Genome-Wide Characterization of the VfBES1 Gene Family in Vernicia fordii Unveils Lineage- Specific Regulatory Innovations in Floral Development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genome-Wide Characterization of the VfBES1 Gene Family in Vernicia fordii Unveils Lineage- Specific Regulatory Innovations in Floral Development Chong Ge, Jing Gao, Lin Zhang, Jie Cao, Xiang Li, Junjie Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6855119/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background The Tung tree ( Vernicia fordii Hemsl.), a commercially significant oil-producing tree species. However, the molecular mechanisms governing floral sex determination remain elusive, particularly the genetic basis underlying the skewed female-to-male flower ratio and the evolutionary dynamics of sex-related gene families, which severely restricts targeted breeding for yield enhancement. The BES1 transcription factor family, which plays a crucial role in Brassinosteroid (BR) signaling and reproductive development, is particularly underexplored in woody perennials. Results In this study, we introduce the first genome-wide identification and functional characterization of the VfBES1 gene family in the Tung tree. Integrative multi-omics approaches have revealed seven VfBES1 genes, clustered into three phylogenetically distinct clades, each characterized by lineage-specific motifs and structural simplicity. Segmental duplication events ( VfBES1-1 / VfBES1-5 and VfBES1-4 / VfBES1-7 ) and promoter cis-element enrichment (hormone-responsive and abiotic stress-related motifs) highlight evolutionary innovation and functional diversification. Spatiotemporal expression profiling reveals tissue- and stage-specific roles: VfBES1-1 was predominantly expressed in female flowers and fruits, suggesting potential involvement in sex determination. Conversely, VfBES1-2 and VfBES1-6 exhibited male flower-specific and early floral developmental activation, respectively. Nuclear-localized VfBES1-6 displayed co-expression with VfMYB35-1 , a regulator of male structure degeneration, although no direct interaction was detected. Conclusions These findings shed light on the regulation of VfBES1s in floral development, offering a reference for precision breeding to enhance flowering synchrony and seed productivity in the Tung tree. This study provides a comparative framework for understanding lineage-specific BES1 functions in non-model woody plants. Vernicia fordii BES1 gene family floral development gene duplication multi-omics analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The Tung tree ( Vernicia fordii Hemsl.), a perennial woody plant of the Euphorbiaceae family, is one of the world's most significant oilseed crops. Its oil, rich in triacylglycerol, is extensively utilized for biodiesel production, industrial paints, and pharmaceutical products [ 1 – 3 ]. However, the Tung tree's reproductive efficiency is relatively low, a result of insufficient understanding of the molecular regulatory network governing reproductive development. Recent studies on plant genomics have revealed that lineage-specific gene family expansion and functional diversification are crucial in regulating reproductive traits in non-model woody perennials [ 4 , 5 ]. The BES1 gene family, a subgroup of the transcription factor family, was first identified for its crucial role in regulating genes mediated by Brassinosteroids (BR) [ 6 ]. This family consists of six highly homologous members: BES1 , BZR1 , BEH1 , BEH2 , BEH3 , and BEH4 [ 7 ]. The transcription factors involved in the detection of BR signals play a crucial role in regulating a wide array of growth and developmental processes in plants. These processes encompass cell elongation and division, leaf and root growth, vascular tissue differentiation, floral initiation, stamen fertility, stress tolerance, and senescence [ 8 ]. Notably, in another development, the BES1 gene family serves as downstream transcription factors within the TPD1-EMS1/SERK1/2 signaling pathway, playing an integral role in plant reproduction by modulating tapetum development [ 9 ]. Furthermore, the BES1 gene family regulates the expression of key genes such as DYSFUNCTIONAL TAPETUM1 ( DYT1 ) and MALE STERILITY1 ( MS1 ), which are instrumental in pollen sac development and pollen spore production [ 10 , 11 ]. The BES1 gene family has been identified in several crops, including Arabidopsis, rapeseed, cotton, maize, and tomato [ 12 – 16 ]. However, its characterization in woody species remains relatively underexplored. Therefore, investigating the functions of BES1 gene family members in Tung tree is of particular importance for enhancing our understanding of their roles in perennial plants. This study represents the first genome-wide identification and functional characterization of the VfBES1 gene family in Tung tree. By using integrative multi-omics approaches, we have clarified the phylogenetic divergence, gene duplication history, and promoter cis-element architectures of VfBES1 paralogs. Time-resolved transcriptome profiling at key floral developmental stages revealed stage-specific regulation of VfBES1 expression during floral transition, organogenesis, and gametophyte development. These findings deepen our understanding of evolutionary innovation and regulatory specialization of BES1 homologs in woody plants and provide usable genetic targets for precise breeding to improve flowering synchrony, inflorescence architecture, and seed productivity in Tung tree. Our study provides a comparative framework for reproductive development studies in non-model woody perennials. Materials and Methods 2.1 Plant materials The Tung trees used in this study were cultivated in the experimental area of Central South University of Forestry and Technology, located in Qingping Town, Yongshun County, Hunan Province. 2.2 Identification and Classification of VfBES1s Genes The Tung tree genome, obtained from the NCBI (BioProject: PRJNA503685), was analyzed to identify VfBES1s genes. A Hidden Markov Model (HMM) profile corresponding to the BES1 domain (PF05687) was retrieved from the Pfam database [ 17 ]. Using TBtools, the genome was scanned with an e-value threshold of < 1.0 × 10 − 10 to ensure stringent identification of candidate genes [ 18 ]. Putative VfBES1s sequences were further validated for domain integrity using SMART, Pfam, and Conserved Domain Database (CDD) analyses. Subcellular localization predictions were performed via BUSCA, while physicochemical properties (molecular weight, isoelectric point, grand average of hydropathicity) were computed using ExPASy ProtParam [ 19 ]. 2.3 Phylogenomic Reconstruction, Conserved Motif Analysis, and Gene Structure Analysis The ClustalW was used for multiple alignments of VfBES1s , and the phylogenetic tree was constructed using MEGA7.0 software based on the neighbor-joining method (NJ) [ 20 ]. The iTOL online software ( https:/itolembl.de/ ) was employed to beautify the phylogenetic tree. When analyzing the conserved motifs of VfBES1s , the maximum number of motifs was set to 10, and the Multiple Expectation Maximization for Motif (MEME) was used to evaluate the conserved motifs of VfBES1s with default parameters. Finally, the gene structure saved in the gff3 file and the conserved motifs in the eXtensible Markup Language (xML) file were input into the TBtools software to visualize the exon-intron assignments and types of conserved motifs. The TBtools software was used for the gene structure analysis of VfBES1s in the general feature format version 3 (gff3) annotation file of Tung tree. 2.4 Chromosomal Localization and Collinearity Analysis of VfBES1s Genes The chromosomal localization information was included in the gff3 annotation files, and all VfBES1s genes were mapped and visualized by TBtools. Gene duplication includes whole genome duplication, segmental duplication, out-of-linkage duplication using the Multiple Collinearity Scanning toolkit MCScanX in TBtools to assess VfBES1s duplication events. 2.5 Expression Pattern Analysis of VfBES1s in Different Tissues Root, stem, leaf, female flower, male flower, and fruit samples were collected from the mature Tung tree during June to July. The RNA was extracted separately using Trizol reagent, then reverse transcribed into cDNA. The VfEF1a gene was utilized as an internal control for analyzing the expression levels of VfBESs genes in these samples via qRT-PCR (primer sequences are provided in Table 1 ). All experiments were conducted in triplicate and the relative expression levels were calculated using the 2 −ΔΔCt method. Origin 2022 software was employed for graph illustration. Table 1 The primers of this study Primer Name Sequence VfEF1a-qPCR-F GCCTGGTATGGTTGTGACCT VfEF1a-qPCR-R GGATCATCCTTGGAGTTGGA VfBES1-1-qPCR-F TGGGTCAGCAGAATGGCTTT VfBES1-1-qPCR-R TAACCATGGGCCTTTGCACT VfBES1-2-qPCR-F AGCCTCTATCAGGTGCTGGA VfBES1-2-qPCR-R AAGCCTGCTGTGTTACTCCC VfBES1-3-qPCR-F GTTCTCCTGCCATTCCAGCT VfBES1-3-qPCR-R CACCTGGTTCTTGAGGTCCC VfBES1-4-qPCR-F CTATGCCGTATCTGCCCCAG VfBES1-4-qPCR-R TTGGAGAGGTTGGCATTGCT VfBES1-5-qPCR-F AGGGCAAGAGAGAGAGGGAG VfBES1-5-qPCR-R ATCAGCCTCAACAGTCCAGC VfBES1-6-qPCR-F ACCGAGAGAAGCTCATTGCC VfBES1-6-qPCR-R CTCCGATGCCGCTCTCTTAG VfBES1-7-qPCR-F CAAGCTTCTTAACCGCTGCC VfBES1-7-qPCR-R CGATGAGGTGATGCAGTGGT VfMYB35-1-qPCR-F TGGAACACAAAACTAAGAAAG VfMYB35-1-qPCR-R GCAACCAATGTTTCCATAATC pCAMBIA1300-GFP-F CTCGGTACCCGGGGATCCATGGTGGGGGGTTCATCT pCAMBIA1300-GFP-R CTTGCTCACCATGTCGACGTTGTTAAGGGGCAGAGGT 2.6 Expression Patterns of VfBES1s at Different Developmental Stages of Female and Male Flowers To characterize the expression patterns of VfBES1s at different developmental stages of female and male flowers, RNA-seq data from four periods of flower development—30 days before flowering (C1 and X1), 20 days before flowering (C2 and X2), 10 days before flowering (C3 and X3), and 0 days before flowering (C4 and X4)—were analyzed. Transcript abundance (FPKM values) was quantified using HISAT2-StringTie pipeline. Heatmaps were generated in TBtools to visualize stage-specific. 2.7 Subcellular Localization Analysis of VfBES1-6 VfMYB35-1 plays a pivotal role in the early degradation of male structures within female flowers. Interestingly, the expression pattern of VfMYB35-1 during the developmental stages of both female and male flowers aligns with that of VfBES1-6. Consequently, this research delved deeper into the interplay between VfMYB35-1 and VfBES1-6 . Utilizing the BUSCA software for analysis revealed that the VfBES1-6 protein is primarily located in the cell nucleus. To ascertain the precise subcellular localization of this gene, a fusion expression vector, VfBES1-6- pCAMBIA1300-GFP, was crafted and subsequently introduced into the protoplasts of the Tung tree. The localization of VfBES1-6 was then visualized using a confocal microscope. Furthermore, we conducted real-time fluorescent quantitative analysis on the successfully transformed protoplasts. Result 3.1 Identification and Physicochemical Property Analysis of the Tung tree BES1 Genes Through the analysis of the whole genome data of Tung tree, seven candidate genes containing the BES1 domain were identified in Tung tree. All seven members passed the verification of SMART, NCBI-CDD, and PFAM websites. They were named VfBES1-1 to VfBES1-7 based on their physical location order on the Tung tree chromosome (Table 2 ). The physicochemical property analysis results of the VfBES1s protein showed that the sequence length ranged from 780-34359 bp, the molecular weight distribution ranged from 24643.38-79044.11 Da, and the isoelectric point varied between 5.44–9.10. Subcellular localization prediction indicated that this gene family is located in the nucleus. Table 2 Physiological and biochemical characterization of VfEBS1s proteins in Tung tree Gene name Gene ID Chromosome Start site End site Length/AA MW(Da) pl Subcellular localization VfBES1-1 Vf01g00271 Chr1 3353380 3354890 1511 34340.13 8.98 Nucleus VfBES1-2 Vf06g02665 Chr6 96839318 96844248 4931 79044.11 5.44 Nucleus VfBES1-3 Vf07g00352 Chr7 42811492 42845850 34359 77223.06 5.85 Nucleus VfBES1-4 Vf07g01244 Chr7 80614690 80618447 3758 38102.46 7.07 Nucleus VfBES1-5 Vf09g02058 Chr9 96848203 96849693 1491 34038.22 9.10 Nucleus VfBES1-6 Vf10g00729 Chr10 69887734 69888513 780 24643.38 8.24 Nucleus VfBES1-7 Vf11g00439 Chr11 55494194 55498222 4029 35274.29 8.60 Nucleus 3.2 Phylogenetic, Conserved Motif analysis and Gene Structure Analysis of VfBES1 Gene Family The phylogenetic tree was constructed using the 7 selected Tung tree VfBES1s protein sequences. The results showed that the VfBES1s genes in Tung tree can be divided into three branches. Conserved motif analysis results showed that the number of conserved motifs in the VfBES1s gene family of Tung tree ranged from 2 to 8, among which Motif1 and Motif2 appeared in all genes, indicating that these two motifs are highly conserved. In addition, Motif3 appeared in 6 VfBES1s genes. VfBES1s proteins within the same branch have similar motif compositions, for example, the most closely related VfBES1-2 and VfBES1-3 both contain Motif1, Motif2, Motif3, Motif6, Motif7, Motif8, and Motif9, while VfBES1-1, VfBES1-4, VfBES1-5, and VfBES1-7 all contain Motif1, Motif2, Motif3, Motif4, Motif5, and Motif10 (Fig. 1 ). Gene structure analysis results showed that VfBES1s genes contain a maximum of 2 introns, and 8 genes lack introns, among which the proteins of clade1 all lack introns, indicating that the VfBES1s genes of clade1 have simpler gene structure characteristics. Gene structure analysis results showed that VfBES1s genes contain a maximum of 1 intron, and 6 genes lack introns, among which VfBES1-6 has simpler gene structure characteristics. 3.3 Cis-acting Elements in the Promoter of VfBES1s Gene To understand the pathways in which the VfBES1s gene is involved in signal transduction in Tung tree, the cis-acting elements of the 2000 bp promoter region upstream of the ATG of 7 VfBES1s genes were analyzed through the PlantCARE website. The results showed that the promoter region of the VfBES1s gene contains a series of important growth and abiotic stress response elements, such as: auxin, gibberellin, light reaction, and low temperature response elements (Fig. 2 ). These predicted results indicate that the VfBES1s family may be involved in responses to hormone signal transduction and environmental stress. 3.4 Chromosomal Location Analysis of VfBES1s Gene The 7 VfBES1s genes are unevenly distributed across the 6 chromosomes of the Tung tree. Specifically, chromosome 7 carries 2 VfBES1s genes, while chromosomes 1, 6, 9, 10, and 11 each have 1 VfBES1 gene (Fig. 3 ). No VfBES1s genes were found on the other chromosomes. 3.5 Analysis of Gene Duplication Relationships and Collinearity in VfBES1s Genes To further analyze the evolutionary relationship of the Tung tree genes, a genomic intra-duplication event analysis was conducted. The results showed that there are 2476 collinear genes among the Tung tree genes, of which two pairs of collinear gene pairs exist between VfBES1s genes: VfBES1-1 / VfBES1-5 and VfBES1-4 / VfBES1-7 , indicating that gene duplication events have occurred in the VfBES1s gene family (Fig. 4 ). 3.6 The Expression Patterns of VfEBS1s Across Various Tissues The expression patterns of VfEBS1s genes exhibited marked variations across diverse tissues. Specifically, VfEBS1-1 was predominantly expressed in the female flower and fruit, displaying a significant difference in expression level between male and female flowers (Fig. 5 A). This underscores its potential role in sex determination. VfEBS1-2 was predominantly expressed in the fruit, indicating a possible association with fruit development (Fig. 5 B). Conversely, VfEBS1-3, VfEBS1-4, VfEBS1-5, VfEBS1-6 and VfEBS1-7 were primarily expressed in the root, suggesting these genes may be linked to the growth stability and stress resistance of the Tung tree (Fig. 5 C, D, E, F, G). 3.7 Expression Patterns of VfBES1s in Different Flowering Phases To elucidate the potential functions of VfBES1s in flower development, the expression patterns of VfBES1s in different developmental stages of female and male flowers in Tung tree were explored through transcriptome data analysis. We screened 7 differentially expressed VfBES1s genes from the transcriptome database, and the expression characteristics of these genes revealed their possible roles in the process of flower development. The results showed that VfBES1-1 and VfBES1-7 maintained high expression throughout the development of female and male flowers, and in addition, these three genes, VfBES1-3 , VfBES1-4 , and VfBES1-5 , had similar expression patterns, suggesting that these genes may play a vital role in the entire development process of flowers in Tung tree, and may be involved in regulating the core process of flower development (Fig. 6 A, C, D, E, G). Notably, VfBES1-2 expressed higher levels in the X1–X3 stage of male flower development than in the female flower (Fig. 6 B). This discovery suggests that VfBES1-2 may play a more important role in the specific stages of male flower development and may be involved in regulating the unique processes or traits of male flower development. Whereas VfBES1-6 showed high expression levels in the early stages of both female and male flower development, indicating that this gene may play a key role in the initiation phase of flower development and may be involved in regulating the formation of flower buds or the early establishment of flower morphology. 3.8 VfEBS1-6 Protein Localization in the Nucleus VfBES1-6 demonstrated pronounced expression characteristics during the initial stages (C1 and X1) of floral development in both sexes, subsequently diminishing rapidly in other developmental stages. Notably, this expression pattern closely aligns with that of VfMYB35-1 , as documented previously, underscoring the pivotal roles VfBES1-6 might serve during specific intervals of floral development. To elucidate its function further, subcellular localization experiments were conducted, revealing that the VfBES1-6 protein is exclusively localized within the nucleus (Fig. 7 A). To investigate potential interactions between VfBES1-6 and VfMYB35-1, the former was overexpressed in protoplasts via transformation assays. This resulted in a marked augmentation of VfBES1-6 expression in OE-VfBES1-6 relative to empty vector ( EV ), concomitant with a noticeable alteration in VfMYB35-1 expression (Fig. 7 B, C). This observation intimate potential interaction between VfBES1-6 and VfMYB35-1 . However, neither yeast one-hybrid nor two-hybrid assays confirmed any direct interaction between the two proteins. Consequently, this suggests that the regulatory mechanism governing the expression of VfBES1-6 and VfMYB35-1 during floral development is likely intricate, potentially entailing indirect interactions or the involvement of additional regulatory elements. Discussion The genome-wide analysis of the VfBES1 gene family in the Tung tree has yielded crucial insights into the lineage-specific regulatory advancements that underpin floral development in woody perennials. In this study, we identified seven VfBES1 genes, uncovering phylogenetic divergence, gene duplication history, and cis-regulatory architectures. These findings collectively highlight the evolutionary dynamism of this transcription factor family. Furthermore, the expression dynamics of VfBES1s across different floral developmental stages and tissues underscore their specialized roles in reproductive processes. These insights lay a solid foundation for improving Tung tree breeding strategies. The phylogenetic analysis grouped VfBES1s into three clades, which was in accordance with the conserved motif compositions and structural simplicity of the clade-specific genes. Clade-specific motifs (Motif1 and Motif2 were universally retained across all paralogs) might contribute to functional conservation in BR signaling, whereas lineage-specific motifs (Motif4-10) may promote functional diversification. This divergence was similar to that in Arabidopsis and Brassica, where BES1 homologs acquired distinct regulatory roles through motif shuffling and neofunctionalization after duplication [ 7 , 13 ]. The occurrence of tandem and segmental duplication ( VfBES1-1 / VfBES1-5 and VfBES1-4 / VfBES1-7 ) indicated that recurrent duplication followed by subfunctionalization led to adaptive evolution of VfBES1s towards ecological or developmental constraints, which has also been reported in other woody perennials [ 5 ]. Analysis of promoter cis-elements has demonstrated an enrichment of hormone-responsive (auxin and gibberellin) and stress-related elements in VfBES1s . This suggests their potential role in facilitating cross-talk between BR signaling and environmental adaptation. Notably, this is congruent with research conducted on Zea mays and Gossypium , where BES1 homologs have been found to integrate developmental cues with responses to abiotic stress [ 14 , 15 ]. The nuclear localization of VfBES1-6 , which is consistent with its function as a transcription factor, further bolsters its regulatory capacity in target gene activation during floral transitions. Analysis of spatiotemporal expression revealed tissue- and stage-specific functions of VfBES1s . Preferential expression of VfBES1-1 in female flowers and fruits indicated its possible roles in sex determination and ovule development, similar to BES1-mediated stamen fertility in Arabidopsis [ 9 ]. Root-specific expression of VfBES1-3 to VfBES1-7 suggested their participation in root growth and stress tolerance, which extended the role of BES1 beyond reproductive development. Notably, VfBES1-6 showed highest expression during early floral development (C1/X1), which was quite similar to the temporal expression pattern of VfMYB35-1 , a male structure degeneration regulator [ 3 ]. Although no direct protein interaction was observed, their co-expression suggested potential synergistic or indirect regulation, which might be achieved by unknown upstream factors or chromatin modifiers. Similarly, in Arabidopsis, BES1 proteins regulate developmental programs via combinatorial interactions with MYB and bHLH transcription factors [ 10 ]. Although these findings are significant, there are still some limitations. The lack of a direct interaction between VfBES1-6 and VfMYB35-1 in yeast assays indicates that their coordination might rely on intermediary proteins or epigenetic mechanisms. This warrants further investigation using chromatin immunoprecipitation (ChIP) or co-immunoprecipitation (Co-IP) studies. Moreover, the functional validation of the roles of VfBES1s in floral development needs to be confirmed through CRISPR/Cas9-mediated knockout or overexpression in transgenic Tung trees. In conclusion, this study unravels the evolutionary history and regulatory diversification of VfBES1s , and thus defines them as key regulators of reproductive development in Tung tree. Our integrative analyses on phylogenomic, expression and cis-regulatory data establish a basis for the strategic exploitation of VfBES1s in molecular breeding for improved synchronization of flowering and seed production, and also allow comparative studies on BES1-mediated signaling in non-model woody species. Declarations Acknowledgments This research work was supported by the Graduate Research Innovation Project of Hunan Province (Grant Nos.: CX20240709 and CX20220705) Author contributions Author Statement Chong Ge: wrote the paper, performed the experiments Jing Gao: contributed reagents, materials, analysis tools or data Zhang Lin: contributed reagents, materials, analysis tools or data Xiang Li: performed the experiments Jie Cao: analyzed and interpreted the data Junjie Chen: conceived and designed the experiments Funding This research work was supported by the Graduate Research Innovation Project of Hunan Province (Grant Nos.: CX20240709 and CX20220705) Availability of Data and Materials The data of the genome sequencing of the tung tree are available at NCBI: PRJNA503685. The RNA-seq data is available at NCBI: SRX3843583, SRX3843584, SRX3843585, SRX3843586, SRX3843587, SRX3843588, SRX3843589, SRX3843590 and SRX3843591. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interest. References Chen J, Wu Z, Li R, Huang D, Zhai W, Chen C. New insight into LncRNA-mRNA regulatory network associated with lipid biosynthesis using Hi-C data in seeds of tung tree (Vernicia fordii Hemsl). Ind Crops Prod. 2021;164:113321. Cao H, Cao F, Thomas Klasson K. Characterization of reference gene expression in tung tree (Vernicia fordii). Ind Crops Prod. 2013;50:248–55. Liu M, Li W, Zhao G, Fan X, Long H, Fan Y, Shi M, Tan X, Zhang L. New Insights of Salicylic Acid Into Stamen Abortion of Female Flowers in Tung Tree (Vernicia fordii). Front Genet 2019, 10. Lespinet O, Wolf YI, Koonin EV, Aravind L. The role of lineage-specific gene family expansion in the evolution of eukaryotes. Genome Res. 2002;12(7):1048–59. Qiao X, Li Q, Yin H, Qi K, Li L, Wang R, Zhang S, Paterson AH. Gene duplication and evolution in recurring polyploidization–diploidization cycles in plants. Genome Biol. 2019;20(1):38. Youn JH, Kim TW. Functional insights of plant GSK3-like kinases: multi-taskers in diverse cellular signal transduction pathways. Mol Plant. 2015;8(4):552–65. Yin Y, Vafeados D, Tao Y, Yoshida S, Asami T, Chory J. A new class of transcription factors mediates brassinosteroid-regulated gene expression in Arabidopsis. Cell. 2005;120(2):249–59. Nakashita H, Yasuda M, Nitta T, Asami T, Fujioka S, Arai Y, Sekimata K, Takatsuto S, Yamaguchi I, Yoshida S. Brassinosteroid functions in a broad range of disease resistance in tobacco and rice. Plant J. 2003;33(5):887–98. Chen W, Lv M, Wang Y, Wang PA, Cui Y, Li M, Wang R, Gou X, Li J. BES1 is activated by EMS1-TPD1-SERK1/2-mediated signaling to control tapetum development in Arabidopsis thaliana. Nat Commun. 2019;10(1):4164. Zhang W, Sun Y, Timofejeva L, Chen C, Grossniklaus U, Ma H. Regulation of Arabidopsis tapetum development and function by DYSFUNCTIONAL TAPETUM1 (DYT1) encoding a putative bHLH transcription factor. Development. 2006;133(16):3085–95. Wilson ZA, Morroll SM, Dawson J, Swarup R, Tighe PJ. The Arabidopsis MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis, with homology to the PHD-finger family of transcription factors. Plant J. 2001;28(1):27–39. Jiang J, Zhang C, Wang X. A recently evolved isoform of the transcription factor BES1 promotes brassinosteroid signaling and development in Arabidopsis thaliana. Plant Cell. 2015;27(2):361–74. Song X, Ma X, Li C, Hu J, Yang Q, Wang T, Wang L, Wang J, Guo D, Ge W, et al. Comprehensive analyses of the BES1 gene family in Brassica napus and examination of their evolutionary pattern in representative species. BMC Genomics. 2018;19(1):346. Liu Z, Qanmber G, Lu L, Qin W, Liu J, Li J, Ma S, Yang Z, Yang Z. Genome-wide analysis of BES1 genes in Gossypium revealed their evolutionary conserved roles in brassinosteroid signaling. Sci China Life Sci. 2018;61(12):1566–82. Feng W, Zhang H, Cao Y, Liu Y, Zhao Y, Sun F, Yang Q, Zhang X, Zhang Y, Wang Y, et al. Maize ZmBES1/BZR1-1 transcription factor negatively regulates drought tolerance. Plant Physiol Biochem. 2023;205:108188. Gao Y, Hu J, Zhao T, Xu X, Jiang J, Li J. Genome-wide Identification and Expression Pattern Analysis of BRI1-EMS–suppressor Transcription Factors in Tomato under Abiotic Stresses. J Am Soc Hortic Sci J Amer Soc Hort Sci. 2018;143(1):84–90. Ma S, Ji T, Liang M, Li S, Tian Y, Gao L. Genome-Wide Identification, Structural, and Gene Expression Analysis of BRI1-EMS-Suppressor 1 Transcription Factor Family in Cucumis sativus. Front Genet. 2020;11:583996. Chen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, et al. TBtools-II: A one for all, all for one bioinformatics platform for biological big-data mining. Mol Plant. 2023;16(11):1733–42. Gasteiger E, Hoogland C, Gattiker A, Duvaud Se, Wilkins MR, Appel RD, Bairoch A. Protein Identification and Analysis Tools on the ExPASy Server. In: The Proteomics Protocols Handbook. Edited by Walker JM. Totowa, NJ: Humana Press; 2005: 571–607. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870–4. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 08 Jul, 2025 Reviews received at journal 05 Jul, 2025 Reviews received at journal 30 Jun, 2025 Reviewers agreed at journal 29 Jun, 2025 Reviewers agreed at journal 27 Jun, 2025 Reviewers invited by journal 23 Jun, 2025 Editor assigned by journal 23 Jun, 2025 Submission checks completed at journal 22 Jun, 2025 First submitted to journal 22 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6855119","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":476834321,"identity":"71fc88a9-3703-475b-8722-209ae42d2669","order_by":0,"name":"Chong Ge","email":"","orcid":"","institution":"Central South University of Forestry and Technology","correspondingAuthor":false,"prefix":"","firstName":"Chong","middleName":"","lastName":"Ge","suffix":""},{"id":476834322,"identity":"c81f5698-153e-4e97-b1a3-ca8e3ec1eb3c","order_by":1,"name":"Jing Gao","email":"","orcid":"","institution":"Xianghu Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Gao","suffix":""},{"id":476834323,"identity":"faf83b53-9a35-4b3d-8344-c4c3e79b073c","order_by":2,"name":"Lin Zhang","email":"","orcid":"","institution":"Central South University of Forestry and Technology","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Zhang","suffix":""},{"id":476834324,"identity":"67bf592d-6457-4260-bbc9-7fcaf42d60a7","order_by":3,"name":"Jie Cao","email":"","orcid":"","institution":"Central South University of Forestry and Technology","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Cao","suffix":""},{"id":476834325,"identity":"bb6b4bcf-a9ee-4ce9-982b-4e1136dc9057","order_by":4,"name":"Xiang Li","email":"","orcid":"","institution":"Central South University of Forestry and Technology","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Li","suffix":""},{"id":476834326,"identity":"383dccae-a8d2-4c35-a87c-4fc5dc60936a","order_by":5,"name":"Junjie Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYBACNvbmgw8+VEjI2bcDGQkVNYS18PEcSzacccbC2ADIMHhw5hhhLXISOWbCvG0ViRskctQkH7YwE+EwibQ0Bt42CWNzhhy2isQGNgb+9u4E/Fp4Hh97IHFOQs6y4eyxG4k7ZBgkzpzdgF8Le1q6gUGZhDHDwb60G4ln2BgMJHIJaGHIMZNIYJNIbDjMY1aQ2MZMhBYOoJYDbRKJG47xmDEQpwUUyA1nJIwle9iSJRLOHOMh6Bd5YAw+/lNRJ8cv//jgxx8VNXL87b34tWAAHtKUj4JRMApGwSjACgB1WEvuXyKMOQAAAABJRU5ErkJggg==","orcid":"","institution":"Central South University of Forestry and Technology","correspondingAuthor":true,"prefix":"","firstName":"Junjie","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-06-09 13:53:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6855119/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6855119/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85570455,"identity":"9981d864-376c-44ee-a01b-51fc1606e512","added_by":"auto","created_at":"2025-06-27 16:00:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2165345,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree and conserved motifs for VfBES1s proteins, and gene structures for \u003cem\u003eVfBES1s \u003c/em\u003egenes. (A) Phylogenetic tree. (B) The 10 domains under investigation are visually distinguished by employing a range of colors, each representing a unique domain. (C) UTRs are prominently highlighted in yellow, exons denoted by green, and black lines represent introns of gene structures.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/b831f09d65121acad2a61588.png"},{"id":85569720,"identity":"3614ca32-82ed-4411-9199-cac2da730ccb","added_by":"auto","created_at":"2025-06-27 15:52:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1785573,"visible":true,"origin":"","legend":"\u003cp\u003eCis-acting elements in the promoter of \u003cem\u003eVfBES1s\u003c/em\u003egene\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/8cda60d727b9a209a35e9b69.png"},{"id":85570602,"identity":"95808c8a-1464-47d5-8606-35e74839a4d4","added_by":"auto","created_at":"2025-06-27 16:08:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3282148,"visible":true,"origin":"","legend":"\u003cp\u003eChromosomal location of \u003cem\u003eVfBES1s\u003c/em\u003e gene. The arrangement of genes on each chromosome exhibits a sequential organization\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/a2b9338f49f31ec82be86fc5.png"},{"id":85569723,"identity":"841daff2-3453-4d2c-8cbf-0f0d1d4708ec","added_by":"auto","created_at":"2025-06-27 15:52:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4196669,"visible":true,"origin":"","legend":"\u003cp\u003eCollinear map of \u003cem\u003eVfBES1s\u003c/em\u003e genes. Collinear pairs of \u003cem\u003eVfBES1s\u003c/em\u003e genes are highlighted with red lines.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/d55f3376c5a2147e5e148bfa.png"},{"id":85569718,"identity":"ff1a7eea-8958-4787-abda-3610d2395d0a","added_by":"auto","created_at":"2025-06-27 15:52:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2162414,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression patterns of \u003cem\u003eVfEBS1s\u003c/em\u003e across various tissues. (A) \u003cem\u003eVfBES1-1\u003c/em\u003e, (B) \u003cem\u003eVfBES1-2\u003c/em\u003e, (C) \u003cem\u003eVfBES1-3\u003c/em\u003e, (D) \u003cem\u003eVfBES1-4\u003c/em\u003e, (E) \u003cem\u003eVfBES1-5\u003c/em\u003e, (F) \u003cem\u003eVfBES1-5\u003c/em\u003e, (G) \u003cem\u003eVfBES1-6\u003c/em\u003e, (G) \u003cem\u003eVfBES1-7\u003c/em\u003e. Data are presented as mean ± SD of relative expression levels (log2-transformed fold changes) across three biological replicates.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/ae7ee2552b0955cee303b536.png"},{"id":85569724,"identity":"c2e076e9-61a0-4a85-8980-36f36f389fe6","added_by":"auto","created_at":"2025-06-27 15:52:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":684484,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of \u003cem\u003eVfBES1s \u003c/em\u003eand\u003cem\u003e VfMYB35-1\u003c/em\u003e in different flowering phases. (A) \u003cem\u003eVfBES1-1\u003c/em\u003e, (B) \u003cem\u003eVfBES1-2\u003c/em\u003e, (C) \u003cem\u003eVfBES1-3\u003c/em\u003e, (D) \u003cem\u003eVfBES1-4\u003c/em\u003e, (E) \u003cem\u003eVfBES1-5\u003c/em\u003e, (F) \u003cem\u003eVfBES1-5\u003c/em\u003e, (G) \u003cem\u003eVfBES1-6\u003c/em\u003e, (G) \u003cem\u003eVfBES1-7\u003c/em\u003e. (H) \u003cem\u003eVfMYB35-1\u003c/em\u003e. Data are presented as mean ± SD of relative expression levels (log2-transformed fold changes) across three biological replicates.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/a692f8604c604f509f50c31b.png"},{"id":85569727,"identity":"290f4228-b132-42e2-a161-270a9ff739c5","added_by":"auto","created_at":"2025-06-27 15:52:00","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":7506970,"visible":true,"origin":"","legend":"\u003cp\u003eSubcellular localization of VfEBS1-6 and expression levels of \u003cem\u003eVfEBS1-6\u003c/em\u003e and \u003cem\u003eVfMYB35-1\u003c/em\u003e. (A) VfEBS1-6 protein localization in the nucleus, (B) Expression of \u003cem\u003eVfBES1-6\u003c/em\u003e in \u003cem\u003eEV\u003c/em\u003e and \u003cem\u003eOE-VfBES1-6\u003c/em\u003eprotoplasts, (C) Expression of \u003cem\u003eVfMYB35-1\u003c/em\u003e in \u003cem\u003eEV\u003c/em\u003e and \u003cem\u003eOE-VfBES1-6\u003c/em\u003eprotoplasts. Data are presented as mean ± SD of relative expression levels across three biological replicates. Columns marked with asterisks (*) indicate statistical significance compared with the control (*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, P \u0026lt; 0.01, Student’s t-test).\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/246bfd45e1ac5c4bb579c6d1.png"},{"id":85571186,"identity":"a368f0b8-19c0-4e32-b3f7-1e46acae9618","added_by":"auto","created_at":"2025-06-27 16:16:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":20382385,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6855119/v1/f7d9ef70-a9f2-4bf6-8ad6-e786d5e54671.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genome-Wide Characterization of the VfBES1 Gene Family in Vernicia fordii Unveils Lineage- Specific Regulatory Innovations in Floral Development","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe Tung tree (\u003cem\u003eVernicia fordii\u003c/em\u003e Hemsl.), a perennial woody plant of the Euphorbiaceae family, is one of the world's most significant oilseed crops. Its oil, rich in triacylglycerol, is extensively utilized for biodiesel production, industrial paints, and pharmaceutical products [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, the Tung tree's reproductive efficiency is relatively low, a result of insufficient understanding of the molecular regulatory network governing reproductive development. Recent studies on plant genomics have revealed that lineage-specific gene family expansion and functional diversification are crucial in regulating reproductive traits in non-model woody perennials [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eBES1\u003c/em\u003e gene family, a subgroup of the transcription factor family, was first identified for its crucial role in regulating genes mediated by Brassinosteroids (BR) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This family consists of six highly homologous members: \u003cem\u003eBES1\u003c/em\u003e, \u003cem\u003eBZR1\u003c/em\u003e, \u003cem\u003eBEH1\u003c/em\u003e, \u003cem\u003eBEH2\u003c/em\u003e, \u003cem\u003eBEH3\u003c/em\u003e, and \u003cem\u003eBEH4\u003c/em\u003e [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The transcription factors involved in the detection of BR signals play a crucial role in regulating a wide array of growth and developmental processes in plants. These processes encompass cell elongation and division, leaf and root growth, vascular tissue differentiation, floral initiation, stamen fertility, stress tolerance, and senescence [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Notably, in another development, the \u003cem\u003eBES1\u003c/em\u003e gene family serves as downstream transcription factors within the TPD1-EMS1/SERK1/2 signaling pathway, playing an integral role in plant reproduction by modulating tapetum development [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Furthermore, the \u003cem\u003eBES1\u003c/em\u003e gene family regulates the expression of key genes such as \u003cem\u003eDYSFUNCTIONAL TAPETUM1\u003c/em\u003e (\u003cem\u003eDYT1\u003c/em\u003e) and \u003cem\u003eMALE STERILITY1\u003c/em\u003e (\u003cem\u003eMS1\u003c/em\u003e), which are instrumental in pollen sac development and pollen spore production [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The \u003cem\u003eBES1\u003c/em\u003e gene family has been identified in several crops, including Arabidopsis, rapeseed, cotton, maize, and tomato [\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, its characterization in woody species remains relatively underexplored. Therefore, investigating the functions of \u003cem\u003eBES1\u003c/em\u003e gene family members in Tung tree is of particular importance for enhancing our understanding of their roles in perennial plants.\u003c/p\u003e \u003cp\u003eThis study represents the first genome-wide identification and functional characterization of the \u003cem\u003eVfBES1\u003c/em\u003e gene family in Tung tree. By using integrative multi-omics approaches, we have clarified the phylogenetic divergence, gene duplication history, and promoter cis-element architectures of \u003cem\u003eVfBES1\u003c/em\u003e paralogs. Time-resolved transcriptome profiling at key floral developmental stages revealed stage-specific regulation of \u003cem\u003eVfBES1\u003c/em\u003e expression during floral transition, organogenesis, and gametophyte development. These findings deepen our understanding of evolutionary innovation and regulatory specialization of \u003cem\u003eBES1\u003c/em\u003e homologs in woody plants and provide usable genetic targets for precise breeding to improve flowering synchrony, inflorescence architecture, and seed productivity in Tung tree. Our study provides a comparative framework for reproductive development studies in non-model woody perennials.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Plant materials\u003c/h2\u003e \u003cp\u003eThe Tung trees used in this study were cultivated in the experimental area of Central South University of Forestry and Technology, located in Qingping Town, Yongshun County, Hunan Province.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.2 Identification and Classification of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003eGenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe Tung tree genome, obtained from the NCBI (BioProject: PRJNA503685), was analyzed to identify \u003cem\u003eVfBES1s\u003c/em\u003e genes. A Hidden Markov Model (HMM) profile corresponding to the BES1 domain (PF05687) was retrieved from the Pfam database [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Using TBtools, the genome was scanned with an e-value threshold of \u0026lt;\u0026thinsp;1.0 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;10\u003c/sup\u003e to ensure stringent identification of candidate genes [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Putative \u003cem\u003eVfBES1s\u003c/em\u003e sequences were further validated for domain integrity using SMART, Pfam, and Conserved Domain Database (CDD) analyses. Subcellular localization predictions were performed via BUSCA, while physicochemical properties (molecular weight, isoelectric point, grand average of hydropathicity) were computed using ExPASy ProtParam [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.3 Phylogenomic Reconstruction, Conserved Motif Analysis, and Gene Structure Analysis\u003c/h3\u003e\n\u003cp\u003eThe ClustalW was used for multiple alignments of \u003cem\u003eVfBES1s\u003c/em\u003e, and the phylogenetic tree was constructed using MEGA7.0 software based on the neighbor-joining method (NJ) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The iTOL online software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps:/itolembl.de/\u003c/span\u003e\u003cspan address=\"https://itolembl.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was employed to beautify the phylogenetic tree. When analyzing the conserved motifs of \u003cem\u003eVfBES1s\u003c/em\u003e, the maximum number of motifs was set to 10, and the Multiple Expectation Maximization for Motif (MEME) was used to evaluate the conserved motifs of \u003cem\u003eVfBES1s\u003c/em\u003e with default parameters. Finally, the gene structure saved in the gff3 file and the conserved motifs in the eXtensible Markup Language (xML) file were input into the TBtools software to visualize the exon-intron assignments and types of conserved motifs. The TBtools software was used for the gene structure analysis of \u003cem\u003eVfBES1s\u003c/em\u003e in the general feature format version 3 (gff3) annotation file of Tung tree.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.4 Chromosomal Localization and Collinearity Analysis of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003eGenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe chromosomal localization information was included in the gff3 annotation files, and all \u003cem\u003eVfBES1s\u003c/em\u003e genes were mapped and visualized by TBtools. Gene duplication includes whole genome duplication, segmental duplication, out-of-linkage duplication using the Multiple Collinearity Scanning toolkit MCScanX in TBtools to assess \u003cem\u003eVfBES1s\u003c/em\u003e duplication events.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.5 Expression Pattern Analysis of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003ein Different Tissues\u003c/b\u003e\u003c/p\u003e \u003cp\u003eRoot, stem, leaf, female flower, male flower, and fruit samples were collected from the mature Tung tree during June to July. The RNA was extracted separately using Trizol reagent, then reverse transcribed into cDNA. The \u003cem\u003eVfEF1a\u003c/em\u003e gene was utilized as an internal control for analyzing the expression levels of \u003cem\u003eVfBESs\u003c/em\u003e genes in these samples via qRT-PCR (primer sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All experiments were conducted in triplicate and the relative expression levels were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. Origin 2022 software was employed for graph illustration.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primers of this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfEF1a-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTGGTATGGTTGTGACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfEF1a-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATCATCCTTGGAGTTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-1-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGTCAGCAGAATGGCTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-1-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAACCATGGGCCTTTGCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-2-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCTCTATCAGGTGCTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-2-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGCCTGCTGTGTTACTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-3-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCTCCTGCCATTCCAGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-3-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCTGGTTCTTGAGGTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-4-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTATGCCGTATCTGCCCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-4-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGGAGAGGTTGGCATTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-5-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGCAAGAGAGAGAGGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-5-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCAGCCTCAACAGTCCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-6-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCGAGAGAAGCTCATTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-6-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCGATGCCGCTCTCTTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-7-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGCTTCTTAACCGCTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfBES1-7-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGATGAGGTGATGCAGTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfMYB35-1-qPCR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAACACAAAACTAAGAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVfMYB35-1-qPCR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAACCAATGTTTCCATAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCAMBIA1300-GFP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCGGTACCCGGGGATCCATGGTGGGGGGTTCATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCAMBIA1300-GFP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGCTCACCATGTCGACGTTGTTAAGGGGCAGAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e2.6 Expression Patterns of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003eat Different Developmental Stages of Female and Male Flowers\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo characterize the expression patterns of \u003cem\u003eVfBES1s\u003c/em\u003e at different developmental stages of female and male flowers, RNA-seq data from four periods of flower development\u0026mdash;30 days before flowering (C1 and X1), 20 days before flowering (C2 and X2), 10 days before flowering (C3 and X3), and 0 days before flowering (C4 and X4)\u0026mdash;were analyzed. Transcript abundance (FPKM values) was quantified using HISAT2-StringTie pipeline. Heatmaps were generated in TBtools to visualize stage-specific.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.7 Subcellular Localization Analysis of\u003c/b\u003e \u003cb\u003eVfBES1-6\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eVfMYB35-1\u003c/em\u003e plays a pivotal role in the early degradation of male structures within female flowers. Interestingly, the expression pattern of \u003cem\u003eVfMYB35-1\u003c/em\u003e during the developmental stages of both female and male flowers aligns with that of VfBES1-6. Consequently, this research delved deeper into the interplay between \u003cem\u003eVfMYB35-1\u003c/em\u003e and \u003cem\u003eVfBES1-6\u003c/em\u003e. Utilizing the BUSCA software for analysis revealed that the VfBES1-6 protein is primarily located in the cell nucleus. To ascertain the precise subcellular localization of this gene, a fusion expression vector, \u003cem\u003eVfBES1-6-\u003c/em\u003e pCAMBIA1300-GFP, was crafted and subsequently introduced into the protoplasts of the Tung tree. The localization of VfBES1-6 was then visualized using a confocal microscope. Furthermore, we conducted real-time fluorescent quantitative analysis on the successfully transformed protoplasts.\u003c/p\u003e"},{"header":"Result","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Identification and Physicochemical Property Analysis of the Tung tree BES1 Genes\u003c/h2\u003e \u003cp\u003eThrough the analysis of the whole genome data of Tung tree, seven candidate genes containing the BES1 domain were identified in Tung tree. All seven members passed the verification of SMART, NCBI-CDD, and PFAM websites. They were named \u003cem\u003eVfBES1-1\u003c/em\u003e to \u003cem\u003eVfBES1-7\u003c/em\u003e based on their physical location order on the Tung tree chromosome (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The physicochemical property analysis results of the \u003cem\u003eVfBES1s\u003c/em\u003e protein showed that the sequence length ranged from 780-34359 bp, the molecular weight distribution ranged from 24643.38-79044.11 Da, and the isoelectric point varied between 5.44\u0026ndash;9.10. Subcellular localization prediction indicated that this gene family is located in the nucleus.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePhysiological and biochemical characterization of VfEBS1s proteins in Tung tree\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChromosome\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eStart site\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnd site\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLength/AA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMW(Da)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003epl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eSubcellular localization\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf01g00271\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3353380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3354890\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1511\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e34340.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf06g02665\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e96839318\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e96844248\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4931\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e79044.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e5.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf07g00352\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e42811492\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e42845850\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e34359\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e77223.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e5.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf07g01244\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e80614690\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e80618447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3758\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e38102.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e7.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf09g02058\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e96848203\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e96849693\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1491\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e34038.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e9.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf10g00729\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e69887734\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e69888513\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e780\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e24643.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVfBES1-7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVf11g00439\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChr11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55494194\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e55498222\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4029\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e35274.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2 Phylogenetic, Conserved Motif analysis and Gene Structure Analysis of\u003c/b\u003e \u003cb\u003eVfBES1\u003c/b\u003e \u003cb\u003eGene Family\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe phylogenetic tree was constructed using the 7 selected Tung tree VfBES1s protein sequences. The results showed that the VfBES1s genes in Tung tree can be divided into three branches. Conserved motif analysis results showed that the number of conserved motifs in the \u003cem\u003eVfBES1s\u003c/em\u003e gene family of Tung tree ranged from 2 to 8, among which Motif1 and Motif2 appeared in all genes, indicating that these two motifs are highly conserved. In addition, Motif3 appeared in 6 \u003cem\u003eVfBES1s\u003c/em\u003e genes. \u003cem\u003eVfBES1s\u003c/em\u003e proteins within the same branch have similar motif compositions, for example, the most closely related VfBES1-2 and VfBES1-3 both contain Motif1, Motif2, Motif3, Motif6, Motif7, Motif8, and Motif9, while VfBES1-1, VfBES1-4, VfBES1-5, and VfBES1-7 all contain Motif1, Motif2, Motif3, Motif4, Motif5, and Motif10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Gene structure analysis results showed that \u003cem\u003eVfBES1s\u003c/em\u003e genes contain a maximum of 2 introns, and 8 genes lack introns, among which the proteins of clade1 all lack introns, indicating that the VfBES1s genes of clade1 have simpler gene structure characteristics. Gene structure analysis results showed that \u003cem\u003eVfBES1s\u003c/em\u003e genes contain a maximum of 1 intron, and 6 genes lack introns, among which \u003cem\u003eVfBES1-6\u003c/em\u003e has simpler gene structure characteristics.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3 Cis-acting Elements in the Promoter of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003eGene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo understand the pathways in which the \u003cem\u003eVfBES1s\u003c/em\u003e gene is involved in signal transduction in Tung tree, the cis-acting elements of the 2000 bp promoter region upstream of the ATG of 7 \u003cem\u003eVfBES1s\u003c/em\u003e genes were analyzed through the PlantCARE website. The results showed that the promoter region of the VfBES1s gene contains a series of important growth and abiotic stress response elements, such as: auxin, gibberellin, light reaction, and low temperature response elements (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These predicted results indicate that the \u003cem\u003eVfBES1s\u003c/em\u003e family may be involved in responses to hormone signal transduction and environmental stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4 Chromosomal Location Analysis of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003eGene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe 7 \u003cem\u003eVfBES1s\u003c/em\u003e genes are unevenly distributed across the 6 chromosomes of the Tung tree. Specifically, chromosome 7 carries 2 \u003cem\u003eVfBES1s\u003c/em\u003e genes, while chromosomes 1, 6, 9, 10, and 11 each have 1 VfBES1 gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). No \u003cem\u003eVfBES1s\u003c/em\u003e genes were found on the other chromosomes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.5 Analysis of Gene Duplication Relationships and Collinearity in\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003eGenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further analyze the evolutionary relationship of the Tung tree genes, a genomic intra-duplication event analysis was conducted. The results showed that there are 2476 collinear genes among the Tung tree genes, of which two pairs of collinear gene pairs exist between \u003cem\u003eVfBES1s\u003c/em\u003e genes: \u003cem\u003eVfBES1-1\u003c/em\u003e/\u003cem\u003eVfBES1-5\u003c/em\u003e and \u003cem\u003eVfBES1-4\u003c/em\u003e/\u003cem\u003eVfBES1-7\u003c/em\u003e, indicating that gene duplication events have occurred in the \u003cem\u003eVfBES1s\u003c/em\u003e gene family (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.6 The Expression Patterns of\u003c/b\u003e \u003cb\u003eVfEBS1s\u003c/b\u003e \u003cb\u003eAcross Various Tissues\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe expression patterns of \u003cem\u003eVfEBS1s\u003c/em\u003e genes exhibited marked variations across diverse tissues. Specifically, \u003cem\u003eVfEBS1-1\u003c/em\u003e was predominantly expressed in the female flower and fruit, displaying a significant difference in expression level between male and female flowers (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). This underscores its potential role in sex determination. \u003cem\u003eVfEBS1-2\u003c/em\u003e was predominantly expressed in the fruit, indicating a possible association with fruit development (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Conversely, \u003cem\u003eVfEBS1-3, VfEBS1-4, VfEBS1-5, VfEBS1-6\u003c/em\u003e and \u003cem\u003eVfEBS1-7\u003c/em\u003e were primarily expressed in the root, suggesting these genes may be linked to the growth stability and stress resistance of the Tung tree (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D, E, F, G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.7 Expression Patterns of\u003c/b\u003e \u003cb\u003eVfBES1s\u003c/b\u003e \u003cb\u003ein Different Flowering Phases\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo elucidate the potential functions of \u003cem\u003eVfBES1s\u003c/em\u003e in flower development, the expression patterns of \u003cem\u003eVfBES1s\u003c/em\u003e in different developmental stages of female and male flowers in Tung tree were explored through transcriptome data analysis. We screened 7 differentially expressed \u003cem\u003eVfBES1s\u003c/em\u003e genes from the transcriptome database, and the expression characteristics of these genes revealed their possible roles in the process of flower development. The results showed that \u003cem\u003eVfBES1-1\u003c/em\u003e and \u003cem\u003eVfBES1-7\u003c/em\u003e maintained high expression throughout the development of female and male flowers, and in addition, these three genes, \u003cem\u003eVfBES1-3\u003c/em\u003e, \u003cem\u003eVfBES1-4\u003c/em\u003e, and \u003cem\u003eVfBES1-5\u003c/em\u003e, had similar expression patterns, suggesting that these genes may play a vital role in the entire development process of flowers in Tung tree, and may be involved in regulating the core process of flower development (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, C, D, E, G). Notably, \u003cem\u003eVfBES1-2\u003c/em\u003e expressed higher levels in the X1\u0026ndash;X3 stage of male flower development than in the female flower (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). This discovery suggests that \u003cem\u003eVfBES1-2\u003c/em\u003e may play a more important role in the specific stages of male flower development and may be involved in regulating the unique processes or traits of male flower development. Whereas \u003cem\u003eVfBES1-6\u003c/em\u003e showed high expression levels in the early stages of both female and male flower development, indicating that this gene may play a key role in the initiation phase of flower development and may be involved in regulating the formation of flower buds or the early establishment of flower morphology.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e3.8 VfEBS1-6 Protein Localization in the Nucleus\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eVfBES1-6\u003c/em\u003e demonstrated pronounced expression characteristics during the initial stages (C1 and X1) of floral development in both sexes, subsequently diminishing rapidly in other developmental stages. Notably, this expression pattern closely aligns with that of \u003cem\u003eVfMYB35-1\u003c/em\u003e, as documented previously, underscoring the pivotal roles \u003cem\u003eVfBES1-6\u003c/em\u003e might serve during specific intervals of floral development. To elucidate its function further, subcellular localization experiments were conducted, revealing that the VfBES1-6 protein is exclusively localized within the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). To investigate potential interactions between VfBES1-6 and VfMYB35-1, the former was overexpressed in protoplasts via transformation assays. This resulted in a marked augmentation of \u003cem\u003eVfBES1-6\u003c/em\u003e expression in \u003cem\u003eOE-VfBES1-6\u003c/em\u003e relative to empty vector (\u003cem\u003eEV\u003c/em\u003e), concomitant with a noticeable alteration in \u003cem\u003eVfMYB35-1\u003c/em\u003e expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, C). This observation intimate potential interaction between \u003cem\u003eVfBES1-6\u003c/em\u003e and \u003cem\u003eVfMYB35-1\u003c/em\u003e. However, neither yeast one-hybrid nor two-hybrid assays confirmed any direct interaction between the two proteins. Consequently, this suggests that the regulatory mechanism governing the expression of \u003cem\u003eVfBES1-6\u003c/em\u003e and \u003cem\u003eVfMYB35-1\u003c/em\u003e during floral development is likely intricate, potentially entailing indirect interactions or the involvement of additional regulatory elements.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe genome-wide analysis of the \u003cem\u003eVfBES1\u003c/em\u003e gene family in the Tung tree has yielded crucial insights into the lineage-specific regulatory advancements that underpin floral development in woody perennials. In this study, we identified seven \u003cem\u003eVfBES1\u003c/em\u003e genes, uncovering phylogenetic divergence, gene duplication history, and cis-regulatory architectures. These findings collectively highlight the evolutionary dynamism of this transcription factor family. Furthermore, the expression dynamics of \u003cem\u003eVfBES1s\u003c/em\u003e across different floral developmental stages and tissues underscore their specialized roles in reproductive processes. These insights lay a solid foundation for improving Tung tree breeding strategies.\u003c/p\u003e \u003cp\u003eThe phylogenetic analysis grouped \u003cem\u003eVfBES1s\u003c/em\u003e into three clades, which was in accordance with the conserved motif compositions and structural simplicity of the clade-specific genes. Clade-specific motifs (Motif1 and Motif2 were universally retained across all paralogs) might contribute to functional conservation in BR signaling, whereas lineage-specific motifs (Motif4-10) may promote functional diversification. This divergence was similar to that in Arabidopsis and Brassica, where \u003cem\u003eBES1\u003c/em\u003e homologs acquired distinct regulatory roles through motif shuffling and neofunctionalization after duplication [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The occurrence of tandem and segmental duplication (\u003cem\u003eVfBES1-1\u003c/em\u003e/\u003cem\u003eVfBES1-5\u003c/em\u003e and \u003cem\u003eVfBES1-4\u003c/em\u003e/\u003cem\u003eVfBES1-7\u003c/em\u003e) indicated that recurrent duplication followed by subfunctionalization led to adaptive evolution of VfBES1s towards ecological or developmental constraints, which has also been reported in other woody perennials [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnalysis of promoter cis-elements has demonstrated an enrichment of hormone-responsive (auxin and gibberellin) and stress-related elements in \u003cem\u003eVfBES1s\u003c/em\u003e. This suggests their potential role in facilitating cross-talk between BR signaling and environmental adaptation. Notably, this is congruent with research conducted on \u003cem\u003eZea mays\u003c/em\u003e and \u003cem\u003eGossypium\u003c/em\u003e, where \u003cem\u003eBES1\u003c/em\u003e homologs have been found to integrate developmental cues with responses to abiotic stress [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The nuclear localization of \u003cem\u003eVfBES1-6\u003c/em\u003e, which is consistent with its function as a transcription factor, further bolsters its regulatory capacity in target gene activation during floral transitions.\u003c/p\u003e \u003cp\u003eAnalysis of spatiotemporal expression revealed tissue- and stage-specific functions of \u003cem\u003eVfBES1s\u003c/em\u003e. Preferential expression of \u003cem\u003eVfBES1-1\u003c/em\u003e in female flowers and fruits indicated its possible roles in sex determination and ovule development, similar to BES1-mediated stamen fertility in \u003cem\u003eArabidopsis\u003c/em\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Root-specific expression of \u003cem\u003eVfBES1-3\u003c/em\u003e to \u003cem\u003eVfBES1-7\u003c/em\u003e suggested their participation in root growth and stress tolerance, which extended the role of BES1 beyond reproductive development. Notably, VfBES1-6 showed highest expression during early floral development (C1/X1), which was quite similar to the temporal expression pattern of \u003cem\u003eVfMYB35-1\u003c/em\u003e, a male structure degeneration regulator [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Although no direct protein interaction was observed, their co-expression suggested potential synergistic or indirect regulation, which might be achieved by unknown upstream factors or chromatin modifiers. Similarly, in Arabidopsis, BES1 proteins regulate developmental programs via combinatorial interactions with MYB and bHLH transcription factors [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlthough these findings are significant, there are still some limitations. The lack of a direct interaction between \u003cem\u003eVfBES1-6\u003c/em\u003e and \u003cem\u003eVfMYB35-1\u003c/em\u003e in yeast assays indicates that their coordination might rely on intermediary proteins or epigenetic mechanisms. This warrants further investigation using chromatin immunoprecipitation (ChIP) or co-immunoprecipitation (Co-IP) studies. Moreover, the functional validation of the roles of \u003cem\u003eVfBES1s\u003c/em\u003e in floral development needs to be confirmed through CRISPR/Cas9-mediated knockout or overexpression in transgenic Tung trees.\u003c/p\u003e \u003cp\u003eIn conclusion, this study unravels the evolutionary history and regulatory diversification of \u003cem\u003eVfBES1s\u003c/em\u003e, and thus defines them as key regulators of reproductive development in Tung tree. Our integrative analyses on phylogenomic, expression and cis-regulatory data establish a basis for the strategic exploitation of \u003cem\u003eVfBES1s\u003c/em\u003e in molecular breeding for improved synchronization of flowering and seed production, and also allow comparative studies on BES1-mediated signaling in non-model woody species.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research work was supported by the Graduate Research Innovation Project of Hunan Province (Grant Nos.: CX20240709\u0026nbsp;and CX20220705)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthor Statement\u003c/p\u003e\n\u003cp\u003eChong Ge: wrote the paper, performed the experiments\u003c/p\u003e\n\u003cp\u003eJing Gao: contributed reagents, materials, analysis tools or data\u003c/p\u003e\n\u003cp\u003eZhang Lin: contributed reagents, materials, analysis tools or data\u003c/p\u003e\n\u003cp\u003eXiang Li: performed the experiments\u003c/p\u003e\n\u003cp\u003eJie Cao: analyzed and interpreted the data\u003c/p\u003e\n\u003cp\u003eJunjie Chen: conceived and designed the experiments\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research work was supported by the Graduate Research Innovation Project of Hunan Province (Grant Nos.: CX20240709\u0026nbsp;and CX20220705)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data of the genome sequencing of the tung tree are available at NCBI: PRJNA503685. The RNA-seq data is available at NCBI: SRX3843583, SRX3843584, SRX3843585, SRX3843586, SRX3843587, SRX3843588, SRX3843589, SRX3843590 and SRX3843591.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChen J, Wu Z, Li R, Huang D, Zhai W, Chen C. New insight into LncRNA-mRNA regulatory network associated with lipid biosynthesis using Hi-C data in seeds of tung tree (Vernicia fordii Hemsl). Ind Crops Prod. 2021;164:113321.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao H, Cao F, Thomas Klasson K. Characterization of reference gene expression in tung tree (Vernicia fordii). Ind Crops Prod. 2013;50:248\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M, Li W, Zhao G, Fan X, Long H, Fan Y, Shi M, Tan X, Zhang L. New Insights of Salicylic Acid Into Stamen Abortion of Female Flowers in Tung Tree (Vernicia fordii). Front Genet 2019, 10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLespinet O, Wolf YI, Koonin EV, Aravind L. The role of lineage-specific gene family expansion in the evolution of eukaryotes. Genome Res. 2002;12(7):1048\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao X, Li Q, Yin H, Qi K, Li L, Wang R, Zhang S, Paterson AH. Gene duplication and evolution in recurring polyploidization\u0026ndash;diploidization cycles in plants. Genome Biol. 2019;20(1):38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoun JH, Kim TW. Functional insights of plant GSK3-like kinases: multi-taskers in diverse cellular signal transduction pathways. Mol Plant. 2015;8(4):552\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin Y, Vafeados D, Tao Y, Yoshida S, Asami T, Chory J. A new class of transcription factors mediates brassinosteroid-regulated gene expression in Arabidopsis. Cell. 2005;120(2):249\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakashita H, Yasuda M, Nitta T, Asami T, Fujioka S, Arai Y, Sekimata K, Takatsuto S, Yamaguchi I, Yoshida S. Brassinosteroid functions in a broad range of disease resistance in tobacco and rice. Plant J. 2003;33(5):887\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen W, Lv M, Wang Y, Wang PA, Cui Y, Li M, Wang R, Gou X, Li J. BES1 is activated by EMS1-TPD1-SERK1/2-mediated signaling to control tapetum development in Arabidopsis thaliana. Nat Commun. 2019;10(1):4164.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Sun Y, Timofejeva L, Chen C, Grossniklaus U, Ma H. Regulation of Arabidopsis tapetum development and function by DYSFUNCTIONAL TAPETUM1 (DYT1) encoding a putative bHLH transcription factor. Development. 2006;133(16):3085\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilson ZA, Morroll SM, Dawson J, Swarup R, Tighe PJ. The Arabidopsis MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis, with homology to the PHD-finger family of transcription factors. Plant J. 2001;28(1):27\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang J, Zhang C, Wang X. A recently evolved isoform of the transcription factor BES1 promotes brassinosteroid signaling and development in Arabidopsis thaliana. Plant Cell. 2015;27(2):361\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong X, Ma X, Li C, Hu J, Yang Q, Wang T, Wang L, Wang J, Guo D, Ge W, et al. Comprehensive analyses of the BES1 gene family in Brassica napus and examination of their evolutionary pattern in representative species. BMC Genomics. 2018;19(1):346.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Qanmber G, Lu L, Qin W, Liu J, Li J, Ma S, Yang Z, Yang Z. Genome-wide analysis of BES1 genes in Gossypium revealed their evolutionary conserved roles in brassinosteroid signaling. Sci China Life Sci. 2018;61(12):1566\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng W, Zhang H, Cao Y, Liu Y, Zhao Y, Sun F, Yang Q, Zhang X, Zhang Y, Wang Y, et al. Maize ZmBES1/BZR1-1 transcription factor negatively regulates drought tolerance. Plant Physiol Biochem. 2023;205:108188.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Y, Hu J, Zhao T, Xu X, Jiang J, Li J. Genome-wide Identification and Expression Pattern Analysis of BRI1-EMS\u0026ndash;suppressor Transcription Factors in Tomato under Abiotic Stresses. J Am Soc Hortic Sci J Amer Soc Hort Sci. 2018;143(1):84\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa S, Ji T, Liang M, Li S, Tian Y, Gao L. Genome-Wide Identification, Structural, and Gene Expression Analysis of BRI1-EMS-Suppressor 1 Transcription Factor Family in Cucumis sativus. Front Genet. 2020;11:583996.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, et al. TBtools-II: A one for all, all for one bioinformatics platform for biological big-data mining. Mol Plant. 2023;16(11):1733\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGasteiger E, Hoogland C, Gattiker A, Duvaud Se, Wilkins MR, Appel RD, Bairoch A. Protein Identification and Analysis Tools on the ExPASy Server. In: \u003cem\u003eThe Proteomics Protocols Handbook.\u003c/em\u003e Edited by Walker JM. Totowa, NJ: Humana Press; 2005: 571\u0026ndash;607.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Vernicia fordii, BES1 gene family, floral development, gene duplication, multi-omics analysis","lastPublishedDoi":"10.21203/rs.3.rs-6855119/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6855119/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Tung tree (\u003cem\u003eVernicia fordii\u003c/em\u003e Hemsl.), a commercially significant oil-producing tree species. However, the molecular mechanisms governing floral sex determination remain elusive, particularly the genetic basis underlying the skewed female-to-male flower ratio and the evolutionary dynamics of sex-related gene families, which severely restricts targeted breeding for yield enhancement. The \u003cem\u003eBES1\u003c/em\u003e transcription factor family, which plays a crucial role in Brassinosteroid (BR) signaling and reproductive development, is particularly underexplored in woody perennials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, we introduce the first genome-wide identification and functional characterization of the \u003cem\u003eVfBES1\u003c/em\u003e gene family in the Tung tree. Integrative multi-omics approaches have revealed seven \u003cem\u003eVfBES1\u003c/em\u003e genes, clustered into three phylogenetically distinct clades, each characterized by lineage-specific motifs and structural simplicity. Segmental duplication events (\u003cem\u003eVfBES1-1\u003c/em\u003e/\u003cem\u003eVfBES1-5\u003c/em\u003e and \u003cem\u003eVfBES1-4\u003c/em\u003e/\u003cem\u003eVfBES1-7\u003c/em\u003e) and promoter cis-element enrichment (hormone-responsive and abiotic stress-related motifs) highlight evolutionary innovation and functional diversification. Spatiotemporal expression profiling reveals tissue- and stage-specific roles: \u003cem\u003eVfBES1-1\u003c/em\u003e was predominantly expressed in female flowers and fruits, suggesting potential involvement in sex determination. Conversely, \u003cem\u003eVfBES1-2\u003c/em\u003e and \u003cem\u003eVfBES1-6\u003c/em\u003e exhibited male flower-specific and early floral developmental activation, respectively. Nuclear-localized \u003cem\u003eVfBES1-6\u003c/em\u003e displayed co-expression with \u003cem\u003eVfMYB35-1\u003c/em\u003e, a regulator of male structure degeneration, although no direct interaction was detected.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThese findings shed light on the regulation of \u003cem\u003eVfBES1s\u003c/em\u003e in floral development, offering a reference for precision breeding to enhance flowering synchrony and seed productivity in the Tung tree. This study provides a comparative framework for understanding lineage-specific \u003cem\u003eBES1\u003c/em\u003e functions in non-model woody plants.\u003c/p\u003e","manuscriptTitle":"Genome-Wide Characterization of the VfBES1 Gene Family in Vernicia fordii Unveils Lineage- Specific Regulatory Innovations in Floral Development","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-27 15:51:55","doi":"10.21203/rs.3.rs-6855119/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-07-08T23:23:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-05T04:15:53+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-30T08:22:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"167231126217232372995871745758341982391","date":"2025-06-30T03:56:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"322831215062063259956409037573060401859","date":"2025-06-28T02:49:41+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-24T01:40:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-23T22:53:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-23T02:26:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2025-06-23T02:22:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5947af8b-2c49-4a35-9604-6623613ee150","owner":[],"postedDate":"June 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-09-03T14:38:34+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-27 15:51:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6855119","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6855119","identity":"rs-6855119","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.