IFN-γ and TNF-α Impair Lung Development by Upregulating SMAD7 to Inhibit TGF-β Signaling Pathway and ECM Dysregulation

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Inflammation plays a pivotal role in neonatal lung injury and is closely associated with the pathogenesis of bronchopulmonary dysplasia (BPD) in preterm infants, although the underlying molecular mechanisms remain incompletely understood. Our study detected elevated serum levels of interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α) in preterm neonates as early as postnatal day 1 among those who later developed moderate-to-severe BPD. In pulmonary fibroblasts, co-treatment with IFN-γ and TNF-α significantly downregulated α-smooth muscle actin (α-SMA) and disrupted extracellular matrix (ECM) homeostasis, evidenced by reduced collagen type I alpha 1 (COL1A1), collagen type III alpha 1 (COL3A1), and elastin expression, but elevated fibronectin 1 (FN1) and matrix metalloproteinase-1. Furthermore, dual-cytokine exposure attenuated SMAD2/3 phosphorylation and nuclear translocation, while upregulating SMAD7. Parallel experiments using E16.5 fetal rat lung explants recapitulated these changes, showing decreased COL1A1, elevated SMAD7, and BPD-like histopathological alterations, including alveolar simplification and enlarged airspaces. Mechanistically, IFN-γ and TNF-α synergistically promoted SMAD7 overexpression, which competitively bound to SMAD2/3 and suppressed TGF-β signaling, ultimately leading to ECM dysregulation. These data delineate a novel inflammatory axis impairing lung development, highlighting SMAD7 and TGF-β pathways as promising intervention targets.
Full text 139,702 characters · extracted from preprint-html · click to expand
IFN-γ and TNF-α Impair Lung Development by Upregulating SMAD7 to Inhibit TGF-β Signaling Pathway and ECM Dysregulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article IFN-γ and TNF-α Impair Lung Development by Upregulating SMAD7 to Inhibit TGF-β Signaling Pathway and ECM Dysregulation Xiaotian Liao, Weiliang Huang, Jianwei Wei, Lu Zhu, Xiaojun Lin, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7506004/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Feb, 2026 Read the published version in Inflammation → Version 1 posted 7 You are reading this latest preprint version Abstract Inflammation plays a pivotal role in neonatal lung injury and is closely associated with the pathogenesis of bronchopulmonary dysplasia (BPD) in preterm infants, although the underlying molecular mechanisms remain incompletely understood. Our study detected elevated serum levels of interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α) in preterm neonates as early as postnatal day 1 among those who later developed moderate-to-severe BPD. In pulmonary fibroblasts, co-treatment with IFN-γ and TNF-α significantly downregulated α-smooth muscle actin (α-SMA) and disrupted extracellular matrix (ECM) homeostasis, evidenced by reduced collagen type I alpha 1 (COL1A1), collagen type III alpha 1 (COL3A1), and elastin expression, but elevated fibronectin 1 (FN1) and matrix metalloproteinase-1. Furthermore, dual-cytokine exposure attenuated SMAD2/3 phosphorylation and nuclear translocation, while upregulating SMAD7. Parallel experiments using E16.5 fetal rat lung explants recapitulated these changes, showing decreased COL1A1, elevated SMAD7, and BPD-like histopathological alterations, including alveolar simplification and enlarged airspaces. Mechanistically, IFN-γ and TNF-α synergistically promoted SMAD7 overexpression, which competitively bound to SMAD2/3 and suppressed TGF-β signaling, ultimately leading to ECM dysregulation. These data delineate a novel inflammatory axis impairing lung development, highlighting SMAD7 and TGF-β pathways as promising intervention targets. Lung development Inflammatory cytokines Extracellular matrix SMAD Pulmonary fibroblasts Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTON Bronchopulmonary dysplasia (BPD) has emerged as a predominant chronic lung disease affecting preterm neonates and serves as a significant indicator of poor outcomes related to premature delivery [ 1 ]. Each year in the U.S., about 50,000 infants with extremely low gestational age are born, among whom approximately 35% eventually develop this condition [ 2 ]. Research conducted across multiple centers in China's Guangdong province demonstrated that 63.7% of extremely low birth weight infants needed supplemental oxygen at 28 days postnatal age [ 3 ], with a BPD diagnosis confirmed in 32.3% of extremely preterm cases [ 4 ]. The disease pathogenesis involves maladaptive repair processes following repetitive pulmonary injuries occurring during crucial developmental phases, either before or after birth. Affected neonates exhibit heightened respiratory compromise, extended hospital stays [ 5 ], and persistent airway obstruction that frequently evolves into chronic respiratory dysfunction in later life [ 6 ]. Growing evidence suggests that inflammatory events occurring during gestation or the perinatal period play a pivotal role in predisposing to neonatal lung damage and show a strong correlation with BPD development. Multiple investigations have detected increased concentrations of inflammatory mediators such as TNF-α, IFN-γ, and IL-6 in both amniotic fluid and neonatal bloodstream, which may contribute to impaired alveolar formation and abnormal pulmonary vascular development [ 7 , 8 ]. Nevertheless, the exact biological pathways through which these inflammatory molecules regulate the characteristic pulmonary developmental abnormalities in BPD remain incompletely elucidated. The extracellular matrix (ECM) constitutes a sophisticated three-dimensional framework generated by stromal cells, encompassing structural proteins (collagens), adhesive glycoproteins, glycosaminoglycans, and other macromolecular components that orchestrate tissue patterning during embryogenesis, physiological maintenance, and regenerative processes. Within the pulmonary microenvironment, this dynamic ECM architecture serves dual roles: providing critical structural integrity for parenchymal cells while simultaneously mediating mechanochemical signaling crucial for pulmonary morphogenesis [ 9 ]. Lung morphogenesis progresses through five consecutive developmental phases: the embryonic period (weeks 4–7), pseudoglandular phase (weeks 5–17), canalicular stage (weeks 16–26), terminal saccular period (weeks 24–38), and alveolar maturation phase (week 36-postnatal) during which precisely regulated ECM remodeling governs cellular proliferation and differentiation events [ 10 , 11 ]. Conversely, developmentally programmed ECM synthesis and degradation represent fundamental requirements for proper organogenesis. Disruptions in these tightly coordinated ECM-cell interactions can result in aberrant pulmonary development, as observed in bronchopulmonary dysplasia. Notably, pathological reactivation of developmental pathways may underlie various pulmonary disorders including idiopathic interstitial pneumonia, pulmonary vascular remodeling diseases, and thoracic malignancies, all of which exhibit characteristic ECM compositional changes [ 12 , 13 ]. The transforming growth factor-β (TGF-β) signaling cascade serves as a master regulator of extracellular matrix homeostasis, critically governing both ECM biosynthesis and accumulation processes [ 14 ]. Mechanistically, TGF-β induces phosphorylation of SMAD2/3 proteins, which subsequently form heteromeric complexes with SMAD4 and translocate to the nucleus to activate transcription of key ECM components including COL1A1, COL3A1 and FN1 genes [ 15 , 16 ]. This pathway simultaneously modulates ECM turnover by enhancing TIMP1/2 expression while suppressing MMP2/9 activity, thereby shifting the balance toward matrix accumulation [ 17 , 18 ]. Signal initiation occurs when TGF-β ligands engage specific cell surface receptors (types I and II serine/threonine kinase receptors), inducing receptor phosphorylation and subsequent activation of downstream effectors. The SMAD protein family, consisting of eight structurally related members, mediates these signals through three functionally distinct subgroups: 1) receptor-activated SMADs (R-SMADs: SMAD1/2/3/5/8), 2) the common-mediator SMAD4, and 3) inhibitory SMADs (I-SMADs: SMAD6/7) that negatively regulate the pathway [ 19 ]. Notably, genetic ablation of Smad3 in murine models leads to profound pulmonary abnormalities characterized by defective alveolarization, airspace enlargement, and marked reduction in lung tropoelastin expression - pathological features that closely recapitulate the hallmarks of both bronchopulmonary dysplasia and emphysema [ 20 ]. This study revealed that preterm infants with moderate-to-severe BPD exhibited significantly increased serum levels of IFN-γ and TNF-α on postnatal day 1. The synergistic action of IFN-γ and TNF-α upregulates SMAD7, thereby inhibiting TGF-β-Smad2/3 signaling and suppressing fibroblast activation and ECM remodeling. Additionally, lung explants treated with IFN-γ and TNF-α showed reduced alveolar number and enlarged alveolar diameter, mimicking key pathological features of BPD. Materials and methods Clinical data collection This study included very preterm infants admitted to the Department of Neonatology at the Third Affiliated Hospital of Guangzhou Medical University between February and December 2021. Bronchopulmonary dysplasia (BPD) was diagnosed according to the 2018 NICHD revised criteria [ 21 ]. Grade II and Grade III BPD correspond to moderate and severe BPD, respectively. Collected clinical data encompassed perinatal factors (gestational age, birth weight, delivery mode, amniotic fluid status, sex, Apgar scores, singleton/twin status), respiratory support details (FiO₂ on postnatal days 1, 7, 14, 21, and 28; cumulative oxygen exposure; durations of invasive/non-invasive ventilation), and initial white blood cell counts. Luminex multiplex assay All preterm infants included in the study underwent arterial or venous blood collection for 0.5 mL per time on the postnatal day 1, 14, and 28 respectively. The samples were centrifuged at 3,200 rpm for 10 minutes at room temperature to separate serum, which was then aliquoted into EP tubes and stored at − 80°C until analysis. After completing specimen collection, serum levels of TNF-α, IFN-γ, IL-10, CCL1, VEGF, and PDGF-BB were simultaneously quantified using Luminex technology (Kit: Shanghai Univ Biotechnology Co., Ltd., Cat. No. LXSAHM-22), strictly following the manufacturer’s protocols. Cell Culture The human alveolar epithelial cell line A549 and lung fibroblast cell line MRC-5 were acquired from ATCC (Manassas, VA, USA). A549 cells were maintained in DMEM (Gibco, Grand Island, NY), while MRC-5 cells were cultured in MEM (Gibco), both supplemented with 10% FBS (Gibco). Cell propagation was performed using 0.25% trypsin-EDTA solution under standard culture conditions (37°C, 5% CO₂). Experimental interventions involved treatment with commercially available cytokines (IFN-γ, TNF-α, TGF-β; Selleck Chemicals) at specified concentrations and durations. Fetal Lung Explant Culture Mouse embryonic lung tissues at gestational day 16.5 were collected under sterile conditions and sectioned into 5 mm³ pieces. After thorough washing with antibiotic-supplemented PBS (1% penicillin-streptomycin) to eliminate residual blood components, tissue explants were placed on Transwell membranes in 12-well culture plates. The explant medium consisted of Minimum Essential Medium enriched with 10% fetal bovine serum, 1% penicillin-streptomycin, 2 mM L-glutamine, and 25 mM HEPES buffer, with three tissue pieces evenly arranged per well. Cultures were incubated under standard conditions (37°C, 5% CO₂) with semi-daily medium replacement (50% volume). For cytokine treatments, 20 ng/mL concentrations of IFN-γ, TNF-α, or their combination were administered for 72 hours before tissue processing for histological (hematoxylin-eosin staining) and immunohistochemical evaluation. CCK-8 Cell Viability Assay The cell proliferation assay was performed as follows: initially, cells were plated in 96-well culture plates at a density of 5×10³ cells per well and incubated for 48 hours with the designated treatments. Cellular viability was then evaluated using the CCK-8 assay kit (Vazyme Biotech Co., Nanjing), strictly adhering to the supplier's instructions. Absorbance measurements were conducted at a wavelength of 450 nm employing a BioTek ELx800 absorbance microplate reader. RNA sequencing RNA sequencing was conducted by Novogene Co., Ltd. (Suzhou, China). Initially, RNA concentration and integrity were evaluated using an RNA Nano 6000 Assay Kit (Agilent Technologies, Santa Clara, CA, USA) in conjunction with the Bioanalyzer 2100 system (Agilent Technologies). Subsequently, cDNA library preparation was performed following standard protocols, with library quality verification conducted using the AMPure XP system (Beckman Coulter, Brea, CA, USA). Following quality control, the prepared libraries were subjected to high-throughput sequencing on an Illumina Novaseq platform (Illumina, San Diego, CA, USA), generating 150 base-pair paired-end reads. For differential expression analysis, the edgeR package in R was employed to identify significantly differentially expressed genes (DEGs), applying stringent thresholds of |log2 fold change| >1 and adjusted p-value (false discovery rate) < 0.05. Functional annotation of the identified DEGs was performed through Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using the clusterProfiler package. Additionally, Gene Set Enrichment Analysis (GSEA) was implemented to evaluate whether predefined gene sets exhibited statistically significant, concordant differences between experimental groups, providing complementary pathway-level insights to the DEG analysis. Western blot Western blot analysis was conducted according to standard methods [ 22 ], using whole-cell lysates prepared as described previously. Primary antibodies were used as follows: α-smooth muscle actin (α-SMA, Cat#19245, 1:1000), collagen type I alpha 1 chain (COL1A1, Cat#91144, 1:1000), SMAD2 (Cat#5339, 1:1000), phosphorylated SMAD2 (p-SMAD2, Ser465/467, Cat#18338, 1:1000), SMAD3 (Cat#9523, 1:1000), phosphorylated SMAD3 (p-SMAD3, Ser423/425, Cat#9520, 1:1000), and SMAD4 (Cat#38454, 1:1000) from Cell Signaling Technology (CST, USA); SMAD7 (Cat#ab216428, 1:1000) from Abcam (UK); β-actin (1:1000) as loading control from Beijing Boaosen Biotechnology (Beigjing, China). RNA Extraction and Quantitative Real-Time PCR Analysis Total RNA was extracted from cells/tissues with TRIzol reagent (Thermo Fisher Scientific) following the supplier’s instructions. Subsequently, 1 µg of RNA was reverse-transcribed into cDNA using a commercial kit (Vazyme, Nanjing). qRT-PCR was carried out in a 20 µL reaction mixture containing 2 µL cDNA, 0.4 µM primers, and SYBR Green Premix (Vazyme) on a QuantStudio 6 Flex system. Thermal cycling conditions included an initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. Amplification specificity was confirmed by melt curve analysis. Relative gene expression, normalized to GAPDH , was determined using the 2^(-ΔΔCt) method. Primer sequences are listed in Table 2 . Table 1 Clinical characteristics of the eligible preterm infants Characteristics Non/Mild BPD group(n=9) Moderate/Severe BPD group (n=9) P Gestational age (weeks), Maen ±SD 27.2±1.21 27.08±2.05 NS Birth weight (grams), Maen ±SD 822±182 814±120 NS Gender (female), No.(%) 4(44.44) 3(33.33) NS Cesarean section, No.(%) 7(77.78) 7(77.78) NS Twin birth, No.(%) 2(22.22) 3(33.33) NS Apgar score at 1min, M(Q1-Q3) 7(6-8) 8(7-8) NS Apgar score at 5min, M(Q1-Q3) 9(8-10) 9(9-10) NS Apgar score at 10min, M(Q1-Q3) 10(9.5-10) 10(9-10) NS FiO₂(%) on day 1, M(Q1-Q3) 30(23-37.5) 28(25.5-45) NS FiO₂(%) on day 7, M(Q1-Q3) 21(21-26.5) 23(21.5-30) NS FiO₂(%) on day 14, M(Q1-Q3) 23(21-27) 25(22.5-30) NS FiO₂(%) on day 21, M(Q1-Q3) 25(21-28) 28(21.5-29) NS FiO₂(%) on day 28, M(Q1-Q3) 25(21-29) 28(23.5-32.5) NS Oxygen dependence (days), M(Q1-Q3) 68(54-80.5) 81(65.5-114.5) NS Non-invasive ventilation (days), M(Q1-Q3) 48(41-56) 61(57.5-70) 0.012 Invasive ventilation (days), M(Q1-Q3) 10(5.5-14.5) 11(2.5-38.5) NS WBC on day 1 (×10⁹/L), M(Q1-Q3) 6.94(3.18-13.4) 7.08(4.15-7.52) NS BPD: bronchopulmonary dysplasia; SD: standard deviation; NS: no significance; M(Q1-Q3): median and the 1 st to the 3 rd quarter; FiO 2 : fraction of inspired oxygen; WBC: white blood cell. Table 2 Primers of RT-PCR Species Gene Forward primer (5'-3') Reverse primer (5'-3') Homo GAPDH CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG Homo ACTA2 GTGTTGCCCCTGAAGAGCAT GCTGGGACATTGAAAGTCTCA Homo COL1A1 GTGCGATGACGTGATCTGTGA CGGTGGTTTCTTGGTCGGT Homo COL1A2 GGCCCTCAAGGTTTCCAAGG CACCCTGTGGTCCAACAACTC Homo COL3A1 TTGAAGGAGGATGTTCCCATCT ACAGACACATATTTGGCATGGTT Homo FN1 AGGAAGCCGAGGTTTTAACTG AGGACGCTCATAAGTGTCACC Homo ELN GCAGGAGTTAAGCCCAAGG TGTAGGGCAGTCCATAGCCA Homo MMP1 AAAATTACACGCCAGATTTGCC GGTGTGACATTACTCCAGAGTTG Homo MMP2 TACAGGATCATTGGCTACACACC GGTCACATCGCTCCAGACT Homo SMAD2 TCATAGCTTGGATTTACAGCCAG TTCTACCGTGGCATTTCGGTT Homo SMAD3 CCATCTCCTACTACGAGCTGAA CACTGCTGCATTCCTGTTGAC Homo SMAD7 GGACAGCTCAATTCGGACAAC GTACACCCACACACCATCCAC Immunofluorescence Protocol Following fixation (4% PFA, 15 min), permeabilization (0.1% Triton X-100, 10 min), and blocking (5% BSA, 30 min), cells were incubated overnight at 4°C with primary antibodies (α-SMA, 1:200, CST #19245; SMAD2/3, 1:200, CST #8685). After PBS washes, Alexa Fluor-conjugated secondary antibodies (1:200) were applied for 1 h at room temperature. DAPI (5 min) was used for nuclear visualization before mounting with ProLong Gold (Thermo Fisher Scientific, USA). Co-immunoprecipitation MRC5 cells were disrupted using RIPA lysis buffer (Thermo Fisher Scientific, USA) containing a cocktail of protease and phosphatase inhibitors. After pre-clearing, the lysates were subjected to centrifugation at 12,000 ×g for 15 minutes at 4°C. The resulting supernatant was incubated overnight at 4°C with gentle agitation in the presence of an anti-SMAD3 primary antibody (Cell Signaling Technology, #9523). Subsequently, Protein A/G magnetic beads were introduced and allowed to bind for 6 hours at 4°C to isolate the immune complexes. The beads were then washed three times with lysis buffer before proceeding to immunoblotting. Histology and Immunohistochemistry Lung tissue samples were carefully washed with phosphate-buffered saline (PBS) and then immersion-fixed in 4% paraformaldehyde. After embedding in paraffin, thin sections (5 µm thickness) were cut and subjected to H&E staining. For immunohistochemistry (IHC), tissue sections were first deparaffinized, followed by antigen unmasking and nonspecific binding blocking. Subsequently, they were exposed to primary antibodies targeting COL1A1 (Cell Signaling Technology, #72026) or SMAD7 (Thermo Fisher, #42–0400) and kept at 4°C overnight. Following PBS washes, the sections were treated with horseradish peroxidase (HRP)-linked secondary antibodies for 1 hour at room temperature. Finally, DAB substrate (Vector Laboratories, USA) was applied for signal development, and hematoxylin was used to counterstain nuclei. Statistical analysis Data analysis was conducted utilizing SPSS 25 and GraphPad Prism 8. Continuous variables are presented as mean ± SD unless specified otherwise. For comparisons involving two groups, independent samples t-tests or Mann-Whitney U tests were employed based on data distribution characteristics. Multigroup analyses were performed using one-way ANOVA with appropriate post-hoc tests. Categorical variables were assessed through Pearson's chi-square test or exact probability tests depending on sample size requirements. When parametric test assumptions (normality and equal variance) were not met, corresponding non-parametric alternatives were applied. P < 0.05 was considered statistically significant. Result Elevated serum IFN-γ and TNF-α levels at birth in very preterm infants with Moderate/Severe BPD Previous studies have demonstrated a significant association between BPD and inflammatory cytokines [ 7 , 23 ]. However, the inflammatory factors at different perinatal time points remain to be further elucidated. In this study, at first, we employed Luminex multiplex assay to systematically analyze the concentration of serum inflammatory cytokines in very preterm infants on day 1 (at birth), 14, and 28 after birth; and made comparison between Moderate/Severe BPD group and Non/Mild BPD group to identify the major elevated cytokines. To minimize confounding effects of gestational age and birth weight, we performed propensity score matching (PSM) prior to serum analysis. The final cohort comprised 18 matched infants, with baseline characteristics presented in Table 1 . The Moderate/Severe BPD group required significantly longer non-invasive ventilation compared to controls. Cytokine profiling demonstrated markedly higher serum TNF-α and IFN-γ levels on postnatal day 1 in the Moderate/Severe BPD group (Fig. 1 a-b), while no significant differences were observed for these cytokines at later time points (day 14/28) or for IL-10, CCL1, PDGF-BB, and VEGF levels at any time point (Fig. 1 c-f). These findings indicate that early elevation of IFN-γ and TNF-α may serve as predictive biomarkers for Moderate/Severe BPD development in very preterm neonates. IFN-γ and TNF-α inhibit the fibroblast activation To investigate the impact of IFN-γ and TNF-α on lung development, the in vitro experiments were adopted. The A549 cell line (lung epithelial) and MRC-5 cell line (lung fibroblast) were treated with different dose of IFN-γ, TNF-α, and their combination (IFN-γ + TNF-α). None of them induced cell death or affected cell proliferation (Fig. 2 a-b). However, morphology of MRC-5 cells changed significantly from spindle or irregularly triangular shape to flat shape, especially treatment with IFN-γ + TNF-α for 48h (Fig. 2 c). Significant changes in cell morphology seem to imply fibroblasts have lost their mesenchymal cell properties to some extent. Furthermore, the expression of α-smooth muscle actin (α-SMA) were tested, which is a hallmark of fibroblast activation. The immunofluorescence staining showed IFN-γ + TNF-α treatment remarkably decreased the expression of α-SMA, while compared with the control, TGF-β, IFN-γ + TGF-β, or TNF-α + TGF-β treatment groups (Fig. 2 d). The above results indicated IFN-γ combined with TNF-α significantly inhibit the fibroblast activation. In order to explore the underlying mechanism, the MRC-5 treated with IFN-γ, TNF-α or their combination was tested by RNA-seq. Notably, the transcriptomic changes were most prominently enriched in pathways involving extracellular matrix components and related functions (Fig. 2 e-f). IFN-γ and TNF-α induce fibroblast ECM remodeling To validate the gene enrichment analysis findings, we examined the effects of IFN-γ and TNF-α on ECM-related gene expression. RT-PCR analysis of MRC-5 cells treated with IFN-γ, TNF-α, or their combination for 24 h revealed a pronounced reduction in COL1A1 , COL3A1 , and ELN expression, whereas MMP1 and FN1 were markedly upregulated in the IFN-γ + TNF-α group compared to single treatments or controls (Fig. 3 a). Consistent with these results, Western blot analysis showed dose-dependent decreases in α-SMA and COL1A1 protein levels following 24 h and 48 h of IFN-γ + TNF-α treatment (Fig. 3 b–c). To further assess these effects in a developmental context, E16.5 fetal mouse lung explants were exposed to IFN-γ, TNF-α, or their combination for 72 h. Immunohistochemical analysis revealed significant downregulation of COL1A1 in the alveolar interstitium of the IFN-γ + TNF-α group (Fig. 3 d, g). Additionally, this group exhibited impaired alveolarization, characterized by reduced alveolar number and increased mean alveolar diameter (Fig. 3 e–f). Collectively, these results indicate that the synergistic action of IFN-γ and TNF-α disrupts lung development by inhibiting fibroblast activation and altering ECM remodeling. IFN-γ and TNF-α decrease the ECM through inhibition of TGF-β/SMAD2/3 signaling pathway GSEA of RNA-seq data identified significant alterations in TGF-β signaling pathway-related gene sets in the IFN-γ + TNF-α group compared to controls (Fig. 4 a). Given the critical role of TGF-β in ECM deposition [ 14 ], we further examined its regulation under pro-inflammatory conditions. Exogenous TGF-β1 was applied to MRC-5 cells alongside IFN-γ, TNF-α, or their combination. RT-PCR analysis revealed that IFN-γ + TNF-α co-treatment significantly downregulated COL1A1 and α-SMA mRNA levels compared to other groups, whereas SMAD2 and SMAD3 expression remained unchanged (Fig. 4 b). At the protein level, short-term TGF-β1 treatment (2 h) robustly induced SMAD2/3 phosphorylation regardless of cytokine exposure, accompanied by a modest increase in COL1A1 and α-SMA (Fig. 4 c). However, prolonged treatment (24–48 h) showed that IFN-γ + TNF-α co-treatment markedly attenuated TGF-β1-induced SMAD2/3 phosphorylation and ECM protein expression, while IFN-γ or TNF-α alone had no significant effect (Fig. 4 d–e). Immunofluorescence staining further confirmed these findings: TGF-β1 promoted SMAD2/3 nuclear translocation, but this effect was abolished by IFN-γ + TNF-α co-treatment (Fig. 4 f–g). Together, these data demonstrate that IFN-γ and TNF-α synergistically inhibit TGF-β/SMAD signaling, thereby suppressing ECM production. IFN-γ and TNF-α inhibit SMAD2/3 phosphorylation via upregulating SMAD7 The regulation of the TGF-β signaling pathway involves multiple molecules and pathways, among which SMAD7 is a key negative regulator [ 24 ]. Our RNA-seq analysis revealed significant upregulation of SMAD7 expression in the IFN-γ + TNF-α group comparing with the control, IFN-γ or TNF-α(Fig. 5 a). We further validated this result. MRC-5 cells were treated with IFN-γ, TNF-α and IFN-γ + TNF-α for 1h, 12h, 24h and 48h. RT-PCR analysis demonstrated that SMAD7 expression increased sharply in IFN-γ + TNF-α treatment group compared to other groups (Fig. 5 b). Moreover, Co-treated with TGF-β1, IFN-γ + TNF-α treatment group markedly increased the SMAD7 at 24h and 48h(Fig. 5 c). Previous studies proved SMAD7 competitively inhibited the binding of R-SMADs (including SMAD1, 2, 3, 5, and 8) to receptors and disrupted the interactions of R-SMADs with Co-Smad (SMAD4), thereby inhibiting the TGF signaling pathway [ 24 ]. As shown in Fig. 5 d, co-immunoprecipitation revealed increased binding of SMAD3 to SMAD7, and decreased binding to SMAD4 in the IFN-γ + TNF-α co-treatment with TGF-β1. Conversely, TGF-β1 treatment enhanced the interactions between SMAD3 and SMAD4, and attenuated the interactions with SMAD 7. Consistently, IFN-γ + TNF-α treatment markedly increased SMAD7 expression in fetal mouse lung explants, as demonstrated by immunohistochemistry (Fig. 5 e-f). These results indicated IFN-α combined with TNF-α inhibited TGF-β signaling pathway by upregulating SMAD7 expression. Discussion Extensive research has established a significant link between prenatal or perinatal inflammatory exposure and bronchopulmonary dysplasia (BPD) pathogenesis. A comprehensive meta-analysis incorporating 158 clinical studies (n = 244,096 neonates) with expanded covariate assessment reaffirmed chorioamnionitis as an independent risk factor for BPD in premature infants [ 25 ]. Subsequent investigations by Costa [ 26 ] and Lee [ 27 ] demonstrated a positive correlation between the histological grading of chorioamnionitis and BPD occurrence. Koksal et al. [ 7 ] observed markedly increased circulating pro-inflammatory cytokine concentrations within the first postnatal day in neonates who later developed BPD. Postnatal airway IFN-γ concentrations were also identified as predictive biomarkers for BPD progression [ 28 , 29 ]. Our experimental data revealed substantial elevations in both IFN-γ and TNF-α serum levels at delivery in extremely premature infants subsequently diagnosed with moderate-to-severe BPD. Mechanistic studies further elucidated that the synergistic action of these cytokines inhibits pulmonary fibroblast activation, consequently disrupting extracellular matrix reorganization and impairing alveolar formation. Notably, this pathophysiological effect emerges from the integrated action of multiple inflammatory mediators rather than isolated cytokine activity, reflecting systemic dysregulation of pulmonary developmental pathways within a complex inflammatory milieu. These collective findings underscore the critical involvement of cytokine network interactions in BPD development. The extracellular matrix (ECM) of the lung serves dual essential functions: maintaining structural integrity while actively transmitting biochemical signals and mechanical stimuli necessary for proper organ development [ 30 ]. Research demonstrated that spatiotemporal-specific ECM composition and spatial organization patterns precisely direct lung morphogenesis, homeostasis maintenance, and injury repair processes [ 31 – 34 ]. This matrix network exhibits remarkable regional heterogeneity. ECM components display distinct profiles in peribronchial regions, alveolar septa, and subpleural areas, with characteristic evolutionary patterns observed during pseudoglandular stage, alveolar formation phase, and mature lung development [ 35 – 37 ]. Notably, aberrant ECM remodeling can lead to significant deviations in pulmonary developmental signaling pathways [ 9 ]. Our findings illustrated that the IFN-γ combined with TNF-α significantly alters the composition of the ECM in lung tissue, including key components such as collagen, elastin, fibronectin, and matrix metalloproteinases, thereby affecting pulmonary development. Based on these results, targeted modulation of IFN-γ receptor, TNF-α receptor, and their downstream signaling pathways may serve as a potential therapeutic approach to promote lung development or to treat BPD. Normal lung development requires appropriate regulation of TGF-β signaling. Research demonstrates that TGF-β plays stage-specific roles during pulmonary morphogenesis. Either hyperactivation of TGF-β signaling or Smad3 knockout in late developmental stages leads to pathological phenotypes including delayed alveolarization and enlarged airspaces [ 20 , 38 – 42 ]. Alejandro-Alcázar MA's murine model further revealed phase-dependent expression patterns of TGF-β pathway components—elevated SMAD2/3 with low SMAD7 during canalicular and saccular stages, whereas this pattern reverses during the alveolar stage with Smad2/3 downregulation and Smad7 upregulation [ 43 ]. Moreover, Recent study identified TGF-β signaling as crucial in late lung development. Callaway et al. demonstrated its regulatory role in the plasticity of alveolar type 1 (AT1) cells and the transcriptional control of alveolar matrix-related genes [ 44 ]. Notably, IFN-γ and TNF-αinhibited SMAD2/3 phosphorylation and remodeled ECM through upregulated Smad7 expression. Pathological Smad7 overexpression disrupted the alveolarization in lung explants. Therefore, precise modulation of SMAD7 activity and expression may represent a novel therapeutic strategy for promoting lung development and treating BPD. However, our study has several limitations. First, the clinical sample size was relatively small, and future studies with larger cohorts are needed to validate the association between other inflammatory factors and lung development. Second, due to experimental constraints, we were unable to perform in vivo validation using Smad7 knockout mouse models, which would be addressed in follow-up research. Nevertheless, our findings support the critical role of IFN-γ and TNF-α, in BPD pathogenesis, suggesting SMAD7 mediated TGF-β signaling as a therapeutic target for BPD intervention. In summary, our findings demonstrate that IFN-γ combined with TNF-α to upregulate Smad7 , which inhibits the TGF-β/SMAD2/3 pathway, impairing fibroblast activation and ECM remodeling, and ultimately compromising alveolar development. This mechanism reveals a key pathway in perinatal inflammation-induced BPD, offering new insights for targeted intervention. Declarations Acknowledgements This research was supported by Science and Technology Projects in Guangzhou (grant number 2024A03J0145 and 2023A03J0381) and Guangzhou Municipal Health Commission (grant number 20241A011087). Author contributions XTL, WLH and JWW: data curation, methodology, validation and writing original draft. LZ and XJL: methodology and visualization. ZTM and CHJ: Formal analysis and software. ZWS and FW: conceptualization, funding acquisition, project administration and Writing review & editing. Funding This work was supported by Science and Technology Projects in Guangzhou (grant number 2024A03J0145 and 2023A03J0381) and Guangzhou Municipal Health Commission (grant number 20241A011087). Data Availability The data analyzed in this study are available within the article or from the corresponding authors upon reasonable request. Ethics approval and consent to participate The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the Third Affiliated Hospital of Guangzhou Medical University (Approval No. [2020] 097). Written informed consent was obtained from all patients involved in the study. All procedures involving Mice were performed in accordance with protocols approved by the Committee review of animal experiments in Guangzhou Medical University (No: G2024-1274). Clinical Trial Number Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Thébaud B., K. N. Goss, M. Laughon, J. A. Whitsett, S. H. Abman, R. H. Steinhorn, J. L. Aschner, P. G. Davis, S. A. McGrath-Morrow, R. F. Soll, et al. 2019. Bronchopulmonary dysplasia. Nature reviews Disease primers ;5(1):78. Lapcharoensap W., S. C. Gage, P. Kan, J. Profit, G. M. Shaw, J. B. Gould, D. K. Stevenson, H. O'Brodovich, H. C. Lee. 2015. Hospital variation and risk factors for bronchopulmonary dysplasia in a population-based cohort. JAMA pediatrics ;169(2):e143676. Jia C. H., Z. S. Feng, X. J. Lin, Q. L. Cui, S. S. Han, Y. Jin, G. S. Liu, C. Z. Yang, X. T. Ye, Y. H. Dai, et al. 2022. Short term outcomes of extremely low birth weight infants from a multicenter cohort study in Guangdong of China. Scientific reports ;12(1):11119. Wu F., G. Liu, Z. Feng, X. Tan, C. Yang, X. Ye, Y. Dai, W. Liang, X. Ye, J. Mo, et al. 2019. Short-term outcomes of extremely preterm infants at discharge: a multicenter study from Guangdong province during 2008-2017. BMC pediatrics ;19(1):405. Cotten C. M., W. Oh, S. McDonald, W. Carlo, A. A. Fanaroff, S. Duara, B. Stoll, A. Laptook, K. Poole, L. L. Wright, et al. 2005. Prolonged hospital stay for extremely premature infants: risk factors, center differences, and the impact of mortality on selecting a best-performing center. Journal of perinatology : official journal of the California Perinatal Association ;25(10):650-5. Been J. V., M. J. Lugtenberg, E. Smets, C. P. van Schayck, B. W. Kramer, M. Mommers, A. Sheikh. 2014. Preterm birth and childhood wheezing disorders: a systematic review and meta-analysis. PLoS medicine ;11(1):e1001596. Köksal N., B. Kayik, M. Çetinkaya, H. Özkan, F. Budak, Ş Kiliç, Y. Canitez, B. Oral. 2012. Value of serum and bronchoalveolar fluid lavage pro- and anti-inflammatory cytokine levels for predicting bronchopulmonary dysplasia in premature infants. European cytokine network ;23(2):29-35. Hu J., Z. Wu, H. Wang, H. Geng, J. Huo, X. Zhu, X. Zhu. 2022. Vitamin D Ameliorates Apoptosis and Inflammation by Targeting the Mitochondrial and MEK1/2-ERK1/2 Pathways in Hyperoxia-Induced Bronchopulmonary Dysplasia. Journal of inflammation research ;15:4891-906. Zhou Y., J. C. Horowitz, A. Naba, N. Ambalavanan, K. Atabai, J. Balestrini, P. B. Bitterman, R. A. Corley, B. S. Ding, A. J. Engler, et al. 2018. Extracellular matrix in lung development, homeostasis and disease. Matrix biology : journal of the International Society for Matrix Biology ;73:77-104. Warburton D., A. El-Hashash, G. Carraro, C. Tiozzo, F. Sala, O. Rogers, S. De Langhe, P. J. Kemp, D. Riccardi, J. Torday, et al. 2010. Lung organogenesis. Current topics in developmental biology ;90:73-158. Mund S. I., M. Stampanoni, J. C. Schittny. 2008. Developmental alveolarization of the mouse lung. Developmental dynamics : an official publication of the American Association of Anatomists ;237(8):2108-16. Selman M., A. Pardo, N. Kaminski. 2008. Idiopathic pulmonary fibrosis: aberrant recapitulation of developmental programs? PLoS medicine ;5(3):e62. Chanda D., A. Kurundkar, S. Rangarajan, M. Locy, K. Bernard, N. S. Sharma, N. J. Logsdon, H. Liu, D. K. Crossman, J. C. Horowitz, et al. 2016. Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis. Scientific reports ;6:37445. Meng X. M., D. J. Nikolic-Paterson, H. Y. Lan. 2016. TGF-β: the master regulator of fibrosis. Nature reviews Nephrology ;12(6):325-38. Douthwaite J. A., T. S. Johnson, J. L. Haylor, P. Watson, A. M. El Nahas. 1999. Effects of transforming growth factor-beta1 on renal extracellular matrix components and their regulating proteins. Journal of the American Society of Nephrology : JASN ;10(10):2109-19. Hänsch G. M., C. Wagner, A. Bürger, W. Dong, G. Staehler, M. Stoeck. 1995. Matrix protein synthesis by glomerular mesangial cells in culture: effects of transforming growth factor beta (TGF beta) and platelet-derived growth factor (PDGF) on fibronectin and collagen type IV mRNA. Journal of cellular physiology ;163(3):451-7. Overall C. M., J. L. Wrana, J. Sodek. 1991. Transcriptional and post-transcriptional regulation of 72-kDa gelatinase/type IV collagenase by transforming growth factor-beta 1 in human fibroblasts. Comparisons with collagenase and tissue inhibitor of matrix metalloproteinase gene expression. The Journal of biological chemistry ;266(21):14064-71. Zhang Q., Y. Guo, R. Dong, R. Dai, M. Zhou. 2015. Suppressor of cytokine signaling 1-modulated metalloproteinases and tissue inhibitor of metalloproteinase in pulmonary fibrosis. Molecular medicine reports ;12(3):3855-61. Shi Y., J. Massagué. 2003. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell ;113(6):685-700. Chen H., J. Sun, S. Buckley, C. Chen, D. Warburton, X. F. Wang, W. Shi. 2005. Abnormal mouse lung alveolarization caused by Smad3 deficiency is a developmental antecedent of centrilobular emphysema. American journal of physiology Lung cellular and molecular physiology ;288(4):L683-91. Higgins R. D., A. H. Jobe, M. Koso-Thomas, E. Bancalari, R. M. Viscardi, T. V. Hartert, R. M. Ryan, S. G. Kallapur, R. H. Steinhorn, G. G. Konduri, et al. 2018. Bronchopulmonary Dysplasia: Executive Summary of a Workshop. The Journal of pediatrics ;197:300-8. Feng Z., C. Jia, X. Lin, H. Hao, S. Li, F. Li, Q. Cui, Y. Chen, F. Wu, X. Xiao. 2022. The inhibition of enterocyte proliferation by lithocholic acid exacerbates necrotizing enterocolitis through downregulating the Wnt/β-catenin signalling pathway. Cell proliferation ;55(5):e13228. Bose C. L., C. E. Dammann, M. M. Laughon. 2008. Bronchopulmonary dysplasia and inflammatory biomarkers in the premature neonate. Archives of disease in childhood Fetal and neonatal edition ;93(6):F455-61. Yan X., H. Liao, M. Cheng, X. Shi, X. Lin, X. H. Feng, Y. G. Chen. 2016. Smad7 Protein Interacts with Receptor-regulated Smads (R-Smads) to Inhibit Transforming Growth Factor-β (TGF-β)/Smad Signaling. The Journal of biological chemistry ;291(1):382-92. Villamor-Martinez E., M. Álvarez-Fuente, A. M. T. Ghazi, P. Degraeuwe, L. J. I. Zimmermann, B. W. Kramer, E. Villamor. 2019. Association of Chorioamnionitis With Bronchopulmonary Dysplasia Among Preterm Infants: A Systematic Review, Meta-analysis, and Metaregression. JAMA network open ;2(11):e1914611. Costa S., S. Fattore, M. De Santis, A. Lanzone, T. Spanu, V. Arena, M. Tana, M. Trapani, M. Sanguinetti, E. R. Barnea, et al. 2024. Effect of acute histologic chorioamnionitis on bronchopulmonary dysplasia and mortality rate among extremely low gestational age neonates: A retrospective case-control study. International journal of gynaecology and obstetrics: the official organ of the International Federation of Gynaecology and Obstetrics ;165(3):1040-6. Lee Y., H. J. Kim, S. J. Choi, S. Y. Oh, J. S. Kim, C. R. Roh, J. H. Kim. 2015. Is there a stepwise increase in neonatal morbidities according to histological stage (or grade) of acute chorioamnionitis and funisitis?: effect of gestational age at delivery. Journal of perinatal medicine ;43(2):259-67. Aghai Z. H., J. G. Saslow, K. Mody, R. Eydelman, V. Bhat, G. Stahl, K. Pyon, V. Bhandari. 2013. IFN-γ and IP-10 in tracheal aspirates from premature infants: relationship with bronchopulmonary dysplasia. Pediatric pulmonology ;48(1):8-13. Hikino S., S. Ohga, T. Kinjo, T. Kusuda, M. Ochiai, H. Inoue, S. Honjo, K. Ihara, K. Ohshima, T. Hara. 2012. Tracheal aspirate gene expression in preterm newborns and development of bronchopulmonary dysplasia. Pediatrics international : official journal of the Japan Pediatric Society ;54(2):208-14. McGowan S. E. 1992. Extracellular matrix and the regulation of lung development and repair. FASEB journal : official publication of the Federation of American Societies for Experimental Biology ;6(11):2895-904. Olsen C. O., B. E. Isakson, G. J. Seedorf, R. L. Lubman, S. Boitano. 2005. Extracellular matrix-driven alveolar epithelial cell differentiation in vitro. Experimental lung research ;31(5):461-82. Plosa E. J., L. R. Young, P. M. Gulleman, V. V. Polosukhin, R. Zaynagetdinov, J. T. Benjamin, A. M. Im, R. van der Meer, L. A. Gleaves, N. Bulus, et al. 2014. Epithelial β1 integrin is required for lung branching morphogenesis and alveolarization. Development (Cambridge, England) ;141(24):4751-62. Shannon J. M., L. D. Nielsen, S. A. Gebb, S. H. Randell. 1998. Mesenchyme specifies epithelial differentiation in reciprocal recombinants of embryonic lung and trachea. Developmental dynamics : an official publication of the American Association of Anatomists ;212(4):482-94. Coraux C., G. Meneguzzi, P. Rousselle, E. Puchelle, D. Gaillard. 2002. Distribution of laminin 5, integrin receptors, and branching morphogenesis during human fetal lung development. Developmental dynamics : an official publication of the American Association of Anatomists ;225(2):176-85. Mariani T. J., J. J. Reed, S. D. Shapiro. 2002. Expression profiling of the developing mouse lung: insights into the establishment of the extracellular matrix. American journal of respiratory cell and molecular biology ;26(5):541-8. Godoy-Guzmán C., S. San Martin, J. Pereda. 2012. Proteoglycan and collagen expression during human air conducting system development. European journal of histochemistry : EJH ;56(3):e29. Nguyen N. M., D. G. Kelley, J. A. Schlueter, M. J. Meyer, R. M. Senior, J. H. Miner. 2005. Epithelial laminin alpha5 is necessary for distal epithelial cell maturation, VEGF production, and alveolization in the developing murine lung. Developmental biology ;282(1):111-25. Zhou L., C. R. Dey, S. E. Wert, J. A. Whitsett. 1996. Arrested lung morphogenesis in transgenic mice bearing an SP-C-TGF-beta 1 chimeric gene. Developmental biology ;175(2):227-38. Zeng X., M. Gray, M. T. Stahlman, J. A. Whitsett. 2001. TGF-beta1 perturbs vascular development and inhibits epithelial differentiation in fetal lung in vivo. Developmental dynamics : an official publication of the American Association of Anatomists ;221(3):289-301. Gauldie J., T. Galt, P. Bonniaud, C. Robbins, M. Kelly, D. Warburton. 2003. Transfer of the active form of transforming growth factor-beta 1 gene to newborn rat lung induces changes consistent with bronchopulmonary dysplasia. The American journal of pathology ;163(6):2575-84. Vicencio A. G., C. G. Lee, S. J. Cho, O. Eickelberg, Y. Chuu, G. G. Haddad, J. A. Elias. 2004. Conditional overexpression of bioactive transforming growth factor-beta1 in neonatal mouse lung: a new model for bronchopulmonary dysplasia? American journal of respiratory cell and molecular biology ;31(6):650-6. Bonniaud P., M. Kolb, T. Galt, J. Robertson, C. Robbins, M. Stampfli, C. Lavery, P. J. Margetts, A. B. Roberts, J. Gauldie. 2004. Smad3 null mice develop airspace enlargement and are resistant to TGF-beta-mediated pulmonary fibrosis. Journal of immunology (Baltimore, Md : 1950) ;173(3):2099-108. Alejandre-Alcázar M. A., M. Michiels-Corsten, A. G. Vicencio, I. Reiss, J. Ryu, R. R. de Krijger, G. G. Haddad, D. Tibboel, W. Seeger, O. Eickelberg, et al. 2008. TGF-beta signaling is dynamically regulated during the alveolarization of rodent and human lungs. Developmental dynamics : an official publication of the American Association of Anatomists ;237(1):259-69. Callaway D. A., I. J. Penkala, S. Zhou, J. J. Knowlton, F. Cardenas-Diaz, A. Babu, M. P. Morley, M. Lopes, B. A. Garcia, E. E. Morrisey. 2024. TGF-β controls alveolar type 1 epithelial cell plasticity and alveolar matrisome gene transcription in mice. The Journal of clinical investigation ;134(6). Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.docx Cite Share Download PDF Status: Published Journal Publication published 03 Feb, 2026 Read the published version in Inflammation → Version 1 posted Editorial decision: Revision requested 19 Sep, 2025 Reviews received at journal 12 Sep, 2025 Reviewers agreed at journal 11 Sep, 2025 Reviewers invited by journal 10 Sep, 2025 Editor assigned by journal 08 Sep, 2025 Submission checks completed at journal 08 Sep, 2025 First submitted to journal 01 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7506004","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":515324163,"identity":"8e1094ef-82f6-4976-8e8e-bdd254adb0fe","order_by":0,"name":"Xiaotian Liao","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaotian","middleName":"","lastName":"Liao","suffix":""},{"id":515324164,"identity":"a7ca9362-d300-43c7-a502-78c38fe95fd4","order_by":1,"name":"Weiliang Huang","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weiliang","middleName":"","lastName":"Huang","suffix":""},{"id":515324165,"identity":"d2b41753-04d8-4735-86d8-6514ae1b2bfd","order_by":2,"name":"Jianwei Wei","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jianwei","middleName":"","lastName":"Wei","suffix":""},{"id":515324166,"identity":"bfed56d3-5680-4e30-bf7b-a413e1ce828b","order_by":3,"name":"Lu Zhu","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Zhu","suffix":""},{"id":515324167,"identity":"65876dc5-b609-420a-954a-d9b341cc63d5","order_by":4,"name":"Xiaojun Lin","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaojun","middleName":"","lastName":"Lin","suffix":""},{"id":515324168,"identity":"f2e000ac-cc5c-45e5-9ab3-d3aa18e9462f","order_by":5,"name":"Zitong Mo","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zitong","middleName":"","lastName":"Mo","suffix":""},{"id":515324169,"identity":"40396aa8-26e5-436d-bc62-16b3d4ebb886","order_by":6,"name":"Chunhong Jia","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chunhong","middleName":"","lastName":"Jia","suffix":""},{"id":515324170,"identity":"6d88cf8c-60c9-4eae-8911-e7488ccc27a8","order_by":7,"name":"Zhiwen Su","email":"","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhiwen","middleName":"","lastName":"Su","suffix":""},{"id":515324171,"identity":"7e4e2ab2-dd92-4348-b010-f350885636c1","order_by":8,"name":"Fan Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuklEQVRIiWNgGAWjYFCCBAaGCgYGOTb25gMkaDnDwGDMx3MsgTQtifMkchSI0yDvnmMmcaDmTnobQw4Dw4+KbYS1GJ55A9Ry7FluG8PZA4w9Z24ToWVG7jbpD2yHc9sY+xKYGduI1CJx4N/hdDZmHgPitMhLALUcbDucwMZGrBYDnvefLQ72HTZs42FLOEiUX+Tb0xJvHPh2WF5+/uODD35UEGPLASTOARyK0GxpIErZKBgFo2AUjGgAAMiWQCdAV6XxAAAAAElFTkSuQmCC","orcid":"","institution":"Third Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Fan","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2025-09-01 08:23:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7506004/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7506004/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10753-025-02357-7","type":"published","date":"2026-02-03T15:57:28+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91828923,"identity":"10588005-124d-4f26-910e-763226fdcadf","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4445176,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/8c4e1e7aa0408b1d233c76c0.tif"},{"id":91828919,"identity":"ccb088b1-09d0-471a-8394-d1657a2fc346","added_by":"auto","created_at":"2025-09-22 08:54:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54250,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/007ff0db01e77c25df6944d1.docx"},{"id":91828950,"identity":"9ea547eb-b168-4dea-bc89-9685a03c8fc3","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26384392,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/28e0caa58aa1cf39bf8427f2.tif"},{"id":91828936,"identity":"c41f8a44-dcf5-4145-86dd-12220e99635e","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25807040,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/acdca17657ce962d55d03adc.tif"},{"id":91828934,"identity":"c0d192af-1bd6-4953-a6b3-3c550ec22392","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14980452,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/5c983e953e4419e9e14fedd0.tif"},{"id":91828949,"identity":"96b8ff66-dee0-4955-b9d7-1526abc727b2","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22611288,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/9baf17c3e69266155d9184f8.tif"},{"id":91828920,"identity":"8866c77d-7535-4e12-95a0-fafbdadc0cd9","added_by":"auto","created_at":"2025-09-22 08:54:10","extension":"json","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9477,"visible":true,"origin":"","legend":"","description":"","filename":"28797ba041064a9595c0e7d32052860a.json","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/29f5183ffab1d1b281b4e655.json"},{"id":91828929,"identity":"074b3e80-7494-41a4-8100-d942dbb5ec84","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7168901,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/80098a00af4fd39cf1382b4f.docx"},{"id":91828926,"identity":"74c02be1-3cf6-443c-b3cb-12455fe46bbc","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133872,"visible":true,"origin":"","legend":"","description":"","filename":"28797ba041064a9595c0e7d32052860a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/7d20922526ec4de7110aeb64.xml"},{"id":91831652,"identity":"b536b96c-e262-401d-afa3-4aa00afc6462","added_by":"auto","created_at":"2025-09-22 09:10:11","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4445176,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/0b074a4ca1ff39f766cc32f0.tif"},{"id":91830368,"identity":"7ca62a2a-3a30-4cc7-9b5e-43dbb8f0e9cd","added_by":"auto","created_at":"2025-09-22 09:02:11","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26384392,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/45db85bb40615fbd7a7aa77c.tif"},{"id":91828952,"identity":"5efd02e4-5e9c-4dcf-a4f4-da701953a2ef","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25807040,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/e745d2e1f149cd9b2e3b3c60.tif"},{"id":91830369,"identity":"4b18d6a8-dc28-4cdd-a9c8-fd785304213d","added_by":"auto","created_at":"2025-09-22 09:02:11","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14980452,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/920cce56adb5ab4271ea9bcc.tif"},{"id":91828953,"identity":"bcbed301-3666-4ffb-9253-6e64192a3f3d","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22611288,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/9c7b044a423358e906a78211.tif"},{"id":91828932,"identity":"1d7a01b6-2231-4fe0-955a-76d6b138e005","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":238466,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/2e3ec645a85699bf745828c0.png"},{"id":91828940,"identity":"b183e6ce-d5d8-4303-b108-824c80630c86","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1806319,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/76fd1c18b4c9ecf91fda2bff.png"},{"id":91828935,"identity":"de9de1b2-720c-4d77-bba6-af357cce744a","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2915703,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/4a02595609bb8cb767b14721.png"},{"id":91828944,"identity":"fd353d45-65cd-43d1-b331-07c2ef4cee6a","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":807066,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/aae7b896b2ac8c55ff3f3b9e.png"},{"id":91828941,"identity":"a0d5b5b0-105b-4e28-a43c-6ef1240cc3ac","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2530650,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/2d0da97dba4aae49412dfde8.png"},{"id":91828945,"identity":"d83a0a41-30a6-4282-bf93-52cb01998bf3","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"xml","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":135385,"visible":true,"origin":"","legend":"","description":"","filename":"28797ba041064a9595c0e7d32052860a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/dc0639462bff3f88fe2b66a3.xml"},{"id":91828943,"identity":"98472e3a-4af3-4feb-abb0-d7fe4c467de7","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"html","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":145555,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/1fd0496aeb555eec6ac6d987.html"},{"id":91830365,"identity":"96c5f0cd-cae0-4671-986b-de66f86a9e83","added_by":"auto","created_at":"2025-09-22 09:02:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2985771,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElevated serum IFN-γ and TNF-α levels in Moderate/Severe BPD infants at birth. \u003c/strong\u003eThe serum TNF-α (a), IFN-γ (b), IL-10 (c), CCL1 (d), PDGF-BB (e), and VEGF (f) in very preterm infants were detected using Luminex multiplex assay on the first day, 14\u003csup\u003eth\u003c/sup\u003e day, and 28\u003csup\u003eth\u003c/sup\u003e day after birth. (n=9; mean ± SEM; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, \u003cem\u003et-\u003c/em\u003etest)\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/161ada2b98e2d24b3f53a207.png"},{"id":91830372,"identity":"451c6025-d597-4be7-8cf7-6f3c662ce3f7","added_by":"auto","created_at":"2025-09-22 09:02:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":31329783,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIFN-γ and TNF-α suppress fibroblast activation.\u003c/strong\u003e (a, b) A549 and MRC-5 cells were exposed to IFN-γ, TNF-α (10, 20, 40 ng/mL), or their combination for 48 h, followed by CCK-8 viability assays. (c) Phase-contrast microscopy (20×; scale bar = 100 μm) of MRC-5 cells treated with IFN-γ (20 ng/mL), TNF-α (20 ng/mL), or both for 24 h and 48 h. (d) Immunofluorescence staining (40×; scale bar = 50 μm) of MRC-5 cells incubated with IFN-γ (20 ng/mL), TNF-α (20 ng/mL), and TGF-β (10 ng/mL) for 48 h. (e) Transcriptomic profiling (RNA-seq) of MRC-5 cells after 24 h treatment with IFN-γ (20 ng/mL), TNF-α (20 ng/mL), or their combination. (f) Gene Ontology (GO) enrichment analysis comparing IFN-γ + TNF-α-treated cells to controls\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/263868967f57b7b779c3fc2c.png"},{"id":91830366,"identity":"50c3af20-c690-48c2-9282-62a5dffc0f2c","added_by":"auto","created_at":"2025-09-22 09:02:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":35115153,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIFN-γ and TNF-α mediate extracellular matrix remodeling in fibroblasts.\u003c/strong\u003e(a) RT-qPCR analysis of\u003cem\u003e COL1A1\u003c/em\u003e, \u003cem\u003eCOL1A2\u003c/em\u003e, \u003cem\u003eCOL3A1\u003c/em\u003e,\u003cem\u003e ACTA2\u003c/em\u003e, \u003cem\u003eELN\u003c/em\u003e, \u003cem\u003eFN1\u003c/em\u003e, \u003cem\u003eMMP1\u003c/em\u003e, and \u003cem\u003eMMP2\u003c/em\u003e mRNA expression in MRC-5 cells treated with IFN-γ(20 ng/ml), TNF-α(20 ng/ml), or their combination for 24 h. (b-c) Western blot analysis of COL1A1 and α-SMA protein expression after 24 h and 48 h treatment. (d) Representative images of HE staining and COL1A1 immunohistochemistry (40×; scale bar=50 μm) in E16.5 fetal mouse lung explants treated for 72 h. (e-g) Quantitative analysis of alveolar number, alveolar diameter, and COL1A1-positive area. Data represent mean ± SEM; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 by one-way \u003cem\u003eANOVA\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/588c4a99d25ff49e0d6c22c5.png"},{"id":91830370,"identity":"21fa6181-1269-48a1-be60-038bce92dba2","added_by":"auto","created_at":"2025-09-22 09:02:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":18601012,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIFN-γ and TNF-α attenuate ECM production by inhibiting TGF-β/SMAD2/3 signaling pathway. \u003c/strong\u003e(a) GSEA analysis between control and IFN-γ + TNF-α treated groups. (b) RT-qPCR analysis of C\u003cem\u003eOL1A1\u003c/em\u003e, \u003cem\u003eACTA2\u003c/em\u003e, \u003cem\u003eSMAD2\u003c/em\u003e, and \u003cem\u003eSMAD3\u003c/em\u003e mRNA expression in MRC-5 cells treated with IFN-γ(20 ng/mL), TNF-α(20 ng/mL) and TGF-β (10 ng/mL) for 24h. (c-e) Western blot analysis of COL1A1, α-SMA, total SMAD2/3, and phosphorylated SMAD2/3 (p-SMAD2/3) after 2h, 24h, and 48h treatment. (f) Immunofluorescence staining of SMAD2/3 (40×; scale bar=50 μm) in MRC-5 cells pre-treated with IFN-γ (20 ng/mL), TNF-α(20 ng/mL), or IFN-γ (20 ng/mL) + TNF-α(20 ng/mL) for 47 h followed by 1 h TGF-β stimulation. (g) Quantitative analysis of SMAD2/3 nuclear translocation. Data are presented as mean ± SEM; *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001 by one-way ANOVA\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/e48c5429f844cc772693a32b.png"},{"id":91828947,"identity":"1081f3a6-1cdd-4b0c-a452-088f3150f862","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":30296701,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIFN-γ and TNF-α suppress SMAD2/3 phosphorylation through SMAD7 upregulation. \u003c/strong\u003e(a) Heatmap of key TGF-β signaling pathway components from RNA sequencing. (b) Time-course analysis (0, 1h, 12h, 24h, 48h) of S\u003cem\u003eMAD7\u003c/em\u003e mRNA expression by RT-qPCR in MRC-5 cells treated with IFN-γ(20 ng/mL) + TNF-α(20 ng/mL). (c) Western blot analysis of SMAD7 protein expression after IFN-γ(20 ng/mL), TNF-α(20 ng/mL) and TGF-β (10 ng/mL) treatment for 24h or 48 h. (d) Co-immunoprecipitation assay showing SMAD4 and SMAD7 binding to SMAD3 under indicated treatment. (e) Representative images of HE staining and SMAD7 immunohistochemistry (IHC) in E16.5 fetal mouse lung explants after 72 h treatment. (f) Quantitative analysis of SMAD7 IHC staining intensity. Data represent mean ± SEM; *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001 by one-way ANOVA\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/e27017da96227c963c045867.png"},{"id":102234997,"identity":"79165f8f-06ba-48c0-a55b-9f78ce19c0d2","added_by":"auto","created_at":"2026-02-09 16:14:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":106027516,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/acfb3fa7-98d5-4136-b40a-5ad3a0ba7eb0.pdf"},{"id":91828930,"identity":"5d5801b1-939e-412e-96a7-abfe779f696b","added_by":"auto","created_at":"2025-09-22 08:54:11","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":7168901,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-7506004/v1/c2b68059cb0fb165fec2ca4f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"IFN-γ and TNF-α Impair Lung Development by Upregulating SMAD7 to Inhibit TGF-β Signaling Pathway and ECM Dysregulation","fulltext":[{"header":"INTRODUCTON","content":"\u003cp\u003eBronchopulmonary dysplasia (BPD) has emerged as a predominant chronic lung disease affecting preterm neonates and serves as a significant indicator of poor outcomes related to premature delivery [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Each year in the U.S., about 50,000 infants with extremely low gestational age are born, among whom approximately 35% eventually develop this condition [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Research conducted across multiple centers in China's Guangdong province demonstrated that 63.7% of extremely low birth weight infants needed supplemental oxygen at 28 days postnatal age [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], with a BPD diagnosis confirmed in 32.3% of extremely preterm cases [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The disease pathogenesis involves maladaptive repair processes following repetitive pulmonary injuries occurring during crucial developmental phases, either before or after birth. Affected neonates exhibit heightened respiratory compromise, extended hospital stays [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], and persistent airway obstruction that frequently evolves into chronic respiratory dysfunction in later life [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Growing evidence suggests that inflammatory events occurring during gestation or the perinatal period play a pivotal role in predisposing to neonatal lung damage and show a strong correlation with BPD development. Multiple investigations have detected increased concentrations of inflammatory mediators such as TNF-α, IFN-γ, and IL-6 in both amniotic fluid and neonatal bloodstream, which may contribute to impaired alveolar formation and abnormal pulmonary vascular development [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Nevertheless, the exact biological pathways through which these inflammatory molecules regulate the characteristic pulmonary developmental abnormalities in BPD remain incompletely elucidated.\u003c/p\u003e\u003cp\u003eThe extracellular matrix (ECM) constitutes a sophisticated three-dimensional framework generated by stromal cells, encompassing structural proteins (collagens), adhesive glycoproteins, glycosaminoglycans, and other macromolecular components that orchestrate tissue patterning during embryogenesis, physiological maintenance, and regenerative processes. Within the pulmonary microenvironment, this dynamic ECM architecture serves dual roles: providing critical structural integrity for parenchymal cells while simultaneously mediating mechanochemical signaling crucial for pulmonary morphogenesis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Lung morphogenesis progresses through five consecutive developmental phases: the embryonic period (weeks 4\u0026ndash;7), pseudoglandular phase (weeks 5\u0026ndash;17), canalicular stage (weeks 16\u0026ndash;26), terminal saccular period (weeks 24\u0026ndash;38), and alveolar maturation phase (week 36-postnatal) during which precisely regulated ECM remodeling governs cellular proliferation and differentiation events [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Conversely, developmentally programmed ECM synthesis and degradation represent fundamental requirements for proper organogenesis. Disruptions in these tightly coordinated ECM-cell interactions can result in aberrant pulmonary development, as observed in bronchopulmonary dysplasia. Notably, pathological reactivation of developmental pathways may underlie various pulmonary disorders including idiopathic interstitial pneumonia, pulmonary vascular remodeling diseases, and thoracic malignancies, all of which exhibit characteristic ECM compositional changes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe transforming growth factor-β (TGF-β) signaling cascade serves as a master regulator of extracellular matrix homeostasis, critically governing both ECM biosynthesis and accumulation processes [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Mechanistically, TGF-β induces phosphorylation of SMAD2/3 proteins, which subsequently form heteromeric complexes with SMAD4 and translocate to the nucleus to activate transcription of key ECM components including COL1A1, COL3A1 and FN1 genes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This pathway simultaneously modulates ECM turnover by enhancing TIMP1/2 expression while suppressing MMP2/9 activity, thereby shifting the balance toward matrix accumulation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Signal initiation occurs when TGF-β ligands engage specific cell surface receptors (types I and II serine/threonine kinase receptors), inducing receptor phosphorylation and subsequent activation of downstream effectors. The SMAD protein family, consisting of eight structurally related members, mediates these signals through three functionally distinct subgroups: 1) receptor-activated SMADs (R-SMADs: SMAD1/2/3/5/8), 2) the common-mediator SMAD4, and 3) inhibitory SMADs (I-SMADs: SMAD6/7) that negatively regulate the pathway [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Notably, genetic ablation of Smad3 in murine models leads to profound pulmonary abnormalities characterized by defective alveolarization, airspace enlargement, and marked reduction in lung tropoelastin expression - pathological features that closely recapitulate the hallmarks of both bronchopulmonary dysplasia and emphysema [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThis study revealed that preterm infants with moderate-to-severe BPD exhibited significantly increased serum levels of IFN-γ and TNF-α on postnatal day 1. The synergistic action of IFN-γ and TNF-α upregulates SMAD7, thereby inhibiting TGF-β-Smad2/3 signaling and suppressing fibroblast activation and ECM remodeling. Additionally, lung explants treated with IFN-γ and TNF-α showed reduced alveolar number and enlarged alveolar diameter, mimicking key pathological features of BPD.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eClinical data collection\u003c/h2\u003e\u003cp\u003eThis study included very preterm infants admitted to the Department of Neonatology at the Third Affiliated Hospital of Guangzhou Medical University between February and December 2021. Bronchopulmonary dysplasia (BPD) was diagnosed according to the 2018 NICHD revised criteria [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Grade II and Grade III BPD correspond to moderate and severe BPD, respectively. Collected clinical data encompassed perinatal factors (gestational age, birth weight, delivery mode, amniotic fluid status, sex, Apgar scores, singleton/twin status), respiratory support details (FiO₂ on postnatal days 1, 7, 14, 21, and 28; cumulative oxygen exposure; durations of invasive/non-invasive ventilation), and initial white blood cell counts.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eLuminex multiplex assay\u003c/h3\u003e\n\u003cp\u003eAll preterm infants included in the study underwent arterial or venous blood collection for 0.5 mL per time on the postnatal day 1, 14, and 28 respectively. The samples were centrifuged at 3,200 rpm for 10 minutes at room temperature to separate serum, which was then aliquoted into EP tubes and stored at − 80°C until analysis. After completing specimen collection, serum levels of TNF-α, IFN-γ, IL-10, CCL1, VEGF, and PDGF-BB were simultaneously quantified using Luminex technology (Kit: Shanghai Univ Biotechnology Co., Ltd., Cat. No. LXSAHM-22), strictly following the manufacturer’s protocols.\u003c/p\u003e\n\u003ch3\u003eCell Culture\u003c/h3\u003e\n\u003cp\u003eThe human alveolar epithelial cell line A549 and lung fibroblast cell line MRC-5 were acquired from ATCC (Manassas, VA, USA). A549 cells were maintained in DMEM (Gibco, Grand Island, NY), while MRC-5 cells were cultured in MEM (Gibco), both supplemented with 10% FBS (Gibco). Cell propagation was performed using 0.25% trypsin-EDTA solution under standard culture conditions (37°C, 5% CO₂). Experimental interventions involved treatment with commercially available cytokines (IFN-γ, TNF-α, TGF-β; Selleck Chemicals) at specified concentrations and durations.\u003c/p\u003e\n\u003ch3\u003eFetal Lung Explant Culture\u003c/h3\u003e\n\u003cp\u003eMouse embryonic lung tissues at gestational day 16.5 were collected under sterile conditions and sectioned into 5 mm³ pieces. After thorough washing with antibiotic-supplemented PBS (1% penicillin-streptomycin) to eliminate residual blood components, tissue explants were placed on Transwell membranes in 12-well culture plates. The explant medium consisted of Minimum Essential Medium enriched with 10% fetal bovine serum, 1% penicillin-streptomycin, 2 mM L-glutamine, and 25 mM HEPES buffer, with three tissue pieces evenly arranged per well. Cultures were incubated under standard conditions (37°C, 5% CO₂) with semi-daily medium replacement (50% volume). For cytokine treatments, 20 ng/mL concentrations of IFN-γ, TNF-α, or their combination were administered for 72 hours before tissue processing for histological (hematoxylin-eosin staining) and immunohistochemical evaluation.\u003c/p\u003e\n\u003ch3\u003eCCK-8 Cell Viability Assay\u003c/h3\u003e\n\u003cp\u003eThe cell proliferation assay was performed as follows: initially, cells were plated in 96-well culture plates at a density of 5×10³ cells per well and incubated for 48 hours with the designated treatments. Cellular viability was then evaluated using the CCK-8 assay kit (Vazyme Biotech Co., Nanjing), strictly adhering to the supplier's instructions. Absorbance measurements were conducted at a wavelength of 450 nm employing a BioTek ELx800 absorbance microplate reader.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eRNA sequencing\u003c/h2\u003e\u003cp\u003eRNA sequencing was conducted by Novogene Co., Ltd. (Suzhou, China). Initially, RNA concentration and integrity were evaluated using an RNA Nano 6000 Assay Kit (Agilent Technologies, Santa Clara, CA, USA) in conjunction with the Bioanalyzer 2100 system (Agilent Technologies). Subsequently, cDNA library preparation was performed following standard protocols, with library quality verification conducted using the AMPure XP system (Beckman Coulter, Brea, CA, USA). Following quality control, the prepared libraries were subjected to high-throughput sequencing on an Illumina Novaseq platform (Illumina, San Diego, CA, USA), generating 150 base-pair paired-end reads. For differential expression analysis, the edgeR package in R was employed to identify significantly differentially expressed genes (DEGs), applying stringent thresholds of |log2 fold change| \u0026gt;1 and adjusted p-value (false discovery rate) \u0026lt; 0.05. Functional annotation of the identified DEGs was performed through Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using the clusterProfiler package. Additionally, Gene Set Enrichment Analysis (GSEA) was implemented to evaluate whether predefined gene sets exhibited statistically significant, concordant differences between experimental groups, providing complementary pathway-level insights to the DEG analysis.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eWestern blot\u003c/h3\u003e\n\u003cp\u003eWestern blot analysis was conducted according to standard methods [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], using whole-cell lysates prepared as described previously. Primary antibodies were used as follows: α-smooth muscle actin (α-SMA, Cat#19245, 1:1000), collagen type I alpha 1 chain (COL1A1, Cat#91144, 1:1000), SMAD2 (Cat#5339, 1:1000), phosphorylated SMAD2 (p-SMAD2, Ser465/467, Cat#18338, 1:1000), SMAD3 (Cat#9523, 1:1000), phosphorylated SMAD3 (p-SMAD3, Ser423/425, Cat#9520, 1:1000), and SMAD4 (Cat#38454, 1:1000) from Cell Signaling Technology (CST, USA); SMAD7 (Cat#ab216428, 1:1000) from Abcam (UK); β-actin (1:1000) as loading control from Beijing Boaosen Biotechnology (Beigjing, China).\u003c/p\u003e\n\u003ch3\u003eRNA Extraction and Quantitative Real-Time PCR Analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from cells/tissues with TRIzol reagent (Thermo Fisher Scientific) following the supplier’s instructions. Subsequently, 1 µg of RNA was reverse-transcribed into cDNA using a commercial kit (Vazyme, Nanjing). qRT-PCR was carried out in a 20 µL reaction mixture containing 2 µL cDNA, 0.4 µM primers, and SYBR Green Premix (Vazyme) on a QuantStudio 6 Flex system. Thermal cycling conditions included an initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. Amplification specificity was confirmed by melt curve analysis. Relative gene expression, normalized to \u003cem\u003eGAPDH\u003c/em\u003e, was determined using the 2^(-ΔΔCt) method. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eTable 1 Clinical characteristics of the eligible preterm infants\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"112%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCharacteristics\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNon/Mild BPD group(n=9)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eModerate/Severe BPD group (n=9)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eP\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eGestational age (weeks), Maen\u003cem\u003e\u0026plusmn;SD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e27.2\u0026plusmn;1.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e27.08\u0026plusmn;2.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eBirth weight (grams), Maen\u003cem\u003e\u0026plusmn;SD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e822\u0026plusmn;182\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e814\u0026plusmn;120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eGender (female), \u003cem\u003eNo.(%)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e4(44.44)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e3(33.33)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eCesarean section, \u003cem\u003eNo.(%)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e7(77.78)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e7(77.78)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eTwin birth, \u003cem\u003eNo.(%)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e2(22.22)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e3(33.33)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eApgar score at 1min, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e7(6-8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e8(7-8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eApgar score at 5min, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e9(8-10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e9(9-10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eApgar score at 10min, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e10(9.5-10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e10(9-10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eFiO₂(%) on day 1, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e30(23-37.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e28(25.5-45)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eFiO₂(%) on day 7, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e21(21-26.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e23(21.5-30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eFiO₂(%) on day 14, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e23(21-27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e25(22.5-30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eFiO₂(%) on day 21, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e25(21-28)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e28(21.5-29)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eFiO₂(%) on day 28, \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e25(21-29)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e28(23.5-32.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eOxygen dependence (days), \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e68(54-80.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e81(65.5-114.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eNon-invasive ventilation (days), \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e48(41-56)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e61(57.5-70)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003e0.012\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eInvasive ventilation (days), \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e10(5.5-14.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e11(2.5-38.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.4679%;\"\u003e\n \u003cp\u003eWBC on day 1 (\u0026times;10⁹/L), \u003cem\u003eM(Q1-Q3)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 27.2436%;\"\u003e\n \u003cp\u003e6.94(3.18-13.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 22.7564%;\"\u003e\n \u003cp\u003e7.08(4.15-7.52)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 7.53205%;\"\u003e\n \u003cp\u003eNS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eBPD: bronchopulmonary dysplasia; SD: standard deviation; NS: no significance; M(Q1-Q3): median and the 1\u003csup\u003est\u003c/sup\u003e to the 3\u003csup\u003erd\u003c/sup\u003e quarter; FiO\u003csub\u003e2\u003c/sub\u003e: fraction of inspired oxygen; WBC: white blood cell.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers of RT-PCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSpecies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward primer (5'-3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReverse primer (5'-3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGGGCTACACTGAGCACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAAGTGGTCGTTGAGGGCAATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eACTA2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTGTTGCCCCTGAAGAGCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGCTGGGACATTGAAAGTCTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eCOL1A1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTGCGATGACGTGATCTGTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCGGTGGTTTCTTGGTCGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eCOL1A2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCTCAAGGTTTCCAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCACCCTGTGGTCCAACAACTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eCOL3A1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTGAAGGAGGATGTTCCCATCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eACAGACACATATTTGGCATGGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eFN1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGAAGCCGAGGTTTTAACTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAGGACGCTCATAAGTGTCACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eELN\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCAGGAGTTAAGCCCAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTGTAGGGCAGTCCATAGCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eMMP1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAAATTACACGCCAGATTTGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGTGTGACATTACTCCAGAGTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eMMP2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTACAGGATCATTGGCTACACACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGTCACATCGCTCCAGACT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSMAD2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCATAGCTTGGATTTACAGCCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTTCTACCGTGGCATTTCGGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSMAD3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCATCTCCTACTACGAGCTGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCACTGCTGCATTCCTGTTGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHomo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSMAD7\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGACAGCTCAATTCGGACAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGTACACCCACACACCATCCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence Protocol\u003c/h2\u003e\u003cp\u003eFollowing fixation (4% PFA, 15 min), permeabilization (0.1% Triton X-100, 10 min), and blocking (5% BSA, 30 min), cells were incubated overnight at 4°C with primary antibodies (α-SMA, 1:200, CST #19245; SMAD2/3, 1:200, CST #8685). After PBS washes, Alexa Fluor-conjugated secondary antibodies (1:200) were applied for 1 h at room temperature. DAPI (5 min) was used for nuclear visualization before mounting with ProLong Gold (Thermo Fisher Scientific, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eCo-immunoprecipitation\u003c/h2\u003e\u003cp\u003eMRC5 cells were disrupted using RIPA lysis buffer (Thermo Fisher Scientific, USA) containing a cocktail of protease and phosphatase inhibitors. After pre-clearing, the lysates were subjected to centrifugation at 12,000 ×g for 15 minutes at 4°C. The resulting supernatant was incubated overnight at 4°C with gentle agitation in the presence of an anti-SMAD3 primary antibody (Cell Signaling Technology, #9523). Subsequently, Protein A/G magnetic beads were introduced and allowed to bind for 6 hours at 4°C to isolate the immune complexes. The beads were then washed three times with lysis buffer before proceeding to immunoblotting.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eHistology and Immunohistochemistry\u003c/h2\u003e\u003cp\u003eLung tissue samples were carefully washed with phosphate-buffered saline (PBS) and then immersion-fixed in 4% paraformaldehyde. After embedding in paraffin, thin sections (5 µm thickness) were cut and subjected to H\u0026amp;E staining. For immunohistochemistry (IHC), tissue sections were first deparaffinized, followed by antigen unmasking and nonspecific binding blocking. Subsequently, they were exposed to primary antibodies targeting COL1A1 (Cell Signaling Technology, #72026) or SMAD7 (Thermo Fisher, #42–0400) and kept at 4°C overnight. Following PBS washes, the sections were treated with horseradish peroxidase (HRP)-linked secondary antibodies for 1 hour at room temperature. Finally, DAB substrate (Vector Laboratories, USA) was applied for signal development, and hematoxylin was used to counterstain nuclei.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData analysis was conducted utilizing SPSS 25 and GraphPad Prism 8. Continuous variables are presented as mean ± SD unless specified otherwise. For comparisons involving two groups, independent samples t-tests or Mann-Whitney U tests were employed based on data distribution characteristics. Multigroup analyses were performed using one-way ANOVA with appropriate post-hoc tests. Categorical variables were assessed through Pearson's chi-square test or exact probability tests depending on sample size requirements. When parametric test assumptions (normality and equal variance) were not met, corresponding non-parametric alternatives were applied. P \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Result","content":"\u003ch2\u003eElevated serum IFN-\u0026gamma; and TNF-\u0026alpha; levels at birth in very preterm infants with Moderate/Severe BPD\u003c/h2\u003e\n\u003cp\u003ePrevious studies have demonstrated a significant association between BPD and inflammatory cytokines [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]. However, the inflammatory factors at different perinatal time points remain to be further elucidated. In this study, at first, we employed Luminex multiplex assay to systematically analyze the concentration of serum inflammatory cytokines in very preterm infants on day 1 (at birth), 14, and 28 after birth; and made comparison between Moderate/Severe BPD group and Non/Mild BPD group to identify the major elevated cytokines.\u003c/p\u003e\n\u003cp\u003eTo minimize confounding effects of gestational age and birth weight, we performed propensity score matching (PSM) prior to serum analysis. The final cohort comprised 18 matched infants, with baseline characteristics presented in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The Moderate/Severe BPD group required significantly longer non-invasive ventilation compared to controls. Cytokine profiling demonstrated markedly higher serum TNF-\u0026alpha; and IFN-\u0026gamma; levels on postnatal day 1 in the Moderate/Severe BPD group (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea-b), while no significant differences were observed for these cytokines at later time points (day 14/28) or for IL-10, CCL1, PDGF-BB, and VEGF levels at any time point (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec-f). These findings indicate that early elevation of IFN-\u0026gamma; and TNF-\u0026alpha; may serve as predictive biomarkers for Moderate/Severe BPD development in very preterm neonates.\u003c/p\u003e\n\u003ch2\u003eIFN-\u0026gamma; and TNF-\u0026alpha; inhibit the fibroblast activation\u003c/h2\u003e\n\u003cp\u003eTo investigate the impact of IFN-\u0026gamma; and TNF-\u0026alpha; on lung development, the \u003cem\u003ein vitro\u003c/em\u003e experiments were adopted. The A549 cell line (lung epithelial) and MRC-5 cell line (lung fibroblast) were treated with different dose of IFN-\u0026gamma;, TNF-\u0026alpha;, and their combination (IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha;). None of them induced cell death or affected cell proliferation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea-b). However, morphology of MRC-5 cells changed significantly from spindle or irregularly triangular shape to flat shape, especially treatment with IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; for 48h (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec). Significant changes in cell morphology seem to imply fibroblasts have lost their mesenchymal cell properties to some extent. Furthermore, the expression of \u0026alpha;-smooth muscle actin (\u0026alpha;-SMA) were tested, which is a hallmark of fibroblast activation. The immunofluorescence staining showed IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; treatment remarkably decreased the expression of \u0026alpha;-SMA, while compared with the control, TGF-\u0026beta;, IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TGF-\u0026beta;, or TNF-\u0026alpha;\u0026thinsp;+\u0026thinsp;TGF-\u0026beta; treatment groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed). The above results indicated IFN-\u0026gamma; combined with TNF-\u0026alpha; significantly inhibit the fibroblast activation. In order to explore the underlying mechanism, the MRC-5 treated with IFN-\u0026gamma;, TNF-\u0026alpha; or their combination was tested by RNA-seq.\u0026nbsp;Notably, the transcriptomic changes were most prominently enriched in pathways involving extracellular matrix components and related functions (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee-f).\u003c/p\u003e\n\u003ch2\u003eIFN-\u0026gamma; and TNF-\u0026alpha; induce fibroblast ECM remodeling\u003c/h2\u003e\n\u003cp\u003eTo validate the gene enrichment analysis findings, we examined the effects of IFN-\u0026gamma; and TNF-\u0026alpha; on ECM-related gene expression. RT-PCR analysis of MRC-5 cells treated with IFN-\u0026gamma;, TNF-\u0026alpha;, or their combination for 24 h revealed a pronounced reduction in \u003cem\u003eCOL1A1\u003c/em\u003e, \u003cem\u003eCOL3A1\u003c/em\u003e, and \u003cem\u003eELN\u003c/em\u003e expression, whereas \u003cem\u003eMMP1\u003c/em\u003e and \u003cem\u003eFN1\u003c/em\u003e were markedly upregulated in the IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; group compared to single treatments or controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). Consistent with these results, Western blot analysis showed dose-dependent decreases in \u0026alpha;-SMA and COL1A1 protein levels following 24 h and 48 h of IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; treatment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb\u0026ndash;c). To further assess these effects in a developmental context, E16.5 fetal mouse lung explants were exposed to IFN-\u0026gamma;, TNF-\u0026alpha;, or their combination for 72 h. Immunohistochemical analysis revealed significant downregulation of COL1A1 in the alveolar interstitium of the IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed, g). Additionally, this group exhibited impaired alveolarization, characterized by reduced alveolar number and increased mean alveolar diameter (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ee\u0026ndash;f). Collectively, these results indicate that the synergistic action of IFN-\u0026gamma; and TNF-\u0026alpha; disrupts lung development by inhibiting fibroblast activation and altering ECM remodeling.\u003c/p\u003e\n\u003ch2\u003eIFN-\u0026gamma; and TNF-\u0026alpha; decrease the ECM through inhibition of TGF-\u0026beta;/SMAD2/3 signaling pathway\u003c/h2\u003e\n\u003cp\u003eGSEA of RNA-seq data identified significant alterations in TGF-\u0026beta; signaling pathway-related gene sets in the IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; group compared to controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea). Given the critical role of TGF-\u0026beta; in ECM deposition [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e], we further examined its regulation under pro-inflammatory conditions. Exogenous TGF-\u0026beta;1 was applied to MRC-5 cells alongside IFN-\u0026gamma;, TNF-\u0026alpha;, or their combination. RT-PCR analysis revealed that IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; co-treatment significantly downregulated \u003cem\u003eCOL1A1\u003c/em\u003e and \u003cem\u003e\u0026alpha;-SMA\u003c/em\u003e mRNA levels compared to other groups, whereas \u003cem\u003eSMAD2\u003c/em\u003e and \u003cem\u003eSMAD3\u003c/em\u003e expression remained unchanged (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb). At the protein level, short-term TGF-\u0026beta;1 treatment (2 h) robustly induced SMAD2/3 phosphorylation regardless of cytokine exposure, accompanied by a modest increase in COL1A1 and \u0026alpha;-SMA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec). However, prolonged treatment (24\u0026ndash;48 h) showed that IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; co-treatment markedly attenuated TGF-\u0026beta;1-induced SMAD2/3 phosphorylation and ECM protein expression, while IFN-\u0026gamma; or TNF-\u0026alpha; alone had no significant effect (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed\u0026ndash;e). Immunofluorescence staining further confirmed these findings: TGF-\u0026beta;1 promoted SMAD2/3 nuclear translocation, but this effect was abolished by IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; co-treatment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ef\u0026ndash;g). Together, these data demonstrate that IFN-\u0026gamma; and TNF-\u0026alpha; synergistically inhibit TGF-\u0026beta;/SMAD signaling, thereby suppressing ECM production.\u003c/p\u003e\n\u003ch2\u003eIFN-\u0026gamma; and TNF-\u0026alpha; inhibit SMAD2/3 phosphorylation via upregulating SMAD7\u003c/h2\u003e\n\u003cp\u003eThe regulation of the TGF-\u0026beta; signaling pathway involves multiple molecules and pathways, among which SMAD7 is a key negative regulator [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. Our RNA-seq analysis revealed significant upregulation of \u003cem\u003eSMAD7\u003c/em\u003e expression in the IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; group comparing with the control, IFN-\u0026gamma; or TNF-\u0026alpha;(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). We further validated this result. MRC-5 cells were treated with IFN-\u0026gamma;, TNF-\u0026alpha; and IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; for 1h, 12h, 24h and 48h. RT-PCR analysis demonstrated that \u003cem\u003eSMAD7\u003c/em\u003e expression increased sharply in IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; treatment group compared to other groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb). Moreover, Co-treated with TGF-\u0026beta;1, IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; treatment group markedly increased the SMAD7 at 24h and 48h(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec). Previous studies proved SMAD7 competitively inhibited the binding of R-SMADs (including SMAD1, 2, 3, 5, and 8) to receptors and disrupted the interactions of R-SMADs with Co-Smad (SMAD4), thereby inhibiting the TGF signaling pathway [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ed, co-immunoprecipitation revealed increased binding of SMAD3 to SMAD7, and decreased binding to SMAD4 in the IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; co-treatment with TGF-\u0026beta;1. Conversely, TGF-\u0026beta;1 treatment enhanced the interactions between SMAD3 and SMAD4, and attenuated the interactions with SMAD 7. Consistently, IFN-\u0026gamma;\u0026thinsp;+\u0026thinsp;TNF-\u0026alpha; treatment markedly increased SMAD7 expression in fetal mouse lung explants, as demonstrated by immunohistochemistry (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ee-f). These results indicated IFN-\u0026alpha; combined with TNF-\u0026alpha; inhibited TGF-\u0026beta; signaling pathway by upregulating SMAD7 expression.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eExtensive research has established a significant link between prenatal or perinatal inflammatory exposure and bronchopulmonary dysplasia (BPD) pathogenesis. A comprehensive meta-analysis incorporating 158 clinical studies (n\u0026thinsp;=\u0026thinsp;244,096 neonates) with expanded covariate assessment reaffirmed chorioamnionitis as an independent risk factor for BPD in premature infants [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Subsequent investigations by Costa [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] and Lee [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] demonstrated a positive correlation between the histological grading of chorioamnionitis and BPD occurrence. Koksal et al. [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] observed markedly increased circulating pro-inflammatory cytokine concentrations within the first postnatal day in neonates who later developed BPD. Postnatal airway IFN-γ concentrations were also identified as predictive biomarkers for BPD progression [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Our experimental data revealed substantial elevations in both IFN-γ and TNF-α serum levels at delivery in extremely premature infants subsequently diagnosed with moderate-to-severe BPD. Mechanistic studies further elucidated that the synergistic action of these cytokines inhibits pulmonary fibroblast activation, consequently disrupting extracellular matrix reorganization and impairing alveolar formation. Notably, this pathophysiological effect emerges from the integrated action of multiple inflammatory mediators rather than isolated cytokine activity, reflecting systemic dysregulation of pulmonary developmental pathways within a complex inflammatory milieu. These collective findings underscore the critical involvement of cytokine network interactions in BPD development.\u003c/p\u003e\u003cp\u003eThe extracellular matrix (ECM) of the lung serves dual essential functions: maintaining structural integrity while actively transmitting biochemical signals and mechanical stimuli necessary for proper organ development [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Research demonstrated that spatiotemporal-specific ECM composition and spatial organization patterns precisely direct lung morphogenesis, homeostasis maintenance, and injury repair processes [\u003cspan additionalcitationids=\"CR32 CR33\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. This matrix network exhibits remarkable regional heterogeneity. ECM components display distinct profiles in peribronchial regions, alveolar septa, and subpleural areas, with characteristic evolutionary patterns observed during pseudoglandular stage, alveolar formation phase, and mature lung development [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Notably, aberrant ECM remodeling can lead to significant deviations in pulmonary developmental signaling pathways [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Our findings illustrated that the IFN-γ combined with TNF-α significantly alters the composition of the ECM in lung tissue, including key components such as collagen, elastin, fibronectin, and matrix metalloproteinases, thereby affecting pulmonary development. Based on these results, targeted modulation of IFN-γ receptor, TNF-α receptor, and their downstream signaling pathways may serve as a potential therapeutic approach to promote lung development or to treat BPD.\u003c/p\u003e\u003cp\u003eNormal lung development requires appropriate regulation of TGF-β signaling. Research demonstrates that TGF-β plays stage-specific roles during pulmonary morphogenesis. Either hyperactivation of TGF-β signaling or \u003cem\u003eSmad3\u003c/em\u003e knockout in late developmental stages leads to pathological phenotypes including delayed alveolarization and enlarged airspaces [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR39 CR40 CR41\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Alejandro-Alc\u0026aacute;zar MA's murine model further revealed phase-dependent expression patterns of TGF-β pathway components\u0026mdash;elevated SMAD2/3 with low SMAD7 during canalicular and saccular stages, whereas this pattern reverses during the alveolar stage with \u003cem\u003eSmad2/3\u003c/em\u003e downregulation and \u003cem\u003eSmad7\u003c/em\u003e upregulation [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Moreover, Recent study identified TGF-β signaling as crucial in late lung development. Callaway et al. demonstrated its regulatory role in the plasticity of alveolar type 1 (AT1) cells and the transcriptional control of alveolar matrix-related genes [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Notably, IFN-γ and TNF-αinhibited SMAD2/3 phosphorylation and remodeled ECM through upregulated \u003cem\u003eSmad7\u003c/em\u003e expression. Pathological \u003cem\u003eSmad7\u003c/em\u003e overexpression disrupted the alveolarization in lung explants. Therefore, precise modulation of SMAD7 activity and expression may represent a novel therapeutic strategy for promoting lung development and treating BPD.\u003c/p\u003e\u003cp\u003eHowever, our study has several limitations. First, the clinical sample size was relatively small, and future studies with larger cohorts are needed to validate the association between other inflammatory factors and lung development. Second, due to experimental constraints, we were unable to perform in vivo validation using \u003cem\u003eSmad7\u003c/em\u003e knockout mouse models, which would be addressed in follow-up research. Nevertheless, our findings support the critical role of IFN-γ and TNF-α, in BPD pathogenesis, suggesting SMAD7 mediated TGF-β signaling as a therapeutic target for BPD intervention. In summary, our findings demonstrate that IFN-γ combined with TNF-α to upregulate \u003cem\u003eSmad7\u003c/em\u003e, which inhibits the TGF-β/SMAD2/3 pathway, impairing fibroblast activation and ECM remodeling, and ultimately compromising alveolar development. This mechanism reveals a key pathway in perinatal inflammation-induced BPD, offering new insights for targeted intervention.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Science and Technology Projects in Guangzhou (grant number 2024A03J0145 and 2023A03J0381) and Guangzhou Municipal Health Commission (grant number 20241A011087).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXTL, WLH and JWW: data curation, methodology, validation and writing original draft. LZ and XJL: methodology and visualization. ZTM and CHJ: Formal analysis and software. ZWS and FW: conceptualization, funding acquisition, project administration and Writing review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Science and Technology Projects in Guangzhou (grant number 2024A03J0145 and 2023A03J0381) and Guangzhou Municipal Health Commission (grant number 20241A011087).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data analyzed in this study are available within the article or from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the Third Affiliated Hospital of Guangzhou Medical University (Approval No. [2020] 097). Written informed consent was obtained from all patients involved in the study. All procedures involving Mice were performed in accordance with protocols approved by the Committee review of animal experiments in Guangzhou Medical University (No: G2024-1274).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical Trial Number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTh\u0026eacute;baud B., K. N. Goss, M. Laughon, J. A. Whitsett, S. H. Abman, R. H. Steinhorn, J. L. Aschner, P. G. Davis, S. A. McGrath-Morrow, R. F. Soll, et al. 2019. Bronchopulmonary dysplasia. \u003cem\u003eNature reviews Disease primers\u003c/em\u003e;5(1):78.\u003c/li\u003e\n\u003cli\u003eLapcharoensap W., S. C. Gage, P. Kan, J. Profit, G. M. Shaw, J. B. Gould, D. K. Stevenson, H. O\u0026apos;Brodovich, H. C. Lee. 2015. Hospital variation and risk factors for bronchopulmonary dysplasia in a population-based cohort. \u003cem\u003eJAMA pediatrics\u003c/em\u003e;169(2):e143676.\u003c/li\u003e\n\u003cli\u003eJia C. H., Z. S. Feng, X. J. Lin, Q. L. Cui, S. S. Han, Y. Jin, G. S. Liu, C. Z. Yang, X. T. Ye, Y. H. Dai, et al. 2022. Short term outcomes of extremely low birth weight infants from a multicenter cohort study in Guangdong of China. \u003cem\u003eScientific reports\u003c/em\u003e;12(1):11119.\u003c/li\u003e\n\u003cli\u003eWu F., G. Liu, Z. Feng, X. Tan, C. Yang, X. Ye, Y. Dai, W. Liang, X. Ye, J. Mo, et al. 2019. Short-term outcomes of extremely preterm infants at discharge: a multicenter study from Guangdong province during 2008-2017. \u003cem\u003eBMC pediatrics\u003c/em\u003e;19(1):405.\u003c/li\u003e\n\u003cli\u003eCotten C. M., W. Oh, S. McDonald, W. Carlo, A. A. Fanaroff, S. Duara, B. Stoll, A. Laptook, K. Poole, L. L. Wright, et al. 2005. Prolonged hospital stay for extremely premature infants: risk factors, center differences, and the impact of mortality on selecting a best-performing center. \u003cem\u003eJournal of perinatology : official journal of the California Perinatal Association\u003c/em\u003e;25(10):650-5.\u003c/li\u003e\n\u003cli\u003eBeen J. V., M. J. Lugtenberg, E. Smets, C. P. van Schayck, B. W. Kramer, M. Mommers, A. Sheikh. 2014. Preterm birth and childhood wheezing disorders: a systematic review and meta-analysis. \u003cem\u003ePLoS medicine\u003c/em\u003e;11(1):e1001596.\u003c/li\u003e\n\u003cli\u003eK\u0026ouml;ksal N., B. Kayik, M. \u0026Ccedil;etinkaya, H. \u0026Ouml;zkan, F. Budak, Ş Kili\u0026ccedil;, Y. Canitez, B. Oral. 2012. Value of serum and bronchoalveolar fluid lavage pro- and anti-inflammatory cytokine levels for predicting bronchopulmonary dysplasia in premature infants. \u003cem\u003eEuropean cytokine network\u003c/em\u003e;23(2):29-35.\u003c/li\u003e\n\u003cli\u003eHu J., Z. Wu, H. Wang, H. Geng, J. Huo, X. Zhu, X. Zhu. 2022. Vitamin D Ameliorates Apoptosis and Inflammation by Targeting the Mitochondrial and MEK1/2-ERK1/2 Pathways in Hyperoxia-Induced Bronchopulmonary Dysplasia. \u003cem\u003eJournal of inflammation research\u003c/em\u003e;15:4891-906.\u003c/li\u003e\n\u003cli\u003eZhou Y., J. C. Horowitz, A. Naba, N. Ambalavanan, K. Atabai, J. Balestrini, P. B. Bitterman, R. A. Corley, B. S. Ding, A. J. Engler, et al. 2018. Extracellular matrix in lung development, homeostasis and disease. \u003cem\u003eMatrix biology : journal of the International Society for Matrix Biology\u003c/em\u003e;73:77-104.\u003c/li\u003e\n\u003cli\u003eWarburton D., A. El-Hashash, G. Carraro, C. Tiozzo, F. Sala, O. Rogers, S. De Langhe, P. J. Kemp, D. Riccardi, J. Torday, et al. 2010. Lung organogenesis. \u003cem\u003eCurrent topics in developmental biology\u003c/em\u003e;90:73-158.\u003c/li\u003e\n\u003cli\u003eMund S. I., M. Stampanoni, J. C. Schittny. 2008. Developmental alveolarization of the mouse lung. \u003cem\u003eDevelopmental dynamics : an official publication of the American Association of Anatomists\u003c/em\u003e;237(8):2108-16.\u003c/li\u003e\n\u003cli\u003eSelman M., A. Pardo, N. Kaminski. 2008. Idiopathic pulmonary fibrosis: aberrant recapitulation of developmental programs? \u003cem\u003ePLoS medicine\u003c/em\u003e;5(3):e62.\u003c/li\u003e\n\u003cli\u003eChanda D., A. Kurundkar, S. Rangarajan, M. Locy, K. Bernard, N. S. Sharma, N. J. Logsdon, H. Liu, D. K. Crossman, J. C. Horowitz, et al. 2016. Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis. \u003cem\u003eScientific reports\u003c/em\u003e;6:37445.\u003c/li\u003e\n\u003cli\u003eMeng X. M., D. J. Nikolic-Paterson, H. Y. Lan. 2016. TGF-\u0026beta;: the master regulator of fibrosis. \u003cem\u003eNature reviews Nephrology\u003c/em\u003e;12(6):325-38.\u003c/li\u003e\n\u003cli\u003eDouthwaite J. A., T. S. Johnson, J. L. Haylor, P. Watson, A. M. El Nahas. 1999. Effects of transforming growth factor-beta1 on renal extracellular matrix components and their regulating proteins. \u003cem\u003eJournal of the American Society of Nephrology : JASN\u003c/em\u003e;10(10):2109-19.\u003c/li\u003e\n\u003cli\u003eH\u0026auml;nsch G. M., C. Wagner, A. B\u0026uuml;rger, W. Dong, G. Staehler, M. Stoeck. 1995. Matrix protein synthesis by glomerular mesangial cells in culture: effects of transforming growth factor beta (TGF beta) and platelet-derived growth factor (PDGF) on fibronectin and collagen type IV mRNA. \u003cem\u003eJournal of cellular physiology\u003c/em\u003e;163(3):451-7.\u003c/li\u003e\n\u003cli\u003eOverall C. M., J. L. Wrana, J. Sodek. 1991. Transcriptional and post-transcriptional regulation of 72-kDa gelatinase/type IV collagenase by transforming growth factor-beta 1 in human fibroblasts. Comparisons with collagenase and tissue inhibitor of matrix metalloproteinase gene expression. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e;266(21):14064-71.\u003c/li\u003e\n\u003cli\u003eZhang Q., Y. Guo, R. Dong, R. Dai, M. Zhou. 2015. Suppressor of cytokine signaling 1-modulated metalloproteinases and tissue inhibitor of metalloproteinase in pulmonary fibrosis. \u003cem\u003eMolecular medicine reports\u003c/em\u003e;12(3):3855-61.\u003c/li\u003e\n\u003cli\u003eShi Y., J. Massagu\u0026eacute;. 2003. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. \u003cem\u003eCell\u003c/em\u003e;113(6):685-700.\u003c/li\u003e\n\u003cli\u003eChen H., J. Sun, S. Buckley, C. Chen, D. Warburton, X. F. Wang, W. Shi. 2005. Abnormal mouse lung alveolarization caused by Smad3 deficiency is a developmental antecedent of centrilobular emphysema. \u003cem\u003eAmerican journal of physiology Lung cellular and molecular physiology\u003c/em\u003e;288(4):L683-91.\u003c/li\u003e\n\u003cli\u003eHiggins R. D., A. H. Jobe, M. Koso-Thomas, E. Bancalari, R. M. Viscardi, T. V. Hartert, R. M. Ryan, S. G. Kallapur, R. H. Steinhorn, G. G. Konduri, et al. 2018. Bronchopulmonary Dysplasia: Executive Summary of a Workshop. \u003cem\u003eThe Journal of pediatrics\u003c/em\u003e;197:300-8.\u003c/li\u003e\n\u003cli\u003eFeng Z., C. Jia, X. Lin, H. Hao, S. Li, F. Li, Q. Cui, Y. Chen, F. Wu, X. Xiao. 2022. The inhibition of enterocyte proliferation by lithocholic acid exacerbates necrotizing enterocolitis through downregulating the Wnt/\u0026beta;-catenin signalling pathway. \u003cem\u003eCell proliferation\u003c/em\u003e;55(5):e13228.\u003c/li\u003e\n\u003cli\u003eBose C. L., C. E. Dammann, M. M. Laughon. 2008. Bronchopulmonary dysplasia and inflammatory biomarkers in the premature neonate. \u003cem\u003eArchives of disease in childhood Fetal and neonatal edition\u003c/em\u003e;93(6):F455-61.\u003c/li\u003e\n\u003cli\u003eYan X., H. Liao, M. Cheng, X. Shi, X. Lin, X. H. Feng, Y. G. Chen. 2016. Smad7 Protein Interacts with Receptor-regulated Smads (R-Smads) to Inhibit Transforming Growth Factor-\u0026beta; (TGF-\u0026beta;)/Smad Signaling. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e;291(1):382-92.\u003c/li\u003e\n\u003cli\u003eVillamor-Martinez E., M. \u0026Aacute;lvarez-Fuente, A. M. T. Ghazi, P. Degraeuwe, L. J. I. Zimmermann, B. W. Kramer, E. Villamor. 2019. Association of Chorioamnionitis With Bronchopulmonary Dysplasia Among Preterm Infants: A Systematic Review, Meta-analysis, and Metaregression. \u003cem\u003eJAMA network open\u003c/em\u003e;2(11):e1914611.\u003c/li\u003e\n\u003cli\u003eCosta S., S. Fattore, M. De Santis, A. Lanzone, T. Spanu, V. Arena, M. Tana, M. Trapani, M. Sanguinetti, E. R. Barnea, et al. 2024. Effect of acute histologic chorioamnionitis on bronchopulmonary dysplasia and mortality rate among extremely low gestational age neonates: A retrospective case-control study. \u003cem\u003eInternational journal of gynaecology and obstetrics: the official organ of the International Federation of Gynaecology and Obstetrics\u003c/em\u003e;165(3):1040-6.\u003c/li\u003e\n\u003cli\u003eLee Y., H. J. Kim, S. J. Choi, S. Y. Oh, J. S. Kim, C. R. Roh, J. H. Kim. 2015. Is there a stepwise increase in neonatal morbidities according to histological stage (or grade) of acute chorioamnionitis and funisitis?: effect of gestational age at delivery. \u003cem\u003eJournal of perinatal medicine\u003c/em\u003e;43(2):259-67.\u003c/li\u003e\n\u003cli\u003eAghai Z. H., J. G. Saslow, K. Mody, R. Eydelman, V. Bhat, G. Stahl, K. Pyon, V. Bhandari. 2013. IFN-\u0026gamma; and IP-10 in tracheal aspirates from premature infants: relationship with bronchopulmonary dysplasia. \u003cem\u003ePediatric pulmonology\u003c/em\u003e;48(1):8-13.\u003c/li\u003e\n\u003cli\u003eHikino S., S. Ohga, T. Kinjo, T. Kusuda, M. Ochiai, H. Inoue, S. Honjo, K. Ihara, K. Ohshima, T. Hara. 2012. Tracheal aspirate gene expression in preterm newborns and development of bronchopulmonary dysplasia. \u003cem\u003ePediatrics international : official journal of the Japan Pediatric Society\u003c/em\u003e;54(2):208-14.\u003c/li\u003e\n\u003cli\u003eMcGowan S. E. 1992. Extracellular matrix and the regulation of lung development and repair. \u003cem\u003eFASEB journal : official publication of the Federation of American Societies for Experimental Biology\u003c/em\u003e;6(11):2895-904.\u003c/li\u003e\n\u003cli\u003eOlsen C. O., B. E. Isakson, G. J. Seedorf, R. L. Lubman, S. Boitano. 2005. Extracellular matrix-driven alveolar epithelial cell differentiation in vitro. \u003cem\u003eExperimental lung research\u003c/em\u003e;31(5):461-82.\u003c/li\u003e\n\u003cli\u003ePlosa E. J., L. R. Young, P. M. Gulleman, V. V. Polosukhin, R. Zaynagetdinov, J. T. Benjamin, A. M. Im, R. van der Meer, L. A. Gleaves, N. Bulus, et al. 2014. Epithelial \u0026beta;1 integrin is required for lung branching morphogenesis and alveolarization. \u003cem\u003eDevelopment (Cambridge, England)\u003c/em\u003e;141(24):4751-62.\u003c/li\u003e\n\u003cli\u003eShannon J. M., L. D. Nielsen, S. A. Gebb, S. H. Randell. 1998. Mesenchyme specifies epithelial differentiation in reciprocal recombinants of embryonic lung and trachea. \u003cem\u003eDevelopmental dynamics : an official publication of the American Association of Anatomists\u003c/em\u003e;212(4):482-94.\u003c/li\u003e\n\u003cli\u003eCoraux C., G. Meneguzzi, P. Rousselle, E. Puchelle, D. Gaillard. 2002. Distribution of laminin 5, integrin receptors, and branching morphogenesis during human fetal lung development. \u003cem\u003eDevelopmental dynamics : an official publication of the American Association of Anatomists\u003c/em\u003e;225(2):176-85.\u003c/li\u003e\n\u003cli\u003eMariani T. J., J. J. Reed, S. D. Shapiro. 2002. Expression profiling of the developing mouse lung: insights into the establishment of the extracellular matrix. \u003cem\u003eAmerican journal of respiratory cell and molecular biology\u003c/em\u003e;26(5):541-8.\u003c/li\u003e\n\u003cli\u003eGodoy-Guzm\u0026aacute;n C., S. San Martin, J. Pereda. 2012. Proteoglycan and collagen expression during human air conducting system development. \u003cem\u003eEuropean journal of histochemistry : EJH\u003c/em\u003e;56(3):e29.\u003c/li\u003e\n\u003cli\u003eNguyen N. M., D. G. Kelley, J. A. Schlueter, M. J. Meyer, R. M. Senior, J. H. Miner. 2005. Epithelial laminin alpha5 is necessary for distal epithelial cell maturation, VEGF production, and alveolization in the developing murine lung. \u003cem\u003eDevelopmental biology\u003c/em\u003e;282(1):111-25.\u003c/li\u003e\n\u003cli\u003eZhou L., C. R. Dey, S. E. Wert, J. A. Whitsett. 1996. Arrested lung morphogenesis in transgenic mice bearing an SP-C-TGF-beta 1 chimeric gene. \u003cem\u003eDevelopmental biology\u003c/em\u003e;175(2):227-38.\u003c/li\u003e\n\u003cli\u003eZeng X., M. Gray, M. T. Stahlman, J. A. Whitsett. 2001. TGF-beta1 perturbs vascular development and inhibits epithelial differentiation in fetal lung in vivo. \u003cem\u003eDevelopmental dynamics : an official publication of the American Association of Anatomists\u003c/em\u003e;221(3):289-301.\u003c/li\u003e\n\u003cli\u003eGauldie J., T. Galt, P. Bonniaud, C. Robbins, M. Kelly, D. Warburton. 2003. Transfer of the active form of transforming growth factor-beta 1 gene to newborn rat lung induces changes consistent with bronchopulmonary dysplasia. \u003cem\u003eThe American journal of pathology\u003c/em\u003e;163(6):2575-84.\u003c/li\u003e\n\u003cli\u003eVicencio A. G., C. G. Lee, S. J. Cho, O. Eickelberg, Y. Chuu, G. G. Haddad, J. A. Elias. 2004. Conditional overexpression of bioactive transforming growth factor-beta1 in neonatal mouse lung: a new model for bronchopulmonary dysplasia? \u003cem\u003eAmerican journal of respiratory cell and molecular biology\u003c/em\u003e;31(6):650-6.\u003c/li\u003e\n\u003cli\u003eBonniaud P., M. Kolb, T. Galt, J. Robertson, C. Robbins, M. Stampfli, C. Lavery, P. J. Margetts, A. B. Roberts, J. Gauldie. 2004. Smad3 null mice develop airspace enlargement and are resistant to TGF-beta-mediated pulmonary fibrosis. \u003cem\u003eJournal of immunology (Baltimore, Md : 1950)\u003c/em\u003e;173(3):2099-108.\u003c/li\u003e\n\u003cli\u003eAlejandre-Alc\u0026aacute;zar M. A., M. Michiels-Corsten, A. G. Vicencio, I. Reiss, J. Ryu, R. R. de Krijger, G. G. Haddad, D. Tibboel, W. Seeger, O. Eickelberg, et al. 2008. TGF-beta signaling is dynamically regulated during the alveolarization of rodent and human lungs. \u003cem\u003eDevelopmental dynamics : an official publication of the American Association of Anatomists\u003c/em\u003e;237(1):259-69.\u003c/li\u003e\n\u003cli\u003eCallaway D. A., I. J. Penkala, S. Zhou, J. J. Knowlton, F. Cardenas-Diaz, A. Babu, M. P. Morley, M. Lopes, B. A. Garcia, E. E. Morrisey. 2024. TGF-\u0026beta; controls alveolar type 1 epithelial cell plasticity and alveolar matrisome gene transcription in mice. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e;134(6).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"inflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ifla","sideBox":"Learn more about [Inflammation](https://www.springer.com/journal/10753)","snPcode":"10753","submissionUrl":"https://submission.nature.com/new-submission/10753/3","title":"Inflammation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Lung development, Inflammatory cytokines, Extracellular matrix, SMAD, Pulmonary fibroblasts","lastPublishedDoi":"10.21203/rs.3.rs-7506004/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7506004/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInflammation plays a pivotal role in neonatal lung injury and is closely associated with the pathogenesis of bronchopulmonary dysplasia (BPD) in preterm infants, although the underlying molecular mechanisms remain incompletely understood. Our study detected elevated serum levels of interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α) in preterm neonates as early as postnatal day 1 among those who later developed moderate-to-severe BPD. In pulmonary fibroblasts, co-treatment with IFN-γ and TNF-α significantly downregulated α-smooth muscle actin (α-SMA) and disrupted extracellular matrix (ECM) homeostasis, evidenced by reduced collagen type I alpha 1 (COL1A1), collagen type III alpha 1 (COL3A1), and elastin expression, but elevated fibronectin 1 (FN1) and matrix metalloproteinase-1. Furthermore, dual-cytokine exposure attenuated SMAD2/3 phosphorylation and nuclear translocation, while upregulating SMAD7. Parallel experiments using E16.5 fetal rat lung explants recapitulated these changes, showing decreased COL1A1, elevated SMAD7, and BPD-like histopathological alterations, including alveolar simplification and enlarged airspaces. Mechanistically, IFN-γ and TNF-α synergistically promoted SMAD7 overexpression, which competitively bound to SMAD2/3 and suppressed TGF-β signaling, ultimately leading to ECM dysregulation. These data delineate a novel inflammatory axis impairing lung development, highlighting SMAD7 and TGF-β pathways as promising intervention targets.\u003c/p\u003e","manuscriptTitle":"IFN-γ and TNF-α Impair Lung Development by Upregulating SMAD7 to Inhibit TGF-β Signaling Pathway and ECM Dysregulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-22 08:54:05","doi":"10.21203/rs.3.rs-7506004/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-19T13:23:58+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-12T06:58:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"114012399297918597711032277496864809548","date":"2025-09-11T04:02:20+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-10T15:43:07+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-08T11:41:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-08T11:39:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Inflammation","date":"2025-09-01T08:19:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"inflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ifla","sideBox":"Learn more about [Inflammation](https://www.springer.com/journal/10753)","snPcode":"10753","submissionUrl":"https://submission.nature.com/new-submission/10753/3","title":"Inflammation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3a7faced-af05-49cd-8d9c-fba36caafd0b","owner":[],"postedDate":"September 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-09T16:09:09+00:00","versionOfRecord":{"articleIdentity":"rs-7506004","link":"https://doi.org/10.1007/s10753-025-02357-7","journal":{"identity":"inflammation","isVorOnly":false,"title":"Inflammation"},"publishedOn":"2026-02-03 15:57:28","publishedOnDateReadable":"February 3rd, 2026"},"versionCreatedAt":"2025-09-22 08:54:05","video":"","vorDoi":"10.1007/s10753-025-02357-7","vorDoiUrl":"https://doi.org/10.1007/s10753-025-02357-7","workflowStages":[]},"version":"v1","identity":"rs-7506004","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7506004","identity":"rs-7506004","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00