Cloning and assessment of cold resistance in the transcription factor PhIPT5 from Populus hopeiensis

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background: Populus hopeiensis, a significant afforestation species, faces substantial growth constraints due to cold stress. The IPT gene, a pivotal rate-limiting enzyme in cytokinin synthesis, plays a crucial role in controlling plant reactions to both biotic and abiotic pressures. In this study, we isolated the PhIPT5 gene from Populus hopeiensis and analyzed its biological characteristics and cold tolerance with the aim of providing guidance for the production of cold-resistant poplars. Results: The coding sequence (CDS) of the PhIPT5 gene spans 981 bp, encoding 333 amino acid residues with a molecular weight of 37.07 kDa. The PhIPT5 protein has alkaline stability and hydrophilicity. Phylogenetic analysis revealed that Populus hopeiensis IPT5 is closely related to Populus alba. Subcellular localization studies revealed the chloroplastic localization of PhIPT5. We constructed an overexpression vector for PhIPT5 and transformed it into Populus hopeiensis, resulting in improved cold tolerance in transgenic seedlings. Analysis of cytokinin metabolites revealed significantly greater levels in leaves harboring the PhIPT5 gene than in those harboring the CK gene even after exposure to cold. Furthermore, our findings suggest that the PhIPT5 gene primarily regulates the isoamyl pyrophosphate cytokinin metabolism pathway, leading to the synthesis of tZ, iP, and DZ cytokinins. Conclusion: Our isolation of PhIPT5 from Populus hopeiensis demonstrated that its overexpression enhances resistance to cold stress in transgenic plants. This work provides a foundation for further elucidating the function of IPT genes and has significant implications for advancing research on enhancing cold tolerance in Populus hopeiensis.
Full text 153,488 characters · extracted from preprint-html · click to expand
Cloning and assessment of cold resistance in the transcription factor PhIPT5 from Populus hopeiensis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cloning and assessment of cold resistance in the transcription factor PhIPT5 from Populus hopeiensis Qi Zhang, Tiantian Bi, Ning Wang, Jinling Dai, Yue Bai This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4943804/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Jun, 2025 Read the published version in BMC Plant Biology → Version 1 posted 4 You are reading this latest preprint version Abstract Background: Populus hopeiensis, a significant afforestation species, faces substantial growth constraints due to cold stress. The IPT gene, a pivotal rate-limiting enzyme in cytokinin synthesis, plays a crucial role in controlling plant reactions to both biotic and abiotic pressures. In this study, we isolated the PhIPT5 gene from Populus hopeiensis and analyzed its biological characteristics and cold tolerance with the aim of providing guidance for the production of cold-resistant poplars. Results: The coding sequence (CDS) of the PhIPT5 gene spans 981 bp, encoding 333 amino acid residues with a molecular weight of 37.07 kDa. The PhIPT5 protein has alkaline stability and hydrophilicity. Phylogenetic analysis revealed that Populus hopeiensis IPT5 is closely related to Populus alba . Subcellular localization studies revealed the chloroplastic localization of PhIPT5. We constructed an overexpression vector for PhIPT5 and transformed it into Populus hopeiensis , resulting in improved cold tolerance in transgenic seedlings. Analysis of cytokinin metabolites revealed significantly greater levels in leaves harboring the PhIPT5 gene than in those harboring the CK gene even after exposure to cold. Furthermore, our findings suggest that the PhIPT5 gene primarily regulates the isoamyl pyrophosphate cytokinin metabolism pathway, leading to the synthesis of tZ, iP, and DZ cytokinins. Conclusion: Our isolation of PhIPT5 from Populus hopeiensis demonstrated that its overexpression enhances resistance to cold stress in transgenic plants. This work provides a foundation for further elucidating the function of IPT genes and has significant implications for advancing research on enhancing cold tolerance in Populus hopeiensis . Populus hopeiensis PhIPT5 Cytokinin Cold stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Background Plant endogenous hormones are organic compounds synthesized in plants and primarily include auxin, cytokinin, gibberellin, abscisic acid, ethylene and brassinosterol [ 1 ]. Throughout the process of plant growth, these various hormones collectively regulate plant growth and development by either promoting or inhibiting one another [ 2 ]. IPT gene research has shown that cytokinins (CTKs) can stimulate plant cell division and expansion, participate in bud differentiation and apical dominance, and delay leaf senescence [ 3 , 4 ]. In addition to influencing root elongation, they also affect various other plant growth and development processes. Furthermore, their involvement is crucial in how plants respond to stress [ 5 ]. Isopentenyl transferases (IPTs) function as the primary rate-limiting enzymes in cytokinin (CTK) synthesis, and their activity is regulated by this process [ 6 ]. Initially, discovered in Agrobacterium tumefaciens , this gene family includes ATP/ADP-IPTs and tRNA-IPTs. The former enzymes utilize ATP or ADP as their primary substrates, leading to the biosynthesis of isopentenyladenine (iP)-type and trans-zeatin (tZ)-type cytokinins (CTKs). In contrast, tRNA-IPTs are responsible for synthesizing cis-zeatin (cZ)-type CTKs by transferring the isopentenyl group to the N6 atom of adenine in tRNA [ 7 – 9 ]. Under stress conditions, activation of the isopentenyltransferase gene leads to the production of CTK, which effectively scavenges free radicals, enhances SOD and CAT enzyme activities, reduces lipid peroxidation, and minimizes MDA accumulation. These actions collectively mitigate stress-induced damage to plant growth and development [ 10 , 11 ]. The IPT gene family has been identified in Arabidopsis thaliana , Oryza sativa , Solanum lycopersicum , and Malus domestica , and similar homologous IPT genes have been cloned in Humulus lupulus , Glycino max , Zea mays , and Malus hupehensis , among other cultivated plants. Furthermore, it has been established that the expression levels of this gene closely correlate with plant cytokinin content, leaf aging processes, increased yield potential, and enhanced stress resistance mechanisms within these plant species[ 12 – 21 ]. Zhang et al. utilized a biolistic transformation method to introduce the IPT gene into Festuca elata and reported enhanced cold resistance as well as delayed senescence in transgenic plants [ 22 ]. Yu et al. demonstrated that overexpression of the IPT gene in transgenic rice maintained normal physiological activities and high root vitality under cold stress conditions while reducing cold-induced damage to plants [ 23 ]. These findings collectively suggest that the regulation of CTK levels mediated by IPT genes can modulate plant resistance mechanisms. Currently, research on IPT genes has focused predominantly on herbaceous species, with limited exploration within woody poplar species, particularly with respect to stress resistance. Populus hopeiensis , a member of the Salicaceae family, is a hybrid species resulting from the crossbreeding of Populus tomentosa and Populus davidiana. Known for its tall, straight, and aesthetically pleasing appearance, characterized by smooth bark and a large round crown, this tree has emerged as an exceptional choice for afforestation and landscaping in the Loess Plateau and sandstorm-prone areas of Northwest China and North China. Its well-developed root system, robust growth potential, rapid maturation, and high adaptability make it uniquely suited to these challenging environments [ 24 ]. In this study, we successfully cloned the coding region sequence of the isovalenyltransferase gene PhIPT5 from Populus hopeiensis . Through bioinformatics methods, including sequence analysis, subcellular localization, tissue-specific expression analysis, and assessment of the low-temperature stress response at the gene level, our findings lay a solid foundation for deeper insights into the biological functions of IPT genes in poplar growth development as well as their stress responses. This work aims to provide valuable reference data for future research in poplar breeding. method Materials The plant material utilized comprised Populus hebeiensis tissue culture seedlings. The strains used included E. coli DH5α and Agrobacterium tumefaciens GV3101. Vector construction involved the utilization of the plasmids pMD19-T and pCAMBIA1302. These materials were housed in the Forest Tree Genetics and Breeding Laboratory at Inner Mongolia Agricultural University. RT‒qPCR The RNA extraction process involved the utilization of a specialized kit (TIANGEN's RNAprep Pure Plant Plus Kit) for isolating total RNA from leaves, followed by quality assessment through gel electrophoresis. Reverse transcription was subsequently employed to synthesize first-strand cDNA. Transcriptome data were utilized for primer design to screen the IPT gene and isolate PhIPT5 cDNA. A specific primer set, IPT5 F/R, was designed on the basis of the cDNA sequence via version 5.0 of a program. The target gene was then amplified from genomic DNA via these primers, resulting in the isolation of the full-length PhIPT5 gene via PCR under specific cycling conditions. A gel recovery kit was used for product retrieval following electrophoretic detection, as per the kit instructions. The recovered DNA fragments were ligated into the pMD19-T vector according to Table 4 specifications and transformed into E. coli DH5α cells for resistance screening on LB solid media supplemented with 50 mg·L − 1 kanamycin. Positive monoclonal colonies were selected for colony PCR with the reaction system detailed in (Table 1 ), and the bacterial mixture exhibiting the correct bands was subjected to sequencing analysis. To investigate the impact of cold stress and different levels of overexpression on the expression of the PhIPT5 gene, RNA was isolated from leaves and converted into cDNA via reverse transcriptase. The PhIPT5 gene was then amplified via qRT‒PCR via specific primers (Table 1 ) and SYBR Green Master Mix (Roche). Three independent biological experiments were conducted with Actin as an internal reference. The fold change in expression level was determined via the ΔΔCT method (fold change = 2 −[ΔΔCT] ). The real-time fluorescence quantitative RT‒PCRs involved an initial incubation at 95°C for 3 min, followed by 35 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min; finally, the reaction was stored at 72°C for 7 min before being cooled to 4°C. Table 1 Cloning and quantitative primers for the PhIPT5 gene Uses Primer name Primer sequences Gene clone IPT5 -F 5’-3’GGAGAGAACACGGGGGACTTTGCAAC IPT5 -R 5’-3’ ATGACCATGAGGCTTTCTTTGACCG qRT‒PCR IPT5 -RT-F 5’-3’TTCAGGCACCATGCATCACT IPT5 -RT-R 5’-3’GATCGACCCGCTCTGATACG Reference genes Actin -F 5’-3’ACCCTCCAATCCAGACACTG Actin -R 5’-3’TTGCTGACCGTATGAGCAAG Sequence analysis of PhIPT5 NCBI ( https://www.ncbi.nlm.nih.gov/genbank/ ) was used to deduce the coding sequence of PhIPT5 on the NCBI website and explore homologous genes of PhIPT5 in the database. ProtParam ( https://web.ExPASy.org/protparam/ ) was used for analysis of physical and chemical properties, the Prot Scale ( http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=nasp_sopma.html ) was used for hydrophobicity analysis, and SOPMA ( http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page =nasp_sopma.html) and SWISS-MODEL ( https://swissmodel.ExPASy.org/ ) for the prediction of secondary and tertiary structures, respectively, and MEGA software was used to construct a phylogenetic tree with bootstrap values of 1000. Construction of the overexpression vector of the GFP fusion subcellular localization vector The overexpression vector pBWA(V)HS-ccdB-EGFP was obtained by linking PhIPT5 to pBWA(V) HS-CCDB-EGFP with Biorun 2× EasyClone Mix recombinase. The overexpression vector was transformed into DH5α receptor cells, and the positive clones were identified via colony PCR and sequenced for further identification. The correct plasmid transformed into Agrobacterium GV3101 receptive cells was detected, pBWA(V)HS-ccdB-EGFP was used as a negative control, positive clones were selected and propagated, Agrobacterium infection solution was prepared, and the OD 600 was adjusted to approximately 0.60. The lower epidermis of tobacco leaves was injected with a syringe, cultured in darkness for 48 h, and then observed and photographed under a confocal laser microscope. Genetic transformation and identification of transgenic strains of Populus hebeiensis The Agrobacterium GV3101 strain, transformed with the overexpression vector, was initially streaked onto LB solid media supplemented with 50 mg·L − 1 kanamycin and 50 mg·L − 1 rifampicin. Following incubation in the dark at 28°C for approximately 48 h, a single colony was selected and inoculated into 5 mL of LB liquid medium supplemented with 50 mg·L − 1 kanamycin and 50 mg·L − 1 rifampicin. The culture was then agitated at a constant temperature of 180 r for 12–18 h before being transferred to a larger volume (100 mL) of LB liquid medium containing the same concentrations of antibiotics for an additional period of 5–6 h, aiming for OD 600 values between 0.4–0.6. The mixture was subsequently centrifuged at 3500 r for 15 min to separate the supernatant from the pellet, which was subsequently resuspended in lysosomes for subsequent infection experiments. Multiple vials were selected, each containing robust Populus hebeiensis tissue culture seedlings with healthy, flat leaves. After young leaves were excised and 3‒6 vertical incisions were made along the main vein via a blade, the leaves were placed on coculture media for precultivation at 28°C in darkness for 1 d. The precultivated leaves were subsequently immersed in a previously prepared infection solution for 15 min. After removal from the solution, excess moisture was absorbed via sterile filter paper before placing the leaves back onto the coculture medium for further cocultivation at 28°C in darkness for 3 days. After the cocultivation process, the transgenic leaves were transferred to differentiation screening media, which were subsequently replaced approximately 15 days later. Upon reaching a length of approximately 2 cm, the kanamycin-resistant shoots were excised and transferred to rooting screening media. The resistant shoots successfully developed roots after approximately 12 d, and within 30 d, they had regenerated into complete plants, indicating the initial acquisition of the transgenic strains. Cold stress treatment and determination of the physiological indices of the transgenic plants On the basis of previous research on the response of the PhIPT5 gene to low temperatures, it can be inferred that the expression level of the PhIPT5 gene is particularly sensitive when subjected to stress at 5°C for 24 h. Consequently, two transgenic strains with a growth period of 60 days and high expression levels, along with nontransgenic control seedlings, were selected and exposed to a temperature of 5°C in an incubator for 24 hours. The CK strains treated at 25°C were used as the control group. All other conditions remained consistent except for the temperature variation, and each group included 3 biological replicates. Samples were collected immediately after stress treatment from segments spaced 3–6 at the apex of morphology to determine each index. Peroxidase (POD) and superoxide dismutase (SOD) activities, malondialdehyde (MDA) content, and conductivity were assessed. POD activity was measured through quantitative guaiacol oxidation; SOD activity inhibition of the photochemical reduction of nitrobenzene tetrazole was determined via spectrophotometry; the free MDA content was determined via the thiobarbituric acid method; the relative conductivity was determined via the immersion method; and the chlorophyll content was determined via ethanol extraction. Determination of cytokinin metabolites The 60-day-old CK and transgenic plants were provided by Wuhan Metville Biotechnology Co., LTD. The cytokinin metabolites of Hebei Poplar with the PhIPT5 gene and wild-type control lines were analyzed using the AB SciexQTRAP LC‒MS/MS platform, with 3 biological replications per sample. Differential gene expression analysis was conducted using the KEGG database ( https://www.ncbi.nlm.nih.gov/pmc/articles/PMC102409/ ) to enrich biochemical, metabolic, and signal transduction pathways associated with the differentially expressed genes . Results Cloning the PhIPT5 gene The RNAprep Pure Plant Plus Kit from TIANGEN was used for the extraction of total RNA from tissue-cultured seedlings of Populus tomentosa leaves, followed by reverse transcription of the extracted total RNA via the TaKaRa PrimeScript RT reagent Kit to generate cDNA. The Populus hopeiensis cDNA was used as a template for PCR amplification of its coding sequence. The PCR mixture comprised 10 µL of Easy Taq Mix, 1 µL each of upstream and downstream primers (10 µmol/L), 2 µL of template, and 6 µL of deionized water. The PCR program consisted of initial denaturation at 95°C for 3 min; one cycle at 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min; a final extension step at 72°C for 7 min; and storage at 4°C. The sequences of primers used are detailed in Table 2 . Agarose gel electrophoresis was employed to detect the amplified products. The relative expression of the PhIPT5 gene in young leaves was assessed via qRT‒PCR, while the expression of PhIPT5 under different temperature stresses (exposed to 25°C, 10°C, 5°C, and 0°C for 3 h) was analyzed. The RT‒PCR results indicated that at 25°C, the relative expression of PhIPT5 in young leaves remained stable over time; however, as the temperature decreased, the relative expression of PhIPT5 decreased to approximately 1/4 (Fig. 1 ). These findings suggest that varying cold stress conditions influence the regulation of the PhIPT5 gene in young leaves. Bioinformatics analysis of the PhIPT5 gene The full predictive open reading frame (ORF) of PhIPT5 spans 981 base pairs and codes for a total of 333 amino acids(Fig. 2 ). The expected protein has a molecular weight of 37.07 kDa, an isoelectric point of 7.64 (alkaline), an instability coefficient of 36.86, and a hydrophobicity value of -0.223. These results strongly indicate that the PhIPT5 protein can be classified as a stable alkaline hydrophilic protein. Upon analysis, it was determined that among the 327 amino acids constituting the PhIPT5 protein, approximately 49.24% formed alpha helices, while approximately 11.62% formed extended strand structures; the remaining portion (39.14%) adopted random coil configurations (Fig. 3 A). Additionally, the tertiary structure model reveals a tightly folded core region alongside a more loosely arranged area, which may play a crucial role in maintaining the overall structural integrity and functionality of the protein(Fig. 3 B). The amino acid sequences of PhIPT5 were compared with those of 15 species showing high homology in the NCBI database, including Populus alba , Populus nigra , Populus trichocarpa , Populus euphratica , Salix koriyanagi , Salix suchowensis , Ricinus communis , and Tripterygium wilfordii . Hevea brasiliensis , Hibiscus trionum , Gossypium hirsutum , Manihot esculenta , Hibiscus syriacus and Euphorbia lathyris . MEGA 6.0 software was used to construct the phylogenetic tree (Fig. 4 ). The resulting tree revealed three major branches: Euphorbia lathyris formed a single branch within Euphorbiaceae ; Ricinus communis , Hevea brasiliensis and Manihot esculenta grouped into another branch; and the remaining species clustered into the third branch. The genetic and evolutionary relationships between the PhIPT5 protein from Populus hopeien sis and that from Populus alba are closely related. Subcellular localization of GFP-PhIPT5 in transiently transformed tobacco To determine the precise subcellular localization of the PhIPT5 protein, this investigation developed the fusion expression vector p35S::PhiPT5-GFP, which enables the expression of the fusion protein in tobacco leaves through Agrobacterium tumefaciens -mediated delivery. The findings depicted in (Fig. 5 ) revealed that the fluorescence signal of p35S::PhIPT5 coincided with that of the endoplasmic reticulum localization marker HDEL (His-Asp-Glu-Leu)-Mcherry, suggesting the potential localization of PhIPT5 within chloroplasts. Generation of a transgenic Populus hopeiensis strain The plant overexpression vector pCAMBIA1302::PhIPT5 was constructed through double enzyme digestion and T4 DNA ligase. The DH5α strain of Escherichia coli was then transformed, and Kana-resistant LB medium was used for positive screening. After correct sequencing of a single colony, the plasmid was isolated and subsequently introduced into Agrobacterium GV3101 in its competent state for screening resistance to rifampicin. Following the shaking of a single colony, colony PCR was employed to verify the successful transfer of the target gene and vector to Agrobacterium. During the coculture process, when white Agrobacterium appeared around the leaves, they were transferred to differentiation medium for screening. Some transgenic leaves produced resistant differentiated buds, whereas others withered and died. Each resistant bud was separated and numbered. When the resistant bud reached approximately 2 cm in size, it was cut off and transferred to rooting screening medium for further screening. After approximately 10 days, transgenic resistant buds developed adventitious roots and regenerated into whole plants; any false positive meristem buds that failed to take root were discarded. The rooted transgenic tissue culture-generated seedlings were cultivated at room temperature before being transplanted into small pots; after acclimatization in an artificial climate chamber, they were moved into larger pots before being finally transferred into a greenhouse (Fig. 6 ). Analysis of the cold tolerance of transgenic Populus hopeiensis overexpressing PhIPT5 The activity of the antioxidant enzymes SOD and POD, as well as the soluble protein content in plants, serve as indicators of the degree of stress-induced damage to plants. Following a 3h exposure to 0°C stress, both SOD and POD activities, along with soluble protein levels, increased in CK and transgenic Populus hebeiensis compared with those at 25°C. Notably, the activities of SOD, POD, and soluble protein were significantly greater in the transgenic strains than in the CK strains(Fig. 7 ). The MDA content and conductivity are indicators of cell membrane integrity. After 3 h of exposure to 0°C stress, the MDA content and conductivity increased in both CK and transgenic Populus hopeiensis compared with those at 25°C; however, the MDA content and conductivity were lower in the transgenic strain than in the CK strain(Fig. 7 ). At 25°C, the chlorophyll and carotenoid contents were notably greater in transgenic strain No. 1 than in the CK control or transgenic strain No. 2. As the temperature decreased, both the chlorophyll and carotenoid contents decreased to varying degrees for both the transgenic and CK strains. Nevertheless, at 5°C, these contents remained greater for the transgenic strains than for the CK strains(Fig. 7 ). Under cold stress conditions, the levels of soluble protein, POD, SOD, and chlorophyll were significantly greater for transgenics than for CKs; moreover, the increase in MDA content and conductivity was markedly lower. These results indicate that, under cold stress conditions, transgenics exhibit greater resistance than their CK counterparts. Determination of cytokinin metabolites in transgenic Populus hebeiensis under cold stress The cytokinin metabolites of the transgenic and nontransgenic strains of Populus hebeiensis were analyzed via ultrahigh-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS). A total of 36 cytokinin metabolites were identified (Table 2 ). Table 2 Cytokinins in transgenic Populus hopeiensis under cold stress Serial number Full name of the substance English Abbreviations CAS number 1 2-METHYLTHIO-cis-ZEATIN RIBOSIDE 2MeScZR 52049-48-6 2 6-(2-hydroxybenzylamino)-9-beta-D-ribofuranosylpurine oTR 50868-58-1 3 PARA-TOPOLIN pT 80054-30-4 4 meta-TOPOLIN-9-GLUCOSIDE mT9G 179528-30-4 5 Kinetin Riboside KR 4338-47-0 6 trans-Zeatin-riboside tZR 6025-53-2 7 6-Furfurylaminopurine K 525-79-1 8 ortho-TOPOLIN-9-GLUCOSIDE oT9G 160299-96-7 9 DL-DIHYDROZEATIN RIBOSIDE DHZR 22663-55-4 10 2-CHLORO-trans-ZEATIN (2ClZ) 2CltZ 29736-30-9 11 2-METHYLTHIO-cis-ZEATIN (2MeScZ) 2MeScZ 52020-11-8 12 2-METHYLTHIO-N6-ISOPENTENYLADENINE (2MeS-iP) 2MeSiP 20758-33-2 13 2-methylthio-N-6-isopentenyladenosine 2MeSiPR 20859-00-1 14 N6-BENZYLADENOSINE BAPR 4294-16-0 15 KINETIN-9-GLUCOSIDE K9G 98177-43-6 16 para-TOPOLIN RIBOSIDE pTR 23666-24-2 17 DL-DIHYDROZEATIN DZ 14894-18-9 18 6-BENZYLAMINOPURINE 9-(BETA-D-GLUCOSIDE) BAP9G 4294-17-1 19 N6-BENZYLADENINE-7-GLUCOSIDE BAP7G 56159-42-3 20 DIHYDROZEATIN-7-GLUCOSIDE DHZ7G 91599-03-0 21 IHYDROZEATIN-O-GLUCOSIDE RIBOSIDE DHZROG 62512-95-2 22 N6-(delta 2-Isopentenyl)-adenine IP 2365-40-4 23 N6-ISOPENTENYLADENOSINE-D6 IPR 7724-76-7 24 6-[4-HYDROXY-3-METHYL-CIS-2-BUTENYLAMINO]PURINE cZ 32771-64-5 25 cis-ZEATIN-9-GLUCOSIDE cZ9G 169565-72-4 26 cis-ZEATIN RIBOSIDE cZR 15896-46-5 27 cis-ZEATIN-O-GLUCOSIDE RIBOSIDE cZROG 125225-72-1 28 N6-ISOPENTENYLADENINE-7-GLUCOSIDE iP7G 59384-58-6 29 N6-ISOPENTENYLADENINE-9-GLUCOSIDE iP9G 83087-94-9 30 ortho-TOPOLIN oT 20366-83-0 31 4-[[(9-beta-D-Glucopyranosyl-9H-purin-6-yl)amino]methyl]phenol pT9G 1046433-04-8 32 trans-Zeatin tZ 1637-39-4 33 TRANS-ZEATIN GLUCOSIDE tZOG 56329-06-7 34 6-Benzylaminopurine BAP 1214-39-7 35 Meta-Topolin mT 75737-38-1 36 meta-TOPOLIN RIBOSIDE mTR 110505-76-5 Cluster analysis was employed to examine the differential expression of multiple cytokinins in various control groups, aiming to ascertain the alterations in cytokinin metabolites in Populus hebeiensis leaves under cold stress (Fig. 8 ). At 25°C, the expression of cytokinins in the transgenic lines was significantly greater than that in the CK lines. When the transgenic and nontransgenic lines were compared at 25°C and 5°C, respectively, the expression of cytokinins in both types of lines was downregulated to varying degrees due to cold stress. However, under cold stress at 5°C, most cytokinins in the transgenic lines were significantly upregulated, with some even surpassing the levels in the CK lines. These findings suggest that the expression of cytokinins is greater in the transgenic lines than in the CK lines and that cold stress can inhibit their expression to a greater extent in the CK lines. Analysis of the endogenous cytokinin metabolic pathway in transgenic Populus hebeiensis under cold stress Owing to the interactions of metabolites within organisms, various pathways are formed. The metabolites were enriched and annotated via the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, revealing that all the comparison groups were enriched in the zein synthesis pathway (Fig. 9 ). Zeosine is involved in two pathways: isovaleryl pyrophosphate and mevalonate. The isovaleryl pyrophosphate pathway begins with the combination of DMAPP with ATP, ADP, and AMP, followed by catalysis by IPT to produce isovaleryl triphosphate, isovaleryl diphosphate, and isovaleryl adenosine monophosphate sequentially. CYP735A catalyzes the formation of trans-zeanoside adenosine triphosphate, trans-zeanoside diphosphate, and trans-zeanoside adenosine monophosphate, subsequently leading to further synthesis into isovalenyl-adenosine, which then forms isovalenyl-adenine. Trans-zeanoside adenosine monophosphate can generate trans-zeanoside, which can synthesize trans-zeanoside tZ or dihydrozeanoside adenosine monophosphate, leading to dihydrozeanoside DZ synthesis. Mevalonate has two pathways: DMAPP combines with tRNA catalyzed by IPT to form isovalenyldeoxyribonucleic acid, which further generates cis-isovalenyldeoxyribonucleic acid, resulting in cis-zeosine monophosphate and subsequently producing cis-zeosine nucleosides, leading to cis-zeosin cZ. Analysis of cytokinin levels regulated by the PhIPT5 gene in various strains under cold stress The alterations in the levels of the four types of cell kinins primarily facilitated by the PhIPT5 gene under cold stress were examined (Fig. 10 ), and the levels of all four kinins in the transgenic lines were notably greater than those in the CK lines at 25°C. Following exposure to a temperature of 5°C, the levels of these cytokinins decreased to varying extents in both the transgenic and CK lines; however, the reduction was significantly less pronounced in the transgenic lines than in their CK counterparts. Compared with those of the CK strains, the iP content of the transgenic strains remained relatively stable after cold treatment but decreased significantly in the CK strains. Furthermore, the tZ and DZ contents decreased substantially under cold treatment in both the transgenic and nontransgenic lines; nevertheless, the hormone content remained considerably greater in the transgenic lines. The cZ content was nearly six times greater in transgenics than in CK at 25°C; following cold treatment, there was a significant decrease observed only within the former group but still maintained a level almost twice as high as that found within the latter. Discussion Cloning and bioinformatics analysis of the PhIPT5 gene The IPT gene is a pivotal enzyme that catalyzes the initial step in the cytokinin biosynthesis pathway[25]. This gene is closely associated with various aspects of plant growth and development, including delaying leaf senescence, enhancing stress resistance, increasing crop yield, and increasing the fruit setting rate through its encoding of isopentyltransferase. On the basis of their amino acid sequence structure, IPT enzymes can be categorized into ATP/ADP-IPTs and tRNA-IPTs[ 26 ]. In this investigation, the PhIPT5 gene from Populus hopeiensis was cloned via PCR and subjected to bioinformatic analysis to elucidate both the structural and functional characteristics of the gene and its encoded protein. The CDS length of the cloned gene was determined to be 981 bp, which could encode 333 amino acid residues. Amino acids serve as fundamental components of proteins with diverse functions. Protein hydrophilicity refers to the ability of a protein to attract and bind water molecules within the protein structure. Hydrophilic proteins possess hydrogen bond networks on their hydrophobic surfaces that attract water molecules, thereby maintaining protein stability and promoting organismal metabolic processes. The presence or absence of signal peptides can determine a protein's self-transport ability[ 26 ]. The subcellular localization prediction for the PhIPT5 protein primarily indicates chloroplast localization. Research by Huynh et al. revealed that IPT genes can modulate CTK biosynthesis, leading to increased chlorophyll content and improved plant photosynthetic efficiency[27], thus suggesting the potential involvement of this protein in leaf photosynthesis. Gene cis-acting elements play roles in regulating gene expression; notably, multiple elements related to the light response, hormone response, and cold response were identified in the PhIPT5 gene. Physiological and biochemical changes in populus hebeiensis seedlings harboring the PhIPT5 gene under cold stress In plants subjected to low-temperature stress, membrane permeability increases, leading to electrolyte imbalance and resulting in cell metabolism disorders. The conductivity method is commonly used to assess the extent of membrane damage, providing a more accurate reflection of plant cold tolerance[28]. The measurement of relative conductivity revealed an increase in each strain following low-temperature treatment; however, compared with the nontransgenic strain, the transgenic strain presented significantly lower conductivity, indicating less severe membrane damage. Cold tolerance results in the accumulation of a substantial amount of free radicals in plants, thereby intensifying membrane lipid peroxidation and leading to an increase in the malondialdehyde content. The higher the content is, the higher the cold tolerance of plants[ 29 ]. The change in the MDA content paralleled that in the relative conductivity. Following exposure to low-temperature stress, the MDA content increased across all the strains; however, the MDA content of the transgenic strains significantly decreased compared with that of the nontransgenic controls, indicating reduced levels of free radicals and decreased membrane lipid peroxidation in the transgenic strains. Under cold tolerance, there is an increase in reactive oxygen species (ROS) levels within plants. To mitigate ROS-induced damage, alterations in antioxidant enzyme activities facilitate ROS clearance. Investigations into POD, SOD, and CAT levels during eucalyptus and walnut exposure to cold stress revealed varying changes in enzyme activities over time [ 30 , 31 ]. Additionally, osmoregulatory substances serve as indicators of plant resilience to cold temperatures; heightened soluble protein levels contribute to increased bound water content while maintaining intracellular osmotic pressure. Notably, a fluctuating trend [ 32 ] in soluble protein (SP) levels was observed among poplar clones subjected to cold stress. Furthermore, exposure to cold tolerance resulted in elevated concentrations of soluble proteins along with increased POD and SOD activities; notably, higher POD and SOD activities were detected in the transgenic strains than in their CK counterparts, indicating robust cold tolerance within these genetically modified variants. The process of photosynthesis is highly sensitive to low temperatures, particularly those affecting chloroplasts, which serve as the primary sites for this biological function. Low temperatures not only disrupt the structure and function of chloroplasts but also impede the synthesis of chlorophyll, consequently diminishing the overall photosynthetic capacity of plants[ 33 ]. Research indicates that brief exposure to low temperatures can reduce the leaf chlorophyll content, enabling plants to adapt to adverse conditions[ 34 ]. In line with the results of our study, both the chlorophyll a and b levels decreased in the transgenic strains following low-temperature treatment; however, these levels remained higher than those observed in the nontransgenic strains. These findings suggest that low-temperature treatment had a more pronounced inhibitory effect on CK. Zhang et al. utilized the gene gun method to introduce the IPT gene into tall fescue and assessed SOD, POD, and MDA levels in select strains during the late growth phase. These findings indicated that the transgenic strains Li4 and Li69 exhibited favorable performance across all three indices, resulting in significantly increased cold resistance and delayed plant senescence[ 22 ]. Chen evaluated various physiological parameters, including relative electrical conductivity, chlorophyll content, and root activity, in IPT transgenic rice at different growth stages. Compared with wild-type controls, transgenic lines presented reduced changes in relative electrical conductivity and lower degrees of chloroplast damage under low-temperature treatment during the booting stage and flowering stage [ 35 ]. Additionally, other studies have demonstrated notable inhibition of photosynthesis in tobacco and Jatropha under cold stress[ 36 , 37 ]. Analysis of endogenous cytokinin metabolites in Populus hebeiensis with PhIPT5 gene transfer at low temperature The endogenous hormones of plants are closely associated with the entire growth process, and various hormones collaborate to regulate diverse life activities of plants. They also play a role in the response of plants to nonbiotic stress [ 38 ]. Studies indicate that under low-temperature stress, plants adjust the expression of their endogenous cell division hormones to adapt to adverse conditions. Low temperature triggers the synthesis of ABA, while CTK exerts an antagonistic effect on it, leading to a decrease in its content. It has been demonstrated that CTK can modulate plant aging under low-temperature stress, thereby indirectly enhancing cold tolerance [ 39 ]. Multiple types of endogenous cell division hormones with two synthesis pathways exist: de novo synthesis and tRNA degradation. Research suggests that de novo synthesis is the primary source of cell division hormones in plants and is catalyzed by isopentenyl transferase [ 40 ]. In this study, qualitative and quantitative detection was carried out for cell division hormone-like metabolites in the leaves of transgenic and nontransgenic poplar stocks subjected to low-temperature treatment, resulting in the identification of 36 metabolites. Differentially abundant metabolite analysis revealed that most metabolites exhibited specific responses to low temperature. The expression level of cell division hormone-like metabolites was significantly greater in the transgenic stocks than in the nontransgenic controls after low-temperature treatment. Although the expression levels of metabolites were suppressed in both the transgenic and nontransgenic cultivars following low-temperature treatment, those in the transgenic cultivar remained higher than those in the nontransgenic cultivar. These findings indicate that the activity of cell division hormone metabolites was greater in the transgenic cultivar than in the WT cultivar and was less affected by suppression due to low temperatures. Several studies have investigated the levels of endogenous hormones in 5 different Cynodon dactylon strains under low-temperature stress. The findings revealed that as the stress temperature decreased, the ABA content initially increased but then decreased across all the breeds, whereas the CTK content tended to decrease. However, breeds with high cold tolerance presented the lowest decrease in CTK content[ 39 ]. Zeng Guanghui conducted an analysis of endogenous hormones in tea tree leaves under natural low temperatures and reported a significant decrease in cytokinin levels[ 38 ]. In this study, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was used to identify the zeatin bioanabolic pathway. Pathway analysis revealed that iP, tZ, DZ, and cZ were the primary types of endogenous cytokinins in the plants. The combination of DAMPP and ATP/ADP/AMP is catalyzed by ATP/ADP-IPTs to produce iP, tZ, and DZ. Moreover, the combination of DAMPP and tRNA catalyzed the production of cZ by TRNA-IPTS. Following low-temperature treatment, the levels of iP, tZ, DZ, and cZ in the transgenic lines were significantly greater than those in the nontransgenic lines. While the levels of iP, tZ, and DZ remained relatively stable in the transgenic lines after low PhIPT5-temperature treatment compared with the significant decrease observed in the nontransgenic lines, there was a notable decrease in the cZ content within the transgenic lines but no significant change within the nontransgenic lines after treatment. These results suggest that transfer of the gene significantly increased the cytokinin content in Hebei Yang leaf slices; however, low temperatures inhibited their expression, leading to decreased content. Under identical treatment conditions, tZ presented the highest content among all four metabolites, followed by iP and Dz, with cX displaying the lowest concentration. Combined with bioinformatics analysis, these findings suggest that PhIPT5 encodes ATP/ADP-IPTs, further indicating its role in regulating the isopentylpyrophosphate cytokinin metabolism pathway, which primarily involves the synthesis of tX. Analysis of the response of the PhIPT5 gene to low temperature The isopentyltransferase encoded by the IPT gene exhibits specific responses to both biological and abiotic stresses. The endogenous cytokinin content directly correlates with the expression of the IPT gene, indicating its involvement in plant stress resistance through cytokinin regulation[ 41 ]. Wang et al. reported increased endogenous cytokinin levels and enhanced cold resistance in wheat expressing the TaIPT8 gene under drought stress compared with wild-type strains[ 42 ]. Similarly, transfer of the IPT gene in Arabidopsis thaliana led to elevated endogenous cytokinin levels and improved plant resistance[ 43 ]. Low-temperature stress increases the abscisic acid (ABA) content while gradually decreasing the CTK content, negatively regulating IPT gene expression[ 44 ]. In this study, the PhIPT5 gene was overexpressed in Populus hebeiensis via an overexpression vector. Cold tolerance indices and cytokinin metabolites were assessed in transgenic Populus hebeiensis under low-temperature stress. The results indicated the downregulation of differential cytokinin metabolites following low-temperature treatment. Specifically, the iP, tZ, DZ and cZ contents decreased significantly after low-temperature treatment, suggesting a decrease in PhIPT5 gene expression and a subsequent reduction in cytokinin content. Notably, PhIPT5 gene expression was positively correlated with the expression of cytokinins but was negatively regulated by low temperatures. Abbreviations ABA(Abscisic Acid) CDS(Coding sequence) CKXs(Cytokininoxidase/dehydrogenase) CTK(Cytokinine) d(day) h(hour) KEGG(Kyoto Encyclopedia of Genes and Genomes) LB(Luria-Bertanimedium) MDA(Malondialdehyde) min(minute) MS(Murashige & Skoog medium) PCR(Polymerase Chain Reaction) RT-PCR(Real-time Quantitative PCR) POD(Peroxidase) SOD(Superoxide dismutase) Declarations Acknowledgements Not application. Authors’ contributions ZQ analyzes the data, edits and writes the manuscript. TT and WN conducted the experiment. JL edited the manuscript. YE designed the experiment and edited the manuscript. All authors read and approved the manuscript. Funding Supported by the National Science and Technology Major Project (2018ZX08020002-005-005). These funding agencies have no role in research design, sample collection, data analysis or interpretation, and manuscript writing. Availability of data and materials All data and materials are presented in the main paper and additional supporting file. Ethics approval and consent to participate There are no ethical issues involved. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author details 1 Inner Mongolia Agricultural University, Hohhot, China. 2 Forestry and Grassland Bureau of Zhuozi County, Ulanqab City, Inner Mongolia, China References Liu W, Zhang SJ, Hou G. Research progress on poplar germplasm resources in China[J]. Liaoning Forestry Science and Technology, 2020, (5): 47-52. Fang SZ. Research progress on the cultivation technology of poplar plantations in China[J]. Acta Ecologica Sinica, 2008, (10): 2308-2316. Zhang Y, Li SW, He ZG. Research status and development strategy of poplar resources and hybrid breeding in China[J]. Hebei Forestry Science and Technology, 2006, (201): 20-24. Wu FZ, Wang HX. Plant cold stress response mediated by protein ubiquitination[J]. Bulletin of Biological Technology, 2021, 37(6): 225-235. Hoppen C, Groth G. Novel insights into the transfer routes of the essential copper cofactor to the ethylene plant hormone receptor family[J]. Plant signaling & behavior, 2020, 15(2):1716512. Long-Fang O C, Jia Y H, Yee Y C, et al. Transformation of broccoli ( Brassica oleracea var. italica) with isopentenyltransferase gene via Agrobacterium tumefaciens for postharvest yellowing retardation[J]. Molecular Breeding, 2001, 7(3):243-257. Miyawaki K, Matsumoto-Kitano M, Kakimoto T. Expression of cytokinin biosynthetic isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin, and nitrate[J]. The Plant journal : for cell and molecular biology, 2004, 37(1):128-138. Frebort I, Kowalska M, Hluska T, et al. The Evolution of Cytokinin Biosynthesis and Degradation[J]. Journal of experimental botany, 2011, 62(8):2431-2452. Miyawaki K, Tarkowski P, Matsumoto-Kitano M, et al. Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis[J]. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(44):16598-16603. Mok D, Mok M. Cytokinin metabolism and action[J]. Annual Review of Plant Physiology and Plant Molecular Biology, 2001, 52(1):89-118. Leshem Y Y, Wurzburger J, Grossman S, et al. Cytokinin interaction with free radical metabolism and senescence: Effects on endogenous lipoxygenase and purine oxidation[J]. Physiologia Plantarum, 1981, 53(1):9-12. Nguyen H N, Lai N, Kisiala A B, et al. Isopentenyltransferases as master regulators of crop performance: their function, manipulation, and genetic potential for stress adaptation and yield improvement[J]. Plant biotechnology journal, 2021, 19(7):1297-1313. Zhou ZiX. Regulation of cell division in Medicago truncatula by cytokinin and functional identification of the IPT gene [D]. Beijing Forestry University, 2020. Brugiere N, Humbert S, Rizzo N, et al. A member of the maize isopentenyl transferase gene family, Zea mays isopentenyl transferase 2 (ZmIPT2), encodes a cytokinin biosynthetic enzyme expressed during kernel development. Cytokinin biosynthesis in maize[J]. Plant molecular biology, 2008, 67(3): 215-229. Matsuo S, Kikuchi K, Fukuda M, et al. Roles and regulation of cytokinins in tomato fruit development[J]. Journal of experimental botany, 2012, 63(15):5569-5579. Peng J, Peng F, Zhu C, et al. Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate[J]. Tree Physiology, 2008, 28(6):899-904. Sakamoto T, Sakakibara H, Kojima M, et al. Ectopic expression of KNOTTED1-like homeobox protein induces expression of cytokinin biosynthesis genes in rice[J]. Plant physiology, 2006, 142(1):54-62. Takei K, Sakakibara H, Sugiyama T. Identification of genes encoding adenylate isopentenyltransferase, a cytokinin biosynthesis enzyme, in Arabidopsis thaliana [J]. The Journal of biological chemistry, 2001, 276(28):26405-26410. Ye C J, Wu S W, Kong F N,et al.Identification and characterization of an isopentenyltransferase ( IPT ) gene in soybean ( Glycine max L. )[J]. Plant Science: An International Journal of Experimental Plant Biology, 2005, 170(3):542-550. Yuichi S, Yukio O, Akiko M, et al. Molecular cloning, expression, and characterization of adenylate isopentenyltransferase from hop (Humulus lupulus L.)[J]. Phytochemistry, 2004, 65(17):2439-2446. Li Hao, Zhang Wen, Zhao Xuqian, et al. Cloning and Function Analysis of the MdIPTs Gene Family in Apple ( Malus domestica Borkh.)[J]. Chinese Agricultural Science, 2011, 44(19): 4029-4036. Zhang X, Yang LL, Yang XL. Changes in SOD, POD and MDA in Late Growth Period of Tall Fescue Transgenic with Leafy-ipt Gene[J]. Shanxi Agricultural Science, 2008, (9): 26-28. Yu SJ, Xiong YH,Mi JT, et al. Study on Drought Resistance of Transgenic Rice with IPT Gene[J]. Chinese Journal of Agricultural Science and Technology, 2012, 14(6): 30-35. Liang FF. Study on the Characteristics of Rooted Suckers of Populus davidiana Var. Decidua in Loess Plateau of Shanxi Province and Understory Vegetation[D]. Beijing Forestry University, 2015. Kunkel T, Niu Q, Chan Y, et al. Inducible isopentenyl transferase as a high-efficiency marker for plant transformation[J]. Nature Biotechnology, 1999, 17:916-919 Miyawaki K, Tarkowski P, Matsumoto-Kitano M, et al. Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis[J]. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(44):16598-16603. Yu Xiangtian. Analysis of Protein Sequence Similarity [D]. Shandong University, 2011. Huynh L N, Vantoai T, Streeter J, et al. Regulation of flooding tolerance of SAG12:ipt Arabidopsis plants by cytokinin[J]. Journal of experimental botany, 2005, 56(415):1397-1407. Li YH, Nurmaimaiti Aimaiti, Xiarepatie Azeez, et al. Comparative Study on Cold Resistance of Different Hawthorn Varieties in Xinjiang[J]. Xinjiang Agricultural Sciences, 2019, (12): 2289-2255. Jing JL, Liu MX, Wei X, et al. Evaluation of Cold Resistance of Several Apple Intermediate Rootstocks[J]. Acta Horticulturae Sinica, 2022, 39(6): 970-981. Liu GH, Lan JB, Liu YQ, et al. Impact of exogenous calcium on the physiological characteristics and endogenous hormone levels of Eucalyptus grandis seedlings under low temperature stress[J]. Journal of Northwest Forestry College, 2017, 32(6): 101-106. Wu S, Jia YL, Zhi FJ. Comprehensive assessment of cold resistance in walnut branches under low temperature stress[J]. Forestry and Ecological Science, 2020, 35(3): 314-319. Liu ZY, Liu JL, Zhu YY, et al. Advancements in understanding the low temperature response mechanism of woody plants[J]. Journal of Northwest Forestry College ,2022 ,37(2) :157-163. Wu GX,Tang Xian L,Yang DG ,et al.Research progress on plant physiological responses to low temperature stress[J]. Crop Journal,2008,(3):17-19. Chen NG,Yu XQ,Zhao DT ,et al.Study on cold tolerance of transgenic rice plants with IPT gene [J].Journal Of Southwest Agricultural Sciences,2006,(2):255-259. Feng Y L,Cao K F.Photosynthesis and photoinhibition after night chilling in seedlings of two tropical tree species grown under three irradiances [J].Photosynthetica: International Journal for Photosynthesis Research,2005,43(4):567-574. Hu RS,Zeng Z,Dai XH ,et al.The response of photosynthetic characteristics in young leaves from different tobacco varieties to low temperature stress [J].Chinese Agricultural Bulletin ,2013 ,29(34):71-75. Zeng GH,Ma QP,Wang WD ,et al.Effects of natural low temperatures on endogenous hormone levels in tea plants [J ].Journal Of Tea Science ,2016 ,36(1):85 -91 . Yang Yo,Lou YH,Y ang ZJ ,et a l .Effects o f lo w temperat ure st ress o n hormones an d carbohydrate metabolism i n dogtooth violet s[J ].Journal O f Grassland Science ,2016 ,25(2):205 -215 . Zhang HM,Wang JL,Liao XR.Biosynthesis,m e t abo lism, and receptors o f cell division factor s[J ].Plant Physiological Communications,2003 ,(3) :267 -272 . Nguyen H N, Lai N, Kisiala A B, et al. Isopentenyltransferases as master regulators of crop performance: their function, manipulation, and genetic potential for stress adaptation and yield improvement[J]. Plant biotechnology journal, 2021, 19(7):1297-1313. Na W, Jun C, Yuan G, et al. Genomic analysis of isopentenyltransferase genes and functional characterization of TaIPT8 indicates positive effects of cytokinins on drought tolerance in wheat[J]. The Crop Journal, 2023, 11(1):46-56. Eremina M, Rozhon W, Poppenberger B. Hormonal control of cold stress responses in plants[J]. Cellular and Molecular Life Sciences, 2016, 73(4):797-810. DuanYB,Zhao DG,Zhao FL,g.et al.Some physiological characteristics of rice transplanting IPT gene under low temperature stress[J].Journal of Mountain Agricultural Biology, 2007, (2):95-98. Table 1 and 2 Table 1 and 2 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files 8.31.png Tab.1.xlsx Tab.2.xlsx Cite Share Download PDF Status: Published Journal Publication published 02 Jun, 2025 Read the published version in BMC Plant Biology → Version 1 posted Editorial decision: Revision requested 05 Sep, 2024 Editor assigned by journal 05 Sep, 2024 Submission checks completed at journal 04 Sep, 2024 First submitted to journal 20 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4943804","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":350001922,"identity":"f16658b1-0b18-497b-a41b-bd91e6369458","order_by":0,"name":"Qi Zhang","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Zhang","suffix":""},{"id":350001924,"identity":"5c5d8510-c036-4806-a0bb-aaf556c8cce4","order_by":1,"name":"Tiantian Bi","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tiantian","middleName":"","lastName":"Bi","suffix":""},{"id":350001926,"identity":"d1378ba6-b8cf-4c37-9e38-d10e8f5147da","order_by":2,"name":"Ning Wang","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Wang","suffix":""},{"id":350001929,"identity":"28eecb47-7d00-4843-b2ff-3d513ffcee6f","order_by":3,"name":"Jinling Dai","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jinling","middleName":"","lastName":"Dai","suffix":""},{"id":350001930,"identity":"a021df83-b3da-4c47-b19f-bd36eaa09695","order_by":4,"name":"Yue Bai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYBACAwbGBiBlwwPhshGvJY0kLWBwmIF4Lebsh9ukeSrOy+i2nzFg+FB2mIF/dgN+LZY9iUAtZ27zmJ3JMWCcce4wg8SdAwQcdgCohbcNqOVAjgEzb9thBgOJBAJazj8Eavl3jsfs/BsD5r9EabkBsqXhAI/ZDaAtjMRosZzxsNlyzrFkoJZnBQd7zqXzSNwgoMWcP/3hjTc1dvZm55M3PvhRZi3HP4OAFiBgkYDQHAYHgCQPQfVAwPwBQrM/IEb1KBgFo2AUjEAAAPSSQz5qew+vAAAAAElFTkSuQmCC","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yue","middleName":"","lastName":"Bai","suffix":""}],"badges":[],"createdAt":"2024-08-20 09:29:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4943804/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4943804/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12870-025-06481-2","type":"published","date":"2025-06-02T15:57:35+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65948348,"identity":"b469da6a-726e-4105-9674-7305f69c0e99","added_by":"auto","created_at":"2024-10-04 18:25:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":67833,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eComparison of\u003c/em\u003erelative \u003cem\u003ePhIPT5\u003c/em\u003e expression across different treatments. The data are presented as the means ± SDs of three biological replicates, with error bars indicating the standard deviation of the mean. Different letters above the bars indicate statistical significance at the P \u0026lt; 0.05 level on the basis of the LSD multiple range test.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/ef4ee15db3d43dee1bc5b5d1.png"},{"id":65948349,"identity":"ce8afdb1-36a2-4ce4-88bb-00a2d5280c20","added_by":"auto","created_at":"2024-10-04 18:25:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":472160,"visible":true,"origin":"","legend":"\u003cp\u003eAmino acid sequence encoded by \u003cem\u003ePhIPT5\u003c/em\u003e gene.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/2c348a30f9fffadebe07e4fd.png"},{"id":65948930,"identity":"4a598cbc-e51c-4bbd-8c22-ed5ba6d3a424","added_by":"auto","created_at":"2024-10-04 18:41:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":450668,"visible":true,"origin":"","legend":"\u003cp\u003eA:Predicted secondary structure of PhIPT5 protein,B:Prediction of tertiary structure of PhIPT5 protein,a,b,c,d:Different aspects of the tertiary structure of PhIPT5 protein\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/37f0e4ccef4beb87168c4b1e.png"},{"id":65948351,"identity":"8001c248-ffbe-4969-9fb6-ed18562b9390","added_by":"auto","created_at":"2024-10-04 18:25:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":140398,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of IPT5 proteins in \u003cem\u003ePopulus hopeiensis\u003c/em\u003e and other diverse species. Pn, \u003cem\u003ePopulus nigra;\u003c/em\u003ept, \u003cem\u003ePopulus trichocarpa\u003c/em\u003e;Pe, \u003cem\u003ePopulus euphratica;\u003c/em\u003ePh\u003cem\u003e, Populus hopeiensis;\u003c/em\u003ePa, \u003cem\u003ePopulus alba\u003c/em\u003e;Ss, \u003cem\u003eSalix suchowensis\u003c/em\u003e;Sk, \u003cem\u003eSalix koriyanagi\u003c/em\u003e;Tw, \u003cem\u003eTripterygium wilfordii\u003c/em\u003e;Gh, \u003cem\u003eGossypium hirsutum\u003c/em\u003e;Ht, \u003cem\u003eHibiscus trionum\u003c/em\u003e;Hs, \u003cem\u003eHibiscus syriacus\u003c/em\u003e;Rc, \u003cem\u003eRicinus communis\u003c/em\u003e;Hb, \u003cem\u003eHevea brasiliensis\u003c/em\u003e;Me, \u003cem\u003eManihot esculenta\u003c/em\u003e;El, \u003cem\u003eEuphorbia lathyris.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/cc1aea825bd77ddc9598bd15.png"},{"id":65947966,"identity":"d259e116-3973-43e9-b442-fa6f4e0f0819","added_by":"auto","created_at":"2024-10-04 18:17:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":332256,"visible":true,"origin":"","legend":"\u003cp\u003eSubcellular localization of the PhIPT5 protein, subcellular localization analysis of the cotransformation of the empty vector p35S::GFP (pCAMBIA1300) and the endoplasmic reticulum localization marker vector p35s::HDEL-mCherry (pCAMBIA1300), and subcellular localization analysis of the cotransformation of the fusion expression vector p35S::TkPITP-GFP and the endoplasmic reticulum localization marker vector p35s::HDEL-mCherry (pCAMBIA1300); scale bars, 100 μm.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/6dee6073f8de06dc31527548.png"},{"id":65948511,"identity":"f611b981-2931-45a2-a5c1-f1231ecea207","added_by":"auto","created_at":"2024-10-04 18:33:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":546880,"visible":true,"origin":"","legend":"\u003cp\u003eAcquisition of transgenic strains involves a: cocultivation; b: selection for resistant buds; c: obtaining resistance buds; d:propagation of resistant buds; e: induction of root formation in resistant buds; f: transplantation of rooted seedlings.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/dedcd4cc46373462600c7382.png"},{"id":65947974,"identity":"ec941cc5-90e6-42d5-a8f7-6b3bd47d4b7a","added_by":"auto","created_at":"2024-10-04 18:17:14","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":707061,"visible":true,"origin":"","legend":"\u003cp\u003eThe impact of cold stress on the overexpression of \u003cem\u003ePhIPT5\u003c/em\u003e in \u003cem\u003ePopulus hopeiensis\u003c/em\u003e was investigated. \u003cstrong\u003eA: \u003c/strong\u003eSoluble proteins, \u003cstrong\u003eB:\u003c/strong\u003e SOD, \u003cstrong\u003eC:\u003c/strong\u003eMDA, \u003cstrong\u003eD: \u003c/strong\u003ePOD, \u003cstrong\u003eE: \u003c/strong\u003erelative conductivity, \u003cstrong\u003eF: \u003c/strong\u003echlorophyll a; \u003cstrong\u003eG: \u003c/strong\u003echlorophyll b; \u003cstrong\u003eH: \u003c/strong\u003ecarotenoids. The data are presented as the means ± SDs of three biological replicates, with error bars indicating the standard deviation of the mean. Different letters above the bars indicate statistical significance at the P \u0026lt; 0.05 level on the basis of the LSD multiple range test.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/a3eb9e501d20bcbc0d4295d0.png"},{"id":65947973,"identity":"8bec91c9-55e5-4629-80f6-7b7112e167be","added_by":"auto","created_at":"2024-10-04 18:17:14","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":356832,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential expression of cytokinins (CTKs) in transgenic and nontransgenicstrains of \u003cem\u003ePopulus hopeiensis\u003c/em\u003e under cold stress. A: Differential expression of CTKs between the transgenic and CK strains at 25°C; B: Comparison of CTKexpression between the transgenic and CK strains at 5°C; C: Differences in CTK expression between the transgenic \u003cem\u003ePopulus hopeiensis\u003c/em\u003estrains at 25°C and 5°C; D: Variationsin CTK expression between the CK strains at 25°C and 5°C.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/e92c622ed692a49b7a2ba117.png"},{"id":65947975,"identity":"fb87c8aa-d526-4085-b11f-d1fdf78870b8","added_by":"auto","created_at":"2024-10-04 18:17:14","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":141841,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG pathway of the metabolites of transgenic \u003cem\u003ePopulus hopeiensis\u003c/em\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/86626447b3af4be2fc60e01c.png"},{"id":65947972,"identity":"dbeec725-1690-4eb0-8cb4-94d37e8029af","added_by":"auto","created_at":"2024-10-04 18:17:14","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":305151,"visible":true,"origin":"","legend":"\u003cp\u003eCytokinin levels in transgenic \u003cem\u003ePopulus hopeiensis\u003c/em\u003e before and after cold treatment. The average±SD of three biological replicates is presented, with error bars indicating the standard deviation of the mean. Different letters above the bar chart denote statistically significant differences between transgenic lines at the P \u0026lt; 0.05 level on the basis of the LSD multiple range test.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/c2e835ea41d32c65adcb7389.png"},{"id":84242581,"identity":"af47755b-746b-468a-a38e-05f5929232a2","added_by":"auto","created_at":"2025-06-09 16:09:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4861469,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/e2104fc9-6803-4e78-be21-ce64ebf650a7.pdf"},{"id":65948509,"identity":"bc293c2d-d187-4523-9327-fdb15d3e4eea","added_by":"auto","created_at":"2024-10-04 18:33:13","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":98932,"visible":true,"origin":"","legend":"","description":"","filename":"8.31.png","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/d3d5849f60fb25e66f4f8797.png"},{"id":65947962,"identity":"701f077c-9930-489b-a430-f169a931c77b","added_by":"auto","created_at":"2024-10-04 18:17:13","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":10032,"visible":true,"origin":"","legend":"","description":"","filename":"Tab.1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/2a4853bc6e7725c08fca6972.xlsx"},{"id":65949035,"identity":"e77fbc5f-e166-4569-85b5-e5536eb8a123","added_by":"auto","created_at":"2024-10-04 18:49:13","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":12440,"visible":true,"origin":"","legend":"","description":"","filename":"Tab.2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4943804/v1/b906f4d7ac9e079f5eaef6dc.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cloning and assessment of cold resistance in the transcription factor PhIPT5 from Populus hopeiensis","fulltext":[{"header":"Background","content":"\u003cp\u003ePlant endogenous hormones are organic compounds synthesized in plants and primarily include auxin, cytokinin, gibberellin, abscisic acid, ethylene and brassinosterol [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Throughout the process of plant growth, these various hormones collectively regulate plant growth and development by either promoting or inhibiting one another [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. \u003cem\u003eIPT\u003c/em\u003e gene research has shown that cytokinins (CTKs) can stimulate plant cell division and expansion, participate in bud differentiation and apical dominance, and delay leaf senescence [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition to influencing root elongation, they also affect various other plant growth and development processes. Furthermore, their involvement is crucial in how plants respond to stress [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIsopentenyl transferases (IPTs) function as the primary rate-limiting enzymes in cytokinin (CTK) synthesis, and their activity is regulated by this process [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Initially, discovered in \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e, this gene family includes ATP/ADP-IPTs and tRNA-IPTs. The former enzymes utilize ATP or ADP as their primary substrates, leading to the biosynthesis of isopentenyladenine (iP)-type and trans-zeatin (tZ)-type cytokinins (CTKs). In contrast, tRNA-IPTs are responsible for synthesizing cis-zeatin (cZ)-type CTKs by transferring the isopentenyl group to the N6 atom of adenine in tRNA [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUnder stress conditions, activation of the isopentenyltransferase gene leads to the production of CTK, which effectively scavenges free radicals, enhances SOD and CAT enzyme activities, reduces lipid peroxidation, and minimizes MDA accumulation. These actions collectively mitigate stress-induced damage to plant growth and development [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The \u003cem\u003eIPT\u003c/em\u003e gene family has been identified in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, \u003cem\u003eOryza sativa\u003c/em\u003e, \u003cem\u003eSolanum lycopersicum\u003c/em\u003e, and \u003cem\u003eMalus domestica\u003c/em\u003e, and similar homologous \u003cem\u003eIPT\u003c/em\u003e genes have been cloned in \u003cem\u003eHumulus lupulus\u003c/em\u003e, \u003cem\u003eGlycino max\u003c/em\u003e, \u003cem\u003eZea mays\u003c/em\u003e, and \u003cem\u003eMalus hupehensis\u003c/em\u003e, among other cultivated plants. Furthermore, it has been established that the expression levels of this gene closely correlate with plant cytokinin content, leaf aging processes, increased yield potential, and enhanced stress resistance mechanisms within these plant species[\u003cspan additionalcitationids=\"CR13 CR14 CR15 CR16 CR17 CR18 CR19 CR20\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Zhang et al. utilized a biolistic transformation method to introduce the \u003cem\u003eIPT\u003c/em\u003e gene into \u003cem\u003eFestuca elata\u003c/em\u003e and reported enhanced cold resistance as well as delayed senescence in transgenic plants [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Yu et al. demonstrated that overexpression of the \u003cem\u003eIPT\u003c/em\u003e gene in transgenic rice maintained normal physiological activities and high root vitality under cold stress conditions while reducing cold-induced damage to plants [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These findings collectively suggest that the regulation of CTK levels mediated by \u003cem\u003eIPT\u003c/em\u003e genes can modulate plant resistance mechanisms. Currently, research on \u003cem\u003eIPT\u003c/em\u003e genes has focused predominantly on herbaceous species, with limited exploration within woody poplar species, particularly with respect to stress resistance.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePopulus hopeiensis\u003c/em\u003e, a member of the Salicaceae family, is a hybrid species resulting from the crossbreeding of \u003cem\u003ePopulus tomentosa\u003c/em\u003e and \u003cem\u003ePopulus davidiana.\u003c/em\u003e Known for its tall, straight, and aesthetically pleasing appearance, characterized by smooth bark and a large round crown, this tree has emerged as an exceptional choice for afforestation and landscaping in the Loess Plateau and sandstorm-prone areas of Northwest China and North China. Its well-developed root system, robust growth potential, rapid maturation, and high adaptability make it uniquely suited to these challenging environments [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In this study, we successfully cloned the coding region sequence of the isovalenyltransferase gene \u003cem\u003ePhIPT5\u003c/em\u003e from \u003cem\u003ePopulus hopeiensis\u003c/em\u003e. Through bioinformatics methods, including sequence analysis, subcellular localization, tissue-specific expression analysis, and assessment of the low-temperature stress response at the gene level, our findings lay a solid foundation for deeper insights into the biological functions of \u003cem\u003eIPT\u003c/em\u003e genes in poplar growth development as well as their stress responses. This work aims to provide valuable reference data for future research in poplar breeding.\u003c/p\u003e"},{"header":"method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMaterials\u003c/h2\u003e \u003cp\u003eThe plant material utilized comprised \u003cem\u003ePopulus hebeiensis\u003c/em\u003e tissue culture seedlings. The strains used included \u003cem\u003eE. coli\u003c/em\u003e DH5α and \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV3101. Vector construction involved the utilization of the plasmids pMD19-T and pCAMBIA1302. These materials were housed in the Forest Tree Genetics and Breeding Laboratory at Inner Mongolia Agricultural University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRT‒qPCR\u003c/h2\u003e \u003cp\u003eThe RNA extraction process involved the utilization of a specialized kit (TIANGEN's RNAprep Pure Plant Plus Kit) for isolating total RNA from leaves, followed by quality assessment through gel electrophoresis. Reverse transcription was subsequently employed to synthesize first-strand cDNA. Transcriptome data were utilized for primer design to screen the \u003cem\u003eIPT\u003c/em\u003e gene and isolate \u003cem\u003ePhIPT5\u003c/em\u003e cDNA. A specific primer set, IPT5 F/R, was designed on the basis of the cDNA sequence via version 5.0 of a program. The target gene was then amplified from genomic DNA via these primers, resulting in the isolation of the full-length \u003cem\u003ePhIPT5\u003c/em\u003e gene via PCR under specific cycling conditions. A gel recovery kit was used for product retrieval following electrophoretic detection, as per the kit instructions. The recovered DNA fragments were ligated into the pMD19-T vector according to Table\u0026nbsp;4 specifications and transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α cells for resistance screening on LB solid media supplemented with 50 mg\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e kanamycin. Positive monoclonal colonies were selected for colony PCR with the reaction system detailed in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and the bacterial mixture exhibiting the correct bands was subjected to sequencing analysis.\u003c/p\u003e \u003cp\u003eTo investigate the impact of cold stress and different levels of overexpression on the expression of the \u003cem\u003ePhIPT5\u003c/em\u003e gene, RNA was isolated from leaves and converted into cDNA via reverse transcriptase. The \u003cem\u003ePhIPT5\u003c/em\u003e gene was then amplified via qRT‒PCR via specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and SYBR Green Master Mix (Roche). Three independent biological experiments were conducted with Actin as an internal reference. The fold change in expression level was determined via the ΔΔCT method (fold change\u0026thinsp;=\u0026thinsp;2\u003csup\u003e\u0026minus;[ΔΔCT]\u003c/sup\u003e). The real-time fluorescence quantitative RT‒PCRs involved an initial incubation at 95\u0026deg;C for 3 min, followed by 35 cycles at 95\u0026deg;C for 30 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 1 min; finally, the reaction was stored at 72\u0026deg;C for 7 min before being cooled to 4\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCloning and quantitative primers for the \u003cem\u003ePhIPT5\u003c/em\u003e gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUses\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGene clone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eIPT5\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-3\u0026rsquo;GGAGAGAACACGGGGGACTTTGCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eIPT5\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-3\u0026rsquo; ATGACCATGAGGCTTTCTTTGACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eqRT‒PCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eIPT5\u003c/em\u003e-RT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-3\u0026rsquo;TTCAGGCACCATGCATCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eIPT5\u003c/em\u003e-RT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-3\u0026rsquo;GATCGACCCGCTCTGATACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eReference genes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eActin\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-3\u0026rsquo;ACCCTCCAATCCAGACACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eActin\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-3\u0026rsquo;TTGCTGACCGTATGAGCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSequence analysis\u003c/b\u003e \u003cb\u003eof PhIPT5\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/genbank/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/genbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to deduce the coding sequence of \u003cem\u003ePhIPT5\u003c/em\u003e on the NCBI website and explore homologous genes of \u003cem\u003ePhIPT5\u003c/em\u003e in the database. ProtParam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.ExPASy.org/protparam/\u003c/span\u003e\u003cspan address=\"https://web.ExPASy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for analysis of physical and chemical properties, the Prot Scale (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=nasp_sopma.html\u003c/span\u003e\u003cspan address=\"http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=nasp_sopma.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for hydrophobicity analysis, and SOPMA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page\u003c/span\u003e\u003cspan address=\"http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003e=nasp_sopma.html) and SWISS-MODEL (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://swissmodel.ExPASy.org/\u003c/span\u003e\u003cspan address=\"https://swissmodel.ExPASy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for the prediction of secondary and tertiary structures, respectively, and MEGA software was used to construct a phylogenetic tree with bootstrap values of 1000.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of the overexpression vector of the GFP fusion subcellular localization vector\u003c/h2\u003e \u003cp\u003eThe overexpression vector pBWA(V)HS-ccdB-EGFP was obtained by linking \u003cem\u003ePhIPT5\u003c/em\u003e to pBWA(V) HS-CCDB-EGFP with Biorun 2\u0026times; EasyClone Mix recombinase. The overexpression vector was transformed into DH5α receptor cells, and the positive clones were identified via colony PCR and sequenced for further identification. The correct plasmid transformed into Agrobacterium GV3101 receptive cells was detected, pBWA(V)HS-ccdB-EGFP was used as a negative control, positive clones were selected and propagated, Agrobacterium infection solution was prepared, and the OD\u003csub\u003e600\u003c/sub\u003e was adjusted to approximately 0.60. The lower epidermis of tobacco leaves was injected with a syringe, cultured in darkness for 48 h, and then observed and photographed under a confocal laser microscope.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenetic transformation and identification of transgenic strains of\u003c/b\u003e \u003cb\u003ePopulus hebeiensis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe Agrobacterium GV3101 strain, transformed with the overexpression vector, was initially streaked onto LB solid media supplemented with 50 mg\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e kanamycin and 50 mg\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rifampicin. Following incubation in the dark at 28\u0026deg;C for approximately 48 h, a single colony was selected and inoculated into 5 mL of LB liquid medium supplemented with 50 mg\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e kanamycin and 50 mg\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rifampicin. The culture was then agitated at a constant temperature of 180 r for 12\u0026ndash;18 h before being transferred to a larger volume (100 mL) of LB liquid medium containing the same concentrations of antibiotics for an additional period of 5\u0026ndash;6 h, aiming for OD\u003csub\u003e600\u003c/sub\u003e values between 0.4\u0026ndash;0.6. The mixture was subsequently centrifuged at 3500 r for 15 min to separate the supernatant from the pellet, which was subsequently resuspended in lysosomes for subsequent infection experiments.\u003c/p\u003e \u003cp\u003eMultiple vials were selected, each containing robust \u003cem\u003ePopulus hebeiensis\u003c/em\u003e tissue culture seedlings with healthy, flat leaves. After young leaves were excised and 3‒6 vertical incisions were made along the main vein via a blade, the leaves were placed on coculture media for precultivation at 28\u0026deg;C in darkness for 1 d. The precultivated leaves were subsequently immersed in a previously prepared infection solution for 15 min. After removal from the solution, excess moisture was absorbed via sterile filter paper before placing the leaves back onto the coculture medium for further cocultivation at 28\u0026deg;C in darkness for 3 days.\u003c/p\u003e \u003cp\u003eAfter the cocultivation process, the transgenic leaves were transferred to differentiation screening media, which were subsequently replaced approximately 15 days later. Upon reaching a length of approximately 2 cm, the kanamycin-resistant shoots were excised and transferred to rooting screening media. The resistant shoots successfully developed roots after approximately 12 d, and within 30 d, they had regenerated into complete plants, indicating the initial acquisition of the transgenic strains.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCold stress treatment and determination of the physiological indices of the transgenic plants\u003c/h2\u003e \u003cp\u003eOn the basis of previous research on the response of the \u003cem\u003ePhIPT5\u003c/em\u003e gene to low temperatures, it can be inferred that the expression level of the \u003cem\u003ePhIPT5\u003c/em\u003e gene is particularly sensitive when subjected to stress at 5\u0026deg;C for 24 h. Consequently, two transgenic strains with a growth period of 60 days and high expression levels, along with nontransgenic control seedlings, were selected and exposed to a temperature of 5\u0026deg;C in an incubator for 24 hours. The CK strains treated at 25\u0026deg;C were used as the control group. All other conditions remained consistent except for the temperature variation, and each group included 3 biological replicates. Samples were collected immediately after stress treatment from segments spaced 3\u0026ndash;6 at the apex of morphology to determine each index. Peroxidase (POD) and superoxide dismutase (SOD) activities, malondialdehyde (MDA) content, and conductivity were assessed. POD activity was measured through quantitative guaiacol oxidation; SOD activity inhibition of the photochemical reduction of nitrobenzene tetrazole was determined via spectrophotometry; the free MDA content was determined via the thiobarbituric acid method; the relative conductivity was determined via the immersion method; and the chlorophyll content was determined via ethanol extraction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of cytokinin metabolites\u003c/h2\u003e \u003cp\u003eThe 60-day-old CK and transgenic plants were provided by Wuhan Metville Biotechnology Co., LTD. The cytokinin metabolites of Hebei Poplar with the \u003cem\u003ePhIPT5\u003c/em\u003e gene and wild-type control lines were analyzed using the AB SciexQTRAP LC‒MS/MS platform, with 3 biological replications per sample. Differential gene expression analysis was conducted using the KEGG database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC102409/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC102409/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to enrich biochemical, metabolic, and signal transduction pathways associated with the differentially expressed genes .\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eCloning the\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe RNAprep Pure Plant Plus Kit from TIANGEN was used for the extraction of total RNA from tissue-cultured seedlings of Populus tomentosa leaves, followed by reverse transcription of the extracted total RNA via the TaKaRa PrimeScript RT reagent Kit to generate cDNA. The \u003cem\u003ePopulus hopeiensis\u003c/em\u003e cDNA was used as a template for PCR amplification of its coding sequence. The PCR mixture comprised 10 \u0026micro;L of Easy Taq Mix, 1 \u0026micro;L each of upstream and downstream primers (10 \u0026micro;mol/L), 2 \u0026micro;L of template, and 6 \u0026micro;L of deionized water. The PCR program consisted of initial denaturation at 95\u0026deg;C for 3 min; one cycle at 95\u0026deg;C for 30 s, 58\u0026deg;C for 30 s, and 72\u0026deg;C for 1 min; a final extension step at 72\u0026deg;C for 7 min; and storage at 4\u0026deg;C. The sequences of primers used are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Agarose gel electrophoresis was employed to detect the amplified products.\u003c/p\u003e \u003cp\u003eThe relative expression of the \u003cem\u003ePhIPT5\u003c/em\u003e gene in young leaves was assessed via qRT‒PCR, while the expression of \u003cem\u003ePhIPT5\u003c/em\u003e under different temperature stresses (exposed to 25\u0026deg;C, 10\u0026deg;C, 5\u0026deg;C, and 0\u0026deg;C for 3 h) was analyzed. The RT‒PCR results indicated that at 25\u0026deg;C, the relative expression of PhIPT5 in young leaves remained stable over time; however, as the temperature decreased, the relative expression of \u003cem\u003ePhIPT5\u003c/em\u003e decreased to approximately 1/4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These findings suggest that varying cold stress conditions influence the regulation of the \u003cem\u003ePhIPT5\u003c/em\u003e gene in young leaves.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBioinformatics analysis of the\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe full predictive open reading frame (ORF) of \u003cem\u003ePhIPT5\u003c/em\u003e spans 981 base pairs and codes for a total of 333 amino acids(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The expected protein has a molecular weight of 37.07 kDa, an isoelectric point of 7.64 (alkaline), an instability coefficient of 36.86, and a hydrophobicity value of -0.223. These results strongly indicate that the PhIPT5 protein can be classified as a stable alkaline hydrophilic protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUpon analysis, it was determined that among the 327 amino acids constituting the PhIPT5 protein, approximately 49.24% formed alpha helices, while approximately 11.62% formed extended strand structures; the remaining portion (39.14%) adopted random coil configurations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Additionally, the tertiary structure model reveals a tightly folded core region alongside a more loosely arranged area, which may play a crucial role in maintaining the overall structural integrity and functionality of the protein(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe amino acid sequences of PhIPT5 were compared with those of 15 species showing high homology in the NCBI database, including \u003cem\u003ePopulus alba\u003c/em\u003e, \u003cem\u003ePopulus nigra\u003c/em\u003e, \u003cem\u003ePopulus trichocarpa\u003c/em\u003e, \u003cem\u003ePopulus euphratica\u003c/em\u003e, \u003cem\u003eSalix koriyanagi\u003c/em\u003e, \u003cem\u003eSalix suchowensis\u003c/em\u003e, \u003cem\u003eRicinus communis\u003c/em\u003e, and \u003cem\u003eTripterygium wilfordii\u003c/em\u003e.\u003cem\u003eHevea brasiliensis\u003c/em\u003e, \u003cem\u003eHibiscus trionum\u003c/em\u003e, \u003cem\u003eGossypium hirsutum\u003c/em\u003e, \u003cem\u003eManihot esculenta\u003c/em\u003e, \u003cem\u003eHibiscus syriacus\u003c/em\u003e and \u003cem\u003eEuphorbia lathyris\u003c/em\u003e. MEGA 6.0 software was used to construct the phylogenetic tree (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The resulting tree revealed three major branches: \u003cem\u003eEuphorbia lathyris\u003c/em\u003e formed a single branch within \u003cem\u003eEuphorbiaceae\u003c/em\u003e; \u003cem\u003eRicinus communis\u003c/em\u003e, \u003cem\u003eHevea brasiliensis\u003c/em\u003e and \u003cem\u003eManihot esculenta\u003c/em\u003e grouped into another branch; and the remaining species clustered into the third branch. The genetic and evolutionary relationships between the PhIPT5 protein from \u003cem\u003ePopulus hopeien\u003c/em\u003esis and that from \u003cem\u003ePopulus alba\u003c/em\u003e are closely related.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSubcellular localization of\u003c/b\u003e \u003cb\u003eGFP-PhIPT5\u003c/b\u003e \u003cb\u003ein transiently transformed tobacco\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo determine the precise subcellular localization of the PhIPT5 protein, this investigation developed the fusion expression vector p35S::PhiPT5-GFP, which enables the expression of the fusion protein in tobacco leaves through \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e-mediated delivery. The findings depicted in (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) revealed that the fluorescence signal of p35S::PhIPT5 coincided with that of the endoplasmic reticulum localization marker HDEL (His-Asp-Glu-Leu)-Mcherry, suggesting the potential localization of PhIPT5 within chloroplasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGeneration of a transgenic\u003c/b\u003e \u003cb\u003ePopulus hopeiensis\u003c/b\u003e \u003cb\u003estrain\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe plant overexpression vector pCAMBIA1302::PhIPT5 was constructed through double enzyme digestion and T4 DNA ligase. The DH5α strain of \u003cem\u003eEscherichia coli\u003c/em\u003e was then transformed, and Kana-resistant LB medium was used for positive screening. After correct sequencing of a single colony, the plasmid was isolated and subsequently introduced into Agrobacterium GV3101 in its competent state for screening resistance to rifampicin. Following the shaking of a single colony, colony PCR was employed to verify the successful transfer of the target gene and vector to Agrobacterium.\u003c/p\u003e \u003cp\u003eDuring the coculture process, when white Agrobacterium appeared around the leaves, they were transferred to differentiation medium for screening. Some transgenic leaves produced resistant differentiated buds, whereas others withered and died. Each resistant bud was separated and numbered. When the resistant bud reached approximately 2 cm in size, it was cut off and transferred to rooting screening medium for further screening. After approximately 10 days, transgenic resistant buds developed adventitious roots and regenerated into whole plants; any false positive meristem buds that failed to take root were discarded. The rooted transgenic tissue culture-generated seedlings were cultivated at room temperature before being transplanted into small pots; after acclimatization in an artificial climate chamber, they were moved into larger pots before being finally transferred into a greenhouse (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of the cold tolerance of transgenic\u003c/b\u003e \u003cb\u003ePopulus hopeiensis\u003c/b\u003e \u003cb\u003eoverexpressing\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe activity of the antioxidant enzymes SOD and POD, as well as the soluble protein content in plants, serve as indicators of the degree of stress-induced damage to plants. Following a 3h exposure to 0\u0026deg;C stress, both SOD and POD activities, along with soluble protein levels, increased in CK and transgenic \u003cem\u003ePopulus hebeiensis\u003c/em\u003e compared with those at 25\u0026deg;C. Notably, the activities of SOD, POD, and soluble protein were significantly greater in the transgenic strains than in the CK strains(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe MDA content and conductivity are indicators of cell membrane integrity. After 3 h of exposure to 0\u0026deg;C stress, the MDA content and conductivity increased in both CK and transgenic \u003cem\u003ePopulus hopeiensis\u003c/em\u003e compared with those at 25\u0026deg;C; however, the MDA content and conductivity were lower in the transgenic strain than in the CK strain(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAt 25\u0026deg;C, the chlorophyll and carotenoid contents were notably greater in transgenic strain No. 1 than in the CK control or transgenic strain No. 2. As the temperature decreased, both the chlorophyll and carotenoid contents decreased to varying degrees for both the transgenic and CK strains. Nevertheless, at 5\u0026deg;C, these contents remained greater for the transgenic strains than for the CK strains(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eUnder cold stress conditions, the levels of soluble protein, POD, SOD, and chlorophyll were significantly greater for transgenics than for CKs; moreover, the increase in MDA content and conductivity was markedly lower. These results indicate that, under cold stress conditions, transgenics exhibit greater resistance than their CK counterparts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDetermination of cytokinin metabolites in transgenic\u003c/b\u003e \u003cb\u003ePopulus hebeiensis\u003c/b\u003e \u003cb\u003eunder cold stress\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe cytokinin metabolites of the transgenic and nontransgenic strains of \u003cem\u003ePopulus hebeiensis\u003c/em\u003e were analyzed via ultrahigh-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS). A total of 36 cytokinin metabolites were identified (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCytokinins in transgenic \u003cem\u003ePopulus hopeiensis\u003c/em\u003e under cold stress\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026minus;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerial number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFull name of the substance\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEnglish Abbreviations\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAS number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2-METHYLTHIO-cis-ZEATIN RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2MeScZR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e52049-48-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6-(2-hydroxybenzylamino)-9-beta-D-ribofuranosylpurine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eoTR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e50868-58-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePARA-TOPOLIN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e80054-30-4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emeta-TOPOLIN-9-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emT9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e179528-30-4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKinetin Riboside\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e4338-47-0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etrans-Zeatin-riboside\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etZR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e6025-53-2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6-Furfurylaminopurine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e525-79-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eortho-TOPOLIN-9-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eoT9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e160299-96-7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDL-DIHYDROZEATIN RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDHZR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e22663-55-4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2-CHLORO-trans-ZEATIN (2ClZ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2CltZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e29736-30-9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2-METHYLTHIO-cis-ZEATIN (2MeScZ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2MeScZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e52020-11-8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2-METHYLTHIO-N6-ISOPENTENYLADENINE (2MeS-iP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2MeSiP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e20758-33-2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2-methylthio-N-6-isopentenyladenosine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2MeSiPR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e20859-00-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN6-BENZYLADENOSINE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBAPR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e4294-16-0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKINETIN-9-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eK9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e98177-43-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epara-TOPOLIN RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epTR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e23666-24-2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eDL-DIHYDROZEATIN\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e14894-18-9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6-BENZYLAMINOPURINE 9-(BETA-D-GLUCOSIDE)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBAP9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e4294-17-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN6-BENZYLADENINE-7-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBAP7G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e56159-42-3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDIHYDROZEATIN-7-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDHZ7G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e91599-03-0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIHYDROZEATIN-O-GLUCOSIDE RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDHZROG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e62512-95-2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN6-(delta 2-Isopentenyl)-adenine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e2365-40-4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN6-ISOPENTENYLADENOSINE-D6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIPR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e7724-76-7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6-[4-HYDROXY-3-METHYL-CIS-2-BUTENYLAMINO]PURINE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e32771-64-5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecis-ZEATIN-9-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecZ9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e169565-72-4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecis-ZEATIN RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecZR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e15896-46-5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecis-ZEATIN-O-GLUCOSIDE RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecZROG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e125225-72-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN6-ISOPENTENYLADENINE-7-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eiP7G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e59384-58-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN6-ISOPENTENYLADENINE-9-GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eiP9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e83087-94-9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eortho-TOPOLIN\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eoT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e20366-83-0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4-[[(9-beta-D-Glucopyranosyl-9H-purin-6-yl)amino]methyl]phenol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epT9G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e1046433-04-8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etrans-Zeatin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e1637-39-4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTRANS-ZEATIN GLUCOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etZOG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e56329-06-7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6-Benzylaminopurine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e1214-39-7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eMeta-Topolin\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e75737-38-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emeta-TOPOLIN RIBOSIDE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emTR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c4\"\u003e \u003cp\u003e110505-76-5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCluster analysis was employed to examine the differential expression of multiple cytokinins in various control groups, aiming to ascertain the alterations in cytokinin metabolites in Populus hebeiensis leaves under cold stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt 25\u0026deg;C, the expression of cytokinins in the transgenic lines was significantly greater than that in the CK lines. When the transgenic and nontransgenic lines were compared at 25\u0026deg;C and 5\u0026deg;C, respectively, the expression of cytokinins in both types of lines was downregulated to varying degrees due to cold stress. However, under cold stress at 5\u0026deg;C, most cytokinins in the transgenic lines were significantly upregulated, with some even surpassing the levels in the CK lines. These findings suggest that the expression of cytokinins is greater in the transgenic lines than in the CK lines and that cold stress can inhibit their expression to a greater extent in the CK lines.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of the endogenous cytokinin metabolic pathway in transgenic\u003c/b\u003e \u003cb\u003ePopulus hebeiensis\u003c/b\u003e \u003cb\u003eunder cold stress\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOwing to the interactions of metabolites within organisms, various pathways are formed. The metabolites were enriched and annotated via the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, revealing that all the comparison groups were enriched in the zein synthesis pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Zeosine is involved in two pathways: isovaleryl pyrophosphate and mevalonate. The isovaleryl pyrophosphate pathway begins with the combination of DMAPP with ATP, ADP, and AMP, followed by catalysis by IPT to produce isovaleryl triphosphate, isovaleryl diphosphate, and isovaleryl adenosine monophosphate sequentially. CYP735A catalyzes the formation of trans-zeanoside adenosine triphosphate, trans-zeanoside diphosphate, and trans-zeanoside adenosine monophosphate, subsequently leading to further synthesis into isovalenyl-adenosine, which then forms isovalenyl-adenine. Trans-zeanoside adenosine monophosphate can generate trans-zeanoside, which can synthesize trans-zeanoside tZ or dihydrozeanoside adenosine monophosphate, leading to dihydrozeanoside DZ synthesis. Mevalonate has two pathways: DMAPP combines with tRNA catalyzed by IPT to form isovalenyldeoxyribonucleic acid, which further generates cis-isovalenyldeoxyribonucleic acid, resulting in cis-zeosine monophosphate and subsequently producing cis-zeosine nucleosides, leading to cis-zeosin cZ.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of cytokinin levels regulated by the\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene in various strains under cold stress\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe alterations in the levels of the four types of cell kinins primarily facilitated by the \u003cem\u003ePhIPT5\u003c/em\u003e gene under cold stress were examined (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e), and the levels of all four kinins in the transgenic lines were notably greater than those in the CK lines at 25\u0026deg;C. Following exposure to a temperature of 5\u0026deg;C, the levels of these cytokinins decreased to varying extents in both the transgenic and CK lines; however, the reduction was significantly less pronounced in the transgenic lines than in their CK counterparts. Compared with those of the CK strains, the iP content of the transgenic strains remained relatively stable after cold treatment but decreased significantly in the CK strains. Furthermore, the tZ and DZ contents decreased substantially under cold treatment in both the transgenic and nontransgenic lines; nevertheless, the hormone content remained considerably greater in the transgenic lines. The cZ content was nearly six times greater in transgenics than in CK at 25\u0026deg;C; following cold treatment, there was a significant decrease observed only within the former group but still maintained a level almost twice as high as that found within the latter.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cb\u003eCloning and bioinformatics analysis of the\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eIPT\u003c/em\u003e gene is a pivotal enzyme that catalyzes the initial step in the cytokinin biosynthesis pathway[25]. This gene is closely associated with various aspects of plant growth and development, including delaying leaf senescence, enhancing stress resistance, increasing crop yield, and increasing the fruit setting rate through its encoding of isopentyltransferase. On the basis of their amino acid sequence structure, IPT enzymes can be categorized into ATP/ADP-IPTs and tRNA-IPTs[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In this investigation, the \u003cem\u003ePhIPT5\u003c/em\u003e gene from \u003cem\u003ePopulus hopeiensis\u003c/em\u003e was cloned via PCR and subjected to bioinformatic analysis to elucidate both the structural and functional characteristics of the gene and its encoded protein.\u003c/p\u003e \u003cp\u003eThe CDS length of the cloned gene was determined to be 981 bp, which could encode 333 amino acid residues. Amino acids serve as fundamental components of proteins with diverse functions. Protein hydrophilicity refers to the ability of a protein to attract and bind water molecules within the protein structure. Hydrophilic proteins possess hydrogen bond networks on their hydrophobic surfaces that attract water molecules, thereby maintaining protein stability and promoting organismal metabolic processes. The presence or absence of signal peptides can determine a protein's self-transport ability[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe subcellular localization prediction for the PhIPT5 protein primarily indicates chloroplast localization. Research by Huynh et al. revealed that \u003cem\u003eIPT\u003c/em\u003e genes can modulate CTK biosynthesis, leading to increased chlorophyll content and improved plant photosynthetic efficiency[27], thus suggesting the potential involvement of this protein in leaf photosynthesis. Gene cis-acting elements play roles in regulating gene expression; notably, multiple elements related to the light response, hormone response, and cold response were identified in the \u003cem\u003ePhIPT5\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhysiological and biochemical changes in\u003c/b\u003e \u003cb\u003epopulus hebeiensis\u003c/b\u003e \u003cb\u003eseedlings harboring the\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene under cold stress\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn plants subjected to low-temperature stress, membrane permeability increases, leading to electrolyte imbalance and resulting in cell metabolism disorders. The conductivity method is commonly used to assess the extent of membrane damage, providing a more accurate reflection of plant cold tolerance[28]. The measurement of relative conductivity revealed an increase in each strain following low-temperature treatment; however, compared with the nontransgenic strain, the transgenic strain presented significantly lower conductivity, indicating less severe membrane damage.\u003c/p\u003e \u003cp\u003eCold tolerance results in the accumulation of a substantial amount of free radicals in plants, thereby intensifying membrane lipid peroxidation and leading to an increase in the malondialdehyde content. The higher the content is, the higher the cold tolerance of plants[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The change in the MDA content paralleled that in the relative conductivity. Following exposure to low-temperature stress, the MDA content increased across all the strains; however, the MDA content of the transgenic strains significantly decreased compared with that of the nontransgenic controls, indicating reduced levels of free radicals and decreased membrane lipid peroxidation in the transgenic strains.\u003c/p\u003e \u003cp\u003eUnder cold tolerance, there is an increase in reactive oxygen species (ROS) levels within plants. To mitigate ROS-induced damage, alterations in antioxidant enzyme activities facilitate ROS clearance. Investigations into POD, SOD, and CAT levels during eucalyptus and walnut exposure to cold stress revealed varying changes in enzyme activities over time [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Additionally, osmoregulatory substances serve as indicators of plant resilience to cold temperatures; heightened soluble protein levels contribute to increased bound water content while maintaining intracellular osmotic pressure. Notably, a fluctuating trend [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e32\u003c/span\u003e] in soluble protein (SP) levels was observed among poplar clones subjected to cold stress. Furthermore, exposure to cold tolerance resulted in elevated concentrations of soluble proteins along with increased POD and SOD activities; notably, higher POD and SOD activities were detected in the transgenic strains than in their CK counterparts, indicating robust cold tolerance within these genetically modified variants.\u003c/p\u003e \u003cp\u003eThe process of photosynthesis is highly sensitive to low temperatures, particularly those affecting chloroplasts, which serve as the primary sites for this biological function. Low temperatures not only disrupt the structure and function of chloroplasts but also impede the synthesis of chlorophyll, consequently diminishing the overall photosynthetic capacity of plants[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Research indicates that brief exposure to low temperatures can reduce the leaf chlorophyll content, enabling plants to adapt to adverse conditions[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In line with the results of our study, both the chlorophyll a and b levels decreased in the transgenic strains following low-temperature treatment; however, these levels remained higher than those observed in the nontransgenic strains. These findings suggest that low-temperature treatment had a more pronounced inhibitory effect on CK.\u003c/p\u003e \u003cp\u003eZhang et al. utilized the gene gun method to introduce the \u003cem\u003eIPT\u003c/em\u003e gene into tall fescue and assessed SOD, POD, and MDA levels in select strains during the late growth phase. These findings indicated that the transgenic strains Li4 and Li69 exhibited favorable performance across all three indices, resulting in significantly increased cold resistance and delayed plant senescence[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Chen evaluated various physiological parameters, including relative electrical conductivity, chlorophyll content, and root activity, in IPT transgenic rice at different growth stages. Compared with wild-type controls, transgenic lines presented reduced changes in relative electrical conductivity and lower degrees of chloroplast damage under low-temperature treatment during the booting stage and flowering stage [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Additionally, other studies have demonstrated notable inhibition of photosynthesis in tobacco and Jatropha under cold stress[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of endogenous cytokinin metabolites in\u003c/b\u003e \u003cb\u003ePopulus hebeiensis\u003c/b\u003e \u003cb\u003ewith\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene transfer at low temperature\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe endogenous hormones of plants are closely associated with the entire growth process, and various hormones collaborate to regulate diverse life activities of plants. They also play a role in the response of plants to nonbiotic stress [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Studies indicate that under low-temperature stress, plants adjust the expression of their endogenous cell division hormones to adapt to adverse conditions. Low temperature triggers the synthesis of ABA, while CTK exerts an antagonistic effect on it, leading to a decrease in its content. It has been demonstrated that CTK can modulate plant aging under low-temperature stress, thereby indirectly enhancing cold tolerance [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Multiple types of endogenous cell division hormones with two synthesis pathways exist: de novo synthesis and tRNA degradation. Research suggests that de novo synthesis is the primary source of cell division hormones in plants and is catalyzed by isopentenyl transferase [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In this study, qualitative and quantitative detection was carried out for cell division hormone-like metabolites in the leaves of transgenic and nontransgenic poplar stocks subjected to low-temperature treatment, resulting in the identification of 36 metabolites. Differentially abundant metabolite analysis revealed that most metabolites exhibited specific responses to low temperature. The expression level of cell division hormone-like metabolites was significantly greater in the transgenic stocks than in the nontransgenic controls after low-temperature treatment. Although the expression levels of metabolites were suppressed in both the transgenic and nontransgenic cultivars following low-temperature treatment, those in the transgenic cultivar remained higher than those in the nontransgenic cultivar. These findings indicate that the activity of cell division hormone metabolites was greater in the transgenic cultivar than in the WT cultivar and was less affected by suppression due to low temperatures.\u003c/p\u003e \u003cp\u003eSeveral studies have investigated the levels of endogenous hormones in 5 different \u003cem\u003eCynodon dactylon\u003c/em\u003e strains under low-temperature stress. The findings revealed that as the stress temperature decreased, the ABA content initially increased but then decreased across all the breeds, whereas the CTK content tended to decrease. However, breeds with high cold tolerance presented the lowest decrease in CTK content[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Zeng Guanghui conducted an analysis of endogenous hormones in tea tree leaves under natural low temperatures and reported a significant decrease in cytokinin levels[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was used to identify the zeatin bioanabolic pathway. Pathway analysis revealed that iP, tZ, DZ, and cZ were the primary types of endogenous cytokinins in the plants. The combination of DAMPP and ATP/ADP/AMP is catalyzed by ATP/ADP-IPTs to produce iP, tZ, and DZ. Moreover, the combination of DAMPP and tRNA catalyzed the production of cZ by TRNA-IPTS. Following low-temperature treatment, the levels of iP, tZ, DZ, and cZ in the transgenic lines were significantly greater than those in the nontransgenic lines. While the levels of iP, tZ, and DZ remained relatively stable in the transgenic lines after low PhIPT5-temperature treatment compared with the significant decrease observed in the nontransgenic lines, there was a notable decrease in the cZ content within the transgenic lines but no significant change within the nontransgenic lines after treatment. These results suggest that transfer of the gene significantly increased the cytokinin content in Hebei Yang leaf slices; however, low temperatures inhibited their expression, leading to decreased content. Under identical treatment conditions, tZ presented the highest content among all four metabolites, followed by iP and Dz, with cX displaying the lowest concentration. Combined with bioinformatics analysis, these findings suggest that PhIPT5 encodes ATP/ADP-IPTs, further indicating its role in regulating the isopentylpyrophosphate cytokinin metabolism pathway, which primarily involves the synthesis of tX.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of the response of the\u003c/b\u003e \u003cb\u003ePhIPT5\u003c/b\u003e \u003cb\u003egene to low temperature\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe isopentyltransferase encoded by the \u003cem\u003eIPT\u003c/em\u003e gene exhibits specific responses to both biological and abiotic stresses. The endogenous cytokinin content directly correlates with the expression of the \u003cem\u003eIPT\u003c/em\u003e gene, indicating its involvement in plant stress resistance through cytokinin regulation[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Wang et al. reported increased endogenous cytokinin levels and enhanced cold resistance in wheat expressing the \u003cem\u003eTaIPT8\u003c/em\u003e gene under drought stress compared with wild-type strains[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Similarly, transfer of the \u003cem\u003eIPT\u003c/em\u003e gene in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e led to elevated endogenous cytokinin levels and improved plant resistance[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Low-temperature stress increases the abscisic acid (ABA) content while gradually decreasing the CTK content, negatively regulating \u003cem\u003eIPT\u003c/em\u003e gene expression[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, the \u003cem\u003ePhIPT5\u003c/em\u003e gene was overexpressed in \u003cem\u003ePopulus hebeiensis\u003c/em\u003e via an overexpression vector. Cold tolerance indices and cytokinin metabolites were assessed in transgenic Populus hebeiensis under low-temperature stress. The results indicated the downregulation of differential cytokinin metabolites following low-temperature treatment. Specifically, the iP, tZ, DZ and cZ contents decreased significantly after low-temperature treatment, suggesting a decrease in \u003cem\u003ePhIPT5\u003c/em\u003e gene expression and a subsequent reduction in cytokinin content. Notably, \u003cem\u003ePhIPT5\u003c/em\u003e gene expression was positively correlated with the expression of cytokinins but was negatively regulated by low temperatures.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eABA(Abscisic Acid)\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCDS(Coding sequence)\u003c/p\u003e\n\u003cp\u003eCKXs(Cytokininoxidase/dehydrogenase)\u003c/p\u003e\n\u003cp\u003eCTK(Cytokinine)\u003c/p\u003e\n\u003cp\u003ed(day)\u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eh(hour)\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eKEGG(Kyoto Encyclopedia of Genes and Genomes)\u003c/p\u003e\n\u003cp\u003eLB(Luria-Bertanimedium)\u003c/p\u003e\n\u003cp\u003eMDA(Malondialdehyde)\u003c/p\u003e\n\u003cp\u003emin(minute)\u003c/p\u003e\n\u003cp\u003eMS(Murashige \u0026amp; Skoog medium)\u003c/p\u003e\n\u003cp\u003ePCR(Polymerase Chain Reaction)\u003c/p\u003e\n\u003cp\u003eRT-PCR(Real-time Quantitative PCR)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePOD(Peroxidase)\u003c/p\u003e\n\u003cp\u003eSOD(Superoxide dismutase)\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot application.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZQ analyzes the data, edits and writes the manuscript. TT and WN conducted the experiment. JL edited the manuscript. YE designed the experiment and edited the manuscript. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupported by the National Science and Technology Major Project (2018ZX08020002-005-005). These funding agencies have no role in research design, sample collection, data analysis or interpretation, and manuscript writing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll data and materials are presented in the main paper and additional supporting file.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere are no ethical issues involved.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eInner Mongolia Agricultural University, Hohhot, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eForestry and Grassland Bureau of Zhuozi County, Ulanqab City, Inner Mongolia, China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLiu W, Zhang SJ, Hou G. Research progress on \u003cem\u003epoplar\u003c/em\u003e germplasm resources in China[J]. Liaoning Forestry Science and Technology, 2020, (5): 47-52.\u003c/li\u003e\n\u003cli\u003eFang SZ. Research progress on the cultivation technology of poplar plantations in China[J]. Acta Ecologica Sinica, 2008, (10): 2308-2316.\u003c/li\u003e\n\u003cli\u003eZhang Y, Li SW, He ZG. Research status and development strategy of poplar resources and hybrid breeding in China[J]. Hebei Forestry Science and Technology, 2006, (201): 20-24.\u003c/li\u003e\n\u003cli\u003eWu FZ, Wang HX. Plant cold stress response mediated by protein ubiquitination[J]. Bulletin of Biological Technology, 2021, 37(6): 225-235.\u003c/li\u003e\n\u003cli\u003eHoppen C, Groth G. Novel insights into the transfer routes of the essential copper cofactor to the ethylene plant hormone receptor family[J]. Plant signaling \u0026amp; behavior, 2020, 15(2):1716512.\u003c/li\u003e\n\u003cli\u003eLong-Fang O C, Jia Y H, Yee Y C, et al. Transformation of broccoli (\u003cem\u003eBrassica oleracea\u003c/em\u003e var. italica) with isopentenyltransferase gene via \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e for postharvest yellowing retardation[J]. Molecular Breeding, 2001, 7(3):243-257.\u003c/li\u003e\n\u003cli\u003eMiyawaki K, Matsumoto-Kitano M, Kakimoto T. Expression of cytokinin biosynthetic isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin, and nitrate[J]. The Plant journal : for cell and molecular biology, 2004, 37(1):128-138.\u003c/li\u003e\n\u003cli\u003eFrebort I, Kowalska M, Hluska T, et al. The Evolution of Cytokinin Biosynthesis and Degradation[J]. Journal of experimental botany, 2011, 62(8):2431-2452.\u003c/li\u003e\n\u003cli\u003eMiyawaki K, Tarkowski P, Matsumoto-Kitano M, et al. Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis[J]. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(44):16598-16603.\u003c/li\u003e\n\u003cli\u003eMok D, Mok M. Cytokinin metabolism and action[J]. Annual Review of Plant Physiology and Plant Molecular Biology, 2001, 52(1):89-118.\u003c/li\u003e\n\u003cli\u003eLeshem Y Y, Wurzburger J, Grossman S, et al. Cytokinin interaction with free radical metabolism and senescence: Effects on endogenous lipoxygenase and purine oxidation[J]. Physiologia Plantarum, 1981, 53(1):9-12.\u003c/li\u003e\n\u003cli\u003eNguyen H N, Lai N, Kisiala A B, et al. Isopentenyltransferases as master regulators of crop performance: their function, manipulation, and genetic potential for stress adaptation and yield improvement[J]. Plant biotechnology journal, 2021, 19(7):1297-1313.\u003c/li\u003e\n\u003cli\u003eZhou ZiX. Regulation of cell division in \u003cem\u003eMedicago truncatula\u003c/em\u003e by cytokinin and functional identification of the \u003cem\u003eIPT\u003c/em\u003e gene [D]. Beijing Forestry University, 2020.\u003c/li\u003e\n\u003cli\u003eBrugiere N, Humbert S, Rizzo N, et al. A member of the maize isopentenyl transferase gene family, \u003cem\u003eZea mays\u003c/em\u003e isopentenyl transferase 2 (ZmIPT2), encodes a cytokinin biosynthetic enzyme expressed during kernel development. Cytokinin biosynthesis in maize[J]. Plant molecular biology, 2008, 67(3): 215-229.\u003c/li\u003e\n\u003cli\u003eMatsuo S, Kikuchi K, Fukuda M, et al. Roles and regulation of cytokinins in tomato fruit development[J]. Journal of experimental botany, 2012, 63(15):5569-5579.\u003c/li\u003e\n\u003cli\u003ePeng J, Peng F, Zhu C, et al. Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate[J]. Tree Physiology, 2008, 28(6):899-904.\u003c/li\u003e\n\u003cli\u003eSakamoto T, Sakakibara H, Kojima M, et al. Ectopic expression of KNOTTED1-like homeobox protein induces expression of cytokinin biosynthesis genes in rice[J]. Plant physiology, 2006, 142(1):54-62.\u003c/li\u003e\n\u003cli\u003eTakei K, Sakakibara H, Sugiyama T. Identification of genes encoding adenylate isopentenyltransferase, a cytokinin biosynthesis enzyme, in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e[J]. The Journal of biological chemistry, 2001, 276(28):26405-26410.\u003c/li\u003e\n\u003cli\u003eYe C J, Wu S W, Kong F N,et al.Identification and characterization of an isopentenyltransferase (\u003cem\u003eIPT\u003c/em\u003e) gene in soybean (\u003cem\u003eGlycine max L.\u003c/em\u003e)[J]. Plant Science: An International Journal of Experimental Plant Biology, 2005, 170(3):542-550.\u003c/li\u003e\n\u003cli\u003eYuichi S, Yukio O, Akiko M, et al. Molecular cloning, expression, and characterization of adenylate isopentenyltransferase from hop (Humulus lupulus L.)[J]. Phytochemistry, 2004, 65(17):2439-2446.\u003c/li\u003e\n\u003cli\u003eLi Hao, Zhang Wen, Zhao Xuqian, et al. Cloning and Function Analysis of the MdIPTs Gene Family in Apple (\u003cem\u003eMalus domestica\u003c/em\u003e Borkh.)[J]. Chinese Agricultural Science, 2011, 44(19): 4029-4036.\u003c/li\u003e\n\u003cli\u003eZhang X, Yang LL, Yang XL. Changes in SOD, POD and MDA in Late Growth Period of Tall Fescue Transgenic with Leafy-ipt Gene[J]. Shanxi Agricultural Science, 2008, (9): 26-28.\u003c/li\u003e\n\u003cli\u003eYu SJ, Xiong YH,Mi JT, et al. Study on Drought Resistance of Transgenic Rice with IPT Gene[J]. Chinese Journal of Agricultural Science and Technology, 2012, 14(6): 30-35.\u003c/li\u003e\n\u003cli\u003eLiang FF. Study on the Characteristics of Rooted Suckers of Populus davidiana Var. Decidua in Loess Plateau of Shanxi Province and Understory Vegetation[D]. Beijing Forestry University, 2015. \u003c/li\u003e\n\u003cli\u003eKunkel T, Niu Q, Chan Y, et al. Inducible isopentenyl transferase as a high-efficiency marker for plant transformation[J]. Nature Biotechnology, 1999, 17:916-919\u003c/li\u003e\n\u003cli\u003eMiyawaki K, Tarkowski P, Matsumoto-Kitano M, et al. Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis[J]. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(44):16598-16603.\u003c/li\u003e\n\u003cli\u003eYu Xiangtian. Analysis of Protein Sequence Similarity [D]. Shandong University, 2011. \u003c/li\u003e\n\u003cli\u003eHuynh L N, Vantoai T, Streeter J, et al. Regulation of flooding tolerance of SAG12:ipt Arabidopsis plants by cytokinin[J]. Journal of experimental botany, 2005, 56(415):1397-1407.\u003c/li\u003e\n\u003cli\u003eLi YH, Nurmaimaiti Aimaiti, Xiarepatie Azeez, et al. Comparative Study on Cold Resistance of Different Hawthorn Varieties in Xinjiang[J]. Xinjiang Agricultural Sciences, 2019, (12): 2289-2255.\u003c/li\u003e\n\u003cli\u003eJing JL, Liu MX, Wei X, et al. Evaluation of Cold Resistance of Several Apple Intermediate Rootstocks[J]. Acta Horticulturae Sinica, 2022, 39(6): 970-981.\u003c/li\u003e\n\u003cli\u003eLiu GH, Lan JB, Liu YQ, et al. Impact of exogenous calcium on the physiological characteristics and endogenous hormone levels of Eucalyptus grandis seedlings under low temperature stress[J]. Journal of Northwest Forestry College, 2017, 32(6): 101-106.\u003c/li\u003e\n\u003cli\u003eWu S, Jia YL, Zhi FJ. Comprehensive assessment of cold resistance in walnut branches under low temperature stress[J]. Forestry and Ecological Science, 2020, 35(3): 314-319.\u003c/li\u003e\n\u003cli\u003eLiu ZY, Liu JL, Zhu YY, et al. Advancements in understanding the low temperature response mechanism of woody plants[J]. Journal of Northwest Forestry College ,2022 ,37(2) :157-163.\u003c/li\u003e\n\u003cli\u003eWu GX,Tang Xian L,Yang DG ,et al.Research progress on plant physiological responses to low temperature stress[J]. Crop Journal,2008,(3):17-19.\u003c/li\u003e\n\u003cli\u003eChen NG,Yu XQ,Zhao DT ,et al.Study on cold tolerance of transgenic rice plants with\u003cem\u003e IPT \u003c/em\u003egene [J].Journal Of Southwest Agricultural Sciences,2006,(2):255-259.\u003c/li\u003e\n\u003cli\u003eFeng Y L,Cao K F.Photosynthesis and photoinhibition after night chilling in seedlings of two tropical tree species grown under three irradiances [J].Photosynthetica: International Journal for Photosynthesis Research,2005,43(4):567-574.\u003c/li\u003e\n\u003cli\u003eHu RS,Zeng Z,Dai XH ,et al.The response of photosynthetic characteristics in young leaves from different tobacco varieties to low temperature stress [J].Chinese Agricultural Bulletin ,2013 ,29(34):71-75.\u003c/li\u003e\n\u003cli\u003eZeng GH,Ma QP,Wang WD ,et al.Effects of natural low temperatures on endogenous hormone levels in tea plants [J ].Journal Of Tea Science ,2016 ,36(1):85 -91 .\u003c/li\u003e\n\u003cli\u003eYang Yo,Lou YH,Y ang ZJ ,et a l .Effects o f lo w temperat ure st ress o n hormones an d carbohydrate metabolism i n dogtooth violet s[J ].Journal O f Grassland Science ,2016 ,25(2):205 -215 .\u003c/li\u003e\n\u003cli\u003eZhang HM,Wang JL,Liao XR.Biosynthesis,m e t abo lism, and receptors o f cell division factor s[J ].Plant Physiological Communications,2003 ,(3) :267 -272 .\u003c/li\u003e\n\u003cli\u003eNguyen H N, Lai N, Kisiala A B, et al. Isopentenyltransferases as master regulators of crop performance: their function, manipulation, and genetic potential for stress adaptation and yield improvement[J]. Plant biotechnology journal, 2021, 19(7):1297-1313.\u003c/li\u003e\n\u003cli\u003eNa W, Jun C, Yuan G, et al. Genomic analysis of isopentenyltransferase genes and functional characterization of \u003cem\u003eTaIPT8\u003c/em\u003e indicates positive effects of cytokinins on drought tolerance in wheat[J]. The Crop Journal, 2023, 11(1):46-56.\u003c/li\u003e\n\u003cli\u003eEremina M, Rozhon W, Poppenberger B. Hormonal control of cold stress responses in plants[J]. Cellular and Molecular Life Sciences, 2016, 73(4):797-810.\u003c/li\u003e\n\u003cli\u003eDuanYB,Zhao DG,Zhao FL,g.et al.Some physiological characteristics of rice transplanting \u003cem\u003eIPT\u003c/em\u003e gene under low temperature stress[J].Journal of Mountain Agricultural Biology, 2007, (2):95-98.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1 and 2 ","content":"\u003cp\u003eTable 1 and 2 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Populus hopeiensis, PhIPT5, Cytokinin, Cold stress","lastPublishedDoi":"10.21203/rs.3.rs-4943804/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4943804/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground:\u003c/h2\u003e \u003cp\u003ePopulus hopeiensis, a significant afforestation species, faces substantial growth constraints due to cold stress. The \u003cem\u003eIPT\u003c/em\u003e gene, a pivotal rate-limiting enzyme in cytokinin synthesis, plays a crucial role in controlling plant reactions to both biotic and abiotic pressures. In this study, we isolated the \u003cem\u003ePhIPT5\u003c/em\u003e gene from \u003cem\u003ePopulus hopeiensis\u003c/em\u003e and analyzed its biological characteristics and cold tolerance with the aim of providing guidance for the production of cold-resistant poplars.\u003c/p\u003e\u003ch2\u003eResults:\u003c/h2\u003e \u003cp\u003eThe coding sequence (CDS) of the \u003cem\u003ePhIPT5\u003c/em\u003e gene spans 981 bp, encoding 333 amino acid residues with a molecular weight of 37.07 kDa. The PhIPT5 protein has alkaline stability and hydrophilicity. Phylogenetic analysis revealed that \u003cem\u003ePopulus hopeiensis\u003c/em\u003e IPT5 is closely related to \u003cem\u003ePopulus alba\u003c/em\u003e. Subcellular localization studies revealed the chloroplastic localization of PhIPT5. We constructed an overexpression vector for \u003cem\u003ePhIPT5\u003c/em\u003e and transformed it into \u003cem\u003ePopulus hopeiensis\u003c/em\u003e, resulting in improved cold tolerance in transgenic seedlings. Analysis of cytokinin metabolites revealed significantly greater levels in leaves harboring the \u003cem\u003ePhIPT5\u003c/em\u003e gene than in those harboring the CK gene even after exposure to cold. Furthermore, our findings suggest that the \u003cem\u003ePhIPT5\u003c/em\u003e gene primarily regulates the isoamyl pyrophosphate cytokinin metabolism pathway, leading to the synthesis of tZ, iP, and DZ cytokinins.\u003c/p\u003e\u003ch2\u003eConclusion:\u003c/h2\u003e \u003cp\u003eOur isolation of \u003cem\u003ePhIPT5\u003c/em\u003e from \u003cem\u003ePopulus hopeiensis\u003c/em\u003e demonstrated that its overexpression enhances resistance to cold stress in transgenic plants. This work provides a foundation for further elucidating the function of \u003cem\u003eIPT\u003c/em\u003e genes and has significant implications for advancing research on enhancing cold tolerance in \u003cem\u003ePopulus hopeiensis\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Cloning and assessment of cold resistance in the transcription factor PhIPT5 from Populus hopeiensis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-04 18:17:08","doi":"10.21203/rs.3.rs-4943804/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-09-05T12:11:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-05T12:05:53+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-04T05:55:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2024-08-20T09:27:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9fe692d0-c988-4a85-86cc-ebe0cfd5edb9","owner":[],"postedDate":"October 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-09T16:02:55+00:00","versionOfRecord":{"articleIdentity":"rs-4943804","link":"https://doi.org/10.1186/s12870-025-06481-2","journal":{"identity":"bmc-plant-biology","isVorOnly":false,"title":"BMC Plant Biology"},"publishedOn":"2025-06-02 15:57:35","publishedOnDateReadable":"June 2nd, 2025"},"versionCreatedAt":"2024-10-04 18:17:08","video":"","vorDoi":"10.1186/s12870-025-06481-2","vorDoiUrl":"https://doi.org/10.1186/s12870-025-06481-2","workflowStages":[]},"version":"v1","identity":"rs-4943804","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4943804","identity":"rs-4943804","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00