K. pneumoniae RT-PCR from direct sample mrk D pga C wca J Biofilm forming + +/- - Non-biofilm forming +/- +/- + Non-Klebsiella - - - Table 2 Sensitivity and specificity of RT-PCR to detect K. pneumoniae from direct patient samples N = 76 Culture + ve ( n = 44) Culture -ve ( n = 32) RT-PCR + ve ( n = 64) 44 (TP) 20 (FP) PPV = TP/(TP/FP) = 44/64 = 68.75% RT-PCR -ve ( n = 12) 0 (FN) 12 (TN) NPV = TN/(TN + FN) = 12/(12) = 100% Sensitivity – TP/(TP + FN) = 100% Specificity – TN/(TN + FP) = 12/32 = 37.5% TP – true positives, TN – true negatives, FP – false positives, FN – false negatives, PPV – positive predictive value, NPV – negative predictive value Metagenomics of direct samples A total of 6 ETA and 2 BAL samples were included for metagenome sequencing. Of these, 5 ETA and 2 BAL samples were positive for K. pneumoniae by RT-PCR. 16S rRNA metagenomic sequencing revealed the presence of Klebsiella reads in all these RT-PCR positive samples. Of these 8 samples, four were culture positive and four were culture negative for K. pneumoniae . All culture positives were positive also in RT-PCR and metagenomics. Whereas, among four culture negatives, three were positive by RT-PCR and metagenomics. Remaining one culture negative sample was confirmed to be truly negative by RT-PCR and metagenomics (Table 3 ). Figure 2 A depicts the abundance of various genus identified among the eight sequenced samples, where Klebsiella reads from culture positive and negative groups correlate with the RT-PCR results (Fig. 2 B). Results of the culture-negative RT-PCR-positive group confirms the sensitivity of RT-PCR assay to be 100% for identification of K. pneumoniae . Table 3: Confirmation of culture-negative vs RT-PCR positives using 16S metagenomics Sample id Sample type Organism identified in culture mrk D pga C wca J Metagenome KPN Reads SP1385 ETA NFGNB, B. cenocepacia, C. albicans/glabrata + + - Present SP 1475 BAL Normal flora + - - Present SP 1487 ETA Stenotrophomonas maltophilia, Acinetobacter baumannii + - - Present SP 2545 ETA ABC, NFGNB (burkholderia) - - - Absent SP 1460 ETA Stenotrophomonas maltophilia, Acinetobacter baumannii, Klebsiella pneumoniae + + - Present SP 2438 ETA Klebsiella , Escherichia coli + + - Present SP 3804 BAL Klebsiella , Escherichia coli + + - Present SP 1401 ETA Pseudomonas aeruginosa, Klebsiella pneumoniae + + - Present + is <30 Ct values; - is ≥30 Ct values by RT-PCR; KPN – K. pneumoniae Discussion Antimicrobial resistance is the increasing challenge in healthcare associated infections. K. pneumoniae is one of the main causes of nosocomial infections especially among immunocompromised individuals with increasing resistance rates. Drug resistance and virulence such as its biofilm forming ability are the key factors involved in the persistence of infections 10 . These factors found to have a significant association with the clinical outcomes. Currently, increasing AMR in K. pneumoniae have become a worldwide problem and there is still very limited data regarding biofilm producing K. pneumoniae in India. These biofilms forming K. pneumoniae are highly resistance to many commonly used antibiotics thus making the current treatment challenging. The situation become more complicated when biofilm producing organisms are treated with inappropriate antibiotics and with insufficient concentrations. For instance, biofilms can resist empiric antibiotic therapy and contribute to bacterial persistence in chronic infections that result in high morbidity and mortality. Antibiotics such as piperacillin, piperacillin/tazobactam, cefoperazone, ceftazidime, cefepime, meropenem, ciprofloxacin, netilmicin and amikacin were reported to show reduced activity against adherent bacteria when compared to the planktonic counterparts 11 . In addition, several studies have shown that certain antibiotics induce biofilm formation when treated with sub-inhibitory concentration 12 . For this reason, early detection of biofilm forming nosocomial pathogens mainly from high dependency units is crucial. The present study was designed to inform the clinicians in identifying and choosing the appropriate antibiotic therapy for biofilm mediated infections. The key aspect of this study was to develop a diagnostic assay that uses a set of virulence genes of K. pneumoniae as a marker. Currently, there are no rapid diagnostic methods available to identify K. pneumoniae biofilms from clinical isolates and direct samples. Conventional assays take 48–72 hrs for identification of K. pneumoniae and biofilm formation ability. This assay based on real-time (RT)-PCR provided an added advantage by offering information on the biofilm forming ability of K. pneumoniae as well as confirming the identity of the pathogen in a short span. Among the various genes responsible for the biofilm production, mrk (Type 3 fimbriae) and pga C (polysaccharide adhesion) are the candidate genes linked with biofilm formation in K. pneumoniae and has shown to promote strong biofilm formation, enabling surface adhesion 13 . Studies have indicated that mrkA gene contributes to rapid biofilm formation while mrkD responsible for dense K. pneumoniae biofilms 14,15,16,17 . MrkD, a fimbrial adhesin from Klebsiella pneumoniae , causes adherence to the basement membranes of tissues and the basolateral surfaces of renal and pulmonary epithelia. This adhesin, which is an extracellular matrix binding protein, has been demonstrated to bind to type V collagen. Even though all isolates containing the MrkD adhesin induce the agglutination of erythrocytes treated with tannic acid in vitro, the mrk D gene is not conserved across species. The ability of a plasmid-borne mrkD gene product to induce type V collagen binding is usually associated with K. oxytoca strains and seldom with K. pneumoniae strains. The MrkD adhesin is a chromosomally borne adhesin that mediates binding to collagen types IV and V in K. pneumoniae 18,19 . Similarly, pga C also reported to serves as an adhesion factor for the initiation and maintenance of biofilm structure 20 . pga C is known to be closely associated with pga B/D, a biofilm adhesin polysaccharide and lux R gene, an N -acyl homoserine lactone (AHL)-dependent transcriptional regulator. AHL is one of the most common quorum sensing (QS) mechanism utilized by Proteobacteria 21 . QS is a well-established mechanism in the process of biofilm formation 22 . LuxR protein plays a key role in QS mechanism in most of the Gram-negative bacteria by detecting the presence of signalling molecules which enable inter- and intra-species interaction in response to external stimuli according to population density 23 . Furthermore, in-silico screening of the clinical K. pneumoniae genomes available in the public database revealed that 98%, 99.3% and 34.6% of the genomes carried mrk D, pga C and wca J genes 13 . It was also found that mrk D and pga C genes were present in all biofilm forming K. pneumoniae isolates in the present study. This indicates their conservation in K. pneumoniae strains and the specificity of the chosen targets in the detection of K. pneumoniae biofilms from clinical samples. Occasionally, some strains of K. pneumoniae may lose their fimbriae during culturing or may lack this fimbriae gene 17 . This issue has been addressed by using more than one target as demonstrated in the present study to ensure the reliability of the assay. Interestingly, the PCR panel evaluated in this study identified K. pneumoniae from the samples that were even culture-negative, showing the high sensitivity of the assay. Further, the samples that were PCR positive and culture negative were confirmed by 16S metagenomics to have Klebsiella reads. This could be due to the limited sensitivity of the culture method, or lesser load of the pathogen. In such cases, treatment with broad spectrum antibiotics will be helpful since Klebsiella in this individual may or may not be associated with the infection due to its low bacterial load. However, this approach also has its limitations where the patient may be over-treated leading to the development of drug resistance. To avoid this difficulty, the RT-PCR results can be coupled with clinical diagnosis to make this an accurate diagnostic tool. Further, wca J gene appears to act as a negative regulator, where its absence indicates the high potential of biofilm-forming capacity of the strain. The hypothesis was supported by earlier study by Pal et al, where they demonstrated that the inactivation of the wcaJ gene results in the disruption of colanic acid synthesis and enhances the biofilm formation in K. pneumoniae 3 . Based on the observed results for known positives and negatives, the cut off for Ct values to define negatives were ≥ 30 Ct for mrk D and > 30 for pga C genes. However, this needs further standardization with a higher number of clinical samples. Antimicrobial resistance rates among biofilm forming bacteria are higher compared to its planktonic forms and above the breakpoints proposed for therapeutic clinical use. This shows that treatment of biofilms with standard antimicrobial therapy would be unhelpful mainly among patients in high dependency units. This may also explain the treatment failure in some patients, despite susceptibility to antimicrobials in vitro , to result in clinical resistance. The PCR evaluated in this study in combination with clinical diagnosis will help in early detection of K. pneumoniae biofilms in critically ill patients and for their appropriate treatment either with high-dosage broad spectrum antimicrobials or with combinations. In conclusion, the PCR assay standardized in this study is the first of its kind for rapid identification of biofilm forming K. pneumoniae from clinical samples. Considering the limited resource settings like primary health laboratories, the cost of the PCR test and maintenance of the sample integrity might be the limiting factors. Overall, the results of the study highlight that the rapid detection of K. pneumoniae biofilms based on the real time PCR results coupled with clinical conditions would be appropriate to treat emerging infections or to prevent re-infections in the clinical settings. Materials and methods Study Samples The study includes direct respiratory samples (ETA/BAL) received for routine bacteriological culture at the Department of Clinical Microbiology from patients admitted in intensive care units at Christian Medical College, Vellore, India. For this study, samples were used after the routine processing for which it was collected. K. pneumoniae isolates obtained from these respiratory samples were also included for the evaluation of rapid screening assay. Antimicrobial Susceptibility Testing Antimicrobial susceptibility testing was performed by the Kirby-Bauer disc diffusion method against cefotaxime (30 µg), ceftazidime (30 µg), cefuroxime (30 µg), cefepime (30 µg), piperacilllin-tazobactam (100/10 µg), cefoperazone-sulbactam (75/30 µg), levofloxacin (5 µg), trimethoprim-sulfamethoxazole (75/30 µg), meropenem (10 µg), ertapenem (10 µg), amikacin (30 µg), gentamycin (10 µg), tobramycin (30 µg) according to CLSI, 2021 guidelines 24 . Quality control strains used were Escherichia coli ATCC 25922 for all antibiotics concurrently in all the batches. Tigecycline results were interpreted according to FDA criteria. Biofilm Screening Assay The screening assay was performed as described previously by Naveen Kumar et al, 2020. Briefly, about 5 to 10 fresh colonies were inoculated into a 10 ml LB broth and incubated at 37°C for 12–18 h. The optical density (OD) was measured in a spectrophotometer (Shimadzu, Kyoto, Japan) at 625 nm and 0.05 OD cells prepared by dilution in Mueller-Hinton broth (MHB) containing 1% glucose. OD adjusted cells were inoculated into a 96-well plate and incubated at 37°C for 24 hours. After 24 hrs of incubation, the medium was removed, and the biofilm was washed with 200 µl of distilled water. The biofilm was later stained with 200 µl 0.1% (w / v) crystal violet dye and incubated for 10 min at RT. OD was read at 570 nm after de-stained with glacial acetic acid followed by 5 mins incubation at RT. The assay was performed in triplicate. Broth without cells was used as a negative control. The biofilm production was classified as: OD < ODc = poor biofilm producer; ODc < OD ≤ 2 × ODc = weak biofilm producer; 2 × ODc < OD < 4 × ODc = moderate biofilm producer; and OD ≥ 4 × ODc = strong biofilm producer. RNA Isolation using Guanidinium Isothiocyanate Guanidinium Isothiocyanate (GITC) is a chaotropic agent which disrupts cells, denatures proteins, and deactivates nucleases, thereby stabilizing the nucleic acid. Briefly, a 10 µl loop full of bacteria was suspended in 400 µl of saline and 400 µl of GITC lysis buffer (4M GITC, 25mM Tris-HCl). The suspension was vortexed for 15 sec then incubated at 56°C for 15 min on the heating block. After that (96%-100% ethanol) was added and vortexed for 15 sec, after which the lysate was transferred to a spin column and incubated at RT for 5 min. After centrifugation at 6000 x g for 1 min and the supernatant was discarded. RNA was then washed with wash buffer I (0.9 M GITC, 10 mM Tris, 20% EtOH) and wash buffer II (100 mM NaCl, 10 mM Tris-HCl, 80% EtOH). After washing, the spin column dried at 56°C for 3 min. Finally, RNA was eluted in fresh Eppendorf tubes by adding 50 µl of RNase free water into the spin column followed by centrifugation at 6000 x g for 5 min. The quality and purity of the RNA obtained was evaluated using the Qubit and Nanodrop spectrophotometer. Reverse Transcriptase PCR cDNA was synthesized by Reverse transcriptase kit using 1µl of primer mix, 1µl of Reverse Transcriptase (RT), 4 µl of RT Buffer 5X and 14 µl of RNA template and the reaction mixture was incubated at 42°C for 15 min and then incubate at 95°C for 3 min then the product is kept in ice while preparing reaction mixture for real-time PCR. Real Time PCR for detection of biofilm forming K. pneumoniae Real-time PCR 7500 Fast DX instrument was used for gene amplification and relative quantification. Amplifications were performed using the instrument’s programmed two-step real-time PCR. Table 4 shows the primers used for RT-PCR. The total reaction volume (20 µl) was prepared by mixing 10 µl of SYBR Green qPCR master mix, 1 µl of forward primer, 1 µl of reverse primer (2 pmol), 5 µl of template cDNA, and 3 µl of PCR water. The real time PCR cyclic condition was programmed as follows; initial holding at 55°C for 30 min and 94°C for 2 min followed by 40 cycles of 94°C for 15 sec, 55°C for 1 min and 68°C for 1 min. Table 4 Primer sequences used for Real Time PCR Gene Forward Primer (5’ -3’) Reverse Primer (5’ -3’) mrk D GCCACAACGCCTTACTGAAA CTATTCTGCGCTGGTCATCG pga C ATGCCTGTTCCACGCTGTGG CAGGCTTCCTTTTCCCCGGT wca J AAATGGCGTACCGGTTGTTC CGGCCCTTTCGAGGTAGTTT Real-time quantification of cDNA was carried out on an ABI 7500 PCR detection system (Applied Biosystems, UK) using the SYBR green PCR master mix. Real-time PCR was used to investigate the expression level of mrk D, pga C and wca J genes measured by relative quantitation. Relative expression values (R) were determined using the ΔΔCt method. rrsE gene was considered as a housekeeping gene and all gene expression levels were normalized to rrs E gene. The assay was performed three times for each sample and the mean calculated. Expressions of all genes were calculated using the 2 −ΔΔCt method (fold). Cycle of threshold (C t ) was considered as the average threshold cycle number from three independent experiments. 16S metagenomic sequencing Sampling and DNA extraction A total of 6 ETA and 2 BAL samples received at the laboratory for routine testing were used for metagenomics assay. The collected samples were extracted by QIAmp DNA Mini Kit as per the manufacturer’s instruction with slight modifications in the sample preparation steps. Briefly, samples were incubated with lysozyme for 1 hr and overnight lysis with ATL buffer and proteinase K. Following incubation, samples were added with 0.5% saponin at RT for 10 min and incubated for 1 hr at 56 ˚C with NaCl. Lysed extracts were then transferred to spin columns for purification of DNA. Metagenome sequencing Bacterial 16S hypervariable genes were amplified by PCR from DNA samples using a range of V2,4,8 and V3,6,7,9 oligonucleotide primers specific for domain bacteria using Ion 16S metagenomic kit (Life Technologies, USA). Following amplification, all the PCR products were quantified, end repaired, ligated and nick repaired by Ion Plus Fragment Library Kit (Life Technologies, USA). Emulsion PCR was carried out using the Ion OneTouch Hi-Q View kit (Life Technologies), and the samples were adjusted to a final concentration of 100 pM. Templated-ISPs were sequenced on 318 chip v 2 bc (2 Gb) micro-chip using the Ion Torrent Personal Genome Machine (Life Technologies, USA) for 850 flows. Bioinformatic analysis The raw reads obtained by sequencing were analyzed using QIIME2 pipeline. First, the raw sequences were demultiplexed and then denoised to filter out too short sequences, singletons and chimeras. Reads were compared with Curated MicroSEQ(R) 16S Reference Library v2013.1 and Curated Greengenes v13.5 to define genus with 97% similarity, and species with 99% similarity. Percentage OTU similarity between samples were analyzed in SPSS and plotted using Microsoft Excel. Data analysis All statistical analysis was conducted using SPSS v and Microsoft Excel v. Sensitivity and Specificity of the RT-PCR assay was calculated in comparison with culture method as gold standard using conventional 2x2 table. Slope of concentration dependent decrease in Ct in RT-PCR was calculated and R2 represents coefficient of determination. Declarations Informed consent The requirement for informed consent from patients was waived by the Institutional Review Board and Ethical Committee of Christian Medical College, Vellore, India. Author information These authors contributed equally: Naveen Kumar Devanga Ragupathi, Dhiviya Prabaa Muthuirulandi Sethuvel. Competing interests The authors declare no competing interests. Funding ND is a Global Challenge Fellow at The University of Sheffield, supported by a Research England QR GCRF award (10065043). The study was funded by the GCRF networking grant, Academy of Medical Sciences, UK (GCRFNGR5\1293). The authors acknowledge The University of Sheffield, Sheffield, United Kingdom and the Christian Medical College, Vellore, India for providing basic infrastructure required for the study. Author Contribution N.K.D.R.: conception, investigation, funding acquisition, data curation, formal analysis, supervision, writing the original draft and review. D.P.M.S.: investigation, data curation, formal analysis, writing the original draft of the manuscript and contributed equally to this work as first author. A.G.: methodology, data acquisition, curation. D.M.: methodology, bacteria identification, clinical collection. A.B.: Bioinformatics analysis, methodology, validation. D.L.W.: supervision, critical review and editing of the manuscript. P.N.M.: supervision, critical review and editing of the manuscript. E.K.: supervision, critical review and editing of the manuscript. B.V.: supervision, critical review and editing of the manuscript. Data availability Raw and processed data is available through SRA (NCBI BioProject PRJNA1060935) under the accession SRX23131011 to SRX23131018. Ethics approval The study was approved by the Institutional Review Board and Ethical Committee, Christian Medical College, Vellore, India (IRB No.: 11940 dt 27-03-2019). The study was conducted according to the guidelines and protocols approved by the Institution. References Piperaki, E.T., Syrogiannopoulos, G.A., Tzouvelekis, L.S. and Daikos, G.L., 2017. Klebsiella pneumoniae: virulence, biofilm and antimicrobial resistance. The Pediatric infectious disease journal, 36 (10), pp.1002–1005. Wu, M.C., Lin, T.L., Hsieh, P.F., Yang, H.C. and Wang, J.T., 2011. Isolation of genes involved in biofilm formation of a Klebsiella pneumoniae strain causing pyogenic liver abscess. PloS one, 6 (8), p.e23500. Pal, S., Verma, J., Mallick, S., Rastogi, S.K., Kumar, A. and Ghosh, A.S., 2019. Absence of the glycosyltransferase WcaJ in Klebsiella pneumoniae ATCC13883 affects biofilm formation, increases polymyxin resistance and reduces murine macrophage activation. Microbiology, 165 (8), pp.891–904. Chen, L., Wilksch, J.J., Liu, H., Zhang, X., Torres, V.V., Bi, W., Mandela, E., Cao, J., Li, J., Lithgow, T. and Zhou, T., 2020. Investigation of LuxS-mediated quorum sensing in Klebsiella pneumoniae. Journal of medical microbiology , 69 (3), p.402. Zheng, J.X., Lin, Z.W., Chen, C., Chen, Z., Lin, F.J., Wu, Y., Yang, S.Y., Sun, X., Yao, W.M., Li, D.Y. and Yu, Z.J., 2018. Biofilm formation in Klebsiella pneumoniae bacteremia strains was found to be associated with CC23 and the presence of wcaG. Frontiers in cellular and infection microbiology , 8 , p.21. Alcántar-Curiel, M.D., Blackburn, D., Saldaña, Z., Gayosso-Vázquez, C., Iovine, N., De la Cruz, M.A. and Girón, J.A., 2013. Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation. Virulence, 4 (2), pp.129–138. Hasani, A., Soltani, E., Ahangarzadeh Rezaee, M., Pirzadeh, T., Ahangar Oskouee, M., Hasani, A., Gholizadeh, P., Noie Oskouie, A. and Binesh, E., 2020. Serotyping of Klebsiella pneumoniae and its relation with capsule-associated virulence genes, antimicrobial resistance pattern, and clinical infections: a descriptive study in medical practice. Infection and Drug Resistance, pp.1971–1980. Vuotto, C., Longo, F., Balice, M.P., Donelli, G. and Varaldo, P.E., 2014. Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens, 3 (3), pp.743–758. Wannigama, D.L., Shein, A.M.S., Hurst, C., Monk, P.N., Hongsing, P., Phattharapornjaroen, P., Ditcham, W.G.F., Ounjai, P., Saethang, T., Chantaravisoot, N. and Wapeesittipan, P., 2023. Ca-EDTA restores the activity of ceftazidime-avibactam or aztreonam against carbapenemase-producing Klebsiella pneumoniae infections. Iscience , 26 (7), p.107215. Kot, B., Piechota, M., Szweda, P., Mitrus, J., Wicha, J., Grużewska, A. and Witeska, M., 2023. Virulence analysis and antibiotic resistance of Klebsiella pneumoniae isolates from hospitalised patients in Poland. Scientific Reports , 13 (1), p.4448. Černohorská, L. and Votava, M., 2004. Determination of minimal regrowth concentration (MRC) in clinical isolates of various biofilm-forming bacteria. Folia microbiologica, 49 (1), pp.75–78. Bernardi, S., Anderson, A., Macchiarelli, G., Hellwig, E., Cieplik, F., Vach, K. and Al-Ahmad, A., 2021. Subinhibitory antibiotic concentrations enhance biofilm formation of clinical Enterococcus faecalis isolates. Antibiotics , 10 (7), p.874. Devanga Ragupathi, Naveen Kumar, Dhiviya Prabaa Muthuirulandi Sethuvel, Hariharan Triplicane Dwarakanathan, Dhivya Murugan, Yamini Umashankar, Peter N. Monk, Esther Karunakaran, and Balaji Veeraraghavan. "The influence of biofilms on carbapenem susceptibility and patient outcome in device associated K. pneumoniae infections: insights into phenotype vs genome-wide analysis and correlation." Frontiers in microbiology 11 (2020): 591679. Ashwath P., Deekshit V. K., Rohit A., Dhinakaran I., Karunasagar I., Karunasagar I., et al.. (2022). Biofilm formation and associated gene expression in multidrug-resistant Klebsiella pneumoniae isolated from clinical specimens. Curr. Microbiol. 79:73. doi: 10.1007/s00284-022-02766-z Jagnow, J. and Clegg, S., 2003. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix-and collagen-coated surfaces. Microbiology, 149 (9), pp.2397–2405. Bellifa, S., Hassaine, H., Balestrino, D., Charbonnel, N., M’hamedi, I., Terki, I.K., Lachachi, M., Didi, W. and Forestier, C., 2013. Evaluation of biofilm formation of Klebsiella pneumoniae isolated from medical devices at the University Hospital of Tlemcen, Algeria. Afr J Microbiol Res, 7 (49), pp.5558–64. Mahmood, M.T. and Abdullah, B.A., 2015. The relationship between biofilm formation and presence of fimH and mrkD genes among E. coli and K. pneumoniae isolated from patients in Mosul. Mosul Journal of Nursing, 3 (1), pp.34–42. Schurtz, T. A., D. B. Hornick, T. K. Korhonen, and S. Clegg. 1994. “The Type 3 Fimbrial Adhesin Gene (MrkD) of Klebsiella Species Is Not Conserved among All Fimbriate Strains.” Infection and Immunity 62(10):4186–91. Sebghati, T.A.S., Korhonen, T.K., Hornick, D.B. and Clegg, S., 1998. Characterization of the type 3 fimbrial adhesins of Klebsiella strains. Infection and immunity, 66 (6), pp.2887–2894. Itoh, Y., Rice, J.D., Goller, C., Pannuri, A., Taylor, J., Meisner, J., Beveridge, T.J., Preston III, J.F. and Romeo, T., 2008. Roles of pgaABCD genes in synthesis, modification, and export of the Escherichia coli biofilm adhesin poly-β-1, 6-N-acetyl-D-glucosamine. Journal of bacteriology, 190 (10), pp.3670–3680. Lau, Y.Y., How, K.Y., Yin, W.F. and Chan, K.G., 2020. Functional characterization of quorum sensing LuxR-type transcriptional regulator, EasR in Enterobacter asburiae strain L1. PeerJ , 8 , p.e10068. Chen, L., Wilksch, J.J., Liu, H., Zhang, X., Torres, V.V., Bi, W., Mandela, E., Cao, J., Li, J., Lithgow, T. and Zhou, T., 2020. Investigation of LuxS-mediated quorum sensing in Klebsiella pneumoniae. Journal of medical microbiology , 69 (3), p.402. Ca, P., Sa, L., SVb, R. and Shanmugamc, G., 2018. Comparative modeling and molecular docking studies of quorum sensing transcriptional regulating factor SdiA from Klebsiella pneumoniae. Int. J. Cur. Res. Eng. Sci. Tech. ISSN , 2581 , p.4311. Clinical and Laboratory Standards Institute. 2021. Performance standards for antimicrobial susceptibility testing—31st ed. Clinical and Laboratory Standards Institute, Wayne, PA. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure.docx Cite Share Download PDF Status: Published Journal Publication published 09 Oct, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 19 Apr, 2024 Reviews received at journal 18 Apr, 2024 Reviews received at journal 18 Apr, 2024 Reviewers agreed at journal 05 Apr, 2024 Reviewers agreed at journal 05 Apr, 2024 Reviewers agreed at journal 05 Apr, 2024 Reviewers invited by journal 05 Apr, 2024 Editor assigned by journal 15 Feb, 2024 Editor invited by journal 16 Jan, 2024 Submission checks completed at journal 16 Jan, 2024 First submitted to journal 15 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3758116","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":267570533,"identity":"d38e351d-0b40-45d4-a14e-52e17df13466","order_by":0,"name":"Naveen Kumar Devanga Ragupathi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYDCCAwwGUBYbmJQDCz4gRYsxWDCBFC2JDSASnxa+24e3fS6oOSzHL92WJnWj5l76/LDDD4G22MnpNmDXInkurXj2jGOHjSXnHDsmnXOsOHfj7TQDoJZkY7MD2LUYnOExZuZhS0vccCO9TTqHLSF34+wEkJYDidvwavmXVr8frOVfQrrh7PQPhLXwttkkGEikHZPObUtIkJfOwW+L5Bm2YmbePhvDGTfSkq1z+xIMN0jnFBxIMMDtF74zzJuZeb5JyPPPSDO8nfMtQV5+dvrmDx8q7ORwacHiVLBKAwKqUIB8AymqR8EoGAWjYCQAAGg7X0ipUcdiAAAAAElFTkSuQmCC","orcid":"","institution":"The University of Sheffield","correspondingAuthor":true,"prefix":"","firstName":"Naveen","middleName":"Kumar Devanga","lastName":"Ragupathi","suffix":""},{"id":267570534,"identity":"b7a8046f-d62b-4846-a23a-7b89ef6c99be","order_by":1,"name":"Dhiviya Prabaa Muthuirulandi Sethuvel","email":"","orcid":"","institution":"Christian Medical College","correspondingAuthor":false,"prefix":"","firstName":"Dhiviya","middleName":"Prabaa Muthuirulandi","lastName":"Sethuvel","suffix":""},{"id":267570535,"identity":"06d53f73-6b87-4282-9033-e091b970bac3","order_by":2,"name":"Anju G","email":"","orcid":"","institution":"Christian Medical College","correspondingAuthor":false,"prefix":"","firstName":"Anju","middleName":"","lastName":"G","suffix":""},{"id":267570536,"identity":"916c2eec-eb5b-4a0e-b065-90887ce8b695","order_by":3,"name":"Dhivya Murugan","email":"","orcid":"","institution":"Christian Medical College","correspondingAuthor":false,"prefix":"","firstName":"Dhivya","middleName":"","lastName":"Murugan","suffix":""},{"id":267570537,"identity":"950df46c-6cc3-40d7-a86c-d7393bf8ee77","order_by":4,"name":"Ashtawarthani Baskaran","email":"","orcid":"","institution":"Christian Medical College","correspondingAuthor":false,"prefix":"","firstName":"Ashtawarthani","middleName":"","lastName":"Baskaran","suffix":""},{"id":267570538,"identity":"fefc9c3f-81c8-43e0-b2e0-e2afa6c69f58","order_by":5,"name":"Dhammika Leshan Wannigama","email":"","orcid":"","institution":"Chulalongkorn University, King Chulalongkorn Memorial Hospital, Thai Red Cross Society","correspondingAuthor":false,"prefix":"","firstName":"Dhammika","middleName":"Leshan","lastName":"Wannigama","suffix":""},{"id":267570539,"identity":"14d301ce-96ad-472c-af8d-745fcb04a2b6","order_by":6,"name":"Peter N. Monk","email":"","orcid":"","institution":"The University of Sheffield","correspondingAuthor":false,"prefix":"","firstName":"Peter","middleName":"N.","lastName":"Monk","suffix":""},{"id":267570540,"identity":"88e9642f-c34d-4c4a-ad38-c31d1030fcf2","order_by":7,"name":"Esther Karunakaran","email":"","orcid":"","institution":"The University of Sheffield","correspondingAuthor":false,"prefix":"","firstName":"Esther","middleName":"","lastName":"Karunakaran","suffix":""},{"id":267570541,"identity":"b0e935cc-47dc-4992-832b-53a3cfc5b0ac","order_by":8,"name":"Balaji Veeraraghavan","email":"","orcid":"","institution":"Christian Medical College","correspondingAuthor":false,"prefix":"","firstName":"Balaji","middleName":"","lastName":"Veeraraghavan","suffix":""}],"badges":[],"createdAt":"2023-12-15 10:29:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3758116/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3758116/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-69232-7","type":"published","date":"2024-10-09T15:56:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49804448,"identity":"fb344b1c-ac59-4736-a6bb-5740b9724c2c","added_by":"auto","created_at":"2024-01-18 09:48:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":29457,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of sample types included in the study A) and biofilm forming capacity of the \u003cem\u003eK. pneumoniae\u003c/em\u003eclinical strains B).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3758116/v1/87f0eebf16bfcf04669a94f1.png"},{"id":49804449,"identity":"e87d3edf-d56a-4e06-a171-ad14c4a227c9","added_by":"auto","created_at":"2024-01-18 09:48:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":65036,"visible":true,"origin":"","legend":"\u003cp\u003eMetagenomic data revealing percentage OTU abundance for genus-wise distribution of reads among metagenome-sequenced ETA/BAL samples A) Graph showing highly abundant genera between culture positive and negative group B).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3758116/v1/9b899f2107859279af497708.png"},{"id":66597040,"identity":"33eed33a-2454-4f16-b654-7703314a51be","added_by":"auto","created_at":"2024-10-14 16:05:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":790892,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3758116/v1/0d4f165b-5a25-4159-8c74-c10da23cbff9.pdf"},{"id":49804450,"identity":"fbb0baf5-87cc-47bb-8178-5cff989beafb","added_by":"auto","created_at":"2024-01-18 09:48:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":241891,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-3758116/v1/bb374c550f0a0de14bfa64ef.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Evaluation of genomic markers mrkD, pgaC and wcaJ involved in biofilm formation to aid in rapid screening of K. pneumoniae biofilms from endotracheal aspirates and bronchoalveolar lavage","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e is an opportunistic Gram-negative pathogen frequently implicated in catheter associated and urinary tract infection. \u003cem\u003eK. pneumoniae\u003c/em\u003e promotes colonization of gastrointestinal and respiratory tracts that leads to weakened immune functions and involves in the development of invasive infections in hospitalized patients. This has become a serious threat worldwide due to the spread of hypervirulent and antibiotic resistance strains presenting high mortality and morbidity rate.\u003c/p\u003e \u003cp\u003e \u003cem\u003eK. pneumoniae\u003c/em\u003e is one of the important nosocomial pathogens with potential to form biofilms \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e and are clinically significant in patients associated with devices. \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms developed on the solid surfaces promote cell adherence, formation of microcolonies, maturation and finally dispersal as free-living cells. Capsular polysaccharides and fimbriae (type 3) are factors that play vital roles in forming important surface structures. Fimbriae maintain the stable adherence, whereas capsular polysaccharides affect the communication between cells and the structure of biofilm. Immune defences against cells of \u003cem\u003eK. pneumoniae\u003c/em\u003e are protected partially by biofilms which contributes to the drug resistance\u003csup\u003e1\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe clinical \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilm formation mechanism is associated with a series of genes, includes allantoin (\u003cem\u003eallS\u003c/em\u003e), capsular polysaccharide (CPS) (\u003cem\u003etreC\u003c/em\u003e, \u003cem\u003ecpsD\u003c/em\u003e, \u003cem\u003ewzc\u003c/em\u003e, \u003cem\u003ewabG\u003c/em\u003e, \u003cem\u003ewcaG\u003c/em\u003e, \u003cem\u003ermpA\u003c/em\u003e/\u003cem\u003eA2\u003c/em\u003e, \u003cem\u003ewzyk2\u003c/em\u003e and \u003cem\u003emagA\u003c/em\u003e), aerobactin (\u003cem\u003eiutA\u003c/em\u003e), polysaccharides and adhesins (\u003cem\u003epgaA\u003c/em\u003e, \u003cem\u003epgaB\u003c/em\u003e, \u003cem\u003epgaC\u003c/em\u003e, and \u003cem\u003ebcsA\u003c/em\u003e), type 1 (\u003cem\u003efimA\u003c/em\u003e and \u003cem\u003efimH\u003c/em\u003e) and type 3 fimbriae (\u003cem\u003emrkD\u003c/em\u003e and \u003cem\u003emrkA\u003c/em\u003e), quorum sensing (QS) (\u003cem\u003eluxS\u003c/em\u003e) and colonic acid\u003csup\u003e2,3,4,5,6,7\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eEradication of the biofilm cells is challenging when compared with planktonic cells. \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms are highly resistant to almost all commonly used antibiotics\u003csup\u003e8\u003c/sup\u003e. Antimicrobial susceptibility testing (AST) is difficult in biofilm situations. Biofilms and the analysis of the increased requirement of drug concentrations for their eradication need special equipment and expertise. However, limited data are available on the effectiveness of ceftazidime/avibactam, aztreonam and colistin against biofilm infections unlike beta-lactams which have poor penetration capacity in biofilm structures\u003csup\u003e9\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe rapid detection of \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilm can achieve early isolation and treatment to prevent further spread. Specific biomarkers to screen for \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms using real-time (RT) PCR method will ensure early detection with utmost sensitivity and specificity. Timely detection of biofilm-forming pathogens is essential to appropriately treat the infection with the right dose and combinations. The present study focusses on evaluating the markers \u003cem\u003emrk\u003c/em\u003eD, \u003cem\u003epga\u003c/em\u003eC and \u003cem\u003ewca\u003c/em\u003eJ to screen for biofilm-forming \u003cem\u003eK. pneumoniae\u003c/em\u003e from clinical specimens.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eAmong 351 isolates of \u003cem\u003eK. pneumoniae\u003c/em\u003e tested from blood stream infected patients, \u0026sim;60% were found to be carbapenem susceptible, followed by minocycline and chloramphenicol, with 65 and 60% susceptibility, respectively. Amikacin and netilmicin found to be 59% susceptible. In contrast, most of other tested antimicrobials showed\u0026thinsp;\u0026lt;\u0026thinsp;55% susceptibility. Among 114 isolates of \u003cem\u003eK. pneumoniae\u003c/em\u003e tested from patients with respiratory infections (ETA/BAL), 46% were carbapenem susceptible, followed by gentamicin and tobramycin, with 89 and 47% susceptibility, respectively. In contrast, most of other tested antimicrobials showed\u0026thinsp;\u0026lt;\u0026thinsp;45% susceptibility.\u003c/p\u003e \u003cp\u003e33 ETA, 9 BAL samples and 66 clinical \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates (blood and ETA/BAL) were included for RT-PCR assay standardization. \u003cem\u003emrk\u003c/em\u003eD, \u003cem\u003epga\u003c/em\u003eC and \u003cem\u003ewca\u003c/em\u003eJ genes as evaluated by RT-PCR exhibited decrease in Ct values with increasing concentration of RNA (Figure S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm forming capacity\u003c/h2\u003e \u003cp\u003eOut of 66 isolates screened for the biofilm formation, 20 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were strong biofilm producers, 16 isolates were moderate biofilm producers and 30 isolates were weak biofilm producers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003cp\u003e \u003cb\u003eRT-PCR based identification of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003efrom isolates\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe samples that contain \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilm producers express \u003cem\u003emrk\u003c/em\u003eD and \u003cem\u003epga\u003c/em\u003eC with low Ct values, whereas the samples with other pathogens are undetermined or \u0026ge;\u0026thinsp;30 Ct for \u003cem\u003emrk\u003c/em\u003eD and \u0026gt;\u0026thinsp;30 for \u003cem\u003epga\u003c/em\u003eC genes, respectively. The RT-PCR interpretative criteria for biofilm/non-biofilm \u003cem\u003eK. pneumoniae\u003c/em\u003e are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Using RT-PCR, all clinical \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were positive for \u003cem\u003emrk\u003c/em\u003eD and \u003cem\u003epga\u003c/em\u003eC, while borderline for \u003cem\u003ewca\u003c/em\u003eJ. This showed 100% sensitivity and specificity in comparison to conventional microbiological tests (CMT) for identification of \u003cem\u003eK. pneumoniae\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRT-PCR based identification of\u003c/b\u003e \u003cb\u003eK. pneumoniae\u003c/b\u003e \u003cb\u003efrom direct samples\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFor evaluation, 76 ETA/BAL samples were subjected to RT-PCR assay. Of which, 44 were culture positive and 32 were culture negative for \u003cem\u003eK. pneumoniae\u003c/em\u003e. All culture-positive samples were also positive for marker genes \u003cem\u003emrk\u003c/em\u003eD and \u003cem\u003epga\u003c/em\u003eC in RT-PCR. However, 20 culture-negative samples were also picked as positives by RT-PCR. The sensitivity and specificity calculated in comparison to the culture method as gold standard is given in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The sensitivity of the assay to detect \u003cem\u003eK. pneumoniae\u003c/em\u003e in samples has a limit of detection as low as 1 ng/\u0026micro;l total RNA.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInterpretative criteria for \u003cem\u003eK. pneumoniae\u003c/em\u003e RT-PCR from direct sample\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emrk\u003c/em\u003eD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003epga\u003c/em\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ewca\u003c/em\u003eJ\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBiofilm forming\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNon-biofilm forming\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNon-Klebsiella\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSensitivity and specificity of RT-PCR to detect \u003cem\u003eK. pneumoniae\u003c/em\u003e from direct patient samples\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;76\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture\u0026thinsp;+\u0026thinsp;ve\u003c/p\u003e \u003cp\u003e(\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;44)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCulture -ve\u003c/p\u003e \u003cp\u003e(\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;32)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT-PCR\u0026thinsp;+\u0026thinsp;ve\u003c/p\u003e \u003cp\u003e(\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;64)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e44 (TP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20 (FP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePPV =\u003c/p\u003e \u003cp\u003eTP/(TP/FP) =\u003c/p\u003e \u003cp\u003e44/64\u0026thinsp;=\u0026thinsp;68.75%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT-PCR -ve\u003c/p\u003e \u003cp\u003e(\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0 (FN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12 (TN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNPV\u0026thinsp;=\u0026thinsp;TN/(TN\u0026thinsp;+\u0026thinsp;FN)\u0026thinsp;=\u0026thinsp;12/(12)\u0026thinsp;=\u0026thinsp;100%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSensitivity \u0026ndash; TP/(TP\u0026thinsp;+\u0026thinsp;FN)\u0026thinsp;=\u0026thinsp;100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSpecificity \u0026ndash; TN/(TN\u0026thinsp;+\u0026thinsp;FP)\u0026thinsp;=\u0026thinsp;12/32\u0026thinsp;=\u0026thinsp;37.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eTP \u0026ndash; true positives, TN \u0026ndash; true negatives, FP \u0026ndash; false positives, FN \u0026ndash; false negatives, PPV \u0026ndash; positive predictive value, NPV \u0026ndash; negative predictive value\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMetagenomics of direct samples\u003c/h2\u003e \u003cp\u003eA total of 6 ETA and 2 BAL samples were included for metagenome sequencing. Of these, 5 ETA and 2 BAL samples were positive for \u003cem\u003eK. pneumoniae\u003c/em\u003e by RT-PCR. 16S rRNA metagenomic sequencing revealed the presence of \u003cem\u003eKlebsiella\u003c/em\u003e reads in all these RT-PCR positive samples. Of these 8 samples, four were culture positive and four were culture negative for \u003cem\u003eK. pneumoniae\u003c/em\u003e. All culture positives were positive also in RT-PCR and metagenomics. Whereas, among four culture negatives, three were positive by RT-PCR and metagenomics. Remaining one culture negative sample was confirmed to be truly negative by RT-PCR and metagenomics (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA depicts the abundance of various genus identified among the eight sequenced samples, where \u003cem\u003eKlebsiella\u003c/em\u003e reads from culture positive and negative groups correlate with the RT-PCR results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Results of the culture-negative RT-PCR-positive group confirms the sensitivity of RT-PCR assay to be 100% for identification of \u003cem\u003eK. pneumoniae\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e\u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003eTable 3:\u003c/strong\u003e Confirmation of culture-negative vs RT-PCR positives using 16S metagenomics\u003c/p\u003e\n\u003ctable style=\"width:474.45pt;border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eSample id\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eSample type\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eOrganism identified in culture\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003emrk\u003c/span\u003e\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eD\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003epga\u003c/span\u003e\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eC\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003ewca\u003c/span\u003e\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eJ\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;background:#002060;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:white;\"\u003eMetagenome KPN Reads\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP1385\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eETA\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eNFGNB, B. cenocepacia, C. albicans/glabrata\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 1475\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eBAL\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eNormal flora\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 1487\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eETA\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eStenotrophomonas maltophilia, Acinetobacter baumannii\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 2545\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eETA\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;background:#FBE4D6;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eABC, NFGNB (burkholderia)\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;background:#FBE4D5;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;background:#FBE4D5;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;background:#FBE4D5;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;background:#FBE4D5;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eAbsent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 1460\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eETA\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eStenotrophomonas maltophilia, Acinetobacter baumannii,\u003c/span\u003e\u003c/em\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:#0432FF;\"\u003e\u0026nbsp;Klebsiella pneumoniae\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 2438\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eETA\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:#0432FF;\"\u003eKlebsiella\u003c/span\u003e\u003c/em\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e, Escherichia coli\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 3804\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eBAL\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:#0432FF;\"\u003eKlebsiella\u003c/span\u003e\u003c/em\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e, Escherichia coli\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:.85in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eSP 1401\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:69.45pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cstrong\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003eETA\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:134.7pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePseudomonas aeruginosa,\u0026nbsp;\u003c/span\u003e\u003c/em\u003e\u003cem\u003e\u003cspan style=\"font-size:12px;line-height: 115%;color:#0432FF;\"\u003eKlebsiella pneumoniae\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:49.6pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:60.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:22.5pt;\"\u003e\n \u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:12px;line-height:115%;color:black;\"\u003ePresent\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style='margin:0in;font-size:16px;font-family:\"Times New Roman\",serif;text-align:justify;line-height:115%;'\u003e\u003cspan style=\"font-size:13px;line-height:115%;\"\u003e+ \u0026nbsp;is \u0026lt;30 Ct values; - is \u0026ge;30 Ct values by RT-PCR; KPN \u0026ndash; \u003cem\u003eK. pneumoniae\u003c/em\u003e\u003c/span\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAntimicrobial resistance is the increasing challenge in healthcare associated infections. \u003cem\u003eK. pneumoniae\u003c/em\u003e is one of the main causes of nosocomial infections especially among immunocompromised individuals with increasing resistance rates. Drug resistance and virulence such as its biofilm forming ability are the key factors involved in the persistence of infections\u003csup\u003e10\u003c/sup\u003e. These factors found to have a significant association with the clinical outcomes. Currently, increasing AMR in \u003cem\u003eK. pneumoniae\u003c/em\u003e have become a worldwide problem and there is still very limited data regarding biofilm producing \u003cem\u003eK. pneumoniae\u003c/em\u003e in India. These biofilms forming \u003cem\u003eK. pneumoniae\u003c/em\u003e are highly resistance to many commonly used antibiotics thus making the current treatment challenging.\u003c/p\u003e \u003cp\u003eThe situation become more complicated when biofilm producing organisms are treated with inappropriate antibiotics and with insufficient concentrations. For instance, biofilms can resist empiric antibiotic therapy and contribute to bacterial persistence in chronic infections that result in high morbidity and mortality. Antibiotics such as piperacillin, piperacillin/tazobactam, cefoperazone, ceftazidime, cefepime, meropenem, ciprofloxacin, netilmicin and amikacin were reported to show reduced activity against adherent bacteria when compared to the planktonic counterparts\u003csup\u003e11\u003c/sup\u003e. In addition, several studies have shown that certain antibiotics induce biofilm formation when treated with sub-inhibitory concentration\u003csup\u003e12\u003c/sup\u003e. For this reason, early detection of biofilm forming nosocomial pathogens mainly from high dependency units is crucial. The present study was designed to inform the clinicians in identifying and choosing the appropriate antibiotic therapy for biofilm mediated infections.\u003c/p\u003e \u003cp\u003eThe key aspect of this study was to develop a diagnostic assay that uses a set of virulence genes of \u003cem\u003eK. pneumoniae\u003c/em\u003e as a marker. Currently, there are no rapid diagnostic methods available to identify \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms from clinical isolates and direct samples. Conventional assays take 48\u0026ndash;72 hrs for identification of \u003cem\u003eK. pneumoniae\u003c/em\u003e and biofilm formation ability. This assay based on real-time (RT)-PCR provided an added advantage by offering information on the biofilm forming ability of \u003cem\u003eK. pneumoniae\u003c/em\u003e as well as confirming the identity of the pathogen in a short span.\u003c/p\u003e \u003cp\u003eAmong the various genes responsible for the biofilm production, \u003cem\u003emrk\u003c/em\u003e (Type 3 fimbriae) and \u003cem\u003epga\u003c/em\u003eC (polysaccharide adhesion) are the candidate genes linked with biofilm formation in \u003cem\u003eK. pneumoniae\u003c/em\u003e and has shown to promote strong biofilm formation, enabling surface adhesion\u003csup\u003e13\u003c/sup\u003e. Studies have indicated that \u003cem\u003emrkA\u003c/em\u003e gene contributes to rapid biofilm formation while \u003cem\u003emrkD\u003c/em\u003e responsible for dense \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms\u003csup\u003e14,15,16,17\u003c/sup\u003e. MrkD, a fimbrial adhesin from \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, causes adherence to the basement membranes of tissues and the basolateral surfaces of renal and pulmonary epithelia. This adhesin, which is an extracellular matrix binding protein, has been demonstrated to bind to type V collagen. Even though all isolates containing the MrkD adhesin induce the agglutination of erythrocytes treated with tannic acid in vitro, the \u003cem\u003emrk\u003c/em\u003eD gene is not conserved across species. The ability of a plasmid-borne mrkD gene product to induce type V collagen binding is usually associated with \u003cem\u003eK. oxytoca\u003c/em\u003e strains and seldom with \u003cem\u003eK. pneumoniae\u003c/em\u003e strains. The MrkD adhesin is a chromosomally borne adhesin that mediates binding to collagen types IV and V in \u003cem\u003eK. pneumoniae\u003c/em\u003e\u003csup\u003e18,19\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eSimilarly, \u003cem\u003epga\u003c/em\u003eC also reported to serves as an adhesion factor for the initiation and maintenance of biofilm structure\u003csup\u003e20\u003c/sup\u003e. \u003cem\u003epga\u003c/em\u003eC is known to be closely associated with \u003cem\u003epga\u003c/em\u003eB/D, a biofilm adhesin polysaccharide and \u003cem\u003elux\u003c/em\u003eR gene, an \u003cem\u003eN\u003c/em\u003e-acyl homoserine lactone (AHL)-dependent transcriptional regulator. AHL is one of the most common quorum sensing (QS) mechanism utilized by Proteobacteria\u003csup\u003e21\u003c/sup\u003e. QS is a well-established mechanism in the process of biofilm formation\u003csup\u003e22\u003c/sup\u003e. LuxR protein plays a key role in QS mechanism in most of the Gram-negative bacteria by detecting the presence of signalling molecules which enable inter- and intra-species interaction in response to external stimuli according to population density\u003csup\u003e23\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFurthermore, \u003cem\u003ein-silico\u003c/em\u003e screening of the clinical \u003cem\u003eK. pneumoniae\u003c/em\u003e genomes available in the public database revealed that 98%, 99.3% and 34.6% of the genomes carried \u003cem\u003emrk\u003c/em\u003eD, \u003cem\u003epga\u003c/em\u003eC and \u003cem\u003ewca\u003c/em\u003eJ genes\u003csup\u003e13\u003c/sup\u003e. It was also found that \u003cem\u003emrk\u003c/em\u003eD and \u003cem\u003epga\u003c/em\u003eC genes were present in all biofilm forming \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates in the present study. This indicates their conservation in \u003cem\u003eK. pneumoniae\u003c/em\u003e strains and the specificity of the chosen targets in the detection of \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms from clinical samples.\u003c/p\u003e \u003cp\u003eOccasionally, some strains of \u003cem\u003eK. pneumoniae\u003c/em\u003e may lose their fimbriae during culturing or may lack this fimbriae gene\u003csup\u003e17\u003c/sup\u003e. This issue has been addressed by using more than one target as demonstrated in the present study to ensure the reliability of the assay. Interestingly, the PCR panel evaluated in this study identified \u003cem\u003eK. pneumoniae\u003c/em\u003e from the samples that were even culture-negative, showing the high sensitivity of the assay. Further, the samples that were PCR positive and culture negative were confirmed by 16S metagenomics to have \u003cem\u003eKlebsiella\u003c/em\u003e reads. This could be due to the limited sensitivity of the culture method, or lesser load of the pathogen. In such cases, treatment with broad spectrum antibiotics will be helpful since \u003cem\u003eKlebsiella\u003c/em\u003e in this individual may or may not be associated with the infection due to its low bacterial load. However, this approach also has its limitations where the patient may be over-treated leading to the development of drug resistance. To avoid this difficulty, the RT-PCR results can be coupled with clinical diagnosis to make this an accurate diagnostic tool.\u003c/p\u003e \u003cp\u003eFurther, \u003cem\u003ewca\u003c/em\u003eJ gene appears to act as a negative regulator, where its absence indicates the high potential of biofilm-forming capacity of the strain. The hypothesis was supported by earlier study by Pal et al, where they demonstrated that the inactivation of the \u003cem\u003ewcaJ\u003c/em\u003e gene results in the disruption of colanic acid synthesis and enhances the biofilm formation in \u003cem\u003eK. pneumoniae\u003c/em\u003e\u003csup\u003e3\u003c/sup\u003e. Based on the observed results for known positives and negatives, the cut off for Ct values to define negatives were \u0026ge;\u0026thinsp;30 Ct for \u003cem\u003emrk\u003c/em\u003eD and \u0026gt;\u0026thinsp;30 for \u003cem\u003epga\u003c/em\u003eC genes. However, this needs further standardization with a higher number of clinical samples.\u003c/p\u003e \u003cp\u003eAntimicrobial resistance rates among biofilm forming bacteria are higher compared to its planktonic forms and above the breakpoints proposed for therapeutic clinical use. This shows that treatment of biofilms with standard antimicrobial therapy would be unhelpful mainly among patients in high dependency units. This may also explain the treatment failure in some patients, despite susceptibility to antimicrobials \u003cem\u003ein vitro\u003c/em\u003e, to result in clinical resistance. The PCR evaluated in this study in combination with clinical diagnosis will help in early detection of \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms in critically ill patients and for their appropriate treatment either with high-dosage broad spectrum antimicrobials or with combinations.\u003c/p\u003e \u003cp\u003eIn conclusion, the PCR assay standardized in this study is the first of its kind for rapid identification of biofilm forming \u003cem\u003eK. pneumoniae\u003c/em\u003e from clinical samples. Considering the limited resource settings like primary health laboratories, the cost of the PCR test and maintenance of the sample integrity might be the limiting factors. Overall, the results of the study highlight that the rapid detection of \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms based on the real time PCR results coupled with clinical conditions would be appropriate to treat emerging infections or to prevent re-infections in the clinical settings.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStudy Samples\u003c/h2\u003e \u003cp\u003eThe study includes direct respiratory samples (ETA/BAL) received for routine bacteriological culture at the Department of Clinical Microbiology from patients admitted in intensive care units at Christian Medical College, Vellore, India. For this study, samples were used after the routine processing for which it was collected. \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates obtained from these respiratory samples were also included for the evaluation of rapid screening assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial Susceptibility Testing\u003c/h2\u003e \u003cp\u003eAntimicrobial susceptibility testing was performed by the Kirby-Bauer disc diffusion method against cefotaxime (30 \u0026micro;g), ceftazidime (30 \u0026micro;g), cefuroxime (30 \u0026micro;g), cefepime (30 \u0026micro;g), piperacilllin-tazobactam (100/10 \u0026micro;g), cefoperazone-sulbactam (75/30 \u0026micro;g), levofloxacin (5 \u0026micro;g), trimethoprim-sulfamethoxazole (75/30 \u0026micro;g), meropenem (10 \u0026micro;g), ertapenem (10 \u0026micro;g), amikacin (30 \u0026micro;g), gentamycin (10 \u0026micro;g), tobramycin (30 \u0026micro;g) according to CLSI, 2021 guidelines\u003csup\u003e24\u003c/sup\u003e. Quality control strains used were \u003cem\u003eEscherichia coli\u003c/em\u003e ATCC 25922 for all antibiotics concurrently in all the batches. Tigecycline results were interpreted according to FDA criteria.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm Screening Assay\u003c/h2\u003e \u003cp\u003eThe screening assay was performed as described previously by Naveen Kumar et al, 2020. Briefly, about 5 to 10 fresh colonies were inoculated into a 10 ml LB broth and incubated at 37\u0026deg;C for 12\u0026ndash;18 h. The optical density (OD) was measured in a spectrophotometer (Shimadzu, Kyoto, Japan) at 625 nm and 0.05 OD cells prepared by dilution in Mueller-Hinton broth (MHB) containing 1% glucose. OD adjusted cells were inoculated into a 96-well plate and incubated at 37\u0026deg;C for 24 hours. After 24 hrs of incubation, the medium was removed, and the biofilm was washed with 200 \u0026micro;l of distilled water. The biofilm was later stained with 200 \u0026micro;l 0.1% (w / v) crystal violet dye and incubated for 10 min at RT. OD was read at 570 nm after de-stained with glacial acetic acid followed by 5 mins incubation at RT. The assay was performed in triplicate. Broth without cells was used as a negative control. The biofilm production was classified as: OD\u0026thinsp;\u0026lt;\u0026thinsp;ODc\u0026thinsp;=\u0026thinsp;poor biofilm producer; ODc\u0026thinsp;\u0026lt;\u0026thinsp;OD\u0026thinsp;\u0026le;\u0026thinsp;2 \u0026times; ODc\u0026thinsp;=\u0026thinsp;weak biofilm producer; 2 \u0026times; ODc\u0026thinsp;\u0026lt;\u0026thinsp;OD\u0026thinsp;\u0026lt;\u0026thinsp;4 \u0026times; ODc\u0026thinsp;=\u0026thinsp;moderate biofilm producer; and OD\u0026thinsp;\u0026ge;\u0026thinsp;4 \u0026times; ODc\u0026thinsp;=\u0026thinsp;strong biofilm producer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRNA Isolation using Guanidinium Isothiocyanate\u003c/h2\u003e \u003cp\u003eGuanidinium Isothiocyanate (GITC) is a chaotropic agent which disrupts cells, denatures proteins, and deactivates nucleases, thereby stabilizing the nucleic acid. Briefly, a 10 \u0026micro;l loop full of bacteria was suspended in 400 \u0026micro;l of saline and 400 \u0026micro;l of GITC lysis buffer (4M GITC, 25mM Tris-HCl). The suspension was vortexed for 15 sec then incubated at 56\u0026deg;C for 15 min on the heating block. After that (96%-100% ethanol) was added and vortexed for 15 sec, after which the lysate was transferred to a spin column and incubated at RT for 5 min. After centrifugation at 6000 x g for 1 min and the supernatant was discarded. RNA was then washed with wash buffer I (0.9 M GITC, 10 mM Tris, 20% EtOH) and wash buffer II (100 mM NaCl, 10 mM Tris-HCl, 80% EtOH). After washing, the spin column dried at 56\u0026deg;C for 3 min. Finally, RNA was eluted in fresh Eppendorf tubes by adding 50 \u0026micro;l of RNase free water into the spin column followed by centrifugation at 6000 x g for 5 min. The quality and purity of the RNA obtained was evaluated using the Qubit and Nanodrop spectrophotometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eReverse Transcriptase PCR\u003c/h2\u003e \u003cp\u003ecDNA was synthesized by Reverse transcriptase kit using 1\u0026micro;l of primer mix, 1\u0026micro;l of Reverse Transcriptase (RT), 4 \u0026micro;l of RT Buffer 5X and 14 \u0026micro;l of RNA template and the reaction mixture was incubated at 42\u0026deg;C for 15 min and then incubate at 95\u0026deg;C for 3 min then the product is kept in ice while preparing reaction mixture for real-time PCR.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eReal Time PCR for detection of biofilm forming K. pneumoniae\u003c/h2\u003e \u003cp\u003eReal-time PCR 7500 Fast DX instrument was used for gene amplification and relative quantification. Amplifications were performed using the instrument\u0026rsquo;s programmed two-step real-time PCR. Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows the primers used for RT-PCR. The total reaction volume (20 \u0026micro;l) was prepared by mixing 10 \u0026micro;l of SYBR Green qPCR master mix, 1 \u0026micro;l of forward primer, 1 \u0026micro;l of reverse primer (2 pmol), 5 \u0026micro;l of template cDNA, and 3 \u0026micro;l of PCR water. The real time PCR cyclic condition was programmed as follows; initial holding at 55\u0026deg;C for 30 min and 94\u0026deg;C for 2 min followed by 40 cycles of 94\u0026deg;C for 15 sec, 55\u0026deg;C for 1 min and 68\u0026deg;C for 1 min.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for Real Time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026rsquo; -3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026rsquo; -3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003emrk\u003c/em\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCACAACGCCTTACTGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTATTCTGCGCTGGTCATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epga\u003c/em\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCCTGTTCCACGCTGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGCTTCCTTTTCCCCGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ewca\u003c/em\u003eJ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAATGGCGTACCGGTTGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGCCCTTTCGAGGTAGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eReal-time quantification of cDNA was carried out on an ABI 7500 PCR detection system (Applied Biosystems, UK) using the SYBR green PCR master mix. Real-time PCR was used to investigate the expression level of \u003cem\u003emrk\u003c/em\u003eD, \u003cem\u003epga\u003c/em\u003eC and \u003cem\u003ewca\u003c/em\u003eJ genes measured by relative quantitation. Relative expression values (R) were determined using the ΔΔCt method. \u003cem\u003errsE\u003c/em\u003e gene was considered as a housekeeping gene and all gene expression levels were normalized to \u003cem\u003errs\u003c/em\u003eE gene. The assay was performed three times for each sample and the mean calculated. Expressions of all genes were calculated using the 2 \u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method (fold). Cycle of threshold (C\u003csub\u003et\u003c/sub\u003e) was considered as the average threshold cycle number from three independent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e16S metagenomic sequencing\u003c/h2\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003eSampling and DNA extraction\u003c/h2\u003e \u003cp\u003eA total of 6 ETA and 2 BAL samples received at the laboratory for routine testing were used for metagenomics assay. The collected samples were extracted by QIAmp DNA Mini Kit as per the manufacturer\u0026rsquo;s instruction with slight modifications in the sample preparation steps. Briefly, samples were incubated with lysozyme for 1 hr and overnight lysis with ATL buffer and proteinase K. Following incubation, samples were added with 0.5% saponin at RT for 10 min and incubated for 1 hr at 56 ˚C with NaCl. Lysed extracts were then transferred to spin columns for purification of DNA.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMetagenome sequencing\u003c/h2\u003e \u003cp\u003eBacterial 16S hypervariable genes were amplified by PCR from DNA samples using a range of V2,4,8 and V3,6,7,9 oligonucleotide primers specific for domain bacteria using Ion 16S metagenomic kit (Life Technologies, USA). Following amplification, all the PCR products were quantified, end repaired, ligated and nick repaired by Ion Plus Fragment Library Kit (Life Technologies, USA). Emulsion PCR was carried out using the Ion OneTouch Hi-Q View kit (Life Technologies), and the samples were adjusted to a final concentration of 100 pM. Templated-ISPs were sequenced on 318 chip v\u003csub\u003e2\u003c/sub\u003ebc (2 Gb) micro-chip using the Ion Torrent Personal Genome Machine (Life Technologies, USA) for 850 flows.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analysis\u003c/h2\u003e \u003cp\u003eThe raw reads obtained by sequencing were analyzed using QIIME2 pipeline. First, the raw sequences were demultiplexed and then denoised to filter out too short sequences, singletons and chimeras. Reads were compared with Curated MicroSEQ(R) 16S Reference Library v2013.1 and Curated Greengenes v13.5 to define genus with 97% similarity, and species with 99% similarity. Percentage OTU similarity between samples were analyzed in SPSS and plotted using Microsoft Excel.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eAll statistical analysis was conducted using SPSS v and Microsoft Excel v. Sensitivity and Specificity of the RT-PCR assay was calculated in comparison with culture method as gold standard using conventional 2x2 table. Slope of concentration dependent decrease in Ct in RT-PCR was calculated and R2 represents coefficient of determination.\u003c/p\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003ch2\u003eInformed consent\u003c/h2\u003e \u003cp\u003eThe requirement for informed consent from patients was waived by the Institutional Review Board and Ethical Committee of Christian Medical College, Vellore, India.\u003c/p\u003e \u003ch2\u003eAuthor information\u003c/h2\u003e \u003cp\u003eThese authors contributed equally: Naveen Kumar Devanga Ragupathi, Dhiviya Prabaa Muthuirulandi Sethuvel.\u003c/p\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eND is a Global Challenge Fellow at The University of Sheffield, supported by a Research England QR GCRF award (10065043). The study was funded by the GCRF networking grant, Academy of Medical Sciences, UK (GCRFNGR5\\1293). The authors acknowledge The University of Sheffield, Sheffield, United Kingdom and the Christian Medical College, Vellore, India for providing basic infrastructure required for the study.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eN.K.D.R.: conception, investigation, funding acquisition, data curation, formal analysis, supervision, writing the original draft and review. D.P.M.S.: investigation, data curation, formal analysis, writing the original draft of the manuscript and contributed equally to this work as first author. A.G.: methodology, data acquisition, curation. D.M.: methodology, bacteria identification, clinical collection. A.B.: Bioinformatics analysis, methodology, validation. D.L.W.: supervision, critical review and editing of the manuscript. P.N.M.: supervision, critical review and editing of the manuscript. E.K.: supervision, critical review and editing of the manuscript. B.V.: supervision, critical review and editing of the manuscript.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eRaw and processed data is available through SRA (NCBI BioProject PRJNA1060935) under the accession SRX23131011 to SRX23131018.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Institutional Review Board and Ethical Committee, Christian Medical College, Vellore, India (IRB No.: 11940 dt 27-03-2019). The study was conducted according to the guidelines and protocols approved by the Institution.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePiperaki, E.T., Syrogiannopoulos, G.A., Tzouvelekis, L.S. and Daikos, G.L., 2017. Klebsiella pneumoniae: virulence, biofilm and antimicrobial resistance. The Pediatric infectious disease journal, \u003cem\u003e36\u003c/em\u003e(10), pp.1002\u0026ndash;1005.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, M.C., Lin, T.L., Hsieh, P.F., Yang, H.C. and Wang, J.T., 2011. Isolation of genes involved in biofilm formation of a Klebsiella pneumoniae strain causing pyogenic liver abscess. PloS one, \u003cem\u003e6\u003c/em\u003e(8), p.e23500.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePal, S., Verma, J., Mallick, S., Rastogi, S.K., Kumar, A. and Ghosh, A.S., 2019. Absence of the glycosyltransferase WcaJ in Klebsiella pneumoniae ATCC13883 affects biofilm formation, increases polymyxin resistance and reduces murine macrophage activation. Microbiology, \u003cem\u003e165\u003c/em\u003e(8), pp.891\u0026ndash;904.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, L., Wilksch, J.J., Liu, H., Zhang, X., Torres, V.V., Bi, W., Mandela, E., Cao, J., Li, J., Lithgow, T. and Zhou, T., 2020. Investigation of LuxS-mediated quorum sensing in Klebsiella pneumoniae. \u003cem\u003eJournal of medical microbiology\u003c/em\u003e, \u003cem\u003e69\u003c/em\u003e(3), p.402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng, J.X., Lin, Z.W., Chen, C., Chen, Z., Lin, F.J., Wu, Y., Yang, S.Y., Sun, X., Yao, W.M., Li, D.Y. and Yu, Z.J., 2018. Biofilm formation in Klebsiella pneumoniae bacteremia strains was found to be associated with CC23 and the presence of wcaG. \u003cem\u003eFrontiers in cellular and infection microbiology\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, p.21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlc\u0026aacute;ntar-Curiel, M.D., Blackburn, D., Salda\u0026ntilde;a, Z., Gayosso-V\u0026aacute;zquez, C., Iovine, N., De la Cruz, M.A. and Gir\u0026oacute;n, J.A., 2013. Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation. Virulence, \u003cem\u003e4\u003c/em\u003e(2), pp.129\u0026ndash;138.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasani, A., Soltani, E., Ahangarzadeh Rezaee, M., Pirzadeh, T., Ahangar Oskouee, M., Hasani, A., Gholizadeh, P., Noie Oskouie, A. and Binesh, E., 2020. Serotyping of Klebsiella pneumoniae and its relation with capsule-associated virulence genes, antimicrobial resistance pattern, and clinical infections: a descriptive study in medical practice. Infection and Drug Resistance, pp.1971\u0026ndash;1980.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVuotto, C., Longo, F., Balice, M.P., Donelli, G. and Varaldo, P.E., 2014. Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens, \u003cem\u003e3\u003c/em\u003e(3), pp.743\u0026ndash;758.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWannigama, D.L., Shein, A.M.S., Hurst, C., Monk, P.N., Hongsing, P., Phattharapornjaroen, P., Ditcham, W.G.F., Ounjai, P., Saethang, T., Chantaravisoot, N. and Wapeesittipan, P., 2023. Ca-EDTA restores the activity of ceftazidime-avibactam or aztreonam against carbapenemase-producing Klebsiella pneumoniae infections. \u003cem\u003eIscience\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(7), p.107215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKot, B., Piechota, M., Szweda, P., Mitrus, J., Wicha, J., Grużewska, A. and Witeska, M., 2023. Virulence analysis and antibiotic resistance of Klebsiella pneumoniae isolates from hospitalised patients in Poland. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(1), p.4448.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eČernohorsk\u0026aacute;, L. and Votava, M., 2004. Determination of minimal regrowth concentration (MRC) in clinical isolates of various biofilm-forming bacteria. Folia microbiologica, \u003cem\u003e49\u003c/em\u003e(1), pp.75\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernardi, S., Anderson, A., Macchiarelli, G., Hellwig, E., Cieplik, F., Vach, K. and Al-Ahmad, A., 2021. Subinhibitory antibiotic concentrations enhance biofilm formation of clinical Enterococcus faecalis isolates. \u003cem\u003eAntibiotics\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(7), p.874.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDevanga Ragupathi, Naveen Kumar, Dhiviya Prabaa Muthuirulandi Sethuvel, Hariharan Triplicane Dwarakanathan, Dhivya Murugan, Yamini Umashankar, Peter N. Monk, Esther Karunakaran, and Balaji Veeraraghavan. \"The influence of biofilms on carbapenem susceptibility and patient outcome in device associated K. pneumoniae infections: insights into phenotype vs genome-wide analysis and correlation.\" Frontiers in microbiology 11 (2020): 591679.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshwath P., Deekshit V. K., Rohit A., Dhinakaran I., Karunasagar I., Karunasagar I., et al.. (2022). Biofilm formation and associated gene expression in multidrug-resistant \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolated from clinical specimens. Curr. Microbiol. 79:73. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00284-022-02766-z\u003c/span\u003e\u003cspan address=\"10.1007/s00284-022-02766-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJagnow, J. and Clegg, S., 2003. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix-and collagen-coated surfaces. Microbiology, \u003cem\u003e149\u003c/em\u003e(9), pp.2397\u0026ndash;2405.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellifa, S., Hassaine, H., Balestrino, D., Charbonnel, N., M\u0026rsquo;hamedi, I., Terki, I.K., Lachachi, M., Didi, W. and Forestier, C., 2013. Evaluation of biofilm formation of Klebsiella pneumoniae isolated from medical devices at the University Hospital of Tlemcen, Algeria. Afr J Microbiol Res, \u003cem\u003e7\u003c/em\u003e(49), pp.5558\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahmood, M.T. and Abdullah, B.A., 2015. The relationship between biofilm formation and presence of fimH and mrkD genes among E. coli and K. pneumoniae isolated from patients in Mosul. Mosul Journal of Nursing, \u003cem\u003e3\u003c/em\u003e(1), pp.34\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchurtz, T. A., D. B. Hornick, T. K. Korhonen, and S. Clegg. 1994. \u0026ldquo;The Type 3 Fimbrial Adhesin Gene (MrkD) of Klebsiella Species Is Not Conserved among All Fimbriate Strains.\u0026rdquo; Infection and Immunity 62(10):4186\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSebghati, T.A.S., Korhonen, T.K., Hornick, D.B. and Clegg, S., 1998. Characterization of the type 3 fimbrial adhesins of Klebsiella strains. Infection and immunity, \u003cem\u003e66\u003c/em\u003e(6), pp.2887\u0026ndash;2894.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItoh, Y., Rice, J.D., Goller, C., Pannuri, A., Taylor, J., Meisner, J., Beveridge, T.J., Preston III, J.F. and Romeo, T., 2008. Roles of pgaABCD genes in synthesis, modification, and export of the Escherichia coli biofilm adhesin poly-β-1, 6-N-acetyl-D-glucosamine. Journal of bacteriology, \u003cem\u003e190\u003c/em\u003e(10), pp.3670\u0026ndash;3680.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLau, Y.Y., How, K.Y., Yin, W.F. and Chan, K.G., 2020. Functional characterization of quorum sensing LuxR-type transcriptional regulator, EasR in Enterobacter asburiae strain L1. \u003cem\u003ePeerJ\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, p.e10068.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, L., Wilksch, J.J., Liu, H., Zhang, X., Torres, V.V., Bi, W., Mandela, E., Cao, J., Li, J., Lithgow, T. and Zhou, T., 2020. Investigation of LuxS-mediated quorum sensing in Klebsiella pneumoniae. \u003cem\u003eJournal of medical microbiology\u003c/em\u003e, \u003cem\u003e69\u003c/em\u003e(3), p.402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCa, P., Sa, L., SVb, R. and Shanmugamc, G., 2018. Comparative modeling and molecular docking studies of quorum sensing transcriptional regulating factor SdiA from Klebsiella pneumoniae. \u003cem\u003eInt. J. Cur. Res. Eng. Sci. Tech. ISSN\u003c/em\u003e, \u003cem\u003e2581\u003c/em\u003e, p.4311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClinical and Laboratory Standards Institute. 2021. Performance standards for antimicrobial susceptibility testing\u0026mdash;31st ed. Clinical and Laboratory Standards Institute, Wayne, PA.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"biofilms, diagnosis, AMR, biomarker, nosocomial, K. pneumoniae","lastPublishedDoi":"10.21203/rs.3.rs-3758116/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3758116/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e has been identified as one of the most important opportunistic pathogens responsible for nosocomial infections. Antibiotic resistance and ability to form biofilms are the two main factors involved in the persistence of infections. Conventional detection methods involve culture isolation and identification followed by biofilm assay that takes 48\u0026ndash;72 hrs. Timely detection of biofilm-forming resistant pathogens is essential to appropriately treat the infection with the right dose and combinations. The present study focusses on evaluating an RT-PCR panel using \u003cem\u003emrk\u003c/em\u003eD, \u003cem\u003epga\u003c/em\u003eC and \u003cem\u003ewca\u003c/em\u003eJ genes to screen for biofilm-forming \u003cem\u003eK. pneumoniae\u003c/em\u003e from ETA/BAL specimens. The assay accurately identified \u003cem\u003eK. pneumoniae\u003c/em\u003e harboring samples with a limit of detection (LOD) of 1 ng/\u0026micro;l total RNA. Representative culture-negative-PCR-positive samples were subjected to metagenomics which identified \u003cem\u003eK. pneumoniae\u003c/em\u003e reads in these samples confirming the specificity of RT-PCR. \u003cem\u003emrk\u003c/em\u003eD and \u003cem\u003epga\u003c/em\u003eC acts as \u003cem\u003eK. pneumoniae\u003c/em\u003e specific identification, whereas \u003cem\u003ewca\u003c/em\u003eJ act as negative marker for biofilm-forming \u003cem\u003eK. pneumoniae\u003c/em\u003e. In addition, RT-PCR results correlated well with the phenotypic biofilm forming assay. This RT-PCR assay is the first of its kind for rapid identification of biofilm-forming \u003cem\u003eK. pneumoniae\u003c/em\u003e. The result of this study highlights that the rapid detection of \u003cem\u003eK. pneumoniae\u003c/em\u003e biofilms based on the RT-PCR results coupled with clinical conditions would be appropriate to treat emerging infections or to prevent re-infections in the clinical settings.\u003c/p\u003e","manuscriptTitle":"Evaluation of genomic markers mrkD, pgaC and wcaJ involved in biofilm formation to aid in rapid screening of K. pneumoniae biofilms from endotracheal aspirates and bronchoalveolar lavage","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-18 09:48:05","doi":"10.21203/rs.3.rs-3758116/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-19T07:10:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-18T11:23:35+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-18T04:13:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"c32091ae-f69c-4773-95d6-7bc6ea842a82","date":"2024-04-05T12:52:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"26c82688-3411-47ad-b3a5-3c5bf5d7d488","date":"2024-04-05T08:26:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"1895e393-65b5-4825-84ed-7163f581638e","date":"2024-04-05T07:43:30+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-05T06:26:28+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-15T12:18:09+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-01-16T17:56:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-16T17:46:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2023-12-15T10:19:15+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5fd7c205-efa9-4d7c-a2a1-3bc7b753bcef","owner":[],"postedDate":"January 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":28189679,"name":"Health sciences/Biomarkers/Diagnostic markers"},{"id":28189680,"name":"Health sciences/Diseases/Infectious diseases"},{"id":28189681,"name":"Biological sciences/Microbiology/Bacteria"},{"id":28189682,"name":"Biological sciences/Microbiology/Biofilms"}],"tags":[],"updatedAt":"2024-10-14T15:59:08+00:00","versionOfRecord":{"articleIdentity":"rs-3758116","link":"https://doi.org/10.1038/s41598-024-69232-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-10-09 15:56:52","publishedOnDateReadable":"October 9th, 2024"},"versionCreatedAt":"2024-01-18 09:48:05","video":"","vorDoi":"10.1038/s41598-024-69232-7","vorDoiUrl":"https://doi.org/10.1038/s41598-024-69232-7","workflowStages":[]},"version":"v1","identity":"rs-3758116","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3758116","identity":"rs-3758116","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.