Study on the effect of N-carbamylglutamate (NCG) on reproductive performance and regulation mechanism of primary lake sheep

Study on the effect of N-carbamylglutamate (NCG) on reproductive performance and regulation mechanism of primary lake sheep | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Study on the effect of N-carbamylglutamate (NCG) on reproductive performance and regulation mechanism of primary lake sheep TianLi Gao, ChunYang Li, JuanShan Zheng, YingPai Zhaxi, Yuan Cai, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7371628/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective To investigate the effects of dietary supplementation with 0.11% N-carbamylglutamate (NCG) during early pregnancy (0–90 days) on reproductive performance and fetal development, as well as to elucidate the underlying molecular mechanisms in primiparous Hu sheep. Methods Twelve 10-month-old sexually mature primiparous Hu sheep meeting the mating criteria were randomly assigned to two groups. The control group was fed a basal diet, while the NCG group received the basal diet supplemented with 0.11% NCG, with both feeding regimens maintained for 90 days. Through measurements of uterine and fetal growth indices, maternal plasma biochemical parameters, and amino acid levels, as well as assessments of cotyledon indices, observations of cotyledon morphology and histological structure, and transcriptomic sequencing of maternal placental tissue, the mechanism by which NCG influences placental function and fetal growth and development in pregnant ewes was investigated.. Results Dietary supplementation with NCG significantly increased fetal number, total fetal weight, corpus luteum count, fetal-to-luteum ratio, plasma levels of NO, iNOS, and concentrations of several amino acids ( P < 0.05). In ewes' uteri, the average uterine weight, number of uterine glands, total cotyledon weight, and average weight per cotyledon were significantly increased ( P < 0.05), whereas uterine mucosal thickness was markedly decreased. The q-PCR results for differentially expressed genes were consistent with those of transcriptomic analysis, showing significant changes in the expression levels of certain differentially expressed genes in maternal placental tissues. These changes regulated pathways such as VEGF, IGF, PI3K-AKT and MAPK, which are involved in angiogenesis, energy supply and metabolism, and somatic growth and development.. Conclusion Dietary supplementation with NCG during early pregnancy can significantly improve the reproductive performance of primiparous Hu sheep, optimize the intrauterine environment and nutrient supply, and thereby facilitate pregnancy maintenance and fetal development. The underlying mechanism may involve promoting endogenous arginine synthesis in ewes, increasing plasma levels of NO, arginine, and certain amino acids, which collectively validate the positive effects of NCG on the reproductive performance and growth of Hu sheep during early pregnancy at the molecular level. Hu sheep N-carbamylglutamate (NCG) Transcriptomic sequencing Reproductive performance Fetal development Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1 Introduction China boasts a rich diversity of sheep and goat breeds, among which Hu sheep—a renowned multiparous breed [ 1 ] —have garnered significant attention due to their superior meat quality and high reproductive rate [ 2 ] . However, Hu sheep ewes are prone to issues such as intrauterine growth restriction (IUGR) owing to their small body size, high fecundity, and early mating age, which in turn impairs reproductive efficiency. Arginine (Arg), a functional amino acid, plays a pivotal role in animals. It serves as a precursor for the synthesis of proteins, nitric oxide (NO), polyamines, and other substances in the body [ 3 ] . As a signaling molecule, NO can enhance vascular dilation, thereby increasing blood flow [ 4 ] , and exerts positive effects on somatic growth and development, intestinal immunity, and hormone regulation. Arginine also contributes positively to maternal placental development and maternal-fetal material exchange [ 5 , 6 ] . However, the widespread application of arginine is limited by its relatively high cost and susceptibility to degradation by rumen microorganisms in ruminant diets [ 7 ] . Thus, identifying a cost-effective and efficient arginine substitute is of particular importance. N-carbamylglutamate (NCG), as an activator of carbamyl phosphate synthetase-1 (CPS-I)—an essential cofactor for endogenous Arg synthesis [ 8 ] —can promote endogenous Arg production. Compared with Arg, NCG is more cost-effective, less susceptible to degradation by digestive enzymes, and exerts significant effects even at low doses. Studies in monogastric animals have demonstrated that dietary NCG supplementation during pregnancy can reduce embryonic mortality [ 9 ] , improve pregnancy rates and litter sizes [ 10 ] , enhance placental vascular function [ 11 ] , and facilitate the provision of more nutrients and oxygen by the mother to fetal tissues [ 12 ] , thereby improving reproductive performance. In ruminants, studies have also shown that NCG can significantly increase the birth weight and growth performance of newborn lambs [ 13 ] , exerting a positive impact on reproductive outcomes. Therefore, this study investigated the effects of feeding 0.11% NCG to primiparous ewes during early pregnancy (days 0–90) on improving reproductive performance and fetal development. Its regulatory mechanisms were further explored through measurements of uterine and fetal development indices, plasma biochemical parameters, hematoxylin and eosin (H&E) staining, and transcriptome sequencing of maternal placental tissue. 2 Methods Ethical Statement All animal experiments in this study were approved by Lanzhou Qilihe Wanshan Cooperative and fully approved by the Animal Ethics Committee of College of Life Science and Engineering, Northwest Minzu University (xbmu-sm-2021060). Animals and Design This experiment was carried out in Wanshan Cooperative of Qilihe District, Lanzhou. The subjects were from Wanshan Planting and Breeding Professional Cooperative of Qilihe District, Lanzhou. Twelve healthy 10-month-old purebred primiparous Hu sheep ewes were randomly allocated to two groups. The control group was fed a basal diet, formulated in accordance with the nutrient requirements for 40-kg pregnant ewes specified by the NRC (2004), the composition and nutritional level of the diet are shown in Table 1. The experimental group received the basal diet supplemented with 0.11% NCG, with the dosage determined based on preliminary trials. A 10-day adaptation period was followed by a 90-day experimental feeding period. All ewes were mated via estrus synchronization and artificial insemination, with the mating day designated as day 0. The initial body weight of the ewes was 41.46 ± 4.72 kg. On day 35 of gestation, pregnancy diagnosis was performed using B-mode ultrasound to determine the conception rate and estimate the number of fetuses per litter. Table 1. Composition and nutrient levels of diets (dry matter basis) Items Ingredient (%) Corn 9.84 Wheat bran 2.53 Soybean meal 4.26 Salt 0.08 Premix 0.39 NaHCO3 0.08 CaHPO4 0.08 Alfalfa 44.86 Whole corn silage 37.88 Total 100 Nutrient levels DE（MJ·kg -1 ） 10.98 CP（MJ·kg -1 ） 16.08 Ca（MJ·kg -1 ） 1.30 TP（MJ·kg -1 ） 0.34 Premix provided per kg of diet: VA: 1637.21 IU, VD₃: 388.84 IU, VE: 15.35 IU, niacin: 4.91 mg, Fe: 40.93 mg, Cu: 6.14 mg, Zn: 24.56 mg, Mn: 30.70 mg, I: 0.29 mg, Se: 0.10 mg, Co: 0.03 mg, Mg: 102.33 mg, Ca: 1023.26 mg, TP: 204.65 mg, NaCl: 1023.26 mg. Measurement of Uterine and Fetal Indices On day 90 of gestation, the ewes were euthanized by electrical stunning following venous blood collection. After excising the uterus, the following indices were measured and recorded: total cotyledon weight, fetal height, fetal length, amniotic fluid volume, weights of various organs, average uterine weight, total litter weight, average individual cotyledon weight, fetal-to-corpus luteum ratio, and relative weights of fetal organs (relative to fetal body weight). Blood Index Measurement On day 90 of pregnancy, blood samples were collected from the jugular vein into Heparin sodium tubes. Samples were placed on ice and immediately centrifuged at 3500 g for 10min at 4℃. Serum was separated and stored at −80℃until analysis. The NO, nitric oxide synthase (NOS), blood ammonia, estrogen (E2), and progesterone (PROG) were analyzed using ELISA kits from Nanjing Jiancheng (Jiangsu, China), and the amino acid content was also measured by S-433D type automatic amino acid analyzerfrom Nanjing Jiancheng (Jiangsu, China). Cotyledon HE Staining Index Measurement Cotyledons from each ewe's placenta were randomly cut and fixed in 4% polyformaldehyde solution, embedded and cut into 5 micron slices. After fixation, the samples were transferred to 70% ethanol for long-term storage until subsequent treatment. The morphology of the excised cotyledons was observed, and then histological analysis was performed by measuring capillary density, thickness of uterine mucosa and count of uterine glands by HE staining. Transcriptome Sequencing Analysis After slaughtering the sheep on day 90, maternal placental tissue from the uterus was quickly collected. Maternal placental tissue at the base of the small curvature of the uterine horn was cut with sterilized surgical scissors into 5-10 mm³ pieces, washed with PBS, placed in cryotubes, and stored in liquid nitrogen. Three female sheep samples were randomly selected from both the NCG experimental group and the control group for transcriptome sequencing using the BGISEQ500 platform. The 260/280 OD values of samples between 1.8 and 2.0 were selected for further analysis. The qualified RNA was used for library construction. The transcriptome data sequencing was statistically analyzed using the BGI DNBSEQ platform; the data were filtered using SOAPnuke software. Raw reads were firstly processed using fastp and the low-quality reads were removed. The indexes based on Burrows-Wheeler transform and Ferragina-Manzini (FM) adopt two forms of genome-wide and local genome indexes to efficiently compare clean reads. The genome was compared using Hierarchical Indexing for Spliced Alignment of Transcripts (HISAT) [14] and Bowtie2 [15] software. Gene expression levels of each sample were calculated using RSEM software. Differential expression analysis was performed between the NCG experimental group and the control group using DESeq2 software [16] . Differentially expressed genes (DEGs) were identified using the criteria of adjusted P-value (padj) < 0.05 and |log2 (fold change)| ≥ 1. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) [17] (Kanehisa et al., 2007) pathway enrichment analysis of DEGs were respectively performed using R based on the hypergeometric distribution. Genes with P-value 1.5 were considered differentially expressed. Real-Time Quantitative PCR Quantitative real-time-PCR (RT-qPCR) was used to detect the mRNA levels of twelve genes. The same RNA samples were used for reverse transcription using a reverse transcriptase kit to synthesize first-strand cDNA. Primer Express Software v2.0 were used to design the primers and are detailed in Table 2. GAPDH was used as the standardized reference gene, and the relative expression level was calculated by 2 - ΔΔ Ct . Table 2. Primer information Q - PCR primers The sequence（5’-3’） TM AOX 1-F TGTGCTGGTGACTCACGGTG 59 AOX 1-R CCCGGAGGTGGATACTGGAC TPH 2-F TCTGCTGACGAAACACTGCG 59 TPH 2-R TCCCGAGGACTCAGGTACCC MMP 2-F CGGCATCTCTCAGATCCGTG 59 MMP 2-R CTTTTCCGGTAGCTCAGGCC SPP 1-F CCAAGGAGGAAAGCAAGCAT 59 SPP 1-R GGATTTTCAGGCGCTTGTCT CDA -F GTTGCTGCTGTCCTGCCAAG 59 CDA -R TTGCACCCGGAGAAGATCCT SEPHS 2-F CTCCTGCGTCATACCCCTGA 59 SEPHS 2-R CGATGCGCCCCATCATATAG FLT 1-F GCCTGCCGAGCTAGGAACAT 59 FLT 1-R GTGCGGTCACTGAGGTTTCG THBS 2-F CGACCTCTTCAGCCTCAGCA 59 THBS 2-R TAGTCAAAGCGGACGAAGCG CACNA1A -F GTTTGAGAAAGATTGCCGCG 59 CACNA1A -R GCCCACAGCACGTTGTCATA MAP3K5 -F GTCAGGTCCAGGTGGTGCTC 59 MAP3K5 -R CCGCCTTTCGGATGATACTG CNR 1-F CTCGGACTGCCTGCACAAAC 59 CNR 1-R AGACATGGTCACCTTGGCGA NDUFA 7-F GAGACTTGCAGGCGAAACTG 59 NDUFA 7-R GTTGGAGAGTCTGTGGCTGG Data Statistics and Analysis Experimental data were statistically analyzed using SPSS 23.0, and intergroup differences were tested by t-test. Data are presented as means ± SEM. P 1.5 and P <0.05 between the two groups were classified as DEGs. 3 Results Effects of NCG Supplementation on Uterine and Fetal Index Development in Ewes during Early Pregnancy As shown in Table 3, no significant differences were observed between the two groups in terms of average uterine weight, number of fetuses, birth weight, average fetal weight, number of corpora lutea, or fetal-corpus luteum ratio ( P > 0.05). Notably, all indices except for average fetal weight exhibited an increasing trend relative to the control group, suggesting that NCG may promote fetal development in the uterus of ewes. Table 3. Effects of NCG on uterine weight, fetal index, and corpus luteum index Items Contril group NCG group Uterine average weight 3.54±0.85 4.21±0.62 Number of fetuses 1.80±0.45 2.17±0.41 litter fetal weight 918.99±241.09 1084.21±196.58 Fetal average weight 525.14±62.38 500.40±38.90 Corpus Luteum Count 2.20±0.84 2.33±0.52 Fetal luteal ratio 0.87±0.18 0.94±0.14 As presented in Table 4, no significant differences ( P > 0.05) were detected between the NCG-treated group and the control group with respect to fetal body dimensions or organ weights. These findings indicate that dietary supplementation with NCG during early pregnancy does not exert an influence on fetal body size parameters or internal organ weights. Table 4. Effects of NCG on fetal body size and organ weight Items Contril group NCG group body length 16.80±0.84 16.25±0.76 withers height 16.97±1.05 17.07±1.22 Brain weight ratio 26.43±2.45 27.34±1.62 Gastric weight ratio 14.87±1.32 14.61±1.72 Liver compared to 61.64±3.98 61.49±2.89 Kidney ratio 12.58±0.88 12.38±1.26 Lung size ratio 38.11±3.01 37.72±3.04 Effects of Dietary NCG Supplementation on Blood Biochemical Indices and Amino Acid Content in Ewes during Early Pregnancy As depicted in Table 5, the plasma levels of NO and inducible nitric oxide synthase (iNOS) in ewes from the NCG-treated group were significantly higher than those in the control group ( P < 0.05), while progesterone levels in the treated group exhibited an increasing trend relative to the control group. No significant differences were observed between the two groups in terms of blood ammonia, estradiol, total nitric oxide synthase (TNOS), or endothelial nitric oxide synthase (eNOS) levels ( P > 0.05). These results indicate that dietary supplementation with NCG during early pregnancy can significantly increase plasma concentrations of NO and iNOS in ewes. Table 5. Effects of NCG on plasma NO, NOS, ammonia, and hormone contents in ewes on day 90 Items Contril group NCG group NO（umol·L -1 ） 11.51±2.09 b 14.69±2.29 a blood ammonia（umol·L -1 ） 120.43±14.83 128.12±9.68 PROG（ng·mL -1 ） 4.86±0.25 5.22±0.33 E2（ng·L -1 ） 32.06±1.96 33.22±2.00 TNOS（U·mL -1 ） 16.80±1.05 15.76±1.46 eNOS（U·mL -1 ） 11.76±1.90 12.62±1.55 iNOS（U·mL -1 ） 8.64±0.90 b 10.50±1.06 a As presented in Table 6, the plasma concentrations of glutamic acid, alanine, leucine, arginine, and proline were significantly higher in the NCG-treated group compared to the control group ( P 0.05). These findings suggest that dietary supplementation with NCG during early pregnancy can influence the plasma concentrations of certain amino acids in ewes. Table 6. Effects of NCG on plasma amino acid content in ewes on day 90 Items(umol/L) Contril group NCG group Asp 7.27±1.27 12.44±9.17 Thr 39.70±7.97 62.68±28.46 Ser 75.92±25.47 87.21±14.78 Asn 50.05±12.06 65.70±14.94 Glu 119.96±19.64 b 149.82±21.50 a Gly 522.81±89.83 613.62±100.39 Ala 308.93±13.01 b 356.55±33.92 a Cit 195.76±38.79 184.20±54.09 Val 141.04±16.47 146.09±41.23 Met 41.85±2.23 45.59±5.20 Ile 87.57±13.15 101.85±10.72 Leu 122.05±9.98 b 143.93±14.73 a Tyr 70.17±14.31 74.85±9.30 Phe 29.33±3.81 30.68±5.91 His 51.16±6.80 59.68±11.42 Trp 596.12±60.53 600.05±49.37 Orn 53.52±11.27 70.24±23.49 Lys 272.05±34.54 285.61±42.33 Arg 167.55±29.46 b 207.81±27.21 a Pro 123.90±7.06 b 146.96±19.18 a Effects of NCG Supplementation on Cotyledon and HE Staining Indices in Ewes during Early Pregnancy As illustrated in Table 7, amniotic fluid volume in the NCG-treated group exhibited an increasing trend relative to the control group. No significant difference was observed between the NCG-treated group and the control group in terms of cotyledon number ( P > 0.05). However, both total cotyledon weight and average individual cotyledon weight in the NCG-treated group were significantly higher than those in the control group ( P < 0.05). These results suggest that NCG can enhance cotyledon development. Table 7. Effects of NCG on amniotic fluid volume and cotyledon indices Items Contril group NCG group Amniotic fluid volume 526.40±35.96 566.42±40.76 Number of cotyledons 88.00±15.43 88.67±14.09 total weight of cotyledons 641.00±74.53 b 777.50±79.98 a average weight of monocotyledons 7.38±0.85 b 8.84±0.77 a As demonstrated in Table 8, the uterine mucosal thickness in the NCG-treated group was significantly lower than that in the control group ( P 0.05). However, the number of uterine glands in the NCG-treated group was significantly higher than that in the control group ( P < 0.05). Table 8. Effects of NCG on mucosal thickness, capillary, and uterine gland indices in cotyledon Items Contril group NCG group thickness of the endometrial lining 422.76±116.18 a 256.59±94.59 b Number of capillaries 10.50±1.87 11.17±1.72 Number of uterine adenoma 19.00±2.65 b 26.33±3.06 a area of uterine glands 43454.43±5281.84 47283.32±5694.17 perimeter of uterine glands 955.25±97.80 923.11±94.35 Observation of Cotyledon Structure in Ewes on Day 90 of Pregnancy and Effects of NCG Supplementation on Its Development The anatomical features of the placenta and uterus in 90 pregnant ewes are illustrated in Figure 1. Hu sheep, as a multiparous breed, possess a cotyledonary placenta. The cotyledons are interconnected via an extensive network of uterine blood vessels, and maternal-fetal material exchange occurs through these cotyledon structures. The histological structure observation of cotyledon tissue in Hu Sheep in the 90th of pregnancy was observed as shown in Figure 2. As depicted in Figure 3, panel a shows the fetal placental component, while panels b and e represent the maternal placental components. Villi of the fetal allantochorion converge into villous clusters that are embedded within the maternal uterine mucosa. A key characteristic is that during pregnancy, cotyledons serve as the site of maternal-fetal material exchange, whereas the surfaces between cotyledons are generally smooth. As shown in Figure 2, four different cotyledon tissue parts (a, b, c and d) were selected for HE staining observation, and the results of HE staining are shown in Figure 4. Chorionic blood vessels: The cotyledons on day 90 contained a rich network of chorionic blood vessels, within which numerous red blood cells were visible. Vascular branches extended into the villous branches of the maternal placenta. Additionally, some underdeveloped blood vessels in the mesenchyme were small and remained in a closed state. Mesenchyme: The mesenchyme, distributed between chorionic blood vessels and the chorionic epithelium, consists of cells with star-shaped cytoplasmic processes and columnar or elliptical nuclei. These cells are interconnected to form a network structure. Chorionic epithelium: The chorionic epithelium is primarily composed of two cell types—binucleate cells and cuboidal cells—located on the surface of villous branches. In the cotyledonary chorionic epithelium of Hu sheep at 90 days of pregnancy, a large number of binucleate cells are widely distributed (Figure 5). Together, these cells form the surface structure of the fetal placenta, serving as a barrier between the fetus and the mother. Uterine lacunar epithelium: At 90 days of pregnancy, the nuclei of the uterine lacunar epithelial cells are small, and the cells are flattened with obvious nuclear clustering (Figure 5). It has been suggested that this structure arises from the fusion of chorionic epithelial binucleate cells and uterine lacunar epithelial cells [18] , and it plays a crucial role in maintaining pregnancy. Uterine connective tissue: As branching of the uterine lacunar epithelium increases, the connective tissue becomes sparsely distributed and forms narrow structures. In the uterine mucosal layer adjacent to the uterine wall, connective tissue fibers are densely packed and neatly arranged, with numerous uterine glands distributed throughout. Uterine blood vessels: In the cotyledons of Hu sheep at 90 days of pregnancy, uterine blood vessels are extensively distributed around the uterine mucosa and uterine glands, extending to the cup-like opening of the cotyledons. An abundance of uterine blood vessels is essential for ensuring normal fetal development. Sequencing Quality Control and Comparison Analysis The average data output per sample was 6.55 Gb. The average alignment rate of samples to the genome was 89.21%, with an average alignment rate of 63.90% to the gene set. Following quality control of the sequencing data, the average Q20 and Q30 values were 95.67% and 89.98%, respectively. These results demonstrate that the sequencing data are of high quality, high coverage, and reliability, making them suitable for subsequent differential analysis. Quantitative Analysis of Gene Expression Levels Based on the alignment results, a total of 14,174 genes were detected in the control group, while 14,127 genes were identified in the NCG-treated group. The distribution of gene expression levels (FPKM/TPM) across different samples is presented in a boxplot (Figure 6-D), which illustrates the median and interquartile range of expression values. As shown in Figure 6-B, the intra-group correlation of samples in both the control group and NCG-treated group was analyzed. The results revealed that the correlation coefficient (R²) within each group exceeded 0.7 and approached 1, indicating good experimental reproducibility and validating the reliability of subsequent analyses. Screening of Differentially Expressed Genes In the visualization (Figure 7-A), significantly upregulated genes are depicted in red, downregulated genes in blue, and non-significantly differentially expressed genes in gray. A total of 130 DEGs were identified, comprising 53 upregulated and 77 downregulated genes. GO Enrichment Analysis of Differentially Expressed Genes As illustrated in Figure 7-C, GO functional enrichment analysis was conducted on the DEGs identified between the control group and the NCG-treated group. A total of 45 significantly enriched GO terms were detected ( P < 0.05), encompassing 22 biological processes (BPs), 15 cellular components (CCs), and 8 molecular functions (MFs). The BPs were primarily enriched in cellular processes, regulation of biological processes, responses to stimuli, and metabolic processes; the CCs were enriched in cells, cellular parts, membranes, and extracellular regions; and the MFs were enriched in binding, catalytic activity, transport activities, and molecular function regulators. KEGG Enrichment Analysis of Differentially Expressed Genes As shown in Figure 7-D, the KEGG pathway analysis listed the top 20 significantly enriched pathways associated with the identified DEGs, sorted by adjusted P-value (padj < 0.05). These pathways were found to include ECM-receptor interaction, oxidative phosphorylation, folate biosynthesis, and other processes related to organismal growth, development, nutrient supply, angiogenesis, vasodilation, fetal development, and signal transduction. Among the enriched pathways, the VEGF, Notch, Wnt/β-catenin, and PI3K-AKT signaling pathways are involved in processes such as cell growth and death, transport and catabolism, signal transduction, and amino acid metabolism. Transcriptomic qPCR Validation To validate the RNA-seq results, 12 differentially expressed genes (DEGs) identified between the control group and the NCG-treated group—including 6 upregulated and 6 downregulated genes—were randomly selected for RT-qPCR analysis. As shown in Figure 7-B, the mRNA expression trends of all 12 validated genes were consistent with the RNA-seq data. Compared with the control group, the expression levels of AOX1 , MMP2 , SEPHS2 , THBS2 , CACNA1A , and MAP3K5 were significantly downregulated in the NCG-treated group, whereas those of TPH2 , SPP1 , CDA , FLT1 , CNR1 , and NDUFA7 were significantly upregulated. These validation results confirm the reliability of the transcriptomic sequencing data, supporting that the identified DEGs accurately reflect the gene expression differences between the two groups. 4 Discussion Effects of NCG Supplementation on Uterine and Fetal Development Indices in Ewes during Early Pregnancy The results of this study demonstrated that, compared with the control group, the NCG group showed significant improvements in uterine weight, number of fetuses, total litter weight, and average fetal weight. However, no significant differences were observed in fetal body measurements or relative organ weights between the two groups. These findings suggest that dietary supplementation with NCG enhances maternal reproductive performance without exerting adverse effects on fetal development. The observed increase in uterine weight indicates more pronounced uterine growth, which may help reduce the incidence of IUGR during late gestation. Interestingly, although the average fetal weight in the NCG group did not differ significantly from that in the control group, a notable upward trend was detected in amniotic fluid volume. This phenomenon may be attributed to NCG-induced alterations in amniotic fluid metabolismNakano [18] , which is consistent with previous reports by Wu [19] . Such metabolic modifications are likely to enhance nutrient supply in the maternal uterine environment, ensuring adequate nourishment for both the fetus and the mother, thereby improving embryonic survival rates. Effects of NCG Supplementation on Blood Indices in Ewes during Early Pregnancy Functional amino acids (FAAs) play critical roles in placental angiogenesis and development [20] . Among the most extensively studied FAAs involved in placental vascular regulation are arginine-family amino acids (including arginine, glutamic acid, proline, citrulline, and ornithine), leucine, and sulfur-containing amino acids. Notably, arginine exerts multifaceted biological functions, including promoting angiogenesis, enhancing nitrogen metabolism, stimulating lactation and growth, and improving reproductive performance in animals [21] . In the present study, dietary supplementation with NCG significantly increased plasma concentrations of Arg, glutamic acid, proline, and leucine in ewes. This finding supports the hypothesis that NCG, as a structural analog of N-acetylglutamate (NAG), activates the key enzyme CPS-I, thereby enhancing endogenous Arg synthesis [22] . These results are consistent with previous work by Zhang [12] , who reported that supplementing 20 g/d rumen-protected Arg (RP-Arg) and 5 g/d NCG under 50% feed restriction significantly increased plasma amino acid concentrations in Hu sheep. The observed elevation in amino acid levels may reflect synergistic interactions within the NCG metabolic pathway, which ultimately exert beneficial effects on the growth and physiological status of ewes. NO, hormones, and amino acids in maternal plasma play pivotal roles in regulating placental function and fetal development during pregnancy. NOS catalyzes the production of NO, with iNOS—a key isoform—capable of generating substantial NO levels under immune stimulation. As a potent vasodilator, NO is critical for maintaining placental vascular function and optimizing nutrient delivery to the fetus [23] . Elevated NO levels may thus enhance maternal growth and reproductive performance by improving uterine blood flow and nutrient supply. In the present study, the NCG-supplemented group exhibited significantly higher plasma concentrations of NO and iNOS compared to the control group. These findings are consistent with previous reports by Wang [24] , who observed a significant increase in plasma NO levels in lactating goats supplemented with 2 g/d NCG at 21 and 42 days postpartum. Furthermore, Zhang [25] demonstrated that NCG supplementation elevated plasma iNOS levels in IUGR lactating lambs, providing additional support for our results. Collectively, these data suggest that NCG enhances NO synthesis, potentially via iNOS activation, thereby improving placental vascular function and maternal-fetal nutrient exchange. Effects of NCG Supplementation on Cotyledon and HE Staining Indices in Ewes during Early Pregnancy Uterine glands are critical anatomical structures responsible for histotroph secretion and maternal-fetal material transport [26] , playing an indispensable role in embryonic nutrition. Our experimental results showed that the number of uterine glands in the NCG-supplemented group was significantly greater than that in the control group. This observation is consistent with previous findings by Pramod [27] , who reported that increased uterine gland density enhances nutrient secretory capacity, thereby supporting fetal development. The secretory function of uterine glands is mediated by glandular epithelial cells, with secretory capacity being directly proportional to the number of epithelial cells [28] . Although no significant differences were observed in the perimeter or cross-sectional area of individual glands between the two groups, the increased count of uterine glands in NCG-treated ewes suggests a corresponding increase in the total number of glandular epithelial cells. This histological adaptation likely facilitates enhanced nutrient exchange at the maternal-fetal interface. Cattle and sheep both possess a cotyledonary placenta, yet their structural organization differs significantly [29] . Whereas bovine placentation follows a "fetus-enveloping-mother" pattern, ovine placentation exhibits an inverse "mother-enveloping-fetus" architecture, characterized by maternal caruncles forming bowl-shaped structures that encapsulate fetal cotyledons. Hematoxylin-eosin (HE) staining revealed that cotyledonary villous branches were highly abundant in Hu sheep at 90 days of gestation, with a complex internal structure. Maternal placental lacunae and villous branches were alternately nested, with distinct staining patterns: the maternal cotyledonary components appeared redder, while the fetal components were purple. Consistent with anatomical descriptions [30] , the complete barrier structure of the cotyledonary tissue in Hu sheep comprises six layers from fetus to mother: chorionic blood vessels, mesenchyme, chorionic epithelium, uterine lacunar epithelium, uterine connective tissue, and uterine blood vessels. The first three layers form the fetal placenta, and the latter three constitute the maternal placenta. There is no direct blood contact between the mother and fetus; instead, they are connected via interlaced maternal lacunae and villous branches, which serve as the primary sites for nutrient supply, gas exchange, and metabolite excretion [31] . A large number of syncytiotrophoblasts are distributed within the maternal lacunae, a structure formed by the migration of fetal binucleate cells [32] . In this experiment, the average thickness of the uterine mucosa in the NCG-treated group was significantly lower than that in the control group. Cotyledons play a key role in embryonic development by expanding the effective maternal-fetal exchange area [33] , which is determined by the number of fetal villous branches and their degree of embedding into the endometrium—with more branches and deeper embedding leading to an increased exchange area. Under the same conditions, a thinner maternal uterine mucosa allows for deeper chorionic embedding and more intensive material exchange within the cotyledons. Given that elevated NO levels during pregnancy positively regulate extravillous trophoblast invasion [34] , and that NCG supplementation increased NO content in the present study, it is suggested that NCG may enhance chorionic invasion into the maternal endometrium via NO-mediated pathways, thereby facilitating maternal-fetal communication. Transcriptomic Sequencing and qPCR Validation of Maternal Placental Tissue Through GO and KEGG enrichment analyses, differential expression analysis of upregulated and downregulated genes revealed that significantly upregulated genes were primarily enriched in pathways related to IGF binding, VEGF-A/B, PLGF, and VEGF receptor activity, while downregulated genes were enriched in pathways associated with heparin binding, Roundabout binding, and PGI synthase activity. VEGF is widely recognized as a key regulator of angiogenesis [35] . Its family members, including VEGF-A/B/C/D and PLGF [36] , exhibit high homology [37] . As a potent endothelial growth factor, VEGF induces vasodilation and enhances blood flow by increasing NO production, while PLGF—commonly known as placental growth factor-1—acts as a strong enhancer of endothelial permeability. VEGF shows high nutritional sensitivity. Previous studies have demonstrated that when nutrient intake transitions from adequate to inadequate, the expression of placental VEGF mRNA in cotyledons increases, which correlates with elevated maternal progesterone levels [38] . This aligns with our findings, indicating that the increased VEGF mRNA expression in cotyledons of NCG-supplemented pregnant Hu sheep may be directly mediated by progesterone. In placental lobules, nutrient restriction leads to increased FLT1 mRNA expression [39] , which is consistent with our observations in ewes. This is likely because FLT1 functions as a receptor for VEGF [39] . VEGF participates in neovascularization via the PI3K-AKT signaling pathway [40] . This pathway regulates fundamental cellular functions such as translation, proliferation, and growth arrest [41,42] . KEGG pathway analysis further revealed close associations between the PI3K-AKT signaling pathway and VEGF. During angiogenesis and vascular network formation, blood flow within vessels induces shear stress on endothelial cells. This activates the KLF2 transcription factor, which responds to shear stress on the endothelial cell membrane, leading to increased expression of NOS regulatory proteins. This is supported by the elevated plasma NO and iNOS levels observed in our study, which ultimately regulate vascular endothelial growth factor receptor (VEGFR). Research has demonstrated that KLF2 regulation is mediated through the PI3K-AKT signaling pathway [43] . CNR1 and CNR2 are members of the cannabinoid receptor (CNR) family. The CNR1 gene regulates food intake and fat content in the hypothalamus [44] . Schwartz's team [45] found that this gene is expressed in the central nervous system (including the hypothalamus) and is involved in appetite regulation. Furthermore, CNR1 can positively regulate the MAPK signaling pathway, which is crucial for cellular functions such as growth, differentiation, and apoptosis. It also promotes the early differentiation of skeletal progenitor cells into osteoblasts and accelerates bone mineralization [46] . Notably, the high expression of CNR1 in the NCG group may be closely associated with the regulation of the MAPK pathway and cellular growth/differentiation. Insulin-like growth factor (IGF) exerts biological activity by binding to cell surface receptors [47] . As a broad-spectrum growth promoter, IGF plays a crucial role in embryonic development [48] . IGF-binding proteins (IGFBPs) exhibit diverse physiological functions [49] , specifically, IGFBP3 is involved in cell proliferation, differentiation, and apoptosis [50] . Gadd [51] observed lower IGFBP3 expression in uterine glands of adolescents with intrauterine growth restriction in high/medium dose groups, which aligns with our findings that NCG promotes uterine development in Hu sheep by enhancing IGFBP3 expression. Among the upregulated differentially expressed genes, TPH2 was significantly increased in the NCG group. This gene catalyzes the conversion of L-tryptophan to 5-hydroxy-L-tryptophan (5-HT), thereby regulating levels of gonadotropin-releasing hormone (GnRH) and luteinizing hormone (LH) to support pregnancy maintenance and placental development. For downregulated differentially expressed genes, MAP3K5 was significantly enriched in KEGG pathways, participating in MAPK signaling and endoplasmic reticulum protein processing. MAP3K5 belongs to the MAP3K5 family [52] and regulates intercellular junctions and the actin cytoskeleton [53] . In mammals, knockout of MAP3K5 impairs brown adipose tissue function, accelerates energy expenditure, reduces fat accumulation, and induces metabolic disorders [54] . The upregulation of CNR1 and downregulation of MAP3K5 in uterine tissues are both associated with the MAPK signaling pathway. This suggests that NCG may influence fat deposition and energy metabolism in pregnant ruminants. Figure 8 shows the effect of dietary NCG on placental development in pregnant ewes during the first three months of gestation and the mechanism by which changes in VEGF and PI3K-AKT pathways improve reproductive performance. 5 Conclusion This study demonstrated that dietary supplementation with 0.11% NCG in pregnant ewes (days 0–90 of gestation) significantly improved endometrial parameters in primiparous Hu sheep, including total endometrial weight, average individual cotyledon weight, mucosal thickness, and uterine gland count. The treatment enhanced reproductive performance by promoting endogenous arginine synthesis, increasing plasma levels of NO, arginine, and specific amino acids, and altering the expression patterns of genes such as CNR 1, TPH2 , FLT1 , and MAP3K5 , as well as signaling pathways related to angiogenesis, energy metabolism, and growth regulation. These changes optimized the uterine microenvironment and nutrient supply, thereby creating favorable conditions for maintaining pregnancy and supporting fetal development. Declarations Ethics approval and consent to participate All animal experiments in this study were approved by Lanzhou Qilihe Wanshan Cooperative and fully approved by the Animal Ethics Committee of College of Life Science and Engineering, Northwest Minzu University (xbmu-sm-2021060). Consent for publication All authors approved the final manuscript and the submission to this journel. Availability of data and materials The data requested by your journal has been submitted to the GSA database at the National Center for Biotechnology Information (NCBI), with the login number PRJNA1302455. Competing Interests The authors declares that they have No competing financial interests exist. Funding National Key R&D Program (14th Five-Year Plan) (2024 YFD1301002); Lanzhou Municipal Science and Technology Program (2021-1-171); Fundamental Research Funds for the Central Universities (31920240045). Authors' contributions Gao and Li are primarily responsible for sheep feeding, data collection, analysis, and thesis writing; Zheng mainly contributes to paper revisions; Zaxi focuses on guiding the slicing experiments; Cai handles experimental design, guidance, sample collection, data analysis, and paper revisions; Zang, Liu, and Yang mainly participate in sample collection; Li, Shi, and Huang also contribute to sample collection. Acknowledgments This research is supported by the 14th Five-Year Plan Key R&D Program (2024YFD1301002), Lanzhou Science and Technology Plan Project (2021-1-171), and Central University Basic Research Fund (31920240045). We are grateful to all authors for their contributions, as well as the experimental sites and laboratory animals provided by Wanshanhe District and Qilihe District of Lanzhou. References Li Y, Chen Z, Fang Y, et al. Runs of Homozygosity Revealed Reproductive Traits of Hu Sheep. Genes (Basel). 2022;13(10):1848. Zhao F, Xie R, Fang L, et al. Analysis of 206 whole-genome resequencing reveals selection signatures associated with breed-specific traits in Hu sheep. Evol Appl. 2024;17(6):e13697. Appleton J, Arginine. Clinical potential of a semi-essential amino acid. Altern Med Rev. 2002;7(6):512–22. Ignarro LJ. Nitric oxide as a unique signaling molecule in the vascular system: a historical overview. J Physiol Pharmacol. 2002;53(4 Pt 1):503–14. Wu G, Bazer FW, Hu J, et al. Polyamine synthesis from proline in the developing porcine placenta. Biol Reprod. 2005;72(4):842–50. Wilkinson DL, Bertolo RF, Brunton JA, et al. Arginine synthesis is regulated by dietary arginine intake in the enterally fed neonatal piglet. Am J Physiol Endocrinol Metab. 2004;287(3):E454–62. Peine JL, Jia G, Van Emon ML, et al. Effects of maternal nutrition and rumen-protected arginine supplementation on ewe performance and postnatal lamb growth and internal organ mass. J Anim Sci. 2018;96(8):3471–81. Wu G, Knabe DA, Kim SW. Arginine nutrition in neonatal pigs. J Nutr. 2004;134(10 Suppl):S2783–97. Wu G, Bazer FW, Davis TA, et al. Arginine metabolism and nutrition in growth, health and disease. Amino Acids. 2009;37(1):153–68. Li X, Bazer FW, Johnson GA, et al. Dietary supplementation with L-arginine between days 14 and 25 of gestation enhances embryonic development and survival in gilts. Amino Acids. 2014;46(2):375–84. Wu X, Yin YL, Liu YQ, et al. Effect of dietary arginine and N-carbamoylglutamate supplementation on reproduction and gene expression of eNOS, VEGFA and PlGF1 in placenta in late pregnancy of sows. Anim Reprod Sci. 2012;132(3–4):187–92. Zhang H, Sun L, Wang Z, et al. N-carbamylglutamate and L-arginine improved maternal and placental development in underfed ewes. Reproduction. 2016;151(6):623–35. Zhang H, Zhang Y, Ma Y, Elsabagh M, Wang H, Wang M. Dietary rumen-protected L-arginine or N-carbamylglutamate attenuated fetal hepatic inflammation in undernourished ewes suffering from intrauterine growth restriction. Anim Nutr. 2021;7(4):1095–104. Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357–60. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357–9. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. Kanehisa M, Araki M, Goto S, et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008;36(Database issue):D480–4. Nakano H, Shimada A, Imai K, Takahashi T, Hashizume K. The cytoplasmic expression of E-cadherin and beta-catenin in bovine trophoblasts during binucleate cell differentiation. Placenta. 2005;26(5):393–401. Wu G, Meininger CJ, Knabe DA, et al. Arginine nutrition in development, health and disease. Curr Opin Clin Nutr Metab Care. 2000;3(1):59–66. Wu G, Bazer FW, Johnson GA, et al. Functional amino acids in the development of the pig placenta. Mol Reprod Dev. 2017;84(9):870–82. Chacher B, Liu H, Wang D, et al. Potential role of N-carbamoyl glutamate in biosynthesis of arginine and its significance in production of ruminant animal. J Anim Sci Biotechnol. 2013;4:303–8. Ma W, Yuan M, Chang S, Wang C. N-carbamylglutamate supplementation regulates hindgut microbiota composition and short-chain fatty acid contents in Charollais and Small Tail Han crossbred sheep. Front Vet Sci. 2023;10:1230190. Jin M, Cao B, Lin C, et al. Tianma Gouteng Decoction Exerts Pregnancy-Protective Effects Against Preeclampsia via Regulation of Oxidative Stress and NO Signaling. Front Pharmacol. 2022;13:849074. Wang Z, Wang R, Meng C et al. Effects of dietary supplementation of N-carbamylglutamate on lactation performance of lactating goats and growth performance of their suckling kidlets[J]. Small Ruminant Res,2019;175142–148. Zhang H, Jin Y, Wang M, et al. N-Carbamylglutamate and l-arginine supplementation improve hepatic antioxidant status in intrauterine growth-retarded suckling lambs. RSC Adv. 2020;10(19):11173–81. Bazer FW, Spencer TE, Johnson GA, et al. Comparative aspects of implantation. Reproduction. 2009;138(2):195–209. Dhakal P, Kelleher AM, Behura SK, et al. Sexually dimorphic effects of forkhead box a2 (FOXA2) and uterine glands on decidualization and fetoplacental development. Proc Natl Acad Sci U S A. 2020;117(38):23952–9. Wang CK, Robinson RS, Flint AP, et al. Quantitative analysis of changes in endometrial gland morphology during the bovine oestrous cycle and their association with progesterone levels. Reproduction. 2007;134(2):365–71. Johnson GA, Bazer FW, Seo H, et al. Understanding placentation in ruminants: a review focusing on cows and sheep. Reprod Fertil Dev. 2023;36(2):93–111. Liu B. Morphological study of yak placenta during pregnancy [D]. Gansu Agricultural University; 2010. Ballasy N, Apantaku I, Dean W, Hemberger M. Off to a good start: The importance of the placental exchange surface - Lessons from the mouse. Dev Biol. 2025;517:248–64. Rozemarijn JB, Koen F, Soraya S et al. The immunological intrigue of microchimerism: tracing fetal and maternal cells throughout the body[J].Journal of Reproductive Immunology,2023,159. Kamal MM, Van Eetvelde M, Vandaele L, et al. Environmental and maternal factors associated with gross placental morphology in dairy cattle. Reprod Domest Anim. 2017;52(2):251–6. Poniedziałek-Czajkowska E, Marciniak B, Kimber-Trojnar Z, et al. Nitric oxide in normal and preeclamptic pregnancy. Curr Pharm Biotechnol. 2011;12(5):743–9. Graupera M, Claret M. Endothelial Cells: New Players in Obesity and Related Metabolic Disorders. Trends Endocrinol Metab. 2018;29(11):781–94. Shibuya M. Vascular endothelial growth factor and its receptor system: physiological functions in angiogenesis and pathological roles in various diseases. J Biochem. 2013;153(1):13–9. Calvo PM, Hernández RG, Pastor AM, et al. VEGF Neuronal Survival Neuroscientist. 2024;30(1):71–86. Luther J, Milne J, Aitken R, et al. Placental growth, angiogenic gene expression, and vascular development in undernourished adolescent sheep. Biol Reprod. 2007;77(2):351–7. Lekatz LA, Ward MA, Borowicz PP, et al. Cotyledonary responses to maternal selenium and dietary restriction may influence alterations in fetal weight and fetal liver glycogen in sheep. Anim Reprod Sci. 2010;117(3–4):216–25. Li J, Wu X, Gong J, et al. Vascular endothelial growth factor induces multidrug resistance-associated protein 1 overexpression through phosphatidylinositol-3-kinase /protein kinase B signaling pathway and transcription factor specificity protein 1 in BGC823 cell line. Acta Biochim Biophys Sin (Shanghai). 2013;45(8):656–63. Xue C, Li G, Lu J, Li L. Crosstalk between circRNAs and the PI3K/AKT signaling pathway in cancer progression. Signal Transduct Target Ther. 2021;6(1):400. Savova MS, Mihaylova LV, Tews D, et al. Targeting PI3K/AKT signaling pathway in obesity. Biomed Pharmacother. 2023;159:114244. Li Z, Antila S, Nurmi H, et al. Blockade of VEGFR3 signaling leads to functional impairment of dural lymphatic vessels without affecting autoimmune neuroinflammation. Sci Immunol. 2023;8(82):eabq0375. Pei SJ, Zhu HY, Guo JH, et al. Knockout of CNR1 prevents metabolic stress-induced cardiac injury through improving insulin resistance (IR) injury and endoplasmic reticulum (ER) stress by promoting AMPK-alpha activation. Biochem Biophys Res Commun. 2018;503(2):744–51. Schwartz MW, Woods SC, Porte D Jr, et al. Central nervous system control of food intake. Nature. 2000;404(6778):661–71. Greenblatt MB, Shim JH, Bok S, Kim JM. The Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase Pathway in Osteoblasts. J Bone Metab. 2022;29(1):1–15. Baxter RC. Signaling Pathways of the Insulin-like Growth Factor Binding Proteins. Endocr Rev. 2023;44(5):753–78. Okawa ER, Gupta MK, Kahraman S, et al. Essential roles of insulin and IGF-1 receptors during embryonic lineage development. Mol Metab. 2021;47:101164. Forbes BE, Blyth AJ, Wit JM. Disorders of IGFs and IGF-1R signaling pathways. Mol Cell Endocrinol. 2020;518:111035. Li HB, Wang D, Zhang Y, et al. IGFBP3 Enhances Treatment Outcome and Predicts Favorable Prognosis in ABC-DLBCL. J Oncol. 2023;2023:1388041. Gadd TS, Aitken RP, Wallace JM, et al. Effect of a high maternal dietary intake during mid-gestation on components of the utero-placental insulin-like growth factor (IGF) system in adolescent sheep with retarded placental development. J Reprod Fertil. 2000;118(2):407–16. Pu L, Zhang LC, Zhang JS, et al. Porcine MAP3K5 analysis: molecular cloning, characterization, tissue expression pattern, and copy number variations associated with residual feed intake. Genet Mol Res. 2016;15(3):104238. Rolf MM, Taylor JF, Schnabel RD, et al. Genome-wide association analysis for feed efficiency in Angus cattle. Anim Genet. 2012;43(4):367–74. Moody L, Shao J, Chen H, Pan YX. Maternal Low-Fat Diet Programs the Hepatic Epigenome despite Exposure to an Obesogenic Postnatal Diet. Nutrients. 2019;11(9):2075. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7371628","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":508893658,"identity":"4d3dd060-25dc-49be-8de2-dc9121b031da","order_by":0,"name":"TianLi Gao","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"TianLi","middleName":"","lastName":"Gao","suffix":""},{"id":508893659,"identity":"910fe53f-0e25-4814-b6a1-98c26757f351","order_by":1,"name":"ChunYang Li","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"ChunYang","middleName":"","lastName":"Li","suffix":""},{"id":508893660,"identity":"0cac0d83-fa7f-49a1-993d-b8a8cde13987","order_by":2,"name":"JuanShan Zheng","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"JuanShan","middleName":"","lastName":"Zheng","suffix":""},{"id":508893662,"identity":"f1f2e155-058e-4a6a-a451-e92c4f16fed0","order_by":3,"name":"YingPai Zhaxi","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"YingPai","middleName":"","lastName":"Zhaxi","suffix":""},{"id":508893663,"identity":"9152a2dd-38ec-4f52-b1aa-2b49e622c299","order_by":4,"name":"Yuan Cai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYBACxmb2A4YfKmx47NsbiNTC3M6TUCxxJk3OgOcAkVrY+xkMPvC2HTY2kEggUgtvM0PiBgm2w4nbJR9vvMFQYxNNUItkM+NhgwKe9MSds9OKLRiOpeU2ENJi2MyQZiAhYZ3YcDvHTIKx4TBhLfaHGcx/8BgwJzbcPEOkFsZmBgMDngRnY4MbPERr4UkwljiQJifZA/RLAjF+Yew/fsDw4z8bHn72wxtvfKixIawFGRAfNUhaSNUxCkbBKBgFIwMAAGfzPumbl4GmAAAAAElFTkSuQmCC","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":true,"prefix":"","firstName":"Yuan","middleName":"","lastName":"Cai","suffix":""},{"id":508893666,"identity":"4b399327-b086-4af2-ba03-54b8d7675764","order_by":5,"name":"RongXin Zang","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"RongXin","middleName":"","lastName":"Zang","suffix":""},{"id":508893669,"identity":"3bd63bc7-5850-46db-8f53-aab52aca8d69","order_by":6,"name":"HuiXia Liu","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"HuiXia","middleName":"","lastName":"Liu","suffix":""},{"id":508893672,"identity":"b6b6fd01-8510-4881-9292-d924e1e12dd0","order_by":7,"name":"YanMei Yang","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"YanMei","middleName":"","lastName":"Yang","suffix":""},{"id":508893674,"identity":"da3377b8-3850-44cb-abc5-0d914656935d","order_by":8,"name":"Sai LI","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Sai","middleName":"","lastName":"LI","suffix":""},{"id":508893676,"identity":"f70c4a1b-78e3-48e6-8af4-b31eba557381","order_by":9,"name":"XiaoDi Shi","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"XiaoDi","middleName":"","lastName":"Shi","suffix":""},{"id":508893677,"identity":"8f618b9c-0e71-421f-a786-4fee043fc6b3","order_by":10,"name":"Chen Huang","email":"","orcid":"","institution":"Northwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-08-14 08:38:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7371628/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7371628/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90810500,"identity":"2432ba66-5d36-4824-8afa-659dcc735363","added_by":"auto","created_at":"2025-09-08 11:56:03","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":32513,"visible":true,"origin":"","legend":"\u003cp\u003eUterine diagram of hu sheepat 90 d of gestation，a、cotyledon.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/5570c09e061e6cc25ecf876f.jpg"},{"id":90810764,"identity":"05b47f4f-b2ff-418c-a77b-d4f42b84997d","added_by":"auto","created_at":"2025-09-08 12:04:03","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":22307,"visible":true,"origin":"","legend":"\u003cp\u003eHE staining of cotyledon and site of ingested of Hu sheep.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/12defb1b2a34f0b32453701d.jpg"},{"id":90810503,"identity":"bc1bd31f-72f7-4845-ad52-eb936c1bda1c","added_by":"auto","created_at":"2025-09-08 11:56:03","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":36939,"visible":true,"origin":"","legend":"\u003cp\u003eModel of cotyledon structure of sheep during pregnancy and corresponding anatomical characteristics of Hu sheep\u003c/p\u003e\n\u003cp\u003ea: Allantoic chorion. b: Uterine gland. c: Chorionic branch. d: Placental lacuna. e: Uterine mucosa.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/66a94f83c553ab4e4cd8cd3a.jpg"},{"id":90810504,"identity":"2718accb-27ee-4e66-ba22-7f8ad23e3cc4","added_by":"auto","created_at":"2025-09-08 11:56:03","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":109043,"visible":true,"origin":"","legend":"\u003cp\u003eHE staining of sites a, b, c , d\u003c/p\u003e\n\u003cp\u003ea, Villous branches. b, Mesenchyme c, Chorionic blood vessels. d, Maternal placental lacunae.\u003c/p\u003e\n\u003cp\u003ee, Endometrium. f, Uterine glands. g, Uterine blood vessels. h, Myometrium\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/0b37a5f206f593334639fe58.jpg"},{"id":90810765,"identity":"c126f6f5-0ec8-4b47-8dd2-4259efeb18a0","added_by":"auto","created_at":"2025-09-08 12:04:03","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":224459,"visible":true,"origin":"","legend":"\u003cp\u003eSyncytial and binuclear cells\u003c/p\u003e\n\u003cp\u003eNote: The red circle is labeled as a double nucleus cell, and the yellow circle is labeled as a syncytium\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/7122e073492b40d8a51969b9.jpg"},{"id":90810507,"identity":"86c076ee-7f93-4b3e-a3c6-6ee5d86eed03","added_by":"auto","created_at":"2025-09-08 11:56:03","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":32268,"visible":true,"origin":"","legend":"\u003cp\u003eIntegration of multidimensional statistical analysis and visualization technology\u003c/p\u003e\n\u003cp\u003e(A) PCA diagram, (B) correlation analysis, (C) heat map, (D) box plot\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/66532b0f4f96ee34d150d254.jpg"},{"id":90811770,"identity":"335c0ff7-8b84-4b2c-9c1b-14c71d1b79bb","added_by":"auto","created_at":"2025-09-08 12:12:03","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":45216,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Bar chart of differentially expressed genes between the two groups. (B) Comparison of qPCR and sequencing results of differential genes.(C) GO enrichment classification of differentially expressed genes. (D) KEGG enrichment bubble diagram of differentially expressed genes.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/11ce3a9cbcb363657d345dc3.jpg"},{"id":90810514,"identity":"781f95d7-5278-4b46-8f0a-a8a60407af9e","added_by":"auto","created_at":"2025-09-08 11:56:03","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":175114,"visible":true,"origin":"","legend":"\u003cp\u003eThe addition of 0.11% in early pregnancy diet regulated the reproductive performance and fetal development of ewes.↑: Gene and pathway expression enhancement or promotion.↓: Gene and pathway expression weakening or reduction.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/dec9a2e7f65d5127cef4ec58.jpg"},{"id":92845697,"identity":"ae05be45-f655-4459-8657-b6f8d833d324","added_by":"auto","created_at":"2025-10-06 09:33:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1970724,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7371628/v1/62135e08-bd06-4497-ac44-41c770aee1d0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Study on the effect of N-carbamylglutamate (NCG) on reproductive performance and regulation mechanism of primary lake sheep","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eChina boasts a rich diversity of sheep and goat breeds, among which Hu sheep\u0026mdash;a renowned multiparous breed\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e\u0026mdash;have garnered significant attention due to their superior meat quality and high reproductive rate\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. However, Hu sheep ewes are prone to issues such as intrauterine growth restriction (IUGR) owing to their small body size, high fecundity, and early mating age, which in turn impairs reproductive efficiency. Arginine (Arg), a functional amino acid, plays a pivotal role in animals. It serves as a precursor for the synthesis of proteins, nitric oxide (NO), polyamines, and other substances in the body\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. As a signaling molecule, NO can enhance vascular dilation, thereby increasing blood flow\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, and exerts positive effects on somatic growth and development, intestinal immunity, and hormone regulation. Arginine also contributes positively to maternal placental development and maternal-fetal material exchange\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. However, the widespread application of arginine is limited by its relatively high cost and susceptibility to degradation by rumen microorganisms in ruminant diets\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Thus, identifying a cost-effective and efficient arginine substitute is of particular importance.\u003c/p\u003e\u003cp\u003eN-carbamylglutamate (NCG), as an activator of carbamyl phosphate synthetase-1 (CPS-I)\u0026mdash;an essential cofactor for endogenous Arg synthesis\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e\u0026mdash;can promote endogenous Arg production. Compared with Arg, NCG is more cost-effective, less susceptible to degradation by digestive enzymes, and exerts significant effects even at low doses. Studies in monogastric animals have demonstrated that dietary NCG supplementation during pregnancy can reduce embryonic mortality\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e, improve pregnancy rates and litter sizes\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, enhance placental vascular function\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e, and facilitate the provision of more nutrients and oxygen by the mother to fetal tissues\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, thereby improving reproductive performance. In ruminants, studies have also shown that NCG can significantly increase the birth weight and growth performance of newborn lambs\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, exerting a positive impact on reproductive outcomes. Therefore, this study investigated the effects of feeding 0.11% NCG to primiparous ewes during early pregnancy (days 0\u0026ndash;90) on improving reproductive performance and fetal development. Its regulatory mechanisms were further explored through measurements of uterine and fetal development indices, plasma biochemical parameters, hematoxylin and eosin (H\u0026amp;E) staining, and transcriptome sequencing of maternal placental tissue.\u003c/p\u003e"},{"header":"2 Methods","content":"\u003cp\u003e\u003cstrong\u003eEthical Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments in this study were approved by Lanzhou Qilihe Wanshan Cooperative and fully approved by the Animal Ethics Committee of College of Life Science and Engineering, Northwest Minzu University (xbmu-sm-2021060).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimals and Design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis experiment was carried out in Wanshan Cooperative of Qilihe District, Lanzhou. The subjects were from Wanshan Planting and Breeding Professional Cooperative of Qilihe District, Lanzhou. Twelve healthy 10-month-old purebred primiparous Hu sheep ewes were randomly allocated to two groups. The control group was fed a basal diet, formulated in accordance with the nutrient requirements for 40-kg pregnant ewes specified by the NRC (2004), the composition and nutritional level of the diet are shown in Table 1. The experimental group received the basal diet supplemented with 0.11% NCG, with the dosage determined based on preliminary trials. A 10-day adaptation period was followed by a 90-day experimental feeding period. All ewes were mated via estrus synchronization and artificial insemination, with the mating day designated as day 0. The initial body weight of the ewes was 41.46 ± 4.72 kg. On day 35 of gestation, pregnancy diagnosis was performed using B-mode ultrasound to determine the conception rate and estimate the number of fetuses per litter.\u003c/p\u003e\n\u003cp\u003eTable 1. Composition and nutrient levels of diets (dry matter basis)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eIngredient (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCorn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e9.84\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eWheat bran\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSoybean meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSalt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePremix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.39\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eNaHCO3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;CaHPO4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;Alfalfa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e44.86\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eWhole corn silage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e37.88\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eNutrient levels\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eDE（MJ·kg\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e10.98\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCP（MJ·kg\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e16.08\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCa（MJ·kg\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTP（MJ·kg\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.34\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003ePremix provided per kg of diet: VA: 1637.21 IU, VD₃: 388.84 IU, VE: 15.35 IU, niacin: 4.91 mg, Fe: 40.93 mg, Cu: 6.14 mg, Zn: 24.56 mg, Mn: 30.70 mg, I: 0.29 mg, Se: 0.10 mg, Co: 0.03 mg, Mg: 102.33 mg, Ca: 1023.26 mg, TP: 204.65 mg, NaCl: 1023.26 mg.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of Uterine and Fetal Indices\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn day 90 of gestation, the ewes were euthanized by electrical stunning following venous blood collection. After excising the uterus, the following indices were measured and recorded: total cotyledon weight, fetal height, fetal length, amniotic fluid volume, weights of various organs, average uterine weight, total litter weight, average individual cotyledon weight, fetal-to-corpus luteum ratio, and relative weights of fetal organs (relative to fetal body weight).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlood Index Measurement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn day 90 of pregnancy, blood samples were collected from the jugular vein into Heparin sodium tubes. Samples were placed on ice and immediately centrifuged at 3500\u0026nbsp;g\u0026nbsp;for 10min at 4℃. Serum was separated and stored at\u0026nbsp;−80℃until analysis. The NO, nitric oxide synthase (NOS), blood ammonia, estrogen (E2), and progesterone (PROG) were analyzed using ELISA kits from Nanjing Jiancheng (Jiangsu, China), and the amino acid content was also measured by S-433D type automatic amino acid analyzerfrom Nanjing Jiancheng (Jiangsu, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCotyledon HE Staining Index Measurement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCotyledons from each ewe's placenta were randomly cut and fixed in 4% polyformaldehyde solution, embedded and cut into 5 micron slices. After fixation, the samples were transferred to 70% ethanol for long-term storage until subsequent treatment. The morphology of the excised cotyledons was observed, and then histological analysis was performed by measuring capillary density, thickness of uterine mucosa and count of uterine glands by HE staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptome Sequencing Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter slaughtering the sheep on day 90, maternal placental tissue from the uterus was quickly collected. Maternal placental tissue at the base of the small curvature of the uterine horn was cut with sterilized surgical scissors into 5-10 mm³\u0026nbsp;pieces, washed with PBS, placed in cryotubes, and stored in liquid nitrogen.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThree female sheep samples were randomly selected from both the NCG experimental group and the control group for transcriptome sequencing using the BGISEQ500 platform. The 260/280 OD values of samples between 1.8 and 2.0 were selected for further analysis. The qualified RNA was used for library construction. The transcriptome data sequencing was statistically analyzed using the BGI DNBSEQ platform; the data were filtered using SOAPnuke software. Raw reads were firstly processed using fastp and the low-quality reads were removed. The indexes based on Burrows-Wheeler transform and Ferragina-Manzini (FM) adopt two forms of genome-wide and local genome indexes to efficiently compare clean reads. The genome was compared using Hierarchical Indexing for Spliced Alignment of Transcripts (HISAT)\u003csup\u003e[14]\u0026nbsp;\u003c/sup\u003eand Bowtie2\u003csup\u003e[15]\u003c/sup\u003e software. Gene expression levels of each sample were calculated using RSEM software. Differential expression analysis was performed between the NCG experimental group and the control group using DESeq2 software\u003csup\u003e[16]\u003c/sup\u003e. Differentially expressed genes (DEGs) were identified using the criteria of adjusted P-value (padj) \u0026lt; 0.05 and |log2 (fold change)| ≥ 1. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG)\u003csup\u003e[17]\u003c/sup\u003e (Kanehisa et al., 2007) pathway enrichment analysis of DEGs were respectively performed using R based on the hypergeometric distribution. Genes with P-value \u0026lt; 0.05 and fold changes (FC) \u0026gt; 1.5 were considered differentially expressed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-Time Quantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQuantitative real-time-PCR (RT-qPCR) was used to detect the mRNA levels of twelve genes. The same RNA samples were used for reverse transcription using a reverse transcriptase kit to synthesize first-strand cDNA. Primer Express Software v2.0 were used to design the primers and are detailed in Table 2. GAPDH was used as the standardized reference gene, and the relative expression level was calculated by\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003eΔΔ\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTable 2. Primer information\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"543\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eQ - PCR primers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eThe sequence（5’-3’）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAOX\u003c/em\u003e1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGTGCTGGTGACTCACGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAOX\u003c/em\u003e1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCCGGAGGTGGATACTGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTPH\u003c/em\u003e2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTCTGCTGACGAAACACTGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTPH\u003c/em\u003e2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTCCCGAGGACTCAGGTACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eMMP\u003c/em\u003e2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGGCATCTCTCAGATCCGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eMMP\u003c/em\u003e2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTTTTCCGGTAGCTCAGGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eSPP\u003c/em\u003e1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCAAGGAGGAAAGCAAGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eSPP\u003c/em\u003e1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGATTTTCAGGCGCTTGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCDA\u003c/em\u003e-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTTGCTGCTGTCCTGCCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCDA\u003c/em\u003e-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTTGCACCCGGAGAAGATCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eSEPHS\u003c/em\u003e2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTCCTGCGTCATACCCCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eSEPHS\u003c/em\u003e2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGATGCGCCCCATCATATAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFLT\u003c/em\u003e1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCCTGCCGAGCTAGGAACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFLT\u003c/em\u003e1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTGCGGTCACTGAGGTTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTHBS\u003c/em\u003e2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGACCTCTTCAGCCTCAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTHBS\u003c/em\u003e2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTAGTCAAAGCGGACGAAGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCACNA1A\u003c/em\u003e-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTTTGAGAAAGATTGCCGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCACNA1A\u003c/em\u003e-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCCCACAGCACGTTGTCATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eMAP3K5\u003c/em\u003e-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTCAGGTCCAGGTGGTGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eMAP3K5\u003c/em\u003e-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCGCCTTTCGGATGATACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCNR\u003c/em\u003e1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTCGGACTGCCTGCACAAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCNR\u003c/em\u003e1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGACATGGTCACCTTGGCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eNDUFA\u003c/em\u003e7-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAGACTTGCAGGCGAAACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eNDUFA\u003c/em\u003e7-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTTGGAGAGTCTGTGGCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eData Statistics and Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExperimental data were statistically analyzed using SPSS 23.0, and intergroup differences were tested by t-test. Data are presented as means\u0026nbsp;±\u0026nbsp;SEM. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant. Mucosal thickness and uterine gland area and perimeter were calculated using Image-Pro plus 6.0. Transcripts with FC\u0026gt; 1.5 and \u003cem\u003eP\u003c/em\u003e \u0026lt;0.05 between the two groups were classified as DEGs.\u003c/p\u003e"},{"header":"3 Results","content":"\u003cp\u003e\u003cstrong\u003eEffects of NCG Supplementation on Uterine and Fetal Index Development in Ewes during Early Pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in Table 3, no significant differences were observed between the two groups in terms of average uterine weight, number of fetuses, birth weight, average fetal weight, number of corpora lutea, or fetal-corpus luteum ratio (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05). Notably, all indices except for average fetal weight exhibited an increasing trend relative to the control group, suggesting that NCG may promote fetal development in the uterus of ewes.\u003c/p\u003e\n\u003cp\u003eTable 3. Effects of NCG on uterine weight, fetal index, and corpus luteum index\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eContril group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eNCG group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eUterine average weight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e3.54\u0026plusmn;0.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e4.21\u0026plusmn;0.62\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eNumber of fetuses\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1.80\u0026plusmn;0.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e2.17\u0026plusmn;0.41\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003elitter fetal weight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e918.99\u0026plusmn;241.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1084.21\u0026plusmn;196.58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eFetal average weight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e525.14\u0026plusmn;62.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e500.40\u0026plusmn;38.90\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eCorpus Luteum Count\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e2.20\u0026plusmn;0.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e2.33\u0026plusmn;0.52\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eFetal luteal ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e0.87\u0026plusmn;0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e0.94\u0026plusmn;0.14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eAs presented in Table 4, no significant differences (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05) were detected between the NCG-treated group and the control group with respect to fetal body dimensions or organ weights. These findings indicate that dietary supplementation with NCG during early pregnancy does not exert an influence on fetal body size parameters or internal organ weights.\u003c/p\u003e\n\u003cp\u003eTable 4. Effects of NCG on fetal body size and organ weight\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eContril group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eNCG group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ebody length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e16.80\u0026plusmn;0.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e16.25\u0026plusmn;0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ewithers height\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e16.97\u0026plusmn;1.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e17.07\u0026plusmn;1.22\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eBrain weight ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e26.43\u0026plusmn;2.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e27.34\u0026plusmn;1.62\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eGastric weight ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e14.87\u0026plusmn;1.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e14.61\u0026plusmn;1.72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eLiver compared to\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e61.64\u0026plusmn;3.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e61.49\u0026plusmn;2.89\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eKidney ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e12.58\u0026plusmn;0.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e12.38\u0026plusmn;1.26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eLung size ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e38.11\u0026plusmn;3.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e37.72\u0026plusmn;3.04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of Dietary NCG Supplementation on Blood Biochemical Indices and Amino Acid Content in Ewes during Early Pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs depicted in Table 5, the plasma levels of NO and inducible nitric oxide synthase (iNOS) in ewes from the NCG-treated group were significantly higher than those in the control group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), while progesterone levels in the treated group exhibited an increasing trend relative to the control group. No significant differences were observed between the two groups in terms of blood ammonia, estradiol, total nitric oxide synthase (TNOS), or endothelial nitric oxide synthase (eNOS) levels (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05). These results indicate that dietary supplementation with NCG during early pregnancy can significantly increase plasma concentrations of NO and iNOS in ewes.\u003c/p\u003e\n\u003cp\u003eTable 5. Effects of NCG on plasma NO, NOS, ammonia, and hormone contents in ewes on day 90\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eContril group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eNCG group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eNO（umol\u0026middot;L\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e11.51\u0026plusmn;2.09\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e14.69\u0026plusmn;2.29\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eblood ammonia（umol\u0026middot;L\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e120.43\u0026plusmn;14.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e128.12\u0026plusmn;9.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ePROG（ng\u0026middot;mL\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e4.86\u0026plusmn;0.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e5.22\u0026plusmn;0.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eE2（ng\u0026middot;L\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e32.06\u0026plusmn;1.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e33.22\u0026plusmn;2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eTNOS（U\u0026middot;mL\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e16.80\u0026plusmn;1.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e15.76\u0026plusmn;1.46\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eeNOS（U\u0026middot;mL\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e11.76\u0026plusmn;1.90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e12.62\u0026plusmn;1.55\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eiNOS（U\u0026middot;mL\u003csup\u003e-1\u003c/sup\u003e）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e8.64\u0026plusmn;0.90\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e10.50\u0026plusmn;1.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eAs presented in Table 6, the plasma concentrations of glutamic acid, alanine, leucine, arginine, and proline were significantly higher in the NCG-treated group compared to the control group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). No significant differences were noted between the two groups with respect to the levels of other amino acids (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05). These findings suggest that dietary supplementation with NCG during early pregnancy can influence the plasma concentrations of certain amino acids in ewes.\u003c/p\u003e\n\u003cp\u003eTable 6. Effects of NCG on plasma amino acid content in ewes on day 90\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eItems(umol/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eContril group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eNCG group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eAsp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e7.27\u0026plusmn;1.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e12.44\u0026plusmn;9.17\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eThr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e39.70\u0026plusmn;7.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e62.68\u0026plusmn;28.46\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e75.92\u0026plusmn;25.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e87.21\u0026plusmn;14.78\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eAsn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e50.05\u0026plusmn;12.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e65.70\u0026plusmn;14.94\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eGlu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e119.96\u0026plusmn;19.64\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e149.82\u0026plusmn;21.50\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eGly\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e522.81\u0026plusmn;89.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e613.62\u0026plusmn;100.39\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eAla\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e308.93\u0026plusmn;13.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e356.55\u0026plusmn;33.92\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eCit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e195.76\u0026plusmn;38.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e184.20\u0026plusmn;54.09\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eVal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e141.04\u0026plusmn;16.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e146.09\u0026plusmn;41.23\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eMet\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e41.85\u0026plusmn;2.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e45.59\u0026plusmn;5.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eIle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e87.57\u0026plusmn;13.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e101.85\u0026plusmn;10.72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eLeu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e122.05\u0026plusmn;9.98\u003csup\u003eb\u003c/sup\u003e\u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e143.93\u0026plusmn;14.73\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eTyr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e70.17\u0026plusmn;14.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e74.85\u0026plusmn;9.30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ePhe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e29.33\u0026plusmn;3.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e30.68\u0026plusmn;5.91\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eHis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e51.16\u0026plusmn;6.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e59.68\u0026plusmn;11.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eTrp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e596.12\u0026plusmn;60.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e600.05\u0026plusmn;49.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eOrn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e53.52\u0026plusmn;11.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e70.24\u0026plusmn;23.49\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e272.05\u0026plusmn;34.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e285.61\u0026plusmn;42.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eArg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e167.55\u0026plusmn;29.46\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e207.81\u0026plusmn;27.21\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ePro\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e123.90\u0026plusmn;7.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e146.96\u0026plusmn;19.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of NCG Supplementation on Cotyledon and HE Staining Indices in Ewes during Early Pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs illustrated in Table 7, amniotic fluid volume in the NCG-treated group exhibited an increasing trend relative to the control group. No significant difference was observed between the NCG-treated group and the control group in terms of cotyledon number (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05). However, both total cotyledon weight and average individual cotyledon weight in the NCG-treated group were significantly higher than those in the control group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). These results suggest that NCG can enhance cotyledon development.\u003c/p\u003e\n\u003cp\u003eTable 7. Effects of NCG on amniotic fluid volume and cotyledon indices\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6679%;\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.9783%;\"\u003e\n \u003cp\u003eContril group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26.3538%;\"\u003e\n \u003cp\u003eNCG group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6679%;\"\u003e\n \u003cp\u003eAmniotic fluid volume\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.9783%;\"\u003e\n \u003cp\u003e526.40\u0026plusmn;35.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26.3538%;\"\u003e\n \u003cp\u003e566.42\u0026plusmn;40.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6679%;\"\u003e\n \u003cp\u003eNumber of cotyledons\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.9783%;\"\u003e\n \u003cp\u003e88.00\u0026plusmn;15.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26.3538%;\"\u003e\n \u003cp\u003e88.67\u0026plusmn;14.09\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6679%;\"\u003e\n \u003cp\u003etotal weight of cotyledons\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.9783%;\"\u003e\n \u003cp\u003e641.00\u0026plusmn;74.53\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26.3538%;\"\u003e\n \u003cp\u003e777.50\u0026plusmn;79.98\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6679%;\"\u003e\n \u003cp\u003eaverage weight of monocotyledons\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.9783%;\"\u003e\n \u003cp\u003e7.38\u0026plusmn;0.85\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26.3538%;\"\u003e\n \u003cp\u003e8.84\u0026plusmn;0.77\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eAs demonstrated in Table 8, the uterine mucosal thickness in the NCG-treated group was significantly lower than that in the control group (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). No significant differences were found between the two groups in terms of capillary count, uterine gland area, or uterine gland perimeter (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026gt; 0.05). However, the number of uterine glands in the NCG-treated group was significantly higher than that in the control group (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003eTable 8. Effects of NCG on mucosal thickness, capillary, and uterine gland indices in cotyledon\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.8521%;\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28.8732%;\"\u003e\n \u003cp\u003eContril group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.2746%;\"\u003e\n \u003cp\u003eNCG group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.8521%;\"\u003e\n \u003cp\u003ethickness of the endometrial lining\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28.8732%;\"\u003e\n \u003cp\u003e422.76\u0026plusmn;116.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.2746%;\"\u003e\n \u003cp\u003e256.59\u0026plusmn;94.59\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.8521%;\"\u003e\n \u003cp\u003eNumber of capillaries\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28.8732%;\"\u003e\n \u003cp\u003e10.50\u0026plusmn;1.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.2746%;\"\u003e\n \u003cp\u003e11.17\u0026plusmn;1.72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.8521%;\"\u003e\n \u003cp\u003eNumber of uterine adenoma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28.8732%;\"\u003e\n \u003cp\u003e19.00\u0026plusmn;2.65\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.2746%;\"\u003e\n \u003cp\u003e26.33\u0026plusmn;3.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.8521%;\"\u003e\n \u003cp\u003earea of uterine glands\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28.8732%;\"\u003e\n \u003cp\u003e43454.43\u0026plusmn;5281.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.2746%;\"\u003e\n \u003cp\u003e47283.32\u0026plusmn;5694.17\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.8521%;\"\u003e\n \u003cp\u003eperimeter of uterine glands\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28.8732%;\"\u003e\n \u003cp\u003e955.25\u0026plusmn;97.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.2746%;\"\u003e\n \u003cp\u003e923.11\u0026plusmn;94.35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eObservation of Cotyledon Structure in Ewes on Day 90 of Pregnancy and Effects of NCG Supplementation on Its Development\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe anatomical features of the placenta and uterus in 90 pregnant ewes are illustrated in Figure 1. Hu sheep, as a multiparous breed, possess a cotyledonary placenta. The cotyledons are interconnected via an extensive network of uterine blood vessels, and maternal-fetal material exchange occurs through these cotyledon structures. The histological structure observation of cotyledon tissue in Hu Sheep in the 90th of pregnancy was observed as shown in Figure 2.\u003c/p\u003e\n\u003cp\u003eAs depicted in Figure 3, panel a shows the fetal placental component, while panels b and e represent the maternal placental components. Villi of the fetal allantochorion converge into villous clusters that are embedded within the maternal uterine mucosa. A key characteristic is that during pregnancy, cotyledons serve as the site of maternal-fetal material exchange, whereas the surfaces between cotyledons are generally smooth.\u003c/p\u003e\n\u003cp\u003eAs shown in Figure 2, four different cotyledon tissue parts (a, b, c and d) were selected for HE staining observation, and the results of HE staining are shown in Figure 4.\u003c/p\u003e\n\u003cp\u003eChorionic blood vessels: The cotyledons on day 90 contained a rich network of chorionic blood vessels, within which numerous red blood cells were visible. Vascular branches extended into the villous branches of the maternal placenta. Additionally, some underdeveloped blood vessels in the mesenchyme were small and remained in a closed state.\u003c/p\u003e\n\u003cp\u003eMesenchyme: The mesenchyme, distributed between chorionic blood vessels and the chorionic epithelium, consists of cells with star-shaped cytoplasmic processes and columnar or elliptical nuclei. These cells are interconnected to form a network structure.\u003c/p\u003e\n\u003cp\u003eChorionic epithelium: The chorionic epithelium is primarily composed of two cell types\u0026mdash;binucleate cells and cuboidal cells\u0026mdash;located on the surface of villous branches. In the cotyledonary chorionic epithelium of Hu sheep at 90 days of pregnancy, a large number of binucleate cells are widely distributed (Figure 5). Together, these cells form the surface structure of the fetal placenta, serving as a barrier between the fetus and the mother.\u003c/p\u003e\n\u003cp\u003eUterine lacunar epithelium: At 90 days of pregnancy, the nuclei of the uterine lacunar epithelial cells are small, and the cells are flattened with obvious nuclear clustering (Figure 5). It has been suggested that this structure arises from the fusion of chorionic epithelial binucleate cells and uterine lacunar epithelial cells\u003csup\u003e[18]\u003c/sup\u003e, and it plays a crucial role in maintaining pregnancy.\u003c/p\u003e\n\u003cp\u003eUterine connective tissue: As branching of the uterine lacunar epithelium increases, the connective tissue becomes sparsely distributed and forms narrow structures. In the uterine mucosal layer adjacent to the uterine wall, connective tissue fibers are densely packed and neatly arranged, with numerous uterine glands distributed throughout.\u003c/p\u003e\n\u003cp\u003eUterine blood vessels: In the cotyledons of Hu sheep at 90 days of pregnancy, uterine blood vessels are extensively distributed around the uterine mucosa and uterine glands, extending to the cup-like opening of the cotyledons. An abundance of uterine blood vessels is essential for ensuring normal fetal development.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing Quality Control and Comparison Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe average data output per sample was 6.55 Gb. The average alignment rate of samples to the genome was 89.21%, with an average alignment rate of 63.90% to the gene set. Following quality control of the sequencing data, the average Q20 and Q30 values were 95.67% and 89.98%, respectively. These results demonstrate that the sequencing data are of high quality, high coverage, and reliability, making them suitable for subsequent differential analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Analysis of Gene Expression Levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the alignment results, a total of 14,174 genes were detected in the control group, while 14,127 genes were identified in the NCG-treated group. The distribution of gene expression levels (FPKM/TPM) across different samples is presented in a boxplot (Figure 6-D), which illustrates the median and interquartile range of expression values. As shown in Figure 6-B, the intra-group correlation of samples in both the control group and NCG-treated group was analyzed. The results revealed that the correlation coefficient (R\u0026sup2;) within each group exceeded 0.7 and approached 1, indicating good experimental reproducibility and validating the reliability of subsequent analyses.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScreening of Differentially Expressed Genes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the visualization (Figure 7-A), significantly upregulated genes are depicted in red, downregulated genes in blue, and non-significantly differentially expressed genes in gray. A total of 130 DEGs were identified, comprising 53 upregulated and 77 downregulated genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGO Enrichment Analysis of Differentially Expressed Genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs illustrated in Figure 7-C, GO functional enrichment analysis was conducted on the DEGs identified between the control group and the NCG-treated group. A total of 45 significantly enriched GO terms were detected (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), encompassing 22 biological processes (BPs), 15 cellular components (CCs), and 8 molecular functions (MFs). The BPs were primarily enriched in cellular processes, regulation of biological processes, responses to stimuli, and metabolic processes; the CCs were enriched in cells, cellular parts, membranes, and extracellular regions; and the MFs were enriched in binding, catalytic activity, transport activities, and molecular function regulators.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKEGG Enrichment Analysis of Differentially Expressed Genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in Figure 7-D, the KEGG pathway analysis listed the top 20 significantly enriched pathways associated with the identified DEGs, sorted by adjusted P-value (padj \u0026lt; 0.05). These pathways were found to include ECM-receptor interaction, oxidative phosphorylation, folate biosynthesis, and other processes related to organismal growth, development, nutrient supply, angiogenesis, vasodilation, fetal development, and signal transduction. Among the enriched pathways, the VEGF, Notch, Wnt/\u0026beta;-catenin, and PI3K-AKT signaling pathways are involved in processes such as cell growth and death, transport and catabolism, signal transduction, and amino acid metabolism.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptomic qPCR Validation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo validate the RNA-seq results, 12 differentially expressed genes (DEGs) identified between the control group and the NCG-treated group\u0026mdash;including 6 upregulated and 6 downregulated genes\u0026mdash;were randomly selected for RT-qPCR analysis. As shown in Figure 7-B, the mRNA expression trends of all 12 validated genes were consistent with the RNA-seq data. Compared with the control group, the expression levels of \u003cem\u003eAOX1\u003c/em\u003e, \u003cem\u003eMMP2\u003c/em\u003e, \u003cem\u003eSEPHS2\u003c/em\u003e, \u003cem\u003eTHBS2\u003c/em\u003e, \u003cem\u003eCACNA1A\u003c/em\u003e, and \u003cem\u003eMAP3K5\u003c/em\u003e were significantly downregulated in the NCG-treated group, whereas those of \u003cem\u003eTPH2\u003c/em\u003e, \u003cem\u003eSPP1\u003c/em\u003e, \u003cem\u003eCDA\u003c/em\u003e, \u003cem\u003eFLT1\u003c/em\u003e, \u003cem\u003eCNR1\u003c/em\u003e, and \u003cem\u003eNDUFA7\u003c/em\u003e were significantly upregulated. These validation results confirm the reliability of the transcriptomic sequencing data, supporting that the identified DEGs accurately reflect the gene expression differences between the two groups.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003e\u003cstrong\u003eEffects of NCG Supplementation on Uterine and Fetal Development Indices in Ewes during Early Pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of this study demonstrated that, compared with the control group, the NCG group showed significant improvements in uterine weight, number of fetuses, total litter weight, and average fetal weight. However, no significant differences were observed in fetal body measurements or relative organ weights between the two groups. These findings suggest that dietary supplementation with NCG enhances maternal reproductive performance without exerting adverse effects on fetal development. The observed increase in uterine weight indicates more pronounced uterine growth, which may help reduce the incidence of IUGR during late gestation. Interestingly, although the average fetal weight in the NCG group did not differ significantly from that in the control group, a notable upward trend was detected in amniotic fluid volume. This phenomenon may be attributed to NCG-induced alterations in amniotic fluid metabolismNakano\u003csup\u003e[18]\u003c/sup\u003e, which is consistent with previous reports by Wu\u003csup\u003e[19]\u003c/sup\u003e. Such metabolic modifications are likely to enhance nutrient supply in the maternal uterine environment, ensuring adequate nourishment for both the fetus and the mother, thereby improving embryonic survival rates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of NCG Supplementation on Blood Indices in Ewes during Early Pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFunctional amino acids (FAAs) play critical roles in placental angiogenesis and development\u003csup\u003e[20]\u003c/sup\u003e. Among the most extensively studied FAAs involved in placental vascular regulation are arginine-family amino acids (including arginine, glutamic acid, proline, citrulline, and ornithine), leucine, and sulfur-containing amino acids. Notably, arginine exerts multifaceted biological functions, including promoting angiogenesis, enhancing nitrogen metabolism, stimulating lactation and growth, and improving reproductive performance in animals\u003csup\u003e[21]\u003c/sup\u003e. In the present study, dietary supplementation with NCG significantly increased plasma concentrations of Arg, glutamic acid, proline, and leucine in ewes. This finding supports the hypothesis that NCG, as a structural analog of N-acetylglutamate (NAG), activates the key enzyme CPS-I, thereby enhancing endogenous Arg synthesis\u003csup\u003e[22]\u003c/sup\u003e. These results are consistent with previous work by Zhang\u003csup\u003e[12]\u003c/sup\u003e, who reported that supplementing 20 g/d rumen-protected Arg (RP-Arg) and 5 g/d NCG under 50% feed restriction significantly increased plasma amino acid concentrations in Hu sheep. The observed elevation in amino acid levels may reflect synergistic interactions within the NCG metabolic pathway, which ultimately exert beneficial effects on the growth and physiological status of ewes.\u003c/p\u003e\n\u003cp\u003eNO, hormones, and amino acids in maternal plasma play pivotal roles in regulating placental function and fetal development during pregnancy. NOS catalyzes the production of NO, with iNOS—a key isoform—capable of generating substantial NO levels under immune stimulation. As a potent vasodilator, NO is critical for maintaining placental vascular function and optimizing nutrient delivery to the fetus\u003csup\u003e[23]\u003c/sup\u003e. Elevated NO levels may thus enhance maternal growth and reproductive performance by improving uterine blood flow and nutrient supply. In the present study, the NCG-supplemented group exhibited significantly higher plasma concentrations of NO and iNOS compared to the control group. These findings are consistent with previous reports by Wang\u003csup\u003e[24]\u003c/sup\u003e, who observed a significant increase in plasma NO levels in lactating goats supplemented with 2 g/d NCG at 21 and 42 days postpartum. Furthermore, Zhang\u003csup\u003e[25]\u0026nbsp;\u003c/sup\u003edemonstrated that NCG supplementation elevated plasma iNOS levels in IUGR lactating lambs, providing additional support for our results. Collectively, these data suggest that NCG enhances NO synthesis, potentially via iNOS activation, thereby improving placental vascular function and maternal-fetal nutrient exchange.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of NCG Supplementation on Cotyledon and HE Staining Indices in Ewes during Early Pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUterine glands are critical anatomical structures responsible for histotroph secretion and maternal-fetal material transport\u003csup\u003e[26]\u003c/sup\u003e, playing an indispensable role in embryonic nutrition. Our experimental results showed that the number of uterine glands in the NCG-supplemented group was significantly greater than that in the control group. This observation is consistent with previous findings by Pramod\u003csup\u003e[27]\u003c/sup\u003e, who reported that increased uterine gland density enhances nutrient secretory capacity, thereby supporting fetal development. The secretory function of uterine glands is mediated by glandular epithelial cells, with secretory capacity being directly proportional to the number of epithelial cells\u003csup\u003e[28]\u003c/sup\u003e. Although no significant differences were observed in the perimeter or cross-sectional area of individual glands between the two groups, the increased count of uterine glands in NCG-treated ewes suggests a corresponding increase in the total number of glandular epithelial cells. This histological adaptation likely facilitates enhanced nutrient exchange at the maternal-fetal interface.\u003c/p\u003e\n\u003cp\u003eCattle and sheep both possess a cotyledonary placenta, yet their structural organization differs significantly\u003csup\u003e[29]\u003c/sup\u003e. Whereas bovine placentation follows a \"fetus-enveloping-mother\" pattern, ovine placentation exhibits an inverse \"mother-enveloping-fetus\" architecture, characterized by maternal caruncles forming bowl-shaped structures that encapsulate fetal cotyledons. Hematoxylin-eosin (HE) staining revealed that cotyledonary villous branches were highly abundant in Hu sheep at 90 days of gestation, with a complex internal structure. Maternal placental lacunae and villous branches were alternately nested, with distinct staining patterns: the maternal cotyledonary components appeared redder, while the fetal components were purple. Consistent with anatomical descriptions\u003csup\u003e[30]\u003c/sup\u003e, the complete barrier structure of the cotyledonary tissue in Hu sheep comprises six layers from fetus to mother: chorionic blood vessels, mesenchyme, chorionic epithelium, uterine lacunar epithelium, uterine connective tissue, and uterine blood vessels. The first three layers form the fetal placenta, and the latter three constitute the maternal placenta. There is no direct blood contact between the mother and fetus; instead, they are connected via interlaced maternal lacunae and villous branches, which serve as the primary sites for nutrient supply, gas exchange, and metabolite excretion\u003csup\u003e[31]\u003c/sup\u003e. A large number of syncytiotrophoblasts are distributed within the maternal lacunae, a structure formed by the migration of fetal binucleate cells\u003csup\u003e[32]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn this experiment, the average thickness of the uterine mucosa in the NCG-treated group was significantly lower than that in the control group. Cotyledons play a key role in embryonic development by expanding the effective maternal-fetal exchange area\u003csup\u003e[33]\u003c/sup\u003e, which is determined by the number of fetal villous branches and their degree of embedding into the endometrium—with more branches and deeper embedding leading to an increased exchange area. Under the same conditions, a thinner maternal uterine mucosa allows for deeper chorionic embedding and more intensive material exchange within the cotyledons. Given that elevated NO levels during pregnancy positively regulate extravillous trophoblast invasion\u003csup\u003e[34]\u003c/sup\u003e, and that NCG supplementation increased NO content in the present study, it is suggested that NCG may enhance chorionic invasion into the maternal endometrium via NO-mediated pathways, thereby facilitating maternal-fetal communication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptomic Sequencing and qPCR Validation of Maternal Placental Tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThrough GO and KEGG enrichment analyses, differential expression analysis of upregulated and downregulated genes revealed that significantly upregulated genes were primarily enriched in pathways related to IGF binding, VEGF-A/B, PLGF, and VEGF receptor activity, while downregulated genes were enriched in pathways associated with heparin binding, Roundabout binding, and PGI synthase activity.\u003c/p\u003e\n\u003cp\u003eVEGF is widely recognized as a key regulator of angiogenesis\u003csup\u003e[35]\u003c/sup\u003e. Its family members, including VEGF-A/B/C/D and PLGF\u003csup\u003e[36]\u003c/sup\u003e, exhibit high homology\u003csup\u003e[37]\u003c/sup\u003e. As a potent endothelial growth factor, VEGF induces vasodilation and enhances blood flow by increasing NO production, while PLGF—commonly known as placental growth factor-1—acts as a strong enhancer of endothelial permeability. VEGF shows high nutritional sensitivity. Previous studies have demonstrated that when nutrient intake transitions from adequate to inadequate, the expression of placental VEGF mRNA in cotyledons increases, which correlates with elevated maternal progesterone levels\u003csup\u003e[38]\u003c/sup\u003e. This aligns with our findings, indicating that the increased VEGF mRNA expression in cotyledons of NCG-supplemented pregnant Hu sheep may be directly mediated by progesterone. In placental lobules, nutrient restriction leads to increased \u003cem\u003eFLT1\u003c/em\u003e mRNA expression\u003csup\u003e[39]\u003c/sup\u003e, which is consistent with our observations in ewes. This is likely because \u003cem\u003eFLT1\u003c/em\u003e functions as a receptor for VEGF\u003csup\u003e[39]\u003c/sup\u003e. VEGF participates in neovascularization via the PI3K-AKT signaling pathway\u003csup\u003e[40]\u003c/sup\u003e. This pathway regulates fundamental cellular functions such as translation, proliferation, and growth arrest\u003csup\u003e[41,42]\u003c/sup\u003e. KEGG pathway analysis further revealed close associations between the PI3K-AKT signaling pathway and VEGF. During angiogenesis and vascular network formation, blood flow within vessels induces shear stress on endothelial cells. This activates the KLF2 transcription factor, which responds to shear stress on the endothelial cell membrane, leading to increased expression of NOS regulatory proteins. This is supported by the elevated plasma NO and iNOS levels observed in our study, which ultimately regulate vascular endothelial growth factor receptor (VEGFR). Research has demonstrated that KLF2 regulation is mediated through the PI3K-AKT signaling pathway\u003csup\u003e[43]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCNR1\u003c/em\u003e and \u003cem\u003eCNR2\u003c/em\u003e are members of the cannabinoid receptor (CNR) family. The \u003cem\u003eCNR1\u0026nbsp;\u003c/em\u003egene regulates food intake and fat content in the hypothalamus\u003csup\u003e[44]\u003c/sup\u003e. Schwartz's team\u003csup\u003e[45]\u003c/sup\u003e found that this gene is expressed in the central nervous system (including the hypothalamus) and is involved in appetite regulation. Furthermore, \u003cem\u003eCNR1\u0026nbsp;\u003c/em\u003ecan positively regulate the MAPK signaling pathway, which is crucial for cellular functions such as growth, differentiation, and apoptosis. It also promotes the early differentiation of skeletal progenitor cells into osteoblasts and accelerates bone mineralization\u003csup\u003e[46]\u003c/sup\u003e. Notably, the high expression of \u003cem\u003eCNR1\u003c/em\u003e in the NCG group may be closely associated with the regulation of the MAPK pathway and cellular growth/differentiation.\u003c/p\u003e\n\u003cp\u003eInsulin-like growth factor (IGF) exerts biological activity by binding to cell surface receptors\u003csup\u003e[47]\u003c/sup\u003e. As a broad-spectrum growth promoter, IGF plays a crucial role in embryonic development\u003csup\u003e[48]\u003c/sup\u003e. IGF-binding proteins (IGFBPs) exhibit diverse physiological functions\u003csup\u003e[49]\u003c/sup\u003e, specifically, \u003cem\u003eIGFBP3\u003c/em\u003e is involved in cell proliferation, differentiation, and apoptosis\u003csup\u003e[50]\u003c/sup\u003e. Gadd\u003csup\u003e[51]\u003c/sup\u003e observed lower\u003cem\u003e\u0026nbsp;IGFBP3\u003c/em\u003e expression in uterine glands of adolescents with intrauterine growth restriction in high/medium dose groups, which aligns with our findings that NCG promotes uterine development in Hu sheep by enhancing IGFBP3 expression.\u003c/p\u003e\n\u003cp\u003eAmong the upregulated differentially expressed genes, \u003cem\u003eTPH2\u003c/em\u003e was significantly increased in the NCG group. This gene catalyzes the conversion of L-tryptophan to 5-hydroxy-L-tryptophan (5-HT), thereby regulating levels of gonadotropin-releasing hormone (GnRH) and luteinizing hormone (LH) to support pregnancy maintenance and placental development. For downregulated differentially expressed genes, \u003cem\u003eMAP3K5\u003c/em\u003e was significantly enriched in KEGG pathways, participating in MAPK signaling and endoplasmic reticulum protein processing. \u003cem\u003eMAP3K5\u003c/em\u003e belongs to the \u003cem\u003eMAP3K5\u003c/em\u003e family\u003csup\u003e[52]\u003c/sup\u003e and regulates intercellular junctions and the actin cytoskeleton\u003csup\u003e[53]\u003c/sup\u003e. In mammals, knockout of \u003cem\u003eMAP3K5\u003c/em\u003e impairs brown adipose tissue function, accelerates energy expenditure, reduces fat accumulation, and induces metabolic disorders\u003csup\u003e[54]\u003c/sup\u003e. The upregulation of \u003cem\u003eCNR1\u003c/em\u003e and downregulation of \u003cem\u003eMAP3K5\u003c/em\u003e in uterine tissues are both associated with the MAPK signaling pathway. This suggests that NCG may influence fat deposition and energy metabolism in pregnant ruminants. Figure 8 shows the effect of dietary NCG on placental development in pregnant ewes during the first three months of gestation and the mechanism by which changes in VEGF and PI3K-AKT pathways improve reproductive performance.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eThis study demonstrated that dietary supplementation with 0.11% NCG in pregnant ewes (days 0\u0026ndash;90 of gestation) significantly improved endometrial parameters in primiparous Hu sheep, including total endometrial weight, average individual cotyledon weight, mucosal thickness, and uterine gland count. The treatment enhanced reproductive performance by promoting endogenous arginine synthesis, increasing plasma levels of NO, arginine, and specific amino acids, and altering the expression patterns of genes such as \u003cem\u003eCNR\u003c/em\u003e1, \u003cem\u003eTPH2\u003c/em\u003e, \u003cem\u003eFLT1\u003c/em\u003e, and \u003cem\u003eMAP3K5\u003c/em\u003e, as well as signaling pathways related to angiogenesis, energy metabolism, and growth regulation. These changes optimized the uterine microenvironment and nutrient supply, thereby creating favorable conditions for maintaining pregnancy and supporting fetal development.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments in this study were approved by Lanzhou Qilihe Wanshan Cooperative and fully approved by the Animal Ethics Committee of College of Life Science and Engineering, Northwest Minzu University (xbmu-sm-2021060).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors approved the final manuscript and the submission to this journel.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data requested by your journal has been submitted to the GSA database at the National Center for Biotechnology Information (NCBI), with the login number PRJNA1302455.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declares that they have No competing financial interests exist.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNational Key R\u0026amp;D Program (14th Five-Year Plan) (2024 YFD1301002);\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLanzhou Municipal Science and Technology Program (2021-1-171);\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFundamental Research Funds for the Central Universities (31920240045).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGao and Li are primarily responsible for sheep feeding, data collection, analysis, and thesis writing;\u003c/p\u003e\n\u003cp\u003eZheng mainly contributes to paper revisions;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eZaxi focuses on guiding the slicing experiments;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCai handles experimental design, guidance, sample collection, data analysis, and paper revisions;\u003c/p\u003e\n\u003cp\u003eZang, Liu, and Yang mainly participate in sample collection;\u003c/p\u003e\n\u003cp\u003eLi, Shi, and Huang also contribute to sample collection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;This research is supported by the 14th Five-Year Plan Key R\u0026amp;D Program (2024YFD1301002), Lanzhou Science and Technology Plan Project (2021-1-171), and Central University Basic Research Fund (31920240045). We are grateful to all authors for their contributions, as well as the experimental sites and laboratory animals provided by Wanshanhe District and Qilihe District of Lanzhou.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLi Y, Chen Z, Fang Y, et al. Runs of Homozygosity Revealed Reproductive Traits of Hu Sheep. Genes (Basel). 2022;13(10):1848.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao F, Xie R, Fang L, et al. Analysis of 206 whole-genome resequencing reveals selection signatures associated with breed-specific traits in Hu sheep. Evol Appl. 2024;17(6):e13697.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAppleton J, Arginine. Clinical potential of a semi-essential amino acid. Altern Med Rev. 2002;7(6):512\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIgnarro LJ. Nitric oxide as a unique signaling molecule in the vascular system: a historical overview. J Physiol Pharmacol. 2002;53(4 Pt 1):503\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu G, Bazer FW, Hu J, et al. Polyamine synthesis from proline in the developing porcine placenta. Biol Reprod. 2005;72(4):842\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWilkinson DL, Bertolo RF, Brunton JA, et al. Arginine synthesis is regulated by dietary arginine intake in the enterally fed neonatal piglet. Am J Physiol Endocrinol Metab. 2004;287(3):E454\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeine JL, Jia G, Van Emon ML, et al. Effects of maternal nutrition and rumen-protected arginine supplementation on ewe performance and postnatal lamb growth and internal organ mass. J Anim Sci. 2018;96(8):3471\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu G, Knabe DA, Kim SW. Arginine nutrition in neonatal pigs. J Nutr. 2004;134(10 Suppl):S2783\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu G, Bazer FW, Davis TA, et al. Arginine metabolism and nutrition in growth, health and disease. Amino Acids. 2009;37(1):153\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Bazer FW, Johnson GA, et al. Dietary supplementation with L-arginine between days 14 and 25 of gestation enhances embryonic development and survival in gilts. Amino Acids. 2014;46(2):375\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu X, Yin YL, Liu YQ, et al. Effect of dietary arginine and N-carbamoylglutamate supplementation on reproduction and gene expression of eNOS, VEGFA and PlGF1 in placenta in late pregnancy of sows. Anim Reprod Sci. 2012;132(3\u0026ndash;4):187\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Sun L, Wang Z, et al. N-carbamylglutamate and L-arginine improved maternal and placental development in underfed ewes. Reproduction. 2016;151(6):623\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Zhang Y, Ma Y, Elsabagh M, Wang H, Wang M. Dietary rumen-protected L-arginine or N-carbamylglutamate attenuated fetal hepatic inflammation in undernourished ewes suffering from intrauterine growth restriction. Anim Nutr. 2021;7(4):1095\u0026ndash;104.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLangmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKanehisa M, Araki M, Goto S, et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008;36(Database issue):D480\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakano H, Shimada A, Imai K, Takahashi T, Hashizume K. The cytoplasmic expression of E-cadherin and beta-catenin in bovine trophoblasts during binucleate cell differentiation. Placenta. 2005;26(5):393\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu G, Meininger CJ, Knabe DA, et al. Arginine nutrition in development, health and disease. Curr Opin Clin Nutr Metab Care. 2000;3(1):59\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu G, Bazer FW, Johnson GA, et al. Functional amino acids in the development of the pig placenta. Mol Reprod Dev. 2017;84(9):870\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChacher B, Liu H, Wang D, et al. Potential role of N-carbamoyl glutamate in biosynthesis of arginine and its significance in production of ruminant animal. J Anim Sci Biotechnol. 2013;4:303\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa W, Yuan M, Chang S, Wang C. N-carbamylglutamate supplementation regulates hindgut microbiota composition and short-chain fatty acid contents in Charollais and Small Tail Han crossbred sheep. Front Vet Sci. 2023;10:1230190.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJin M, Cao B, Lin C, et al. Tianma Gouteng Decoction Exerts Pregnancy-Protective Effects Against Preeclampsia via Regulation of Oxidative Stress and NO Signaling. Front Pharmacol. 2022;13:849074.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Z, Wang R, Meng C et al. Effects of dietary supplementation of N-carbamylglutamate on lactation performance of lactating goats and growth performance of their suckling kidlets[J]. Small Ruminant Res,2019;175142\u0026ndash;148.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Jin Y, Wang M, et al. N-Carbamylglutamate and l-arginine supplementation improve hepatic antioxidant status in intrauterine growth-retarded suckling lambs. RSC Adv. 2020;10(19):11173\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBazer FW, Spencer TE, Johnson GA, et al. Comparative aspects of implantation. Reproduction. 2009;138(2):195\u0026ndash;209.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDhakal P, Kelleher AM, Behura SK, et al. Sexually dimorphic effects of forkhead box a2 (FOXA2) and uterine glands on decidualization and fetoplacental development. Proc Natl Acad Sci U S A. 2020;117(38):23952\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang CK, Robinson RS, Flint AP, et al. Quantitative analysis of changes in endometrial gland morphology during the bovine oestrous cycle and their association with progesterone levels. Reproduction. 2007;134(2):365\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohnson GA, Bazer FW, Seo H, et al. Understanding placentation in ruminants: a review focusing on cows and sheep. Reprod Fertil Dev. 2023;36(2):93\u0026ndash;111.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu B. Morphological study of yak placenta during pregnancy [D]. Gansu Agricultural University; 2010.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBallasy N, Apantaku I, Dean W, Hemberger M. Off to a good start: The importance of the placental exchange surface - Lessons from the mouse. Dev Biol. 2025;517:248\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRozemarijn JB, Koen F, Soraya S et al. The immunological intrigue of microchimerism: tracing fetal and maternal cells throughout the body[J].Journal of Reproductive Immunology,2023,159.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKamal MM, Van Eetvelde M, Vandaele L, et al. Environmental and maternal factors associated with gross placental morphology in dairy cattle. Reprod Domest Anim. 2017;52(2):251\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePoniedziałek-Czajkowska E, Marciniak B, Kimber-Trojnar Z, et al. Nitric oxide in normal and preeclamptic pregnancy. Curr Pharm Biotechnol. 2011;12(5):743\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGraupera M, Claret M. Endothelial Cells: New Players in Obesity and Related Metabolic Disorders. Trends Endocrinol Metab. 2018;29(11):781\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShibuya M. Vascular endothelial growth factor and its receptor system: physiological functions in angiogenesis and pathological roles in various diseases. J Biochem. 2013;153(1):13\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCalvo PM, Hern\u0026aacute;ndez RG, Pastor AM, et al. VEGF Neuronal Survival Neuroscientist. 2024;30(1):71\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuther J, Milne J, Aitken R, et al. Placental growth, angiogenic gene expression, and vascular development in undernourished adolescent sheep. Biol Reprod. 2007;77(2):351\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLekatz LA, Ward MA, Borowicz PP, et al. Cotyledonary responses to maternal selenium and dietary restriction may influence alterations in fetal weight and fetal liver glycogen in sheep. Anim Reprod Sci. 2010;117(3\u0026ndash;4):216\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J, Wu X, Gong J, et al. Vascular endothelial growth factor induces multidrug resistance-associated protein 1 overexpression through phosphatidylinositol-3-kinase /protein kinase B signaling pathway and transcription factor specificity protein 1 in BGC823 cell line. Acta Biochim Biophys Sin (Shanghai). 2013;45(8):656\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXue C, Li G, Lu J, Li L. Crosstalk between circRNAs and the PI3K/AKT signaling pathway in cancer progression. Signal Transduct Target Ther. 2021;6(1):400.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSavova MS, Mihaylova LV, Tews D, et al. Targeting PI3K/AKT signaling pathway in obesity. Biomed Pharmacother. 2023;159:114244.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Z, Antila S, Nurmi H, et al. Blockade of VEGFR3 signaling leads to functional impairment of dural lymphatic vessels without affecting autoimmune neuroinflammation. Sci Immunol. 2023;8(82):eabq0375.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePei SJ, Zhu HY, Guo JH, et al. Knockout of CNR1 prevents metabolic stress-induced cardiac injury through improving insulin resistance (IR) injury and endoplasmic reticulum (ER) stress by promoting AMPK-alpha activation. Biochem Biophys Res Commun. 2018;503(2):744\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchwartz MW, Woods SC, Porte D Jr, et al. Central nervous system control of food intake. Nature. 2000;404(6778):661\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGreenblatt MB, Shim JH, Bok S, Kim JM. The Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase Pathway in Osteoblasts. J Bone Metab. 2022;29(1):1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaxter RC. Signaling Pathways of the Insulin-like Growth Factor Binding Proteins. Endocr Rev. 2023;44(5):753\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOkawa ER, Gupta MK, Kahraman S, et al. Essential roles of insulin and IGF-1 receptors during embryonic lineage development. Mol Metab. 2021;47:101164.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eForbes BE, Blyth AJ, Wit JM. Disorders of IGFs and IGF-1R signaling pathways. Mol Cell Endocrinol. 2020;518:111035.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi HB, Wang D, Zhang Y, et al. IGFBP3 Enhances Treatment Outcome and Predicts Favorable Prognosis in ABC-DLBCL. J Oncol. 2023;2023:1388041.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGadd TS, Aitken RP, Wallace JM, et al. Effect of a high maternal dietary intake during mid-gestation on components of the utero-placental insulin-like growth factor (IGF) system in adolescent sheep with retarded placental development. J Reprod Fertil. 2000;118(2):407\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePu L, Zhang LC, Zhang JS, et al. Porcine MAP3K5 analysis: molecular cloning, characterization, tissue expression pattern, and copy number variations associated with residual feed intake. Genet Mol Res. 2016;15(3):104238.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRolf MM, Taylor JF, Schnabel RD, et al. Genome-wide association analysis for feed efficiency in Angus cattle. Anim Genet. 2012;43(4):367\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMoody L, Shao J, Chen H, Pan YX. Maternal Low-Fat Diet Programs the Hepatic Epigenome despite Exposure to an Obesogenic Postnatal Diet. Nutrients. 2019;11(9):2075.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hu sheep, N-carbamylglutamate (NCG), Transcriptomic sequencing, Reproductive performance, Fetal development","lastPublishedDoi":"10.21203/rs.3.rs-7371628/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7371628/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e\u003cp\u003eTo investigate the effects of dietary supplementation with 0.11% N-carbamylglutamate (NCG) during early pregnancy (0\u0026ndash;90 days) on reproductive performance and fetal development, as well as to elucidate the underlying molecular mechanisms in primiparous Hu sheep.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eTwelve 10-month-old sexually mature primiparous Hu sheep meeting the mating criteria were randomly assigned to two groups. The control group was fed a basal diet, while the NCG group received the basal diet supplemented with 0.11% NCG, with both feeding regimens maintained for 90 days. Through measurements of uterine and fetal growth indices, maternal plasma biochemical parameters, and amino acid levels, as well as assessments of cotyledon indices, observations of cotyledon morphology and histological structure, and transcriptomic sequencing of maternal placental tissue, the mechanism by which NCG influences placental function and fetal growth and development in pregnant ewes was investigated..\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eDietary supplementation with NCG significantly increased fetal number, total fetal weight, corpus luteum count, fetal-to-luteum ratio, plasma levels of NO, iNOS, and concentrations of several amino acids (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In ewes' uteri, the average uterine weight, number of uterine glands, total cotyledon weight, and average weight per cotyledon were significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas uterine mucosal thickness was markedly decreased. The q-PCR results for differentially expressed genes were consistent with those of transcriptomic analysis, showing significant changes in the expression levels of certain differentially expressed genes in maternal placental tissues. These changes regulated pathways such as VEGF, IGF, PI3K-AKT and MAPK, which are involved in angiogenesis, energy supply and metabolism, and somatic growth and development..\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eDietary supplementation with NCG during early pregnancy can significantly improve the reproductive performance of primiparous Hu sheep, optimize the intrauterine environment and nutrient supply, and thereby facilitate pregnancy maintenance and fetal development. The underlying mechanism may involve promoting endogenous arginine synthesis in ewes, increasing plasma levels of NO, arginine, and certain amino acids, which collectively validate the positive effects of NCG on the reproductive performance and growth of Hu sheep during early pregnancy at the molecular level.\u003c/p\u003e","manuscriptTitle":"Study on the effect of N-carbamylglutamate (NCG) on reproductive performance and regulation mechanism of primary lake sheep","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-08 11:55:59","doi":"10.21203/rs.3.rs-7371628/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b1680cb0-3fff-4c93-bd04-0a862f9ef68e","owner":[],"postedDate":"September 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-06T09:24:49+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-08 11:55:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7371628","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7371628","identity":"rs-7371628","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}