Derivation of two iPSC lines (KAIMRCi004-A, KAIMRCi004-B) from a Saudi patient with Biotin-Thiamine-Responsive Basal Ganglia disease (BTBGD) carrying homozygous pathogenic missense variant in the SCL19A3 gene

Derivation of two iPSC lines (KAIMRCi004-A, KAIMRCi004-B) from a Saudi patient with Biotin-Thiamine-Responsive Basal Ganglia disease (BTBGD) carrying homozygous pathogenic missense variant in the SCL19A3 gene | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Derivation of two iPSC lines (KAIMRCi004-A, KAIMRCi004-B) from a Saudi patient with Biotin-Thiamine-Responsive Basal Ganglia disease (BTBGD) carrying homozygous pathogenic missense variant in the SCL19A3 gene Maryam Alowaysi, Moayad Baadhaim, Mohammad Al-Shehri, Hajar Alzahrani, and 13 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3977137/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract The neurometabolic disorder known as biotin-thiamine-responsive basal ganglia disease (BTBGD) is a rare autosomal recessive condition linked to bi-allelic pathogenic mutations in the SLC19A3 gene. BTBGD is a neurological disorder characterized by progressive encephalopathy, confusion, seizures, dysarthria, dystonia, and severe disabilities. Diagnosis is difficult due to the disease's rare nature and diverse clinical characteristics. The primary treatment for BTBGD at this time is thiamine and biotin supplementation, while its long-term effectiveness is still being investigated. Despite the lack of knowledge related to genotype-phenotype correlations, the derivation of BTBGD-iPSC lines carrying a homozygous mutation in SLC19A3 constitutes a unique cell model to examine the molecular mechanisms underlying the cellular dysfunctions caused by SLC19A3 pathogenic variant and could promote the development of novel therapeutic agents. iPSC Biotin-Thiamine-Responsive Basal Ganglia disease BTBGD Encephalopathy SLC19A3 variant Saudi Arabia Figures Figure 1 Figure 2 Introduction Biotin-thiamine-responsive basal ganglia disease (BTBGD) (MIM: 607483) is a rare autosomal recessive disorder that affects the basal ganglia characterized by neurological dysfunction [ 1 ]. Also known as thiamine transporter-2 deficiency or thiamine metabolism dysfunction syndrome 2 (THMD2), BTBGD results from mutations in the solute carrier family 19, member 3 ( SLC19A3 , MIM: 606152) gene, which encodes for the thiamine transporter 2 (THTR-2). THTR-2 plays a crucial role in transporting thiamine (vitamin B1) into cells, particularly within the central nervous system [ 2 ]. Mutations in the SLC19A3 gene may result in a reduced ability to transport thiamine into cells, which can lead to decreased absorption of the vitamin and neurological dysfunction [ 3 ]. Globally, it is estimated that BTBGD prevalence at birth is 1 in 215,000, and a carrier frequency of 1 in 232 in the general population has been estimated for all BTBGD phenotypes. Notably, the Middle Eastern populations exhibit a disproportionate burden of this disease, with a carrier frequency estimated at 1 in 500 individuals in Saudi newborns [ 4 ]. However, the overall low prevalence of the condition may be attributed to a combination of misdiagnosis and underdiagnosis, implying that with enhanced diagnostic precision and reporting, the detection and documentation of additional cases are likely [ 1 ]. According to Maney et al. (2023) and Sharma & Saini et al. (2021), Biotin-thiamine-responsive basal ganglia disease presents in infancy (infantile BTBGD), childhood (early childhood encephalopathy) or adulthood (lateonset Wernickelike encephalopathy) [ 1 , 5 ]. First, the early infantile BTBGD that presents within the first few months of life, often during the neonatal period. Movement abnormalities, developmental regression, seizures, altered mental status, feeding difficulties, and bilateral basal ganglia lesions characterize this phase. Next, early childhood encephalopathy normally presents between the ages of 3 and 10. It is characterized by episodic encephalopathy triggered by fever, metabolic stress, trauma, vaccination, or extensive exercise. Other signs include neuro-regression, recurrent seizures (even status epilepticus), spasticity, severe extrapyramidal involvement, gait abnormalities, behavioral problems, and bilateral affection of the corpus striatum and cerebral cortex, with or without brain stem involvement. Finally, late-onset Wernicke-like encephalopathy presents with mental confusion, ataxia, ophthalmoplegia, cognitive impairment, and gait disturbances. This phase, predominant in young adults in their twenties, is associated with compound heterozygous variations in the SLC19A3 gene [ 6 ]. The primary treatment for BTBGD is thiamine and biotin supplementation, which attempts to enhance thiamine's transportation into the brain [ 5 ]. Because biotin treatment has a positive effect, it is important to diagnose this illness as soon as possible to enable adequate management and prevent needless tests and treatments. To completely comprehend the pathophysiology and management of this uncommon ailment, more investigation is necessary. Biotin-thiamine-responsive basal ganglia disease could be fatal if left untreated, emphasizing the need for early diagnosis and proper management of the medical condition [ 2 ]. The recommended methods for diagnosis are Magnetic resonance imaging for brain diagnostics; laboratory tests and genetic testing are used to validate imaging [ 5 ]. With the advent of stem cell research and organoid technology [ 7 ], it has become possible to create in-vitro models of diseases like BTBGD. An in-depth understanding of the pathophysiological mechanisms underlying BTBGD is crucial for the improvement of management strategies. The generation of induced pluripotent stem cells (iPSCs) from patients diagnosed with BTBGD provides a promising avenue for cellular-level disease investigation. Using iPSCs, brain organoid technology could be employed to simulate disease pathology and screen potential therapeutic agents [ 8 ]. In this study, we derived iPSCs (two clones) by reprogramming peripheral blood mononuclear cells (PBMCs) of a Saudi patient with BTBGD carrying a homozygous mutation in the SLC19A3 gene c.1264A > G (p.Thr422Ala). These iPSCs make an invaluable tool for elucidating disease mechanisms and developing patient-specific therapies, including cell replacement strategies and personalized pharmacological interventions [ 8 ]. Materials and methods Patient recruitment and Ethical Approval This study was approved by the institutional review board (IRB) and research ethics committee of KAIMRC (NRJ22J/005/01) and (NRJ22/060/03). The patient is a 10-years-old female diagnosed with Biotin-Thiamine-Responsive Basal Ganglia disease carrying the known familial pathogenic variant in the exon 5 of the SLC19A3 gene, c.1264A > G (p.Thr422Ala) in a homozygous state. The informed consent forms (ICFs) were used to obtain and process the patient's samples with the approval of the patient's parents. PBMCs isolation and enrichment of erythroid progenitors EDTA-containing blood collection tubes were used to collect peripheral blood from the patient and process it with the RosetteSep™ Human Progenitor Cell Basic Pre-Enrichment antibody cocktail (Stem Cell Technologies Catalog#15226). Following PBMC separation and isolation, 1 million cells were cultured for 8 days in StemSpan™ SFEM II medium with 1X StemSpan™ Erythroid Expansion Supplement (Stem Cell Technologies Catalog #02692). Erythroid Progenitor Cells Transfection EPCs reprogramming was performed using the Epi5 Reprogramming Kit (Thermofisher Catalog#A15960). Three pulses at 1600 volts, each lasting 10 milliseconds, was used to transfect the cells with 1 µg of each episomal vector (Neon Transfection System, Thermofisher). Subsequently, iPS colonies were picked and cultured using mTeSR™ Plus medium and Geltrex™ LDEV-Free Reduced Growth Factor Basement Membrane Matrix (Thermofisher Catalog# A1413201) at 37°C with 5% CO2 and 20% O2. Immunocytochemistry The initial fixation of the cells were done for a period of 15 minutes in 4% (w/v) paraformaldehyde. This was followed by another 10-minute wash with PBS solution consisting of 0.1% (v/v) Triton X-100. Subsequently, the cells were blocked with PBS solution containing 1% gelatin for a period of 45 minutes. The cells were then probed overnight at 4°C with the primary antibodies and for an hour at room temperature with the appropriate secondary antibodies. The nuclei were stained with DAPI nuclear staining at 1 µg /mL. We observed the staining using a 20X objective on a Zeiss LSM 880 Airyscan confocal laser scanning microscope. Quantitative Reverse Transcription PCR (RT-qPCR) The total RNA was extracted in accordance with the manufacturer's instructions using the RNeasy Mini Kit. Subsequently, the RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems Catalog#4368814). Real-time qPCR reactions was performed on the QuantStudio 7 Flex Real-Time PCR System (Thermofisher scientific) using the Power SYBR Green Master Mix (ThermoFisher scientific Catalog#4367659). In-vitro Differentiation To develop three germ layers derivatives from the iPSCs, STEMdiff™ Trilineage Differentiation Kit was used (Stem Cell Technologies Catalog #05230). Flow cytometry Analysis Permeabilization and staining for intracellular markers were performed using the BD IntraSure™ Kit (BD Biosciences Catalog# 641778). Reagent A was used to fix 4x10 5 cells for 10 minutes. Upon diluting primary antibodies with reagent B, cells were incubated for 30 minutes. PBS was used to dilute the secondary antibodies before they were incubated at room temperature for 30 minutes. Using BD FACS ARIA cell sorter, FACS samples were analyzed. A comparison of stained vs unstained cells was performed to determine the percentage of FITC-positive cells. Karyotype Analysis iPSCs were treated for 15 minutes with KaryoMAX™ Colcemid™, 0.3 µg/mL, and then dissociated by TrypLE after treatment. A hypotonic solution of 75 mM potassium chloride was used to incubate the cells for 20 minutes at 37°C, and then iPSCs were fixed in methanol and glacial acetic acid in a 3:1 solution. Pathology and laboratory medicine (Ministry of the National Guard - Health Affairs) performed the karyotyping on at least 20 metaphases. Plasmids Screening The DNA was extracted according to the manufacturer's instructions using the All Prep DNA/RNA/Protein Mini Kit (Qiagen Catalog# 80004).. As part of the PCR procedure, EBNA-1 primers were used to identify the five episomal plasmids (expected size 666 bp) (Thermo Fisher Scientific Catalog # A15560). Short Tandem Repeat (STR) In this study, fifteen STR loci and Amelogenin were amplified using the AmpFLSTR™ Identifiler™ Plus PCR Amplification Kit (Applied Biosystems Catalog#4427368). The samples were amplified using the kit then run on 3500 Genetic Analyzer to determine the PCR amplicons. In order to gather and evaluate the data, the GeneMapper ID-X Software, version 1.4, was used to collect the results. Mycoplasma Detection Mycoplasma contamination was assessed using LookOut®Mycoplasma qPCR Detection (SIGMA). Statistical Analysis In this study, RT-PCR data was expressed as mean ± standard deviation (SD). The significance of the analysis was evaluated using the Student's t-test (unpaired; two-tailed). To correct for multiple comparisons, a Bonferroni correction was applied to the p -value. Results A description of clinical data and a mutation analysis The 10-years-old female patient was presented with a history of seizers, subacute encephalopathy, developmental delay, and sensorineural hearing loss. Molecular genetic analysis by whole exome sequencing (WES) of patient blood sample identified homozygous pathogenic variant in the SLC19A3 , c.1264A > G (NP_079519.1:p.Thr422Ala). This mutation leads to an amino acid exchange in exon 5 (NM_025243.4) and has been previously described as disease-causing for biotin-thiamine-responsive basal ganglia disease by Alfadhel et al. , 2013 [ 6 ]. This variant was confirmed in the patient's peripheral blood cells as well as in the derived iPSC lines by Sanger sequencing (Fig. 1 E). The derivation and establishment of BTBGD-iPSC lines In-person interview was conducted and signed informed consent was obtained from the donor’s parent. Erythroid progenitor cells (EPCs) were isolated and enriched from a 10 ml peripheral blood sample and cultured for eight days (Fig. 1 A). Using a non-integrative and virus-free reprogramming technique, as previously described [ 9 , 10 ], two BTBGD-iPSC clones were created. Briefly, episomal vectors encoding OCT4, SOX2, KLF4, L-MYC, LIN28A, dominant-negative form of TP53, and EBNA1 were delivered to EPCs by electroporation (Fig. 1 B). Several ESC-like colonies displaying typical ESC morphological characteristics (including distinct borders, bright centers, tightly packed cells, and a high nucleus-to-cytoplasm ratio) were identified approximately 20 days post transfection (Fig. 1 C). The derived iPSC lines were manually picked, expanded in feeder free conditions, and cryopreserved in KAIMRC facility. A female normal chromosomal content was confirmed by G-banding analysis of the generated BTBGD-iPSCs (Fig. 1 D.) The matched identities of the isolated iPS lines and the donor PBMCs have been validated by short tandem repeats (STR) assay (Fig. S1 B). Furthermore, Mycoplasma testing has indicated that the generated iPSC are free from mycoplasma contamination (Fig. S1 C). Characterization of self-renewal and potency properties Manually picked clones were passaged and analyzed for the presence of episomal plasmids at every passage. Complete absence of reprogramming plasmids became evident at passage twelve (Fig. S1 A). Consequently, we conducted a meticulous evaluation of pluripotency using a number of approaches, including flow cytometry, immunofluorescence and real-time PCR (RT-qPCR) of the pluripotency markers of OCT4, NANOG, and SOX2. According to flow cytometry histograms, more than 95% of cells expressed OCT4, 98% expressed NANOG, and 97% were positive for SOX2 (Fig. 2 A). Furthermore, Immunofluorescence staining showed positive expression of stemness markers in the derived iPS lines (Fig. 2 B). Using RT-qPCR, we found that in comparison to H1 hESCs, the expression of OCT4, NANOG , and SOX2 mRNA was significantly upregulated (Fig. 2 C). The capacity of cells to differentiate into the three germ layers—mesoderm, endoderm, and ectoderm—was assessed through direct in-vitro differentiation. Upregulation of germ layer-specific markers and downregulation of pluripotency markers OCT4 and NANOG was observed across all lineages. Ectodermal differentiation has been proven by the positive expression of the central nervous system neural progenitor markers PAX6 and NESTIN . Capacity of mesodermal commitment was assessed by directed in-vitro differentiation and was demonstrated by an increase in the expression of CDX2 , a caudal-type homeobox protein 2, and Brachyury , a member of the T-box family. The upregulation of the endodermal markers zinc-finger transcription factor GATA4 and the SRY-Box transcription factor 17 ( SOX17 ) has been validated in our BTBGD-iPSC lines and H1 hESC positive controls (Fig. 2 D). Following pluripotency verification, the generated BTBGD-iPSC lines have been registered in the Human Pluripotent Stem Cell Registry https://hpscreg.eu/user/cellline/edit/KAIMRCi004-A https://hpscreg.eu/user/cellline/edit/KAIMRCi004-B Discussion The creation of iPSCs and the revolutionary discovery of cellular reprogramming have been widely used in the past ten years to simulate diseases in vitro and offer the potential for scientific research and regenerative therapies [ 11 , 12 ]. iPSCs and embryonic stem cells have many features of self-renewal, gene expression, and the ability to develop into almost any type of body cell [ 10 ]. NANOG, OCT3/4, SOX2, KLF4, c-MYC, and LIN28 are pluripotency transcription factors that regulate the expression of stemness and repress somatic genes [ 13 – 21 ]. Even though iPSCs can be generated from a variety of somatic cell sources, we opted for EPCs for their tendency to be devoid of genomic DNA mutations or chromosomal abnormalities [ 9 , 10 ]. We found that 69% of EPCs were positive for CD71 + CD235a + erythroid cell surface markers after eight days of expansion in erythroid expansion media [ 9 ]. To generate integration-free iPSCs, non-viral and non-integrating episomal plasmid-based reprogramming method was applied in this study [ 9 , 10 ]. Based on the Epstein-Barr Nuclear Antigen-1, vectors incorporating oriP and EBNA-1 have demonstrated the capacity to generate iPSCs successfully with a single transfection [ 9 , 10 ]. Homozygous presence of the familial pathogenic variant c.1264A > G (p.Thr422Ala) in the SLC19A3 gene has been previously delineated as causative for biotin-thiamine-responsive basal ganglia disease (BTBGD) by Alfadhel et al., 2013 [ 6 ]. BTBGD represents a remarkably rare genetic condition, the diagnosis of which is complicated by its nonspecific clinical manifestations. These typically include seizures and encephalopathy, compounded by a broad spectrum of imaging differentials, including cortical T2-hyperintensities and bilateral involvement of the basal ganglia [ 22 ]. It has also been established that the prognosis of BTBGD is significantly compromised by the delayed administration of biotin and thiamine, underscoring the necessity for timely intervention [ 6 , 23 ]. The pathogenesis of BTBGD caused by SLC19A3 deficiency remains unclear. Therefore, the derivation of BTBGD-iPSC lines carrying SLC19A3 mutation constitutes a suitable research model to study genotype-phenotype correlations. Furthermore, differentiation of BTBGD-iPSCs towards disease-relevant lineages such as neuronal subtypes and midbrain organoids would serve as a powerful cellular platforms to determine the impact of SLC19A3 deficiency and the underlying disease mechanism in BTBGD. CRISPR/Cas9-mediated knock-in of SLC19A3 , coupled with in-vitro disease modeling using midbrain organoids and gene expression profiling could be utilized to further our understanding of BTBGD pathogenesis, thus allowing for the discovery of more efficient therapeutic agents through drug screening. Declarations Acknowledgements We thank KAIMRC for the funding and continuous support, Pfizer for funding the establishment of the Saudi Bank of Human iPSCs, and the Local Content and Government Procurement Authority (LCGPA) in Saudi Arabia for their continuous support. We thank the donor and her family for their valuable donation for science. Author contributions MA and MB contributed through sample processing, iPS generation, validation assays and differentiation and writing the manuscript. M Al Shehri, HA, AB, H Attas, DA, SZ, MH, AZ have contributed in iPS validation tests. S Alameer identified the patient and contacted the family to provide the blood sample. DM obtained the blood sample from the patient. MD performed karyotype analysis. Khaled Al-ghamdi and MM performed the STR tests. M Alfadhel, KA and DA contributed through the conception of the idea, the design of the work, and revision of the document. Funding This study was funded by Pfizer Ireland Pharmaceuticals. Partial funding was provided by King Abdullah International Medical Center (KAIMRC), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS) (Protocol# NRJ22J/005/01). Data availability The data that support the findings of this study are openly available. All characterization data related to this study can be accessed upon reasonable request. Requests for access to this data should be directed to Dr. Khaled Alsayegh, [email protected] and/or Dr. Doaa Aboalola, [email protected] Conflict of interest The authors declare that they have no conflict of interest. Ethical approval This study was approved by the Institutional Review Board of Ministry of National Guard Health Affairs (Protocol# NRJ22J/005/01 and NRJ22J/060/30). Informed consent Written informed consent was obtained from the study subjects. References Saini AG, Sharma S. Biotin-thiamine-responsive basal ganglia disease in children: a treatable neurometabolic disorder. Annals of Indian Academy of Neurology. 2021 Mar;24(2):173. Wang J, Wang J, Han X, Liu Z, Ma Y, Chen G, Zhang H, Sun D, Xu R, Liu Y, Zhang Y. Report of the largest Chinese cohort with SLC19A3 gene defect and literature review. Frontiers in genetics. 2021 Jul 1;12:683255. Subramanian VS, Marchant JS, Said HM. Biotin-responsive basal ganglia disease-linked mutations inhibit thiamine transport via hTHTR2: biotin is not a substrate for hTHTR2. American Journal of Physiology-Cell Physiology. 2006 Nov;291(5):C851-9. Alfadhel M, Umair M, Almuzzaini B, et al. Targeted SLC19A3 gene sequencing of 3000 Saudi newborn: a pilot study toward newborn screening. Annals of Clinical and Translational Neurology. 2019 Oct;6(10):2097-2103. Maney K, Pizoli C, Russ JB. Child Neurology: Infantile Biotin Thiamine Responsive Basal Ganglia Disease: Case Report and Brief Review. Neurology. 2023 Apr 25;100(17):836-9. Alfadhel M, Almuntashri M, Jadah RH, Bashiri FA, Al Rifai MT, Al Shalaan H, Al Balwi M, Al Rumayan A, Eyaid W, Al-Twaijri W. Biotin-responsive basal ganglia disease should be renamed biotin-thiamine-responsive basal ganglia disease: a retrospective review of the clinical, radiological and molecular findings of 18 new cases. Orphanet journal of rare diseases. 2013 Dec;8:1-8. Jo J, Xiao Y, Sun AX, Cukuroglu E, Tran HD, Göke J, Tan ZY, Saw TY, Tan CP, Lokman H, Lee Y. Midbrain-like organoids from human pluripotent stem cells contain functional dopaminergic and neuromelanin-producing neurons. Cell stem cell. 2016 Aug 4;19(2):248-57. Kwak TH, Kang JH, Hali S, Kim J, Kim KP, Park C, Lee JH, Ryu HK, Na JE, Jo J, Je HS. Generation of homogeneous midbrain organoids with in vivo-like cellular composition facilitates neurotoxin-based Parkinson's disease modeling. Stem cells. 2020 Jun 1;38(6):727-40. Alowaysi M, Lehmann R, Al-Shehri M, Baadhaim M, Alzahrani H, Aboalola D, Zia A, Malibari D, Daghestani M, Alghamdi K, Haneef A. HLA-based banking of induced pluripotent stem cells in Saudi Arabia. Stem Cell Research & Therapy. 2023 Dec 18;14(1):374. Alowaysi M, Al-Shehri M, Badkok A, Attas H, Aboalola D, Baadhaim M, Alzahrani H, Daghestani M, Zia A, Al-Ghamdi K, Al-Ghamdi A. Generation of iPSC lines (KAIMRCi003A, KAIMRCi003B) from a Saudi patient with Dravet syndrome carrying homozygous mutation in the CPLX1 gene and heterozygous mutation in SCN9A. Human Cell. 2023 Dec 19:1-9. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. cell. 2007 Nov 30;131(5):861-72. Soejitno A, Prayudi PK. The prospect of induced pluripotent stem cells for diabetes mellitus treatment. Therapeutic advances in endocrinology and metabolism. 2011 Oct;2(5):197-210. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 2003 May 30;113(5):631-42. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003 May 30;113(5):643-55. Niwa H, Ogawa K, Shimosato D, Adachi K. A parallel circuit of LIF signalling pathways maintains pluripotency of mouse ES cells. Nature. 2009 Jul 2;460(7251):118-22. Cartwright P, McLean C, Sheppard A, Rivett D, Jones K, Dalton S. LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Tokuzawa Y, Kaiho E, Maruyama M, Takahashi K, Mitsui K, Maeda M, Niwa H, Yamanaka S. Fbx15 is a novel target of Oct3/4 but is dispensable for embryonic stem cell self-renewal and mouse development. Molecular and cellular biology. 2003 Apr 1;23(8):2699-708. Okumura-Nakanishi S, Saito M, Niwa H, Ishikawa F. Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells. Journal of Biological Chemistry. 2005 Feb 18;280(7):5307-17. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II. Induced pluripotent stem cell lines derived from human somatic cells. science. 2007 Dec 21;318(5858):1917-20. Sridharan R, Tchieu J, Mason MJ, Yachechko R, Kuoy E, Horvath S, Zhou Q, Plath K. Role of the murine reprogramming factors in the induction of pluripotency. Cell. 2009 Jan 23;136(2):364-77. Soufi A, Donahue G, Zaret KS. Facilitators and impediments of the pluripotency reprogramming factors' initial engagement with the genome. Cell. 2012 Nov 21;151(5):994-1004. Majumdar S, Salamon N. Biotin-thiamine-responsive basal ganglia disease: A case report. Radiol Case Rep. 2021 Dec 28;17(3):753-758. Algahtani H, Ghamdi S, Shirah B, Alharbi B, Algahtani R, Bazaid A. Biotin–thiamine–responsive basal ganglia disease: catastrophic consequences of delay in diagnosis and treatment. Neurological research. 2017 Feb 1;39(2):117-25. Table Table 1 List of antibodies and primers used in this study. Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Abcam Cat# ab200834 RRID# AB_2924374 Goat anti-NANOG 1:100 Abcam Cat# ab109250 RRID# AB_10863442 Goat anti-SOX2 1:100 Thermofisher Cat# MA1-014 RRID# AB_2536667 Secondary antibody Goat anti-Rabbit Secondary Antibody, Alexa Fluor 488 IF 1:200 Flow Cyt 1:2000 Abcam Cat#: ab150077 RRID# AB_2630356 Primers and Oligonucleotides used in this study Target Forward/Reverse primer (5′-3′) Differentiation Markers RT-qPCR BRACHYURY or TBXT TAAGGTGGATCTTCAGGTAGC CATCTCATTGGTGAGCTCCCT CDX2 GACGTGAGCATGTACCCTAGC GCGTAGCCATTCCAGTCCT NESTIN CTGCTACCCTTGAGACACCTG GGGCTCTGATCTCTGCATCTAC PAX6 TGGGCAGGTATTACGAGACTG ACTCCCGCTTATACTGGGCTA SOX17 GCATTCTGGAATGAGCCTACT GGGCAGGTCAAGCTTATGAT GATA4 CGACACCCCAATCTCGATATG GTTGCACAGATAGTGACCCGT House-Keeping Genes (qPCR) GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG mutation analysis SLC19A3 TCTCTCTCTCTCTTTGCTG ACTTCTTACCTGCCTTATCC EBNA-1 pEP4-SF2-oriP pEP4-SR2-oriP ATC GTC AAA GCT GCA CAC AG CCC AGG AGT CCC AGT AGT CA Supplementary Files SupplFig1Final.tif Fig. 1S: A. Endpoint PCR demonstrated the absence of the five episomal plasmids in the BTBGD-iPSCs. B. Short Tandem Repeat (STR) profiling guaranteed the genetic identity between the established iPSC lines and the donor PBMCs. C. RT-qPCR showing negative mycoplasma test in BTBGD-iPSC lines. Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 04 Mar, 2024 Reviewers invited by journal 03 Mar, 2024 Editor assigned by journal 01 Mar, 2024 First submitted to journal 27 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3977137","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":276015441,"identity":"97666158-40b7-4304-b4ff-9bd2144234a9","order_by":0,"name":"Maryam Alowaysi","email":"","orcid":"","institution":"King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Maryam","middleName":"","lastName":"Alowaysi","suffix":""},{"id":276015442,"identity":"0c14003f-1ba3-4895-86b5-be9b143fc8e8","order_by":1,"name":"Moayad Baadhaim","email":"","orcid":"","institution":"King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Moayad","middleName":"","lastName":"Baadhaim","suffix":""},{"id":276015443,"identity":"9121ec92-f511-42e3-ba98-aa77a7d040e5","order_by":2,"name":"Mohammad Al-Shehri","email":"","orcid":"","institution":"King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Al-Shehri","suffix":""},{"id":276015444,"identity":"37154065-0ebe-4184-8578-014ca80ff63b","order_by":3,"name":"Hajar Alzahrani","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Hajar","middleName":"","lastName":"Alzahrani","suffix":""},{"id":276015445,"identity":"299dd011-55c7-4747-88ed-2702262d9a77","order_by":4,"name":"Amani Badkok","email":"","orcid":"","institution":"King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Amani","middleName":"","lastName":"Badkok","suffix":""},{"id":276015446,"identity":"13c946bf-7a9a-4ce6-85c2-0c640a972e3b","order_by":5,"name":"Hanouf Attas","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Hanouf","middleName":"","lastName":"Attas","suffix":""},{"id":276015447,"identity":"9d193a83-5046-4f17-b75f-f267aaff6557","order_by":6,"name":"Samer Zakri","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Samer","middleName":"","lastName":"Zakri","suffix":""},{"id":276015448,"identity":"23cad324-e75c-42b2-a74b-2c2203bf328c","order_by":7,"name":"Seham Alameer","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Seham","middleName":"","lastName":"Alameer","suffix":""},{"id":276015449,"identity":"7af5f8f7-fa3b-4d37-8559-ea72e0630909","order_by":8,"name":"Dalal Malibari","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Dalal","middleName":"","lastName":"Malibari","suffix":""},{"id":276015450,"identity":"32546d06-faf9-4ea9-8d7c-9b3fedbee97b","order_by":9,"name":"Manal Hosawi","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Manal","middleName":"","lastName":"Hosawi","suffix":""},{"id":276015451,"identity":"7d818d33-d721-4ff5-b6e2-77d4787f276f","order_by":10,"name":"Mustafa Daghestani","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Mustafa","middleName":"","lastName":"Daghestani","suffix":""},{"id":276015452,"identity":"0473e920-db6c-4407-beef-30c127299800","order_by":11,"name":"Khalid Al-Ghamdi","email":"","orcid":"","institution":"Forensic Science Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Khalid","middleName":"","lastName":"Al-Ghamdi","suffix":""},{"id":276015453,"identity":"e091b0b2-b214-4e4e-bf76-07ec0f20e310","order_by":12,"name":"Asima Zia","email":"","orcid":"","institution":"KAUST: King Abdullah University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Asima","middleName":"","lastName":"Zia","suffix":""},{"id":276015454,"identity":"f9a11e91-6b35-4a89-bbf7-59b154605612","order_by":13,"name":"Jesper Tegne","email":"","orcid":"","institution":"KAUST: King Abdullah University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Jesper","middleName":"","lastName":"Tegne","suffix":""},{"id":276015455,"identity":"43fdd487-a0d0-4197-9339-5fae97c14938","order_by":14,"name":"Majid Alfadhel","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Majid","middleName":"","lastName":"Alfadhel","suffix":""},{"id":276015456,"identity":"a23012ac-0132-48bb-96b0-61f228559234","order_by":15,"name":"Doaa Aboalola","email":"","orcid":"","institution":"KAIMRC: King Abdullah International Medical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Doaa","middleName":"","lastName":"Aboalola","suffix":""},{"id":276015457,"identity":"3507e664-d592-4edb-acba-8e4965a8010e","order_by":16,"name":"Khaled Alsayegh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYDACdgiVIMHAfABIS8gQ1sIM18KWANLCQ4oWHgMQg7AW/mb2h595KmrzJGf3fH51o8aCh4H98NEN+LRIHOYxluY5c7xYWubsNuucY0CH8aSl3cBrzWEeBmnetmOJ8yRytxnnsAG1SPCY4dUif5j98W/efyAtOc+Mc/4RocXgMIOZNG9DTeJsiRzmx7ltRGgxPMxjZjnn2IHEmTPSzJhz+yR42Aj5Re54++Mbb2rqEmfcSH78OedbnRw/++Fj+L0PBEw8DIdBNJsEmCSkHAQYfzDUgWjmD8SoHgWjYBSMgpEHANeyRzuXGwKjAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-2654-835X","institution":"King Abdullah International Medical Research Center","correspondingAuthor":true,"prefix":"","firstName":"Khaled","middleName":"","lastName":"Alsayegh","suffix":""}],"badges":[],"createdAt":"2024-02-22 00:28:01","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3977137/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3977137/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52102667,"identity":"ce7fce24-3809-40e4-946a-8ef24c866f77","added_by":"auto","created_at":"2024-03-06 19:17:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":16778322,"visible":true,"origin":"","legend":"\u003cp\u003eCell reprogramming and derivation of BTBGD-iPSCs using the following methods. \u003cstrong\u003eA\u003c/strong\u003e. A sample of 10 ml peripheral blood from a BTBGD patient was expanded for eight days to enrich for erythroid progenitor cells (EPCs). \u003cstrong\u003eB\u003c/strong\u003e. Schematic representation of ReproteSR\u003csup\u003eTM\u003c/sup\u003e and episomal reprogramming. Phase-contrast images show the transition between mesenchymal and epithelial cells, as well as the emergence of colonies during reprogramming (days 11 to 28). \u003cstrong\u003eC\u003c/strong\u003e. BTBGD-iPSC clones are tightly packed clones with well-defined borders. Scale bar = 100 μm. \u003cstrong\u003eD\u003c/strong\u003e. Typical G-banded karyotype tests show that the karyotypes of BTBGD-iPSCs have normal chromosomal content 46, XX. \u003cstrong\u003eE\u003c/strong\u003e.\u0026nbsp;SLC19A3 mutations in the patient's peripheral blood cells and the BTBGD-iPSC lines are shown in the electropherogram record of Sanger sequencing.\u003c/p\u003e","description":"","filename":"BTB2Fig1Final.png","url":"https://assets-eu.researchsquare.com/files/rs-3977137/v1/a876866c696ad28a604930b7.png"},{"id":52102665,"identity":"c1674073-e391-47bc-a42a-ea15b9545333","added_by":"auto","created_at":"2024-03-06 19:17:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":18913149,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of the pluripotency in the generated BTBGD-iPSCs. \u003cstrong\u003eA\u003c/strong\u003e. Flow cytometry histograms of OCT4, NANOG, and SOX2 in BTBGD-iPSCs. \u003cstrong\u003eB\u003c/strong\u003e. immunofluorescence staining of the pluripotency markers OCT4 (green), NANOG (red), and SOX2 (yellow), Nuclei were stained with DAPI (blue). Scale bar = 50 μm. \u003cstrong\u003eC\u003c/strong\u003e. mRNA expression levels of pluripotency markers for the indicated iPSC lines are presented as a fold change in comparison to H1 hESC. Bars represent the median ± std of three biological replicates for each sample. \u003cstrong\u003eE\u003c/strong\u003e. mRNA expression levels of the lineage-specific markers for the three germ layers—ectoderm (NESTIN and PAX6), mesoderm (CDX2 and Brachyury), and endoderm (GATA4 and SOX17)—presented as fold changes in comparison to undifferentiated cells. Bars are median ± std of 3 biological replicates for each sample. Student’s t-tests, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"BTB2Fig2Final.png","url":"https://assets-eu.researchsquare.com/files/rs-3977137/v1/45373db3c5b5f7c5618634b0.png"},{"id":52104427,"identity":"157f0eb8-7e92-4569-87da-0b5652edf266","added_by":"auto","created_at":"2024-03-06 19:25:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1557647,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3977137/v1/c5c966dd-ddfe-4527-8fc3-4d61775c2951.pdf"},{"id":52102763,"identity":"e4fd6526-2944-487b-9e82-76d746afc3db","added_by":"auto","created_at":"2024-03-06 19:17:20","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":185158540,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. 1S\u003c/strong\u003e: \u003cstrong\u003eA\u003c/strong\u003e. Endpoint PCR demonstrated the absence of the five episomal plasmids in the BTBGD-iPSCs. \u003cstrong\u003eB\u003c/strong\u003e. Short Tandem Repeat (STR) profiling guaranteed the genetic identity between the established iPSC lines and the donor PBMCs. \u003cstrong\u003eC\u003c/strong\u003e. RT-qPCR showing negative mycoplasma test in BTBGD-iPSC lines.\u003c/p\u003e","description":"","filename":"SupplFig1Final.tif","url":"https://assets-eu.researchsquare.com/files/rs-3977137/v1/cef70b8c66374cf27600b2fd.tif"}],"financialInterests":"","formattedTitle":"Derivation of two iPSC lines (KAIMRCi004-A, KAIMRCi004-B) from a Saudi patient with Biotin-Thiamine-Responsive Basal Ganglia disease (BTBGD) carrying homozygous pathogenic missense variant in the SCL19A3 gene","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBiotin-thiamine-responsive basal ganglia disease (BTBGD) (MIM: 607483) is a rare autosomal recessive disorder that affects the basal ganglia characterized by neurological dysfunction [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Also known as thiamine transporter-2 deficiency or thiamine metabolism dysfunction syndrome 2 (THMD2), BTBGD results from mutations in the solute carrier family 19, member 3 (\u003cem\u003eSLC19A3\u003c/em\u003e, MIM: 606152) gene, which encodes for the thiamine transporter 2 (THTR-2). THTR-2 plays a crucial role in transporting thiamine (vitamin B1) into cells, particularly within the central nervous system [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Mutations in the \u003cem\u003eSLC19A3\u003c/em\u003e gene may result in a reduced ability to transport thiamine into cells, which can lead to decreased absorption of the vitamin and neurological dysfunction [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Globally, it is estimated that BTBGD prevalence at birth is 1 in 215,000, and a carrier frequency of 1 in 232 in the general population has been estimated for all BTBGD phenotypes. Notably, the Middle Eastern populations exhibit a disproportionate burden of this disease, with a carrier frequency estimated at 1 in 500 individuals in Saudi newborns [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, the overall low prevalence of the condition may be attributed to a combination of misdiagnosis and underdiagnosis, implying that with enhanced diagnostic precision and reporting, the detection and documentation of additional cases are likely [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAccording to \u003cem\u003eManey et al.\u003c/em\u003e (2023) and \u003cem\u003eSharma \u0026amp; Saini et al.\u003c/em\u003e (2021), Biotin-thiamine-responsive basal ganglia disease presents in infancy (infantile BTBGD), childhood (early childhood encephalopathy) or adulthood (lateonset Wernickelike encephalopathy) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. First, the early infantile BTBGD that presents within the first few months of life, often during the neonatal period. Movement abnormalities, developmental regression, seizures, altered mental status, feeding difficulties, and bilateral basal ganglia lesions characterize this phase. Next, early childhood encephalopathy normally presents between the ages of 3 and 10. It is characterized by episodic encephalopathy triggered by fever, metabolic stress, trauma, vaccination, or extensive exercise. Other signs include neuro-regression, recurrent seizures (even status epilepticus), spasticity, severe extrapyramidal involvement, gait abnormalities, behavioral problems, and bilateral affection of the corpus striatum and cerebral cortex, with or without brain stem involvement. Finally, late-onset Wernicke-like encephalopathy presents with mental confusion, ataxia, ophthalmoplegia, cognitive impairment, and gait disturbances. This phase, predominant in young adults in their twenties, is associated with compound heterozygous variations in the \u003cem\u003eSLC19A3\u003c/em\u003e gene [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe primary treatment for BTBGD is thiamine and biotin supplementation, which attempts to enhance thiamine's transportation into the brain [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Because biotin treatment has a positive effect, it is important to diagnose this illness as soon as possible to enable adequate management and prevent needless tests and treatments. To completely comprehend the pathophysiology and management of this uncommon ailment, more investigation is necessary. Biotin-thiamine-responsive basal ganglia disease could be fatal if left untreated, emphasizing the need for early diagnosis and proper management of the medical condition [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The recommended methods for diagnosis are Magnetic resonance imaging for brain diagnostics; laboratory tests and genetic testing are used to validate imaging [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWith the advent of stem cell research and organoid technology [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], it has become possible to create \u003cem\u003ein-vitro\u003c/em\u003e models of diseases like BTBGD. An in-depth understanding of the pathophysiological mechanisms underlying BTBGD is crucial for the improvement of management strategies. The generation of induced pluripotent stem cells (iPSCs) from patients diagnosed with BTBGD provides a promising avenue for cellular-level disease investigation. Using iPSCs, brain organoid technology could be employed to simulate disease pathology and screen potential therapeutic agents [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we derived iPSCs (two clones) by reprogramming peripheral blood mononuclear cells (PBMCs) of a Saudi patient with BTBGD carrying a homozygous mutation in the \u003cem\u003eSLC19A3\u003c/em\u003e gene c.1264A\u0026thinsp;\u0026gt;\u0026thinsp;G (p.Thr422Ala). These iPSCs make an invaluable tool for elucidating disease mechanisms and developing patient-specific therapies, including cell replacement strategies and personalized pharmacological interventions [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003ePatient recruitment and Ethical Approval\u003c/p\u003e \u003cp\u003e This study was approved by the institutional review board (IRB) and research ethics committee of KAIMRC (NRJ22J/005/01) and (NRJ22/060/03). The patient is a 10-years-old female diagnosed with Biotin-Thiamine-Responsive Basal Ganglia disease carrying the known familial pathogenic variant in the exon 5 of the \u003cem\u003eSLC19A3\u003c/em\u003e gene, c.1264A\u0026thinsp;\u0026gt;\u0026thinsp;G (p.Thr422Ala) in a homozygous state. The informed consent forms (ICFs) were used to obtain and process the patient's samples with the approval of the patient's parents.\u003c/p\u003e \u003cp\u003ePBMCs isolation and enrichment of erythroid progenitors\u003c/p\u003e \u003cp\u003eEDTA-containing blood collection tubes were used to collect peripheral blood from the patient and process it with the RosetteSep\u0026trade; Human Progenitor Cell Basic Pre-Enrichment antibody cocktail (Stem Cell Technologies Catalog#15226). Following PBMC separation and isolation, 1\u0026nbsp;million cells were cultured for 8 days in StemSpan\u0026trade; SFEM II medium with 1X StemSpan\u0026trade; Erythroid Expansion Supplement (Stem Cell Technologies Catalog #02692).\u003c/p\u003e \u003cp\u003eErythroid Progenitor Cells Transfection\u003c/p\u003e \u003cp\u003eEPCs reprogramming was performed using the Epi5 Reprogramming Kit (Thermofisher Catalog#A15960). Three pulses at 1600 volts, each lasting 10 milliseconds, was used to transfect the cells with 1 \u0026micro;g of each episomal vector (Neon Transfection System, Thermofisher). Subsequently, iPS colonies were picked and cultured using mTeSR\u0026trade; Plus medium and Geltrex\u0026trade; LDEV-Free Reduced Growth Factor Basement Membrane Matrix (Thermofisher Catalog# A1413201) at 37\u0026deg;C with 5% CO2 and 20% O2.\u003c/p\u003e \u003cp\u003eImmunocytochemistry\u003c/p\u003e \u003cp\u003eThe initial fixation of the cells were done for a period of 15 minutes in 4% (w/v) paraformaldehyde. This was followed by another 10-minute wash with PBS solution consisting of 0.1% (v/v) Triton X-100. Subsequently, the cells were blocked with PBS solution containing 1% gelatin for a period of 45 minutes. The cells were then probed overnight at 4\u0026deg;C with the primary antibodies and for an hour at room temperature with the appropriate secondary antibodies. The nuclei were stained with DAPI nuclear staining at 1 \u0026micro;g /mL. We observed the staining using a 20X objective on a Zeiss LSM 880 Airyscan confocal laser scanning microscope.\u003c/p\u003e \u003cp\u003eQuantitative Reverse Transcription PCR (RT-qPCR)\u003c/p\u003e \u003cp\u003eThe total RNA was extracted in accordance with the manufacturer's instructions using the RNeasy Mini Kit. Subsequently, the RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems Catalog#4368814). Real-time qPCR reactions was performed on the QuantStudio 7 Flex Real-Time PCR System (Thermofisher scientific) using the \u003cem\u003ePower\u003c/em\u003eSYBR Green Master Mix (ThermoFisher scientific Catalog#4367659).\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn-vitro\u003c/em\u003e Differentiation\u003c/p\u003e \u003cp\u003eTo develop three germ layers derivatives from the iPSCs, STEMdiff\u0026trade; Trilineage Differentiation Kit was used (Stem Cell Technologies Catalog #05230).\u003c/p\u003e \u003cp\u003eFlow cytometry Analysis\u003c/p\u003e \u003cp\u003ePermeabilization and staining for intracellular markers were performed using the BD IntraSure\u0026trade; Kit (BD Biosciences Catalog# 641778). Reagent A was used to fix 4x10\u003csup\u003e5\u003c/sup\u003e cells for 10 minutes. Upon diluting primary antibodies with reagent B, cells were incubated for 30 minutes. PBS was used to dilute the secondary antibodies before they were incubated at room temperature for 30 minutes. Using BD FACS ARIA cell sorter, FACS samples were analyzed. A comparison of stained vs unstained cells was performed to determine the percentage of FITC-positive cells.\u003c/p\u003e \u003cp\u003eKaryotype Analysis\u003c/p\u003e \u003cp\u003eiPSCs were treated for 15 minutes with KaryoMAX\u0026trade; Colcemid\u0026trade;, 0.3 \u0026micro;g/mL, and then dissociated by TrypLE after treatment. A hypotonic solution of 75 mM potassium chloride was used to incubate the cells for 20 minutes at 37\u0026deg;C, and then iPSCs were fixed in methanol and glacial acetic acid in a 3:1 solution. Pathology and laboratory medicine (Ministry of the National Guard - Health Affairs) performed the karyotyping on at least 20 metaphases.\u003c/p\u003e \u003cp\u003ePlasmids Screening\u003c/p\u003e \u003cp\u003eThe DNA was extracted according to the manufacturer's instructions using the All Prep DNA/RNA/Protein Mini Kit (Qiagen Catalog# 80004).. As part of the PCR procedure, EBNA-1 primers were used to identify the five episomal plasmids (expected size 666 bp) (Thermo Fisher Scientific Catalog # A15560).\u003c/p\u003e \u003cp\u003eShort Tandem Repeat (STR)\u003c/p\u003e \u003cp\u003eIn this study, fifteen STR loci and Amelogenin were amplified using the AmpFLSTR\u0026trade; Identifiler\u0026trade; Plus PCR Amplification Kit (Applied Biosystems Catalog#4427368). The samples were amplified using the kit then run on 3500 Genetic Analyzer to determine the PCR amplicons. In order to gather and evaluate the data, the GeneMapper ID-X Software, version 1.4, was used to collect the results.\u003c/p\u003e \u003cp\u003eMycoplasma Detection\u003c/p\u003e \u003cp\u003eMycoplasma contamination was assessed using LookOut\u0026reg;Mycoplasma qPCR Detection (SIGMA).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eIn this study, RT-PCR data was expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). The significance of the analysis was evaluated using the Student's t-test (unpaired; two-tailed). To correct for multiple comparisons, a Bonferroni correction was applied to the \u003cem\u003ep\u003c/em\u003e-value.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eA description of clinical data and a mutation analysis\u003c/h2\u003e\n\u003cp\u003eThe 10-years-old female patient was presented with a history of seizers, subacute encephalopathy, developmental delay, and sensorineural hearing loss. Molecular genetic analysis by whole exome sequencing (WES) of patient blood sample identified homozygous pathogenic variant in the \u003cem\u003eSLC19A3\u003c/em\u003e, c.1264A\u0026thinsp;\u0026gt;\u0026thinsp;G (NP_079519.1:p.Thr422Ala). This mutation leads to an amino acid exchange in exon 5 (NM_025243.4) and has been previously described as disease-causing for biotin-thiamine-responsive basal ganglia disease by \u003cem\u003eAlfadhel et al.\u003c/em\u003e, 2013 [\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]. This variant was confirmed in the patient's peripheral blood cells as well as in the derived iPSC lines by Sanger sequencing (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003eThe derivation and establishment of BTBGD-iPSC lines\u003c/h2\u003e\n\u003cp\u003eIn-person interview was conducted and signed informed consent was obtained from the donor\u0026rsquo;s parent. Erythroid progenitor cells (EPCs) were isolated and enriched from a 10 ml peripheral blood sample and cultured for eight days (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). Using a non-integrative and virus-free reprogramming technique, as previously described [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e], two BTBGD-iPSC clones were created. Briefly, episomal vectors encoding OCT4, SOX2, KLF4, L-MYC, LIN28A, dominant-negative form of TP53, and EBNA1 were delivered to EPCs by electroporation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). Several ESC-like colonies displaying typical ESC morphological characteristics (including distinct borders, bright centers, tightly packed cells, and a high nucleus-to-cytoplasm ratio) were identified approximately 20 days post transfection (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). The derived iPSC lines were manually picked, expanded in feeder free conditions, and cryopreserved in KAIMRC facility.\u003c/p\u003e\n\u003cp\u003eA female normal chromosomal content was confirmed by G-banding analysis of the generated BTBGD-iPSCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD.) The matched identities of the isolated iPS lines and the donor PBMCs have been validated by short tandem repeats (STR) assay (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003eB). Furthermore, Mycoplasma testing has indicated that the generated iPSC are free from mycoplasma contamination (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003eCharacterization of self-renewal and potency properties\u003c/h2\u003e\n\u003cp\u003eManually picked clones were passaged and analyzed for the presence of episomal plasmids at every passage. Complete absence of reprogramming plasmids became evident at passage twelve (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003eA). Consequently, we conducted a meticulous evaluation of pluripotency using a number of approaches, including flow cytometry, immunofluorescence and real-time PCR (RT-qPCR) of the pluripotency markers of OCT4, NANOG, and SOX2. According to flow cytometry histograms, more than 95% of cells expressed OCT4, 98% expressed NANOG, and 97% were positive for SOX2 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Furthermore, Immunofluorescence staining showed positive expression of stemness markers in the derived iPS lines (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Using RT-qPCR, we found that in comparison to H1 hESCs, the expression of \u003cem\u003eOCT4, NANOG\u003c/em\u003e, and \u003cem\u003eSOX2\u003c/em\u003e mRNA was significantly upregulated (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\n\u003cp\u003eThe capacity of cells to differentiate into the three germ layers\u0026mdash;mesoderm, endoderm, and ectoderm\u0026mdash;was assessed through direct \u003cem\u003ein-vitro\u003c/em\u003e differentiation. Upregulation of germ layer-specific markers and downregulation of pluripotency markers \u003cem\u003eOCT4\u003c/em\u003e and \u003cem\u003eNANOG\u003c/em\u003e was observed across all lineages. Ectodermal differentiation has been proven by the positive expression of the central nervous system neural progenitor markers \u003cem\u003ePAX6\u003c/em\u003e and \u003cem\u003eNESTIN\u003c/em\u003e. Capacity of mesodermal commitment was assessed by directed in-vitro differentiation and was demonstrated by an increase in the expression of \u003cem\u003eCDX2\u003c/em\u003e, a caudal-type homeobox protein 2, and \u003cem\u003eBrachyury\u003c/em\u003e, a member of the T-box family. The upregulation of the endodermal markers zinc-finger transcription factor \u003cem\u003eGATA4\u003c/em\u003e and the SRY-Box transcription factor 17 (\u003cem\u003eSOX17\u003c/em\u003e) has been validated in our BTBGD-iPSC lines and H1 hESC positive controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003eFollowing pluripotency verification, the generated BTBGD-iPSC lines have been registered in the Human Pluripotent Stem Cell Registry \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://hpscreg.eu/user/cellline/edit/KAIMRCi004-A\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://hpscreg.eu/user/cellline/edit/KAIMRCi004-B\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe creation of iPSCs and the revolutionary discovery of cellular reprogramming have been widely used in the past ten years to simulate diseases \u003cem\u003ein vitro\u003c/em\u003e and offer the potential for scientific research and regenerative therapies [\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e]. iPSCs and embryonic stem cells have many features of self-renewal, gene expression, and the ability to develop into almost any type of body cell [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. NANOG, OCT3/4, SOX2, KLF4, c-MYC, and LIN28 are pluripotency transcription factors that regulate the expression of stemness and repress somatic genes [\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]. Even though iPSCs can be generated from a variety of somatic cell sources, we opted for EPCs for their tendency to be devoid of genomic DNA mutations or chromosomal abnormalities [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. We found that 69% of EPCs were positive for CD71\u003csup\u003e+\u003c/sup\u003eCD235a\u003csup\u003e+\u003c/sup\u003e erythroid cell surface markers after eight days of expansion in erythroid expansion media [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. To generate integration-free iPSCs, non-viral and non-integrating episomal plasmid-based reprogramming method was applied in this study [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. Based on the Epstein-Barr Nuclear Antigen-1, vectors incorporating oriP and EBNA-1 have demonstrated the capacity to generate iPSCs successfully with a single transfection [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eHomozygous presence of the familial pathogenic variant c.1264A\u0026thinsp;\u0026gt;\u0026thinsp;G (p.Thr422Ala) in the \u003cem\u003eSLC19A3\u003c/em\u003e gene has been previously delineated as causative for biotin-thiamine-responsive basal ganglia disease (BTBGD) by Alfadhel et al., 2013 [\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]. BTBGD represents a remarkably rare genetic condition, the diagnosis of which is complicated by its nonspecific clinical manifestations. These typically include seizures and encephalopathy, compounded by a broad spectrum of imaging differentials, including cortical T2-hyperintensities and bilateral involvement of the basal ganglia [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. It has also been established that the prognosis of BTBGD is significantly compromised by the delayed administration of biotin and thiamine, underscoring the necessity for timely intervention [\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eThe pathogenesis of BTBGD caused by SLC19A3 deficiency remains unclear. Therefore, the derivation of BTBGD-iPSC lines carrying \u003cem\u003eSLC19A3\u003c/em\u003e mutation constitutes a suitable research model to study genotype-phenotype correlations. Furthermore, differentiation of BTBGD-iPSCs towards disease-relevant lineages such as neuronal subtypes and midbrain organoids would serve as a powerful cellular platforms to determine the impact of SLC19A3 deficiency and the underlying disease mechanism in BTBGD. CRISPR/Cas9-mediated knock-in of \u003cem\u003eSLC19A3\u003c/em\u003e, coupled with \u003cem\u003ein-vitro\u003c/em\u003e disease modeling using midbrain organoids and gene expression profiling could be utilized to further our understanding of BTBGD pathogenesis, thus allowing for the discovery of more efficient therapeutic agents through drug screening.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank KAIMRC for the funding and continuous support, Pfizer for funding the establishment of the Saudi Bank of Human iPSCs, and the Local Content and Government Procurement Authority (LCGPA) in Saudi Arabia for their continuous support.\u003c/p\u003e\n\u003cp\u003eWe thank the donor and her family for their valuable donation for science.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMA and MB contributed through sample processing, iPS generation, validation assays and differentiation and writing the manuscript. M Al Shehri, HA, AB, H Attas, DA, SZ, MH, AZ have contributed in iPS validation tests. S Alameer identified the patient and contacted the family to provide the blood sample. DM obtained the blood sample from the patient. MD performed karyotype analysis. Khaled Al-ghamdi and MM performed the STR tests. M Alfadhel, KA and DA contributed through the conception of the idea, the design of the work, and revision of the document.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Pfizer Ireland Pharmaceuticals. Partial funding was provided by King Abdullah International Medical Center (KAIMRC), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS) (Protocol# NRJ22J/005/01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are openly available. All characterization data related to this study can be accessed upon reasonable request. Requests for access to this data should be directed to Dr. Khaled Alsayegh, [email protected] and/or Dr. Doaa Aboalola, [email protected]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Institutional Review Board of Ministry of National Guard Health Affairs (Protocol# NRJ22J/005/01 and NRJ22J/060/30).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed consent\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWritten informed consent was obtained from the study subjects.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eSaini AG, Sharma S. Biotin-thiamine-responsive basal ganglia disease in children: a treatable neurometabolic disorder. Annals of Indian Academy of Neurology. 2021 Mar;24(2):173.\u003c/li\u003e\n \u003cli\u003eWang J, Wang J, Han X, Liu Z, Ma Y, Chen G, Zhang H, Sun D, Xu R, Liu Y, Zhang Y. Report of the largest Chinese cohort with SLC19A3 gene defect and literature review. Frontiers in genetics. 2021 Jul 1;12:683255.\u003c/li\u003e\n \u003cli\u003eSubramanian VS, Marchant JS, Said HM. Biotin-responsive basal ganglia disease-linked mutations inhibit thiamine transport via hTHTR2: biotin is not a substrate for hTHTR2. American Journal of Physiology-Cell Physiology. 2006 Nov;291(5):C851-9.\u003c/li\u003e\n \u003cli\u003eAlfadhel M, Umair M, Almuzzaini B, et al. Targeted SLC19A3 gene sequencing of 3000 Saudi newborn: a pilot study toward newborn screening. Annals of Clinical and Translational Neurology. 2019 Oct;6(10):2097-2103.\u003c/li\u003e\n \u003cli\u003eManey K, Pizoli C, Russ JB. Child Neurology: Infantile Biotin Thiamine Responsive Basal Ganglia Disease: Case Report and Brief Review. Neurology. 2023 Apr 25;100(17):836-9.\u003c/li\u003e\n \u003cli\u003eAlfadhel M, Almuntashri M, Jadah RH, Bashiri FA, Al Rifai MT, Al Shalaan H, Al Balwi M, Al Rumayan A, Eyaid W, Al-Twaijri W. Biotin-responsive basal ganglia disease should be renamed biotin-thiamine-responsive basal ganglia disease: a retrospective review of the clinical, radiological and molecular findings of 18 new cases. Orphanet journal of rare diseases. 2013 Dec;8:1-8.\u003c/li\u003e\n \u003cli\u003eJo J, Xiao Y, Sun AX, Cukuroglu E, Tran HD, G\u0026ouml;ke J, Tan ZY, Saw TY, Tan CP, Lokman H, Lee Y. Midbrain-like organoids from human pluripotent stem cells contain functional dopaminergic and neuromelanin-producing neurons. Cell stem cell. 2016 Aug 4;19(2):248-57.\u003c/li\u003e\n \u003cli\u003eKwak TH, Kang JH, Hali S, Kim J, Kim KP, Park C, Lee JH, Ryu HK, Na JE, Jo J, Je HS. Generation of homogeneous midbrain organoids with in vivo-like cellular composition facilitates neurotoxin-based Parkinson\u0026apos;s disease modeling. Stem cells. 2020 Jun 1;38(6):727-40.\u003c/li\u003e\n \u003cli\u003eAlowaysi M, Lehmann R, Al-Shehri M, Baadhaim M, Alzahrani H, Aboalola D, Zia A, Malibari D, Daghestani M, Alghamdi K, Haneef A. HLA-based banking of induced pluripotent stem cells in Saudi Arabia. Stem Cell Research \u0026amp; Therapy. 2023 Dec 18;14(1):374.\u003c/li\u003e\n \u003cli\u003eAlowaysi M, Al-Shehri M, Badkok A, Attas H, Aboalola D, Baadhaim M, Alzahrani H, Daghestani M, Zia A, Al-Ghamdi K, Al-Ghamdi A. Generation of iPSC lines (KAIMRCi003A, KAIMRCi003B) from a Saudi patient with Dravet syndrome carrying homozygous mutation in the CPLX1 gene and heterozygous mutation in SCN9A. Human Cell. 2023 Dec 19:1-9.\u003c/li\u003e\n \u003cli\u003eTakahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. cell. 2007 Nov 30;131(5):861-72.\u003c/li\u003e\n \u003cli\u003eSoejitno A, Prayudi PK. The prospect of induced pluripotent stem cells for diabetes mellitus treatment. Therapeutic advances in endocrinology and metabolism. 2011 Oct;2(5):197-210.\u003c/li\u003e\n \u003cli\u003eMitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 2003 May 30;113(5):631-42.\u003c/li\u003e\n \u003cli\u003eChambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003 May 30;113(5):643-55.\u003c/li\u003e\n \u003cli\u003eNiwa H, Ogawa K, Shimosato D, Adachi K. A parallel circuit of LIF signalling pathways maintains pluripotency of mouse ES cells. Nature. 2009 Jul 2;460(7251):118-22.\u003c/li\u003e\n \u003cli\u003eCartwright P, McLean C, Sheppard A, Rivett D, Jones K, Dalton S. LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism.\u003c/li\u003e\n \u003cli\u003eTokuzawa Y, Kaiho E, Maruyama M, Takahashi K, Mitsui K, Maeda M, Niwa H, Yamanaka S. Fbx15 is a novel target of Oct3/4 but is dispensable for embryonic stem cell self-renewal and mouse development. Molecular and cellular biology. 2003 Apr 1;23(8):2699-708.\u003c/li\u003e\n \u003cli\u003eOkumura-Nakanishi S, Saito M, Niwa H, Ishikawa F. Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells. Journal of Biological Chemistry. 2005 Feb 18;280(7):5307-17.\u003c/li\u003e\n \u003cli\u003eYu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II. Induced pluripotent stem cell lines derived from human somatic cells. science. 2007 Dec 21;318(5858):1917-20.\u003c/li\u003e\n \u003cli\u003eSridharan R, Tchieu J, Mason MJ, Yachechko R, Kuoy E, Horvath S, Zhou Q, Plath K. Role of the murine reprogramming factors in the induction of pluripotency. Cell. 2009 Jan 23;136(2):364-77.\u003c/li\u003e\n \u003cli\u003eSoufi A, Donahue G, Zaret KS. Facilitators and impediments of the pluripotency reprogramming factors\u0026apos; initial engagement with the genome. Cell. 2012 Nov 21;151(5):994-1004.\u003c/li\u003e\n \u003cli\u003eMajumdar S, Salamon N. Biotin-thiamine-responsive basal ganglia disease: A case report. Radiol Case Rep. 2021 Dec 28;17(3):753-758.\u003c/li\u003e\n \u003cli\u003eAlgahtani H, Ghamdi S, Shirah B, Alharbi B, Algahtani R, Bazaid A. Biotin\u0026ndash;thiamine\u0026ndash;responsive basal ganglia disease: catastrophic consequences of delay in diagnosis and treatment. Neurological research. 2017 Feb 1;39(2):117-25.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eList of antibodies and primers used in this study.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003eAntibodies and stains used for immunocytochemistry/flow-cytometry\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAntibody\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDilution\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCompany Cat # and RRID\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePluripotency Markers\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRabbit anti-OCT4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1:100\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAbcam Cat# ab200834 RRID# AB_2924374\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGoat anti-NANOG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1:100\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAbcam Cat# ab109250 RRID# AB_10863442\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGoat anti-SOX2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1:100\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eThermofisher Cat# MA1-014 RRID# AB_2536667\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSecondary antibody\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGoat anti-Rabbit Secondary Antibody, Alexa Fluor 488\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIF 1:200\u003c/p\u003e\n\u003cp\u003eFlow Cyt 1:2000\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAbcam Cat#: ab150077 RRID# AB_2630356\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003ePrimers and Oligonucleotides used in this study\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTarget\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eForward/Reverse primer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDifferentiation Markers RT-qPCR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBRACHYURY or TBXT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eTAAGGTGGATCTTCAGGTAGC\u003c/p\u003e\n\u003cp\u003eCATCTCATTGGTGAGCTCCCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCDX2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eGACGTGAGCATGTACCCTAGC\u003c/p\u003e\n\u003cp\u003eGCGTAGCCATTCCAGTCCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNESTIN\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eCTGCTACCCTTGAGACACCTG\u003c/p\u003e\n\u003cp\u003eGGGCTCTGATCTCTGCATCTAC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePAX6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eTGGGCAGGTATTACGAGACTG\u003c/p\u003e\n\u003cp\u003eACTCCCGCTTATACTGGGCTA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSOX17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eGCATTCTGGAATGAGCCTACT\u003c/p\u003e\n\u003cp\u003eGGGCAGGTCAAGCTTATGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGATA4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eCGACACCCCAATCTCGATATG\u003c/p\u003e\n\u003cp\u003eGTTGCACAGATAGTGACCCGT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHouse-Keeping Genes (qPCR)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n\u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003emutation analysis\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSLC19A3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eTCTCTCTCTCTCTTTGCTG\u003c/p\u003e\n\u003cp\u003eACTTCTTACCTGCCTTATCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEBNA-1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003epEP4-SF2-oriP\u003c/p\u003e\n\u003cp\u003epEP4-SR2-oriP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eATC GTC AAA GCT GCA CAC AG\u003c/p\u003e\n\u003cp\u003eCCC AGG AGT CCC AGT AGT CA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"human-cell","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"huce","sideBox":"Learn more about [Human Cell](http://link.springer.com/journal/13577)","snPcode":"13577","submissionUrl":"https://www.editorialmanager.com/huce/default2.aspx","title":"Human Cell","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"iPSC, Biotin-Thiamine-Responsive Basal Ganglia disease, BTBGD, Encephalopathy, SLC19A3 variant, Saudi Arabia","lastPublishedDoi":"10.21203/rs.3.rs-3977137/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3977137/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe neurometabolic disorder known as biotin-thiamine-responsive basal ganglia disease (BTBGD) is a rare autosomal recessive condition linked to bi-allelic pathogenic mutations in the \u003cem\u003eSLC19A3\u003c/em\u003e gene. BTBGD is a neurological disorder characterized by progressive encephalopathy, confusion, seizures, dysarthria, dystonia, and severe disabilities. Diagnosis is difficult due to the disease's rare nature and diverse clinical characteristics. The primary treatment for BTBGD at this time is thiamine and biotin supplementation, while its long-term effectiveness is still being investigated. Despite the lack of knowledge related to genotype-phenotype correlations, the derivation of BTBGD-iPSC lines carrying a homozygous mutation in \u003cem\u003eSLC19A3\u003c/em\u003e constitutes a unique cell model to examine the molecular mechanisms underlying the cellular dysfunctions caused by \u003cem\u003eSLC19A3\u003c/em\u003e pathogenic variant and could promote the development of novel therapeutic agents.\u003c/p\u003e","manuscriptTitle":"Derivation of two iPSC lines (KAIMRCi004-A, KAIMRCi004-B) from a Saudi patient with Biotin-Thiamine-Responsive Basal Ganglia disease (BTBGD) carrying homozygous pathogenic missense variant in the SCL19A3 gene","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-06 19:17:02","doi":"10.21203/rs.3.rs-3977137/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-03-04T15:56:10+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-03T06:12:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-01T05:15:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"Human Cell","date":"2024-02-28T04:09:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"human-cell","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"huce","sideBox":"Learn more about [Human Cell](http://link.springer.com/journal/13577)","snPcode":"13577","submissionUrl":"https://www.editorialmanager.com/huce/default2.aspx","title":"Human Cell","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d7ceab73-d390-4e3f-ba2f-2734ae91e2fd","owner":[],"postedDate":"March 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-28T02:08:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-06 19:17:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3977137","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3977137","identity":"rs-3977137","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}