Fishing spider in India: first record of family Dolomedidae with the description of a new species | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Fishing spider in India: first record of family Dolomedidae with the description of a new species Arjun Cherukutty, Jithu Unni Krishnan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7043304/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract India is a biodiverse-rich country with four global hotspots and a high level of endemism. These locations continue to be re-counted with new species discoveries. The present exploratory study was conducted at Wayanad, Kerala which is part of the Western Ghats. The genus Dolomedes Latreille, 1804 commonly known as Raft or Fishing spiders belonging to the family Dolomedidae Simon, 1876, is widely distributed across the globe except Antarctica. However, the genus and family have never been scientifically described from India. However, several checklists and articles have mentioned the presence of this genus in the country. This study details the first record of the family Dolomedidae and the genus Dolomedes with a new species Dolomedes indicus sp. nov from both sexes. This study used both classical and molecular taxonomic method for more robust species-level identification. A basic phylogenetic tree of the Dolomedes genus with novel species was created using the MT-CO1 gene. Biological sciences/Ecology Earth and environmental sciences/Ecology Biological sciences/Evolution Biological sciences/Genetics Biological sciences/Zoology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Spiders are among the most diverse arthropods with 53125 described species [ 1 ] and they are the 7th largest order in the animal kingdom [ 2 ]. In India, there are currently 1958 species belonging to 505 genera in 62 families [ 3 ]. Dolomedes Latreille, 1804 [ 4 ] – is a globally distributed genus in the family Dolomedidae Simon, 1876 [ 5 ] with 105 accepted species around the world [ 1 ]. Earlier the genus was placed in the family Pisauridae Simon, 1890 [ 6 ] commonly known as nursery web spiders, owing to its unique behaviour of constructing nursery webs. However, the construction of nursery webs is not confined only to Pisuaridae. Recent molecular and morphological studies by Sarah et al. , 2024 [ 7 ] and Yu et al ., 2024 [ 8 ] have resurrected the family status of Dolomedidae Simon, 1876. Thus, Pisauridae is circumscribed as a monophyletic group. The resurrected family Dolomedidae consists of seven genera including Dolomedes . The genus Dolomedes is recently originated, approximately 9–16 million years ago during the Miocene epoch [ 8 ]. Dolomedes are commonly known as raft or fishing spiders with large semi-aquatic lifestyle, feeding predominantly on freshwater vertebrates [ 9 ]. Since its description in 1804 by Latreille, the genus has never been scientifically described from India. The nearest congeneric is Dolomedes mizhoanus Kishida (1936) [ 10 ] from China, Laos, Malaysia, and Taiwan; Dolomdes boiei Doleschall (1859) [ 11 ] from Sri Lanka and Indonesia; and Dolomedes karschi Strand (1913) [ 12 ] from Sri Lanka. Several abstract literatures have mentioned the presence of the Dolomedes genus in different locations in India since 1999 (Table 1 ); Albeit, no scientific effort has carried out for a detailed taxonomy. Table 1 List of abstract articles mentioning the presence of the genus Dolomedes in India. Sl. No. Literature Title Location in India Species reference 1 Kumar et al. (1999) [ 13 ] Studies on the ecology of the Raft Spider Dolomedes fimbriatus (DOL.) (Araneae: Pisuaridae) in the rice fields of Coimbatore. Coimbatore, Tamil Nadu Dolomedes fimbriatus 2 Gajbe (2003) [ 14 ] Checklist of Spiders (Arachnida: Araneae) of Madhya Pradesh and Chhattisgarh. Madhya Pradesh and Chhattisgarh Dolomedes sp. 3 Gaikwad et al. (2016) [ 15 ] Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India. Pune-Maharashtra Dolomedes sp. 4 Palita (2016) [ 16 ] Faunal diversity assessment of invertebrates and lower vertebrates of Deomali hills of Eastern Ghats, Koraput, Odisha, India. Final Technical Report. Odisha Biodiversity Board and Central University of Orissa. Koraput, Orissa. Dolomedes sp.1 Dolomedes sp.2 5 Lanka et al. (2017) [ 17 ] An addition to Spider fauna from the vicinity of Radhanagari wildlife sanctuary of Kolhapur district. Radhanagari Wildlife Sanctuary of Kolhapur District, Maharashtra Dolomedes sp. 6 Dhali and Sureshan (2017) [ 18 ] Arachnida: Araneae (Spiders) in Current status of freshwater faunal diversity in India. Maharashtra, Kerala (Aralam WLS), and Goa Dolomedes sp. 7 Namrata et al. (2018) [ 19 ] Species diversity, abundance and habitat association of spiders with relation to their guild composition in different habitats of North Bengal Wild Animals Park (Bengal Safari). West Bengal Dolomedes tenebrosus 8 Sugumaran and Duraimurugan (2019) [ 20 ] Arthropod diversity in horticultural ecosystems in Keelaiyur block, Nagapattinam district, Tamil Nadu. Nagapattinam, Tamil Nadu. Dolomedes tenebrosus 9 Markandan et al . (2021) [ 21 ] A Preliminary study on Spiders diversity from Watiyim village, Mokokchung district, Nagaland, India. Mokokchung, Nagaland. Dolomedes sp. Dolomedes scriptus Dolomedes albineus 10 Tiwari and Singh (2021) [ 22 ] Diversity and distribution of Pisuaridae (Aranea: Araneomorphae: Arachnida) in India. Tamil Nadu, West Bengal, Arunachal Pradesh, Karnataka, Madhya Pradesh, Maharashtra and Odisha Dolomedes tenebrosus Dolomedes triton Dolomedes fimbriatus Dolomedes sp. All of the literature referred to in Table 1 is questioned for authenticity due to the lack of descriptive taxonomic notes that distinguish this genus or for the species of interest. Methods The initial sightings of the species occurred in the evergreen rainforests of Wayanad, Kerala at Periya (11°49'29.4"N;75°50'37.1"E). However, collection was not possible due to lack of permit. Later, searches in similar habitats, including the shallow streams running through a private land with adjacent forest areas of Lakkidi in Wayanad (11°30'54.1"N; 76°02'12.4"E), led to first-hand collections of the species.Spiders were collected by hand from a running stream in Lakkidi during 0900 to 1300 hours in June and August. (Fig. 1 ). A total of 17 spiders were collected, of which eight were preserved in 75% alcohol for morphological examination. Two legs from each preserved specimen were removed and kept in 99% alcohol for molecular studies. The remaining nine live individuals were maintained in the laboratory at confined conditions for future studies. Anatomical Examination : Morphological examination was carried out with a stereo zoom microscope (Make: Olympus SZ61) attached to a camera (Make: Magcam DC Plus 14). The nomenclature of male palp structure follows the description of Carico (1973) [ 23 ] and Sierwald (1990) [ 24 ]. The female genitalia were dissected and cleaned using Potassium hydroxide (KOH), and nomenclature follows that of Sierwald (1989) [ 25 ]. The male palp was soaked in distilled water and KOH to expand for morphological observation. All the microscopic images used in this study were captured using Nikon SMZ 25 stereo-microscope and measurements were taken using NIS-elements 5.4 software. The measurements of palp consist of the femur, patella, tibia, and tarsus, where-as leg consists of femur, patella, tibia, meta tarsus, and tarsus. All the measurements given in this work are in millimetres. The holotype and paratype is deposited at the Kerala Forest Research Institute (KFRI) entomology museum. Molecular Examination Genomic DNA was extracted from four specimens of Dolomedes sp for analyses. The mitochondrial gene cytochrome c oxidase 1 (CO1) was amplified from the specimens (from four individuals) for molecular species identification and construction of a gene tree. DNA was extracted from the sample using DNeasy Blood and Tissue kit (Qiagen; cat no. 69504) Kit following the manufacturer’s instructions. Briefly, sample stored at 4°C was rinsed twice in PBS, air dried briefly, and then ground well with a micro-pestle, after which the powdered sample was transferred to sterile microcentrifuge tubes. To these tubes, 180 µl of buffer ATL and 20 µl Proteinase K were added, mixed thoroughly by vortexing, and incubated at 56°C for 3 hours. The mixture was vortexed occasionally during incubation to disperse the sample. After the incubation period, 200 µl of buffer AL was added to the sample, and mixed by vortexing. Then 200 µl of absolute alcohol was added to the mixture and mixed again. The mixture was then pipetted into the DNeasy Mini-spin column placed in a 2 ml collection tube and centrifuged at ≥ 6000 × g (8000 rpm) for 1 min. The flow through was subsequently discarded, and the column was washed with 500 µl of buffer AW1, and then with 500 µl of buffer AW2, and then a last spin for 3 min at 14,000 rpm to dry the DNeasy spin column membrane. The collection tube was discarded and the DNA in the spin column was eluted into a clean 1.5 ml microcentrifuge tube by adding 200 µl of buffer AE directly onto the DNeasy membrane; incubating the tube at room temperature for 1 min, and then centrifuged for 1 min at ≥ 6000 × g. The quality of DNA was checked via agarose gel electrophoresis. The MT-CO1 gene from spider DNA was amplified in a 20 µl reaction volume containing 1 µl DNA (10–50 ng), 1 µl each of forward LCO1490 GGTCAACAAATCATAAAGATATTGG and reverse HCO2198 TAAACTTCAGGGTGACCAAAAAATCA primers [ 26 ] (10 picomoles/µl), and 10 µl of Emerald Amp GT PCR master mix (Takara). The cycling conditions used were as follows: initial denaturation at 95°C for 2 min: followed by cycle denaturation at 95°C for 40 s, annealing at 52°C/45°C for 40 s, extension at 72°C for 45 s for a total of 30 cycles; and a final extension for 7 min at 72°C. The success of the PCR was confirmed by running 5 µl of PCR product on 1% agarose gel (impregnated with ethidium bromide) at 120 V; for ~ 45 min in 1X TAE Buffer. The gel structure was recorded with a UV gel documentation system. A 100bp DNA ladder from Thermo was loaded parallel to the PCR products as a size marker. The PCR products were further treated with ExoSAP-IT PCR Product Clean-up Reagent and used as a template for sequencing, and Sanger Sequencing of PCR product was performed with ABI PRISM Big Dye Terminator ready reaction mix (Life Technologies, USA). The cycle extension products were purified following ethanol/EDTA/ sodium acetate precipitation ( Applied Biosystems ABI 3730xl DNA). Phylogenetic analysis The sequences generated were quality-checked and trimmed using the software Sequencher V4.10.1 (Gene Codes Corporation, Ann Arbor, MI USA). We constructed an MT-CO1 gene tree using sequences generated from the collected Dolomedes sp. and other existing MT-CO1 sequences of Dolomedes spp. collected from NCBI GenBank. A total of 82 sequences including the outgroup (Supplementary data Table 1 ) were used for the final construct. The sequences were aligned using MAFFT version 7 [ 27 ]. The sequences that created errors in alignment and more repeat sequences of species were omitted from the alignment. For the construction of MT-CO1 gene tree, we performed maximum likelihood (ML) and Bayesian inference (BI) phylogenetic analyses. The ML analysis was performed in RAxML [ 28 ] with 1000 bootstrap replicates using the rapid bootstrapping algorithm with GTRGAMMA substitution model in CIPRES Science Gateway [ 29 ]. The BI analysis was performed in MrBayes [ 30 ] under the substitution model GTR + I + G as suggested by MrModeltest [ 31 ] using PAUP 4.0 [ 32 ], with 1 million generations run independently in two chains with sampling every 1000 generations with 25% burn-in. Hygropoda higenga was used as the outgroup based on the recent phylogenetic study [ 7 ]. The generated gene tree was accessed using Interactive Tree of Life [ 32 ] and edited for better representation. The genetic distance was calculated using Kimura 2-parameter model [ 33 ] in MEGA 10 [ 34 ] with high bootstrap support. Results Taxonomy of Dolomedes indicus sp. nov. Dolomedidae Simon, 1876 [5] (rank resurrected) Dolomedes Latreille, 1804 [4] Dolomedes indicus Arjun and Jithu, 2025 sp. nov. ZooBank ID:urn:lsid:zoobank.org:pub:84CBD244-FC97-4145-8E0C-254191D8ACD7 Holotype male (Figs. 2, 3).India: Kerala, Wayanad, Lakkidi (11.515027, 76.036765, MAP 1), got collected from the stream near ‘Wayanad Wild Resort’ by hand. Deposition number - KFRI-IC-VII-B-24-1424. Paratype female (Figs. 4, 5). Same as Holotype. Deposition number - KFRI-IC-VII-B-24-1425. Holotype and other paratype voucher ID’s are given in Supplementary data table 2 Materials examined:Three females, three males, and two juveniles, from the shallow stream in front of the Wayanad Wild Resort, Wayanad, Kerala India. Figure 1 shows the type locality of Dolomedes indicus sp. nov. Figure 7A, 7B shows the habitat where they were collected. Diagnosis:Male Dolomedes indicus sp. nov.looks very similar to Dolomedes mizhoanus , Kishida, 1986 [10] morphologically. However, the species differ by; a) Adult male Dolomedes indicus sp. nov. has a distinctive white marking often from clypeus till fovea (Fig. 7C) which is present only in lateral edges in Dolomedes mizhoanus , b) The T is more recurved forming a ‘U’ shape before meeting MA (Figs. 3B, 3E), c) E is curved downwards to the 6 ‘O’ clock direction from the tip of Fu and then deviates retro-laterally towards the conductor (Figs. 3B, 3E), e) Presence of a small protrusion on the proximal end of MA (Figs. 3A, 3D). The female Dolomedes indicus sp. nov.can be separated from Dolomedes mizhoanus species by a) narrower MF, widened medially (Figs. 5A, 5C), b) a larger second loop of spermatheca (Figs. 5B, 5D), and c) a smaller final loop of spermatheca (Figs. 5B, 5D). Literature examined for similarity with Dolomedes mizhonus :Kishida, 1936 [10]; Brignoli, 1983 [36]; Zhang et al ., 2004 [37]; Jager, 2007 [38]; Yin et al. , 2012 [39]. Morphological Description Male. Total length 12.98: carapace length 7.80, width 7.43, anterior height 2.14, posterior height 2.86; abdomen length 5.18, width 3.33. Length of palp and legs: palp 12.33 (4.88, 1.88, 2.17, 3.4); leg I 44.6 (2.81, 0.93, 10.22, 4.4, 10, 10.33, 5.91); leg II 44.26 (2.57, 0.93, 10.76, 4.55, 9.69, 9.93, 5.83); leg III 37.74 (2.34, 1.13, 9.41, 4.03, 8.22, 8.18, 4.43) leg IV (2.78, 1.21, 11.09, 4.22, 10.42, 11.51, 6.71). Leg formula 4123. The Legs and body are greenish-brown in colour. The carapace is pear-shaped, almost equal in length and width, distinct fovea, longitudinal, with a depression in the posterior end of the carapace (Fig. 2C), thick white hairs seen from the clypeus till half of the carapace, absent at AER and PER, thicker at clypeus and lateral edges (Figs. 2B, 2C, 7C,7E), the white hairs almost form a convex structure (Fig. 7C), black lines radiating from the distinct fovea, a small black arch structure on both sides with a gap near fovea (Fig. 2A). Eight eyes with a black ring (Fig. 2B). Eyes are arranged in two rows. AER weakly recurved whereas PER strongly recurved (Fig. 2B). MOA is dark brown with several thick black setae. Diameters of AME 0.20, ALE 0.16, PME 0.32, PLE 0.35; Anterior width of MOA 0.69, posterior width of MOA 1.22; distance between AMEs 0.11, distance between PMEs 0.19, distance between AME and ALE 0.04, distance between PME and PLE 0.06. Clypeus 1.08. Chelicera length 2.86. Both chelicerae with four retromarginal and two promarginal teeth, covered with hairs, fang reddish brown, teeth dark brown (Fig. 2D). Endite length 2.16, width 1.12; labium length 1.26, width 1.25; sternum almost heart-shaped with a notch on anterior end, depressed than coxa, with long and short hair structures, length 2.82, width 3.16; All endite, labium, sternum similar in colour, endite and labium darker in colour. Abdomen longer than wide with distinct brown cardiac mark and white marks nearby, almost oval shape, medially widened, posteriorly tapered, dorsum with numerous short setae, white and brown, posterior abdomen segmented with white on black longitudinal lines (Fig. 2A). Lateral edge of abdomen has short white hairs which forms irregular bands. Ventrally light brown coloured with short to long hairs. Legs greenish-brown in colour with numerous spines, short white hairs making spots on legs, tarsus curved/flexible. Tibia I, II, III, IV with one medial dorsal spine and Tibia I and II with four pairs of lateral ventral spines. Metatarsus I, II, III, IV with one medial spine ventrally. Palp tarsus longer than tibia, tibia with four spines, RTA short not crossing BCA, RTA sclerotized, without and branching (Figs. 2E, 3B, 3E), BCA distally widened, proximate to RTA (Figs. 3B, 3E), ST prolaterally elongated, T forms a ‘U’ shape before extending above ST (Figs. 3B, 3E), T connected to membranous C in retrolateral side and DTP in prolateral side (Figs 3C, 3D, 3E, 3F). DTP long extends over E, Sa placed prolaterally, between DTP and MA, MA shorter than DTP, base of MA starts from the ‘U’ shape of T, proximal end of MA has a small projection (Figs. 3A, 3D), Fu surpasses E by a minute distance (Fig, 3B, 3E), E long, E curves down to 5 ‘o’ clock direction over DTP and ends retrolaterally at C with a bend near distal end of MA towards 3 ‘o’ clock direction (Fig. 3B). MA hook-shaped, MA sits retrolaterlly to Sa and DTP, Fu proximally widened and distally narrow (Fig. 3B, 3D). LA is irregularly oval in shape (Fig 2F). ALL Fu, Eb, LA from DST of apical division. Female. Total length 16.42: carapace length 8.62, width 8.54, anterior height 2.82, posterior height 3.22; abdomen length 8.02, width 5.74. Length of palp and legs: palp 12.38 (4.43, 1.78, 2.48, 3.69); leg I 41.45 (3.09, 1.20, 10.25, 4.59, 9.47, 8.53, 4.32); leg II 42.49 (3.22, 0.76, 10.81, 4.77, 9.53, 8.9, 4.5); leg III 40.16 (2.99, 1.13, 10.26, 4.4, 8.7, 8.44, 4.24); leg IV 48.44 (3.1, 1.93, 11.51, 4.53, 10.56, 11.39, 5.42). Leg formula 4213. Leg and body greenish brown in colour. Carapace pear-shaped, length and width almost similar, space above PER lighter with less hairs, dark in colour with many short black hairs (Fig. 4A), carapace has depression in the posterior end, distinct fovea, longitudinal, black lines radiate from distinct fovea, edge of carapace with longer black hairs, a small black arch structure on both sides with a gap near fovea (Fig. 3A). Eight eyes with a black ring (Figs. 4B, 4D). Eyes are arranged in two rows. AER weakly recurved whereas PER strongly recurved (Fig. 4B). MOA is dark brown with several thick black setae. Diameters of AME 0.26, ALE 0.19, PME 0.39, PLE 0.38: Anterior width of MOA 0.81, posterior width of MOA1.31; distance between AMEs 0.09, distance between PMEs 0.17, distance between AME and ALE 0.08, distance between PME and PLE 0.1. Clypeus 1.27, with irregular short black hairs. Chelicera length 3.47. Both Chelicerae with four retromarginal and two promarginal teeth, chelicerae covered in hairs, reddish brown in colour, fangs dark reddish brown in colour (Fig. 4C). Endite length 2.44, width 1.38, endite reddish brown in colour, proximally narrow and distally wide; labium length 1.39, width 1.51, wider medially, dark coffee colour medially, reaches almost half of endite; shield-like sternum with distinct edges, with a notch in anterior end, length 3.33, width 3.75. Abdomen longer than wide with distinct brown cardiac mark and white marks nearby, almost oval shape, medially widened, posteriorly tapered, dorsum with numerous short setae, white and brown, posterior abdomen segmented with white on black longitudinal lines (Fig. 4A). Lateral abdomen dark brown without any markings, short to long black hairs. Dark brown coloured ventrally. Legs greenish-brown in colour with numerous spines, short white hairs making spots on legs, tarsus curved/flexible. Tibia I, II, III, IV with one medial dorsal spine and Tibia I and II with four pairs of lateral ventral spines. Metatarsus I, II, III, IV with one medial spine ventrally. Palp tarsus longer than tibia, tibia with four spines. Females are almost similar, but larger and darker than male, with smaller legs, white lateral bands on carapace absent in female (Figs. 4A, 4B, 7D, 7F). Epigynum pear shaped, longer than wide, broader at LL, highly sclerotized, and divided into two LL (Figs. 4A, 4C). MF large single membranous window, and is almost triangular in shape (Figs. 4A, 4C). CO in the lower half opens to CD. CD long coiled connects with an indistinct AB (Figs. 4B, 4D). FD ventrally begins and with a flattened end SV (Figs. 4B, 4D). Molecular description and phylogenetics: Trimmed sequences were searched in NCBI using the BLASTn suite [40] tool and the sample's identity was tested on percentage similarity and query coverage of the nearest neighbours. The BLASTn results did not exceed ~94% in any of the queries. The BLASTn results are listed in Table 2. Table 2. The results of the BLASTn tool are shown. Sl. No. Accession no. Nearest neighbour E value Similarity Query coverage 1 PQ553468 Araneae sp MF804565.1 0.0 93.66% 99% 2 PQ553465 Araneae sp MF 804565.1 0.0 93.72% 97% 3 PQ553466 Araneae sp MF804565.1 0.0 93.51% 96% 4 PQ553467 Araneae sp MF804565.1 0.0 92.62% 100% The gene tree created using both ML and BI revealed a similar topology where Dolomedes indicus sp. nov. formed a different clade with high support nested with Dolomedes horishanus as sister species Kishida, 1936 [10] (Fig.6). The molecular MT-CO1 sequence of Dolomedes mizhoanus was not included in the phylogenetic construction as there are no data available. The ML tree with high bootstrap support was considered along with posterior probability values as it identically recovered the MT-CO1 gene tree of Madagascar Dolomedes established by Yu and Kuntner [9]. The gene tree shows a clear distinction between Indomalayan, Afrotropic, Palearctic, Nearctic, and, Austalasian species, with Dolomedes horishanus and Dolomedes indicus sp. nov. being sister species sharing the same clade. The intergeneric genetic distance of novel species ranges from approximately 7% to 9%. Natural history: The novel species, Dolomedes indicus was only seen in slow-flowing, shallow streams in the wet evergreen forest. Large in size with proper sexual dimorphism among males and females (Figs. 7C, 7D). Adult males often have prominent snow-white marking from clypeus to the fovea, but are absent at AER, PER, and posterior carapace. (Fig. 7C). The adult female has sporadic white spots along the edges of the carapace and clypeus (Figs. 7D, 7F). In contrast, the immature male with unopened palps has snow-white hairs only along the edge of the carapace and abdomen (Fig. 7E). After the final moulting, the immature males achieve snow-white hairs covering from the clypeus to the fovea, and their palps open with visible structures inside. Both males, females, and immature individuals have white spots on their legs and cardiac mark is present (Figs. 7C, 7D). Their legs had numerous spines attached to them. Both male and female carapaces are longer than wide. The spiders are very much visible on the water and nearby leaves, twigs, and cracks. However, even small movements alert them, upon which they instantly dive into the water for long periods. Dolomedes indicus sp. nov. prefers only streams with slow water flow (Figs. 7A, 7B) but not streams with a strong flow of water, as it might be challenging for them to cling to the substratum. However, we noticed that they were not found in stagnant water. Their sharp fang and quick response make them active hunters. After successful hunting, they move to the banks of streams where there is no to minimal water and continue biting the prey with their strong chelicera. Their excreta are white and liquid in form. They are ambush predators and never constructed capture webs. Nine of the collected individuals were kept in the laboratory for observation and had made a few findings from this; (i) a female spider exhibit a complete submergence of 1 hour and 27 minutes underwater; (ii) an immature male moulted twice, and simultaneously achieved a prominent snow-white marking on its carapace (Fig. 7C), and a functional tarsus become visible on its palp; (iii) two of the female individuals laid eggs and the spiderlings were emerged in 24 days. As mentioned by Yu et al. [41] Dolomedes carrying egg sacs rarely leave them only during hunting. The temperature of the enclosure was maintained between 18°C and 24°C, and the range was found to be critical for its survival. Etymology: This species is the first species of the family Dolomedidae and genus Dolomedes from India; hence it was named Dolomedes indicus. Distribution: Known only from the type locality. (Fig. 1) Systematic account: Both the morphological and molecular data confirmed the novel species Dolomedes indicus sp. nov. Arjun and Jithu, 2024 collected from Wayanad of Kerala. The comparison of morphological characteristics serves as a diagnostic feature for the new species. Discussion Since the first scientific description of Dolomedes Latreile, 1804 [ 4 ], the current study marks the first record of the family Dolomedidae and Dolomedes genus from India. The genus Dolomedes was previously placed in the family Pisauridae. Even though the nursery-web-building character describes them, the behaviour was observed in many other species, thus a synapomorphic character to circumscribe Pisuaridae did not exist untill 2024. Recent studies by Sarah et al . [ 7 ], and Yu et al . [ 8 ] excluded Dolomedes and the other seven genera as Dolomedidae and circumscribed Pisauridae as a monophyletic clade. The family Dolomedidae is described as Raft spiders and genus Dolomedes as fishing spiders [ 41 ]. They are unique among spiders by their fish-hunting behaviour and are widely studied in Europe and North America [ 41 ], [ 42 ], [ 43 ]; however, they are very little explored in the tropics [ 6 ], [ 41 ]. The integration of molecular approach is employed in this study as most arachno-taxonomy currently warrants revision as they rely solely on the morphology of reproductive structures [ 44 ]. The genus was confirmed by the presence of Sa and LA or SLA (subterminal lateral apophysis) (Figs. 3 B, 3 E and 2 F) for male and small AB and long and vertically coiled FD with a flat flake-like end called seminal valve [ 7 ], [ 9 ], [ 41 ] (Figs. 5 B, 5 D). Dolomedes indicus sp. nov. has relatively longer legs than Dolomedes mizhoanus however, the shortest leg remains the third one in both. It is very early to discuss the ecology and behaviour of the Dolomedes indicus sp. nov. as we have very little knowledge about the species. However, these behaviours are compared with the descriptions made by Carico (1973) [ 23 ]. Dolomedes are semi-aquatic spiders with a major diet composition of small freshwater vertebrates. They are ambush predators and fast swimmers. Our observations revealed that Dolomedes indicus sp. nov. preferred shallow water streams with gentle water flow. An exploratory study was conducted near a stream in the wet evergreen forest of Wayanad (820m–830m). The species was available only in stream with low temperatures (18°C–24°C) and usually in pristine environments. They were extremely sensitive and even the slightest unusual movement in the flowing water could trigger them for hunting (Fig. 8 ). The presence of plenty of hydrophobic hairs [ 41 ] on their body enables them to dive underwater for longer periods. Dolomedes indicus sp. nov. was observed in waters where the canopy was not fully covered (Fig. 7 A, 7 B), and they also need a substratum (stone, leaves, twigs) for anchoring besides the running water front (Figs. 7 D, 7 E, 7 F). Carico (1973) [ 23 ] reported that ‘spiders of the genus Dolomedes are rather easy to capture by hand because they rarely give a flight response’ however, during the field study we observed differences as Dolomedes indicus sp. nov. was fast and agile and displayed immediate flight response. Additionally, after every unsuccessful attempt to collect the spider, they returned to the same spot where they were in a hunting position, and also could find a dragline attached to the substratum at which it was sitting. More studies on ecology and behaviour are needed to understand these aspects. Like the other four species described from the tropics by Yu and Kuntner [ 9 ] (Madagascar), Dolomedes indicus sp. nov. is also strictly observed in water bodies and never on trails. Nevertheless, unlike Madagascar species, they are found easily during the day. The strict association of Dolomedes indicus sp. nov. with water bodies highlights the need to conserve such water bodies. Also, they can be an important indicator species because of the high vulnerability of their habitat due to pollution, land use change, and climate change [ 41 ]. More studies are needed to understand the diversity, behaviour, and biology of Dolomedes in India which will help in a better understanding of the climatic oscillations during the Miocene There are limitations in constructing a phylogeny using a single marker, however, the current study provides first genomic data of Dolomedidae and Dolomedes from India, and it aims to understand the position of the species among other congenerics. The phylogenetic tree clearly distinguishes the species on the basis of their geographical position and justifies the position of the novel species. However, due to the limitations of the MT-CO1 marker deeper nodes are not resolved. Further diversity studies accompanied by multiple gene markers are warranted to understand the holistic evolution of Dolomedes. Conclusion The new species Dolomedes indicus sp. nov. erected with an integrative approach of taxonomy marks the first record of the family Dolomedidae and genus Dolomedes in India. The novel species showed considerable differences from the all-existing species. The study also details the potential locations to observe the species in India based on previously published data. However, unless further targeted sampling is performed, a conclusive statement cannot be reached. This study provides the primary molecular data for the family Dolomedidae and genus Dolomedes from India. The family and genus are one of the least explored in the tropics, and a more extensive study with the support of niche modelling can potentially yield species discoveries. The type specimens are deposited in the Insect Collection of the Entomology Department at the Kerala Forest Research Institute (KFRI). Abbreviations AB Accessory Bulb AER Anterior Eye Row ALE Anterior Lateral Eye AME Anterior Median Eye BCA Basal Cymbium Apophysis C Conductor CD Copulatory Duct CO Copulatory Opening DTP Distal Tegular Projection E Embolus FD Fertilization Duct Fu Fulcrum LA Lateral Subterminal Apophysis LL Lateral Lobe MA Median Apophysis MF Middle Field MOA Median Ocular Region PER Posterior Eye Row PLE Posterior Lateral Eye PME Posterior Median Eye RTA Retrolateral Tibial Apophysis ST Subtegulum SV Seminal Valve T Tegulum VTA Ventral Tibial Apophysis. Declarations Acknowledgements: We sincerely thank Dr. Matjaz Kuntner and Mr. Kuang Ping Yu of the Evolutionary Zoology Lab, National Institute of Biology, Lubljana, Slovenia for their continuous guidance and help in this research. We thank Mr. David Raju for his support and permission to survey in the stream running through the property ‘Wayanad Wild’. We extend our thanks to Dr. Sajeev T. V., Chief Scientist and Head, Forest Entomology and Pathology Department, Kerala Forest Research Institute (KFRI), for his continuous support. We thank Dr. Ratheesh Raveendran and Ms. Parvathy of the Marine Biodiversity and Environment Management Division, Central Marine Fisheries Research Institute (CMFRI) for providing us with the needed help with microscopy. We are thankful to Mr. Umesh Pavukandy and Mr. Saeed Ahmed, Naturalists at Wayanad Wild Resort, for their active support during fieldwork. We sincerely thank Mr. Gautam Kadam, Mr. Rishikesh Tripati and Ms. Aswathi Singh for their support in morpho-taxonomy. Author contributions: Arjun Cherukutty conceived and performed the experiments, analysed the data, prepared the figures, tables and illustrations, authored and reviewed drafts of the article. Jithu Unni Krishnan conceived and performed the experiments, analysed the data, authored and reviewed drafts of the article, and approved the final draft. Data availability: The type specimens are deposited in the insect collection and repository of the Forest Entomology Department of Kerala Forest Research Institute. MT-CO1 sequences generated and analysed during the current study are submitted to and taken from NCBI GenBank. All nucleotide sequences used in this study are enclosed in a spreadsheet as Supplementary data table 1 with the corresponding accession numbers, and voucher ID’s are listed in Supplementary data table 2 Additional data related to this paper may be requested from the corresponding author. Competing interests: The authors declare no competing interests. References World Spider Catalog. World Spider Catalog. Version 25.5. Natural History Museum Bern, online at http://wsc.nmbe.ch, accessed on {28/11/2024}. doi: 10.24436/2. (2024). Dimitrov, D. & Hormiga, G. Spider diversification through space and time. Annual Review of Entomology . 66, 1 225-241, https://doi.org/10.1146/annurev-ento-061520-083414, (2021) Caleb, J.T.D. & Sankaran, P.M. Araneae of India. Version 2024, online at http://www.indianspiders.in [28/11/2024]. (2024). Latreille, P.A. Tableau méthodique des Insectes. Dictionnaire (Nouveau) d’Histoire Naturelle . 24 , 129–295 (1804). Simon, E. Les arachnides de France. Tome troisi` eme. Roret, Paris (1876). Simon, E. Etudes arachnologiques. 22e Mémoire. XXXIV. Etude sur les arachnides de l'Yemen. Annales de la Société Entomologique de France . 6 , 10 77-124 (1890). Sarah, A. M., Nicolas, A. H. & Hormiga, G. Molecular phylogenetics of nursery web spiders (Araneae: Pisauridae). Molecular Phylogenetics and Evolution . 203 , https://doi.org/10.1016/j.ympev.2024.108247 (2025). Yu, K. et al. Phylogenomics, Classification, and Lifestyle Evolution in Raft- and Nursery Web- Spiders (Araneae: Dolomedidae and Pisauridae). Preprint at bioRxiv https://doi.org/10.1101/2024.08.23.609317 (2024) Yu, K & Kuntner, M. Discovering unknown Madagascar biodiversity: integrative taxonomy of raft spiders (Pisauridae: Dolomedes ). PeerJ. https://doi.org/10.7717/peerj.1678112:e16781 (2024). Kishida, K. A synopsis of the Japanese spiders of the genus Dolomedes . Acta Arachnologica . 1 , 4 114-127(1936). Doleschall, L. Tweede bijdrage tot de kennis der arachniden van den indischen archipel. Acta Societatis Scientiarum Indo-Neerlandicae 5, 5: 1-60, pl. 1-17 (1859). Strand, E. Neue indoaustralische und polynesische Spinnen des Senckenbergischen Museums. Archiv für Naturgeschichte . 79, A6 113-123 (1913). Kumar, G. M., Sugumaran, M.P., Sivasubramaniam, K. & Nagamani, B. Studies on the ecology of the Raft Spider Dolomedes fimbriatus (Dol.) (Araneae: Pisauridae) in the rice fields of Coimbatore. Zoosprint Journal 14 , 6 45-46 (1999). Gajbe, P. Checklist of spiders (Arachnida: Araneae) of Madhya Pradesh and Chhattisgarh. Zoosprint 18 ,10 1223-1226 (2003). Gaikwad, S., Warudkar, A., & Shouche, Y. Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India. Mitochondrial DNA Part A . 28, 5, 638–644, https://doi.org/10.3109/24701394.2016.1166219 (2016). Palita, K.S. Faunal diversity assessment of invertebrates and lower vertebrates of Deomali hills of Eastern Ghats, Koraput, Odisha, India. Submitted to Odisha biodiversity board. (2016). Lanka, P. L., Kamble, S.S., & Bodke, K.A. An addition to spider fauna from the vicinity of Radhanagari wildlife sanctuary of Kolhapur district. International Journal of Scientific Engineering and Research . (2015). Dhali, C. D. & Sureshan, M. P. Current status of freshwater faunal diversity in India in ZSI pp 339–343 (2017). Namrata, G., Rajib, B. & Aditya, M. Species diversity, abundance and habitat association of spiders with relation to their guild composition in different habitats of North Bengal Wild Animals Park (Bengal Safari). International Journal of Life Sciences . 6 , 4 911-918 (2018). Sugumaran, M.P & Duraimurugan, B. Arthropod diversity in horticultural ecosystems in Keelaiyur block, Nagapattinam district, Tamil Nadu. Indian Journal of Ecology. 46 , 4 889-891 (2019). Markandan, M. M., Vese, M., Gutolohe & Shohe, T. A preliminary study on spiders diversity from Watiyim village, Mokokchung district, Nagaland, India. International Journal of Advanced Research in Biological Sciences . 8 , 10 (2021). Tiwari, A. K. & Singh, R. Diversity and distribution of Pisauridae (Araneae: Araneomorphae: Arachnida) in India. International Journal of Entomology Research. 6 , 1 119-125 https://ssrn.com/abstract=3916139 (2021). Carico, J.E. The nearctic species of the genus Dolomedes (araneae: pisauridae). Bulletin of the Museum of Comparative Zooloogy . 144 , 435–488 (1973). Sierwald, P. Morphology and homologous features in the male palpal organ in Pisauridae and other spider families, with notes on the taxonomy of Pisauridae (Arachnida: Araneae). Nemouria, Occasional Papers of the Delaware Museum of Natural History . 35 , 1–59 (1990). Sierwald, P. Morphology and ontogeny of female copulatory organs in American Pisauridae, with special reference to homologous features (Arachnida: Araneae). Smithsonian Contributions to Zoology 484 , 4841–24 https://doi.org/10.5479/si.00810282.484 (1989). Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular marine biology and biotechnology . 3, 5 (1994). Katoh, K., Rozewicki, J. & Yamada, D. K. MAFFT onlinie service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics . 20, 1160–1166 https://doi.org/10.1093/bib/bbx108 (2019). Stamakis, A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 30 , 9 (2014). Miller, M.A., Pfeiffer, W. & Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees in Proceedings of the Gateway Computing Environments Workshop (GCE). 1–8 (2010). Huelsenbeck, J. P. & Ronquist, F. MRBAYES: Bayesian inference of phylogeny. Bioinformatics . 17 ,754-755 https://doi.org/10.1093/bioinformatics/17.8.754 (2001). Nylander, J.A.A. MrModeltest 2.4. Program distributed by the author. Evolutionary Biology Centre, Uppsala University (2004). Swofford, D. L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Letunic, I., Bork, P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Research . 52 5, 78–82, https://doi.org/10.1093/nar/gkae268 (2024). Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution. 16 111–120 https://doi.org/10.1007/BF01731581 (1980). Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution . 35 6 1547–1549 https://doi.org/10.1093/molbev/msy096 (2018) Brignoli, P. M. A catalogue of the Araneae described between 1940 and 1981. Manchester University Press . 755 pp. (1983). Zhang, J. X., Zhu, M. S. & Song, D. X. A review of the Chinese nursery-web spiders (Araneae, Pisauridae). Journal of Arachnology . 32, 3 353-417 (2004). Jäger, P. Spiders from Laos with descriptions of new species (Arachnida: Araneae). Acta Arachnologica . 56 , 1 29-58 https://doi.org/10.2476/asjaa.56.29 (2007). Yin, C. M. et al. Fauna Hunan: Araneae in Hunan, China in Hunan Science and Technology Press, Changsha . 1590 pp (2012). Zhang, Z. Schwartz, S., Wagner, L., & Miller, M. A greedy algorithm for aligning DNA sequences. Journal of Computational Biology. 7, 1-2 203-14 (2000). Yu, K. et al. Dolomedes fishing spider biology: gaps and opportunities for future research. Frontiers in Arachnid Science. 3 https://doi.org/10.3389/frchs.2024.1501653 (2024). Kralj-Fiser, S. et al. Mate choice and sexual size dimorphism, not personality, explain female aggression and sexual cannibalism in raft spiders. Animal Behaviour . 111 , https://doi.org/10.1016/j.anbehav.2015.10.013 (2016). Williams, D. S. The feeding behaviour of New Zealand Dolomedes species (Araneae: Pisauridae). New Zealand Journal of Zoology . 6, 1 95-105 https://doi.org/10.1080/03014223.1979.10428352 (1979). Bond, J. E., et al. Improving taxonomic practices and enhancing its extensibility—an example from araneology. Diversity . 14, 1 https://doi.org/10.3390/d14010005 (2022). Additional Declarations No competing interests reported. Supplementary Files SupplementarydataTable1.xlsx SupplementaryDataTable21.xlsx Cite Share Download PDF Status: Published Journal Publication published 26 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 04 Aug, 2025 Reviews received at journal 01 Aug, 2025 Reviews received at journal 21 Jul, 2025 Reviewers agreed at journal 21 Jul, 2025 Reviewers agreed at journal 20 Jul, 2025 Reviewers invited by journal 20 Jul, 2025 Editor assigned by journal 14 Jul, 2025 Editor invited by journal 14 Jul, 2025 Submission checks completed at journal 11 Jul, 2025 First submitted to journal 11 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7043304","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":488430061,"identity":"72fc01fa-443c-4e4d-85af-b418a1e2b1f3","order_by":0,"name":"Arjun Cherukutty","email":"","orcid":"","institution":"Kerala Forest Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Arjun","middleName":"","lastName":"Cherukutty","suffix":""},{"id":488430062,"identity":"4e4b800c-a676-4437-a421-96f05a3924ce","order_by":1,"name":"Jithu Unni Krishnan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYBACxmYGNiCVACR5QHwbkFjjAfxamFG0pIHEGvBqYWCAamGAaDkMFsOrhbmd/9hj3ra0fD7+s8ce/Nxx3m5t+2GgLTU20Xgcxm7M25Zj2SaRl27Ye+Z28rYziUAtx9JyG/D4RZq3rcKATYLHTIK37Xay2QGgFsaGw0Ro4T9jJvm37Vyy2fmHRGnJMWBjyDEDMg7Ymd0gbIuZ5JxzaUCHAbXItiUnmN0A2pKAxy+G/QefSbwpSzaQ7wc67G2bnb3Z+fSHDz7U2ODWgi6RCBZIwKEcBOTRBezxKB4Fo2AUjIIRCgAi01fmDe2VwQAAAABJRU5ErkJggg==","orcid":"","institution":"Kerala Forest Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Jithu","middleName":"Unni","lastName":"Krishnan","suffix":""}],"badges":[],"createdAt":"2025-07-04 05:53:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7043304/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7043304/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-26308-2","type":"published","date":"2025-11-26T15:57:59+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87426705,"identity":"36717573-0899-4490-9647-33cd8fd8fa13","added_by":"auto","created_at":"2025-07-23 16:38:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":12151475,"visible":true,"origin":"","legend":"\u003cp\u003eMap of southern India showing type location where the specimen of \u003cem\u003eDolomedes \u003c/em\u003esp. was collected in Wayanad district of Kerala state. Map created using QGIS version 3.26.1-Buenos Aires (\u003ca href=\"https://qgis.org/\"\u003ehttps://qgis.org/\u003c/a\u003e)\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/2afcae3161987434348cb13f.png"},{"id":87428440,"identity":"879acd7c-f107-4908-bf60-70c39b5cf7ee","added_by":"auto","created_at":"2025-07-23 16:54:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8610677,"visible":true,"origin":"","legend":"\u003cp\u003eMale \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov (Holotype). A – Dorsal view, B – Anterior view, C – Lateral view, D – Mouth parts, E – RTA, F – Expanded palp showing the LA. (E- Embolus, Fu- Fulcrum, LA- Lateral subterminal apophysis, RTA- Retrolateral tibial apophysis)\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/9fe800acb65387b49319386b.png"},{"id":87427468,"identity":"8e0cbe62-2fd8-461a-b552-2d30e9092448","added_by":"auto","created_at":"2025-07-23 16:46:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4209434,"visible":true,"origin":"","legend":"\u003cp\u003ePalp structure of \u003cem\u003eDolomedes indicus\u003c/em\u003esp. nov. (Holotype). A – Prolateral view of palp, B – Ventral view, C – Retrolateral view. D, E, F – illustrations of the palp. A, C - Red arrows point to the projection of MA. (BCA- Basal cymbial apophysis, C- Conductor, Cy- Cymbium, DST- Distal tegular projection, E- Embolus, Fu- Fulcrum, MA- Median apophysis, RTA- Retrolateral apophysis, Sa- Saddle, ST- Subtegulum, T- Tegulum, VTA- Ventral tibial apophysis)\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/d7b1917915deed73ded0c3f8.png"},{"id":87429035,"identity":"f2fe7817-309d-4c66-949f-80eac09aedde","added_by":"auto","created_at":"2025-07-23 17:02:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6703996,"visible":true,"origin":"","legend":"\u003cp\u003eFemale \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. (Paratype). A - Dorsal view, B - Anterior view, C – Mouth part, D - Lateral view.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/41dbe0c27cad2cfa9449fc14.png"},{"id":87426716,"identity":"0b3aafc6-cc8c-497f-9df1-f3ee8d64580a","added_by":"auto","created_at":"2025-07-23 16:38:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3858218,"visible":true,"origin":"","legend":"\u003cp\u003eFemale reproductive structure of \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. (Paratype). A – Epigynum, B – Vulva. C, D - Illustration of the epigynum and vulva. B, D - Red arrows point to the AB, E- Schematic drawing of the internal duct system, the circle represents CO. (AB- Accessory bulb, CD- Copulatory duct, CO- Copulatory opening, FD- Fertilization duct, LL- Lateral lobe, MF- Middle field, SV- Seminal valve)\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/dadf450b81bc5929bf0322d1.png"},{"id":87429883,"identity":"20af6d84-430b-4400-bb3b-d0c1e37fef5c","added_by":"auto","created_at":"2025-07-23 17:10:58","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1129862,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum likelihood MT-CO1 gene tree with bootstrap and posterior probability values added to nodes. Bootstrap values less than 50 are indicated by **. The conspecific species are represented as collapsed clades.\u003c/p\u003e","description":"","filename":"Figure61.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/ca8ef57fadc8b3ae51e60d9f.jpg"},{"id":87427473,"identity":"94f80756-5866-4d8e-a2b3-d52bab39f239","added_by":"auto","created_at":"2025-07-23 16:46:58","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":24604762,"visible":true,"origin":"","legend":"\u003cp\u003eLive images of \u003cem\u003eDolomedes indicus\u003c/em\u003esp. nov. Arjun \u0026amp; Jithu, 2024. A, B – Habitat from which \u003cem\u003eDolomedes indicus\u003c/em\u003esp. nov. was collected; C – Adult male; D, F – Adult female; E – Immature male in the hunting position (Fig 7A, 7B, 7C © Arjun Cherukutty, Fig 7D, 7E, 7F© Umesh Pavukandy)\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/9ea518b2c994908efc4cc623.jpg"},{"id":87426710,"identity":"9c32a874-8076-4177-9e19-eb705fc1dad1","added_by":"auto","created_at":"2025-07-23 16:38:58","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4334139,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic illustration of fish hunting by \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov; A- Spider waiting for prey in hunting position keeping minimum a pair of legs into water; B- As the prey get close enough, the sensory hairs in the spider leg signals it; C- Dragline attached on substratum, the spider dives on to the prey in water and catch it; D- Feeding by immobilizing the prey using venom (© Arjun Cherukutty).\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/dcad97399472fd02836af234.png"},{"id":97180012,"identity":"b7c6e56b-0d72-4484-86e8-af275aebd6e2","added_by":"auto","created_at":"2025-12-01 16:17:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":75732029,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/2ba33d61-2e0a-4928-b92d-86dee84d51d7.pdf"},{"id":87426702,"identity":"8db62954-45ad-42b2-bf8c-ff3e15682366","added_by":"auto","created_at":"2025-07-23 16:38:58","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":11926,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarydataTable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/4af03cad2a62c24dc068b360.xlsx"},{"id":87426704,"identity":"4e2477fd-dd27-4e8b-abdc-1c0efd3bfecd","added_by":"auto","created_at":"2025-07-23 16:38:58","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":9727,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryDataTable21.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7043304/v1/4aae89560d47c5aaf3afce12.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Fishing spider in India: first record of family Dolomedidae with the description of a new species","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSpiders are among the most diverse arthropods with 53125 described species [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] and they are the 7th largest order in the animal kingdom [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In India, there are currently 1958 species belonging to 505 genera in 62 families [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. \u003cem\u003eDolomedes\u003c/em\u003e Latreille, 1804 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] – is a globally distributed genus in the family Dolomedidae Simon, 1876 [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] with 105 accepted species around the world [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Earlier the genus was placed in the family Pisauridae Simon, 1890 [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] commonly known as nursery web spiders, owing to its unique behaviour of constructing nursery webs. However, the construction of nursery webs is not confined only to Pisuaridae. Recent molecular and morphological studies by Sarah \u003cem\u003eet al.\u003c/em\u003e, 2024 [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] and Yu \u003cem\u003eet al\u003c/em\u003e., 2024 [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] have resurrected the family status of Dolomedidae Simon, 1876. Thus, Pisauridae is circumscribed as a monophyletic group. The resurrected family Dolomedidae consists of seven genera including \u003cem\u003eDolomedes\u003c/em\u003e. The genus \u003cem\u003eDolomedes\u003c/em\u003e is recently originated, approximately 9–16\u0026nbsp;million years ago during the Miocene epoch [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. \u003cem\u003eDolomedes\u003c/em\u003e are commonly known as raft or fishing spiders with large semi-aquatic lifestyle, feeding predominantly on freshwater vertebrates [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Since its description in 1804 by Latreille, the genus has never been scientifically described from India. The nearest congeneric is \u003cem\u003eDolomedes mizhoanus\u003c/em\u003e Kishida (1936) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] from China, Laos, Malaysia, and Taiwan; \u003cem\u003eDolomdes boiei\u003c/em\u003e Doleschall (1859) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] from Sri Lanka and Indonesia; and \u003cem\u003eDolomedes karschi\u003c/em\u003e Strand (1913) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] from Sri Lanka. Several abstract literatures have mentioned the presence of the \u003cem\u003eDolomedes\u003c/em\u003e genus in different locations in India since 1999 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e); Albeit, no scientific effort has carried out for a detailed taxonomy.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of abstract articles mentioning the presence of the genus \u003cem\u003eDolomedes\u003c/em\u003e in India.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSl. No.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLiterature\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTitle\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLocation in India\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSpecies reference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKumar \u003cem\u003eet al.\u003c/em\u003e (1999) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eStudies on the ecology of the Raft Spider \u003cem\u003eDolomedes fimbriatus\u003c/em\u003e (DOL.) (Araneae: Pisuaridae) in the rice fields of Coimbatore.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCoimbatore, Tamil Nadu\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes fimbriatus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGajbe (2003) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eChecklist of Spiders (Arachnida: Araneae) of Madhya Pradesh and Chhattisgarh.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMadhya Pradesh and Chhattisgarh\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGaikwad \u003cem\u003eet al.\u003c/em\u003e (2016) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEfficacy of DNA barcoding for the species identification of spiders from Western Ghats of India.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePune-Maharashtra\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePalita (2016) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFaunal diversity assessment of invertebrates and lower vertebrates of Deomali hills of Eastern Ghats, Koraput, Odisha, India. Final Technical Report. Odisha Biodiversity Board and Central University of Orissa.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eKoraput, Orissa.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.1\u003c/p\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLanka \u003cem\u003eet al.\u003c/em\u003e (2017) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAn addition to Spider fauna from the vicinity of Radhanagari wildlife sanctuary of Kolhapur district.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRadhanagari Wildlife Sanctuary of Kolhapur District, Maharashtra\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDhali and Sureshan (2017) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eArachnida: Araneae (Spiders) in Current status of freshwater faunal diversity in India.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMaharashtra, Kerala (Aralam WLS), and Goa\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNamrata \u003cem\u003eet al.\u003c/em\u003e (2018) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSpecies diversity, abundance and habitat association of spiders with relation to their guild composition in different habitats of North Bengal Wild Animals Park (Bengal Safari).\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eWest Bengal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes tenebrosus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSugumaran and Duraimurugan (2019) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eArthropod diversity in horticultural ecosystems in Keelaiyur block, Nagapattinam district, Tamil Nadu.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNagapattinam, Tamil Nadu.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes tenebrosus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMarkandan \u003cem\u003eet al\u003c/em\u003e. (2021) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eA Preliminary study on Spiders diversity from Watiyim village, Mokokchung district, Nagaland, India.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMokokchung, Nagaland.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.\u003c/p\u003e\u003cp\u003e\u003cem\u003eDolomedes scriptus\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDolomedes albineus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTiwari and Singh (2021) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDiversity and distribution of Pisuaridae (Aranea: Araneomorphae: Arachnida) in India.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTamil Nadu, West Bengal, Arunachal Pradesh, Karnataka, Madhya Pradesh, Maharashtra and Odisha\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eDolomedes tenebrosus\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDolomedes triton\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDolomedes fimbriatus\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDolomedes\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAll of the literature referred to in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e is questioned for authenticity due to the lack of descriptive taxonomic notes that distinguish this genus or for the species of interest.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eThe initial sightings of the species occurred in the evergreen rainforests of Wayanad, Kerala at Periya (11°49'29.4\"N;75°50'37.1\"E). However, collection was not possible due to lack of permit. Later, searches in similar habitats, including the shallow streams running through a private land with adjacent forest areas of Lakkidi in Wayanad (11°30'54.1\"N; 76°02'12.4\"E), led to first-hand collections of the species.Spiders were collected by hand from a running stream in Lakkidi during 0900 to 1300 hours in June and August. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A total of 17 spiders were collected, of which eight were preserved in 75% alcohol for morphological examination. Two legs from each preserved specimen were removed and kept in 99% alcohol for molecular studies. The remaining nine live individuals were maintained in the laboratory at confined conditions for future studies.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAnatomical Examination\u003c/b\u003e: Morphological examination was carried out with a stereo zoom microscope (Make: Olympus SZ61) attached to a camera (Make: Magcam DC Plus 14). The nomenclature of male palp structure follows the description of Carico (1973) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] and Sierwald (1990) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The female genitalia were dissected and cleaned using Potassium hydroxide (KOH), and nomenclature follows that of Sierwald (1989) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The male palp was soaked in distilled water and KOH to expand for morphological observation. All the microscopic images used in this study were captured using Nikon SMZ 25 stereo-microscope and measurements were taken using NIS-elements 5.4 software. The measurements of palp consist of the femur, patella, tibia, and tarsus, where-as leg consists of femur, patella, tibia, meta tarsus, and tarsus. All the measurements given in this work are in millimetres. The holotype and paratype is deposited at the Kerala Forest Research Institute (KFRI) entomology museum.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMolecular Examination\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eGenomic DNA was extracted from four specimens of \u003cem\u003eDolomedes\u003c/em\u003e sp for analyses. The mitochondrial gene cytochrome c oxidase 1 (CO1) was amplified from the specimens (from four individuals) for molecular species identification and construction of a gene tree. DNA was extracted from the sample using DNeasy Blood and Tissue kit (Qiagen; cat no. 69504) Kit following the manufacturer’s instructions. Briefly, sample stored at 4°C was rinsed twice in PBS, air dried briefly, and then ground well with a micro-pestle, after which the powdered sample was transferred to sterile microcentrifuge tubes. To these tubes, 180 µl of buffer ATL and 20 µl Proteinase K were added, mixed thoroughly by vortexing, and incubated at 56°C for 3 hours. The mixture was vortexed occasionally during incubation to disperse the sample. After the incubation period, 200 µl of buffer AL was added to the sample, and mixed by vortexing. Then 200 µl of absolute alcohol was added to the mixture and mixed again. The mixture was then pipetted into the DNeasy Mini-spin column placed in a 2 ml collection tube and centrifuged at ≥ 6000 × g (8000 rpm) for 1 min. The flow through was subsequently discarded, and the column was washed with 500 µl of buffer AW1, and then with 500 µl of buffer AW2, and then a last spin for 3 min at 14,000 rpm to dry the DNeasy spin column membrane. The collection tube was discarded and the DNA in the spin column was eluted into a clean 1.5 ml microcentrifuge tube by adding 200 µl of buffer AE directly onto the DNeasy membrane; incubating the tube at room temperature for 1 min, and then centrifuged for 1 min at ≥ 6000 × g. The quality of DNA was checked via agarose gel electrophoresis.\u003c/p\u003e\u003cp\u003eThe MT-CO1 gene from spider DNA was amplified in a 20 µl reaction volume containing 1 µl DNA (10–50 ng), 1 µl each of forward LCO1490 GGTCAACAAATCATAAAGATATTGG and reverse HCO2198 TAAACTTCAGGGTGACCAAAAAATCA primers [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] (10 picomoles/µl), and 10 µl of Emerald Amp GT PCR master mix (Takara). The cycling conditions used were as follows: initial denaturation at 95°C for 2 min: followed by cycle denaturation at 95°C for 40 s, annealing at 52°C/45°C for 40 s, extension at 72°C for 45 s for a total of 30 cycles; and a final extension for 7 min at 72°C. The success of the PCR was confirmed by running 5 µl of PCR product on 1% agarose gel (impregnated with ethidium bromide) at 120 V; for ~ 45 min in 1X TAE Buffer. The gel structure was recorded with a UV gel documentation system. A 100bp DNA ladder from Thermo was loaded parallel to the PCR products as a size marker. The PCR products were further treated with ExoSAP-IT PCR Product Clean-up Reagent and used as a template for sequencing, and Sanger Sequencing of PCR product was performed with ABI PRISM Big Dye Terminator ready reaction mix (Life Technologies, USA). The cycle extension products were purified following ethanol/EDTA/ sodium acetate precipitation \u003cb\u003e(\u003c/b\u003eApplied Biosystems ABI 3730xl DNA).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003ePhylogenetic analysis\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe sequences generated were quality-checked and trimmed using the software Sequencher V4.10.1 (Gene Codes Corporation, Ann Arbor, MI USA). We constructed an MT-CO1 gene tree using sequences generated from the collected \u003cem\u003eDolomedes\u003c/em\u003e sp. and other existing MT-CO1 sequences of \u003cem\u003eDolomedes\u003c/em\u003e spp. collected from NCBI GenBank. A total of 82 sequences including the outgroup (Supplementary data Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were used for the final construct. The sequences were aligned using MAFFT version 7 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The sequences that created errors in alignment and more repeat sequences of species were omitted from the alignment. For the construction of MT-CO1 gene tree, we performed maximum likelihood (ML) and Bayesian inference (BI) phylogenetic analyses. The ML analysis was performed in RAxML [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] with 1000 bootstrap replicates using the rapid bootstrapping algorithm with GTRGAMMA substitution model in CIPRES Science Gateway [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The BI analysis was performed in MrBayes [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] under the substitution model GTR + I + G as suggested by MrModeltest [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] using PAUP 4.0 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], with 1\u0026nbsp;million generations run independently in two chains with sampling every 1000 generations with 25% burn-in. \u003cem\u003eHygropoda higenga\u003c/em\u003e was used as the outgroup based on the recent phylogenetic study [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The generated gene tree was accessed using Interactive Tree of Life [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and edited for better representation. The genetic distance was calculated using Kimura 2-parameter model [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] in MEGA 10 [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] with high bootstrap support.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eTaxonomy of \u003cem\u003eDolomedes indicus\u0026nbsp;\u003c/em\u003esp. nov.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDolomedidae Simon, 1876 [5] (rank resurrected)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDolomedes\u0026nbsp;\u003c/em\u003eLatreille, 1804 [4]\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDolomedes indicus\u003c/em\u003e Arjun and Jithu, 2025 sp. nov.\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eZooBank ID:urn:lsid:zoobank.org:pub:84CBD244-FC97-4145-8E0C-254191D8ACD7\u003c/p\u003e\n\u003cp\u003eHolotype male (Figs. 2, 3).India: Kerala, Wayanad, Lakkidi (11.515027, 76.036765, MAP 1), got collected from the stream near \u0026lsquo;Wayanad Wild Resort\u0026rsquo; by hand. Deposition number - KFRI-IC-VII-B-24-1424.\u003c/p\u003e\n\u003cp\u003eParatype female (Figs. 4, 5). Same as Holotype. Deposition number - KFRI-IC-VII-B-24-1425.\u003c/p\u003e\n\u003cp\u003eHolotype and other paratype voucher ID\u0026rsquo;s are given in Supplementary data table 2\u003c/p\u003e\n\u003cp\u003eMaterials examined:Three females, three males, and two juveniles, from the shallow stream in front of the Wayanad Wild Resort, Wayanad, Kerala India. Figure 1 shows the type locality of \u003cem\u003eDolomedes indicus\u0026nbsp;\u003c/em\u003esp. nov. Figure 7A, 7B shows the habitat where they were collected.\u003c/p\u003e\n\u003cp\u003eDiagnosis:Male \u003cem\u003eDolomedes indicus\u0026nbsp;\u003c/em\u003esp. nov.looks very similar to \u003cem\u003eDolomedes mizhoanus\u003c/em\u003e, Kishida, 1986 [10] morphologically. However, the species differ by; a) Adult male \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. has a distinctive white marking often from clypeus till fovea (Fig. 7C) which is present only in lateral edges in \u003cem\u003eDolomedes mizhoanus\u003c/em\u003e, b) The T is more recurved forming a \u0026lsquo;U\u0026rsquo; shape before meeting MA (Figs. 3B, 3E), c) E is curved downwards to the 6 \u0026lsquo;O\u0026rsquo; clock direction from the tip of Fu and then deviates retro-laterally towards the conductor (Figs. 3B, 3E), e) Presence of a small protrusion on the proximal end of MA (Figs. 3A, 3D).\u003c/p\u003e\n\u003cp\u003eThe female \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov.can be separated from \u003cem\u003eDolomedes mizhoanus\u0026nbsp;\u003c/em\u003especies by a) narrower MF, widened medially (Figs. 5A, 5C), b) a larger second loop of spermatheca (Figs. 5B, 5D), and c) a smaller final loop of spermatheca (Figs. 5B, 5D).\u003c/p\u003e\n\u003cp\u003eLiterature examined for similarity with \u003cem\u003eDolomedes mizhonus\u003c/em\u003e:Kishida, 1936 [10]; Brignoli, 1983 [36]; Zhang \u003cem\u003eet al\u003c/em\u003e., 2004 [37]; Jager, 2007 [38]; Yin \u003cem\u003eet al.\u003c/em\u003e, 2012 [39].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorphological Description\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMale.\u0026nbsp;\u003c/strong\u003eTotal length 12.98: carapace length 7.80, width 7.43, anterior height 2.14, posterior height 2.86; abdomen length 5.18, width 3.33. Length of palp and legs: palp 12.33 (4.88, 1.88, 2.17, 3.4); leg I 44.6 (2.81, 0.93, 10.22, 4.4, 10, 10.33, 5.91); leg II 44.26 (2.57, 0.93, 10.76, 4.55, 9.69, 9.93, 5.83); leg III 37.74 (2.34, 1.13, 9.41, 4.03, 8.22, 8.18, 4.43) leg IV (2.78, 1.21, 11.09, 4.22, 10.42, 11.51, 6.71). Leg formula 4123. The Legs and body are greenish-brown in colour. The carapace is pear-shaped, almost equal in length and width, distinct fovea, longitudinal, with a depression in the posterior end of the carapace (Fig. 2C), thick white hairs seen from the clypeus till half of the carapace, absent at AER and PER, thicker at clypeus and lateral edges (Figs. 2B, 2C, 7C,7E), the white hairs almost form a convex structure (Fig. 7C), black lines radiating from the distinct fovea, a small black arch structure on both sides with a gap near fovea (Fig. 2A). Eight eyes with a black ring (Fig. 2B). Eyes are arranged in two rows. AER weakly recurved whereas PER strongly recurved (Fig. 2B). MOA is dark brown with several thick black setae. Diameters of AME 0.20, ALE 0.16, PME 0.32, PLE 0.35; Anterior width of MOA 0.69, posterior width of MOA 1.22; distance between AMEs 0.11, distance between PMEs 0.19, distance between AME and ALE 0.04, distance between PME and PLE 0.06. Clypeus 1.08. Chelicera length 2.86. Both chelicerae with four retromarginal and two promarginal teeth, covered with hairs, fang reddish brown, teeth dark brown (Fig. 2D). Endite length 2.16, width 1.12; labium length 1.26, width 1.25; sternum almost heart-shaped with a notch on anterior end, depressed than coxa, with long and short hair structures, length 2.82, width 3.16; All endite, labium, sternum similar in colour, endite and labium darker in colour. Abdomen longer than wide with distinct brown cardiac mark and white marks nearby, almost oval shape, medially widened, posteriorly tapered, dorsum with numerous short setae, white and brown, posterior abdomen segmented with white on black longitudinal lines (Fig. 2A). Lateral edge of abdomen has short white hairs which forms irregular bands. Ventrally light brown coloured with short to long hairs. Legs greenish-brown in colour with numerous spines, short white hairs making spots on legs, tarsus curved/flexible. Tibia I, II, III, IV with one medial dorsal spine and Tibia I and II with four pairs of lateral ventral spines. Metatarsus I, II, III, IV with one medial spine ventrally. Palp tarsus longer than tibia, tibia with four spines, RTA short not crossing BCA, RTA sclerotized, without and branching (Figs. 2E, 3B, 3E), BCA distally widened, proximate to RTA (Figs. 3B, 3E), ST prolaterally elongated, T forms a \u0026lsquo;U\u0026rsquo; shape before extending above ST (Figs. 3B, 3E), T connected to membranous C in retrolateral side and DTP in prolateral side (Figs 3C, 3D, 3E, 3F). DTP long extends over E, Sa placed prolaterally, between DTP and MA, MA shorter than DTP, base of MA starts from the \u0026lsquo;U\u0026rsquo; shape of T, proximal end of MA has a small projection (Figs. 3A, 3D), Fu surpasses E by a minute distance (Fig, 3B, 3E), E long, E curves down to 5 \u0026lsquo;o\u0026rsquo; clock direction over DTP and ends retrolaterally at C with a bend near distal end of MA towards 3 \u0026lsquo;o\u0026rsquo; clock direction (Fig. 3B). MA hook-shaped, MA sits retrolaterlly to Sa and DTP, Fu proximally widened and distally narrow (Fig. 3B, 3D). LA is irregularly oval in shape (Fig 2F). ALL Fu, Eb, LA from DST of apical division.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFemale.\u0026nbsp;\u003c/strong\u003eTotal length 16.42: carapace length 8.62, width 8.54, anterior height 2.82, posterior height 3.22; abdomen length 8.02, width 5.74. Length of palp and legs: palp 12.38 (4.43, 1.78, 2.48, 3.69); leg I 41.45 (3.09, 1.20, 10.25, 4.59, 9.47, 8.53, 4.32); leg II 42.49 (3.22, 0.76, 10.81, 4.77, 9.53, 8.9, 4.5); leg III 40.16 (2.99, 1.13, 10.26, 4.4, 8.7, 8.44, 4.24); leg IV 48.44 (3.1, 1.93, 11.51, 4.53, 10.56, 11.39, 5.42). Leg formula 4213. Leg and body greenish brown in colour. Carapace pear-shaped, length and width almost similar, space above PER lighter with less hairs, dark in colour with many short black hairs (Fig. 4A), carapace has depression in the posterior end, distinct fovea, longitudinal, black lines radiate from distinct fovea, edge of carapace with longer black hairs, a small black arch structure on both sides with a gap near fovea (Fig. 3A). Eight eyes with a black ring (Figs. 4B, 4D). Eyes are arranged in two rows. AER weakly recurved whereas PER strongly recurved (Fig. 4B). MOA is dark brown with several thick black setae. Diameters of AME 0.26, ALE 0.19, PME 0.39, PLE 0.38: Anterior width of MOA 0.81, posterior width of MOA1.31; distance between AMEs 0.09, distance between PMEs 0.17, distance between AME and ALE 0.08, distance between PME and PLE 0.1. Clypeus 1.27, with irregular short black hairs. Chelicera length 3.47. Both Chelicerae with four retromarginal and two promarginal teeth, chelicerae covered in hairs, reddish brown in colour, fangs dark reddish brown in colour (Fig. 4C). Endite length 2.44, width 1.38, endite reddish brown in colour, proximally narrow and distally wide; labium length 1.39, width 1.51, wider medially, dark coffee colour medially, reaches almost half of endite; shield-like sternum with distinct edges, with a notch in anterior end, length 3.33, width 3.75. Abdomen longer than wide with distinct brown cardiac mark and white marks nearby, almost oval shape, medially widened, posteriorly tapered, dorsum with numerous short setae, white and brown, posterior abdomen segmented with white on black longitudinal lines (Fig. 4A). Lateral abdomen dark brown without any markings, short to long black hairs. Dark brown coloured ventrally. Legs greenish-brown in colour with numerous spines, short white hairs making spots on legs, tarsus curved/flexible. Tibia I, II, III, IV with one medial dorsal spine and Tibia I and II with four pairs of lateral ventral spines. Metatarsus I, II, III, IV with one medial spine ventrally. Palp tarsus longer than tibia, tibia with four spines. Females are almost similar, but larger and darker than male, with smaller legs, white lateral bands on carapace absent in female (Figs. 4A, 4B, 7D, 7F). Epigynum pear shaped, longer than wide, broader at LL, highly sclerotized, and divided into two LL (Figs. 4A, 4C). MF large single membranous window, and is almost triangular in shape (Figs. 4A, 4C). CO in the lower half opens to CD. CD long coiled connects with an indistinct AB (Figs. 4B, 4D). FD ventrally begins and with a flattened end SV (Figs. 4B, 4D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular description and phylogenetics:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTrimmed sequences were searched in NCBI using the BLASTn suite [40] tool and the sample\u0026apos;s identity was tested on percentage similarity and query coverage of the nearest neighbours. The BLASTn results did not exceed ~94% in any of the queries. The BLASTn results are listed in Table 2.\u003c/p\u003e\n\u003cp\u003eTable 2. The results of the BLASTn tool are shown.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.44444%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSl. No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession no.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1111%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNearest neighbour\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7778%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eE value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSimilarity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8889%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eQuery coverage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.44444%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003ePQ553468\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1111%;\"\u003e\n \u003cp\u003e\u003cem\u003eAraneae sp\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003eMF804565.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7778%;\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003e93.66%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8889%;\"\u003e\n \u003cp\u003e99%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.44444%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003ePQ553465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1111%;\"\u003e\n \u003cp\u003e\u003cem\u003eAraneae sp\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003eMF 804565.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7778%;\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003e93.72%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8889%;\"\u003e\n \u003cp\u003e97%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.44444%;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003ePQ553466\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1111%;\"\u003e\n \u003cp\u003e\u003cem\u003eAraneae sp\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003eMF804565.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7778%;\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003e93.51%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8889%;\"\u003e\n \u003cp\u003e96%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.44444%;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003ePQ553467\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1111%;\"\u003e\n \u003cp\u003e\u003cem\u003eAraneae sp\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003eMF804565.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7778%;\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.8889%;\"\u003e\n \u003cp\u003e92.62%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8889%;\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe gene tree created using both ML and BI revealed a similar topology where \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. formed a different clade with high support nested with \u003cem\u003eDolomedes horishanus\u003c/em\u003e as sister species Kishida, 1936 [10] (Fig.6). The molecular MT-CO1 sequence of \u003cem\u003eDolomedes mizhoanus\u003c/em\u003e was not included in the phylogenetic construction as there are no data available. The ML tree with high bootstrap support was considered along with posterior probability values as it identically recovered the MT-CO1 gene tree of Madagascar \u003cem\u003eDolomedes\u003c/em\u003e established by Yu and Kuntner [9]. The gene tree shows a clear distinction between Indomalayan, Afrotropic, Palearctic, Nearctic, and, Austalasian species, with \u003cem\u003eDolomedes horishanus\u003c/em\u003e and \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. being sister species sharing the same clade. The intergeneric genetic distance of novel species ranges from approximately 7% to 9%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNatural history:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe novel species, \u003cem\u003eDolomedes indicus\u003c/em\u003e was only seen in slow-flowing, shallow streams in the wet evergreen forest. Large in size with proper sexual dimorphism among males and females (Figs. 7C, 7D). Adult males often have prominent snow-white marking from clypeus to the fovea, but are absent at AER, PER, and posterior carapace. (Fig. 7C). The adult female has sporadic white spots along the edges of the carapace and clypeus (Figs. 7D, 7F). In contrast, the immature male with unopened palps has snow-white hairs only along the edge of the carapace and abdomen (Fig. 7E). After the final moulting, the immature males achieve snow-white hairs covering from the clypeus to the fovea, and their palps open with visible structures inside. Both males, females, and immature individuals have white spots on their legs and cardiac mark is present (Figs. 7C, 7D). Their legs had numerous spines attached to them. Both male and female carapaces are longer than wide. The spiders are very much visible on the water and nearby leaves, twigs, and cracks. However, even small movements alert them, upon which they instantly dive into the water for long periods. \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. prefers only streams with slow water flow (Figs. 7A, 7B) but not streams with a strong flow of water, as it might be challenging for them to cling to the substratum. However, we noticed that they were not found in stagnant water. Their sharp fang and quick response make them active hunters. After successful hunting, they move to the banks of streams where there is no to minimal water and continue biting the prey with their strong chelicera. Their excreta are white and liquid in form. They are ambush predators and never constructed capture webs. Nine of the collected individuals were kept in the laboratory for observation and had made a few findings from this; (i) a female spider exhibit a complete submergence of 1 hour and 27 minutes underwater; (ii) an immature male moulted twice, and simultaneously achieved a prominent snow-white marking on its carapace (Fig. 7C), and a functional tarsus become visible on its palp; (iii) two of the female individuals laid eggs and the spiderlings were emerged in 24 days. As mentioned by Yu \u003cem\u003eet al.\u003c/em\u003e [41] \u003cem\u003eDolomedes\u003c/em\u003e carrying egg sacs rarely leave them only during hunting. The temperature of the enclosure was maintained between 18\u0026deg;C and 24\u0026deg;C, and the range was found to be critical for its survival.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEtymology:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis species is the first species of the family Dolomedidae and genus \u003cem\u003eDolomedes\u0026nbsp;\u003c/em\u003efrom India; hence it was named \u003cem\u003eDolomedes indicus.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDistribution:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKnown only from the type locality. (Fig. 1)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSystematic account:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBoth the morphological and molecular data confirmed the novel species \u003cem\u003eDolomedes indicus\u0026nbsp;\u003c/em\u003esp. nov. Arjun and Jithu, 2024 collected from Wayanad of Kerala. The comparison of morphological characteristics serves as a diagnostic feature for the new species.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSince the first scientific description of \u003cem\u003eDolomedes\u003c/em\u003e Latreile, 1804 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], the current study marks the first record of the family Dolomedidae and \u003cem\u003eDolomedes\u003c/em\u003e genus from India. The genus \u003cem\u003eDolomedes\u003c/em\u003e was previously placed in the family Pisauridae. Even though the nursery-web-building character describes them, the behaviour was observed in many other species, thus a synapomorphic character to circumscribe Pisuaridae did not exist untill 2024. Recent studies by Sarah \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and Yu \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] excluded \u003cem\u003eDolomedes\u003c/em\u003e and the other seven genera as Dolomedidae and circumscribed Pisauridae as a monophyletic clade. The family Dolomedidae is described as Raft spiders and genus \u003cem\u003eDolomedes\u003c/em\u003e as fishing spiders [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. They are unique among spiders by their fish-hunting behaviour and are widely studied in Europe and North America [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]; however, they are very little explored in the tropics [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The integration of molecular approach is employed in this study as most arachno-taxonomy currently warrants revision as they rely solely on the morphology of reproductive structures [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The genus was confirmed by the presence of Sa and LA or SLA (subterminal lateral apophysis) (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) for male and small AB and long and vertically coiled FD with a flat flake-like end called seminal valve [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. has relatively longer legs than \u003cem\u003eDolomedes mizhoanus\u003c/em\u003e however, the shortest leg remains the third one in both.\u003c/p\u003e\u003cp\u003eIt is very early to discuss the ecology and behaviour of the \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. as we have very little knowledge about the species. However, these behaviours are compared with the descriptions made by Carico (1973) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. \u003cem\u003eDolomedes\u003c/em\u003e are semi-aquatic spiders with a major diet composition of small freshwater vertebrates. They are ambush predators and fast swimmers. Our observations revealed that \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. preferred shallow water streams with gentle water flow. An exploratory study was conducted near a stream in the wet evergreen forest of Wayanad (820m\u0026ndash;830m). The species was available only in stream with low temperatures (18\u0026deg;C\u0026ndash;24\u0026deg;C) and usually in pristine environments. They were extremely sensitive and even the slightest unusual movement in the flowing water could trigger them for hunting (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The presence of plenty of hydrophobic hairs [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] on their body enables them to dive underwater for longer periods. \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. was observed in waters where the canopy was not fully covered (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), and they also need a substratum (stone, leaves, twigs) for anchoring besides the running water front (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eCarico (1973) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] reported that \u0026lsquo;spiders of the genus \u003cem\u003eDolomedes\u003c/em\u003e are rather easy to capture by hand because they rarely give a flight response\u0026rsquo; however, during the field study we observed differences as \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. was fast and agile and displayed immediate flight response. Additionally, after every unsuccessful attempt to collect the spider, they returned to the same spot where they were in a hunting position, and also could find a dragline attached to the substratum at which it was sitting. More studies on ecology and behaviour are needed to understand these aspects. Like the other four species described from the tropics by Yu and Kuntner [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] (Madagascar), \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. is also strictly observed in water bodies and never on trails. Nevertheless, unlike Madagascar species, they are found easily during the day. The strict association of \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. with water bodies highlights the need to conserve such water bodies. Also, they can be an important indicator species because of the high vulnerability of their habitat due to pollution, land use change, and climate change [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. More studies are needed to understand the diversity, behaviour, and biology of \u003cem\u003eDolomedes\u003c/em\u003e in India which will help in a better understanding of the climatic oscillations during the Miocene There are limitations in constructing a phylogeny using a single marker, however, the current study provides first genomic data of Dolomedidae and \u003cem\u003eDolomedes\u003c/em\u003e from India, and it aims to understand the position of the species among other congenerics. The phylogenetic tree clearly distinguishes the species on the basis of their geographical position and justifies the position of the novel species. However, due to the limitations of the MT-CO1 marker deeper nodes are not resolved. Further diversity studies accompanied by multiple gene markers are warranted to understand the holistic evolution of \u003cem\u003eDolomedes.\u003c/em\u003e\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe new species \u003cem\u003eDolomedes indicus\u003c/em\u003e sp. nov. erected with an integrative approach of taxonomy marks the first record of the family Dolomedidae and genus \u003cem\u003eDolomedes\u003c/em\u003e in India. The novel species showed considerable differences from the all-existing species. The study also details the potential locations to observe the species in India based on previously published data. However, unless further targeted sampling is performed, a conclusive statement cannot be reached. This study provides the primary molecular data for the family Dolomedidae and genus \u003cem\u003eDolomedes\u003c/em\u003e from India. The family and genus are one of the least explored in the tropics, and a more extensive study with the support of niche modelling can potentially yield species discoveries. The type specimens are deposited in the Insect Collection of the Entomology Department at the Kerala Forest Research Institute (KFRI).\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eAccessory Bulb\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAER\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eAnterior Eye Row\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eALE\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eAnterior Lateral Eye\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAME\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eAnterior Median Eye\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eBCA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eBasal Cymbium Apophysis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eC\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eConductor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eCopulatory Duct\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCO\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eCopulatory Opening\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eDTP\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDistal Tegular Projection\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eE\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eEmbolus\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eFD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eFertilization Duct\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eFu\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eFulcrum\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLateral Subterminal Apophysis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLL\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLateral Lobe\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eMA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eMedian Apophysis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eMF\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eMiddle Field\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eMOA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eMedian Ocular Region\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePER\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePosterior Eye Row\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePLE\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePosterior Lateral Eye\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePME\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePosterior Median Eye\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eRTA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eRetrolateral Tibial Apophysis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eST\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eSubtegulum\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eSV\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eSeminal Valve\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eT\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTegulum\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eVTA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eVentral Tibial Apophysis.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe sincerely thank Dr. Matjaz Kuntner and Mr. Kuang Ping Yu of the Evolutionary Zoology Lab, National Institute of Biology, Lubljana, Slovenia for their continuous guidance and help in this research. We thank Mr. David Raju for his support and permission to survey in the stream running through the property \u0026lsquo;Wayanad Wild\u0026rsquo;. We extend our thanks to Dr. Sajeev T. V., Chief Scientist and Head, Forest Entomology and Pathology Department, Kerala Forest Research Institute (KFRI), for his continuous support. We thank Dr. Ratheesh Raveendran and Ms. Parvathy of the Marine Biodiversity and Environment Management Division, Central Marine Fisheries Research Institute (CMFRI) for providing us with the needed help with microscopy. We are thankful to Mr. Umesh Pavukandy and Mr. Saeed Ahmed, Naturalists at Wayanad Wild Resort, for their active support during fieldwork. We sincerely thank Mr. Gautam Kadam, Mr. Rishikesh Tripati and Ms. Aswathi Singh for their support in morpho-taxonomy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eArjun Cherukutty conceived and performed the experiments, analysed the data, prepared the figures, tables and illustrations, authored and reviewed drafts of the article. Jithu Unni Krishnan conceived and performed the experiments, analysed the data, authored and reviewed drafts of the article, and approved the final draft.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe type specimens are deposited in the insect collection and repository of the Forest Entomology Department of Kerala Forest Research Institute. MT-CO1 sequences generated and analysed during the current study are submitted to and taken from NCBI GenBank. All nucleotide sequences used in this study are enclosed in a spreadsheet as Supplementary data table 1 with the corresponding accession numbers, and voucher ID\u0026rsquo;s are listed in Supplementary data table 2 \u0026nbsp;Additional data related to this paper may be requested from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWorld Spider Catalog. World Spider Catalog. Version 25.5. Natural History Museum Bern, online at http://wsc.nmbe.ch, accessed on {28/11/2024}. doi: 10.24436/2. (2024).\u003c/li\u003e\n\u003cli\u003eDimitrov, D. \u0026amp; Hormiga, G. Spider diversification through space and time. \u003cem\u003eAnnual Review of Entomology\u003c/em\u003e. \u003cstrong\u003e66, \u003c/strong\u003e1 225-241, https://doi.org/10.1146/annurev-ento-061520-083414, (2021)\u003c/li\u003e\n\u003cli\u003eCaleb, J.T.D. \u0026amp; Sankaran, P.M. Araneae of India. Version 2024, online at http://www.indianspiders.in [28/11/2024]. (2024).\u003c/li\u003e\n\u003cli\u003eLatreille, P.A. Tableau m\u0026eacute;thodique des Insectes. \u003cem\u003eDictionnaire (Nouveau) d\u0026rsquo;Histoire Naturelle\u003c/em\u003e. \u003cstrong\u003e24\u003c/strong\u003e, 129\u0026ndash;295 (1804).\u003c/li\u003e\n\u003cli\u003eSimon, E. \u003cem\u003eLes arachnides de France. Tome troisi` eme. Roret, \u003c/em\u003eParis (1876). \u003c/li\u003e\n\u003cli\u003eSimon, E. Etudes arachnologiques. 22e M\u0026eacute;moire. XXXIV. Etude sur les arachnides de l\u0026apos;Yemen. \u003cem\u003eAnnales de la Soci\u0026eacute;t\u0026eacute; Entomologique de France\u003c/em\u003e. \u003cstrong\u003e6\u003c/strong\u003e, 10 77-124 (1890).\u003c/li\u003e\n\u003cli\u003eSarah, A. M., Nicolas, A. H. \u0026amp; Hormiga, G. Molecular phylogenetics of nursery web spiders (Araneae: Pisauridae). \u003cem\u003eMolecular Phylogenetics and Evolution\u003c/em\u003e. \u003cstrong\u003e203\u003c/strong\u003e, https://doi.org/10.1016/j.ympev.2024.108247 (2025).\u003c/li\u003e\n\u003cli\u003eYu, K. et al. Phylogenomics, Classification, and Lifestyle Evolution in Raft- and Nursery Web- Spiders (Araneae: Dolomedidae and Pisauridae). Preprint at bioRxiv https://doi.org/10.1101/2024.08.23.609317 (2024)\u003c/li\u003e\n\u003cli\u003eYu, K \u0026amp; Kuntner, M. Discovering unknown Madagascar biodiversity: integrative taxonomy of raft spiders (Pisauridae: \u003cem\u003eDolomedes\u003c/em\u003e). \u003cem\u003ePeerJ. \u003c/em\u003ehttps://doi.org/10.7717/peerj.1678112:e16781 (2024). \u003c/li\u003e\n\u003cli\u003eKishida, K. A synopsis of the Japanese spiders of the genus \u003cem\u003eDolomedes\u003c/em\u003e. \u003cem\u003eActa Arachnologica\u003c/em\u003e. \u003cstrong\u003e1\u003c/strong\u003e, 4 114-127(1936).\u003c/li\u003e\n\u003cli\u003eDoleschall, L. Tweede bijdrage tot de kennis der arachniden van den indischen archipel. \u003cem\u003eActa Societatis Scientiarum Indo-Neerlandicae\u003c/em\u003e \u003cstrong\u003e5,\u003c/strong\u003e5: 1-60, pl. 1-17 (1859). \u003c/li\u003e\n\u003cli\u003eStrand, E. Neue indoaustralische und polynesische Spinnen des Senckenbergischen Museums. \u003cem\u003eArchiv f\u0026uuml;r Naturgeschichte\u003c/em\u003e. \u003cstrong\u003e79, \u003c/strong\u003eA6 113-123 (1913). \u003c/li\u003e\n\u003cli\u003eKumar, G. M., Sugumaran, M.P., Sivasubramaniam, K. \u0026amp; Nagamani, B. Studies on the ecology of the Raft Spider \u003cem\u003eDolomedes\u003c/em\u003e fimbriatus (Dol.) (Araneae: Pisauridae) in the rice fields of Coimbatore. \u003cem\u003eZoosprint Journal\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 6 45-46 (1999).\u003c/li\u003e\n\u003cli\u003eGajbe, P. Checklist of spiders (Arachnida: Araneae) of Madhya Pradesh and Chhattisgarh. \u003cem\u003eZoosprint\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e,10 1223-1226 (2003).\u003c/li\u003e\n\u003cli\u003eGaikwad, S., Warudkar, A., \u0026amp; Shouche, Y. Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India. \u003cem\u003eMitochondrial DNA Part A\u003c/em\u003e. \u003cstrong\u003e28, \u003c/strong\u003e5, 638\u0026ndash;644, https://doi.org/10.3109/24701394.2016.1166219 (2016).\u003c/li\u003e\n\u003cli\u003ePalita, K.S. Faunal diversity assessment of invertebrates and lower vertebrates of Deomali hills of Eastern Ghats, Koraput, Odisha, India. Submitted to Odisha biodiversity board. (2016). \u003c/li\u003e\n\u003cli\u003eLanka, P. L., Kamble, S.S., \u0026amp; Bodke, K.A. An addition to spider fauna from the vicinity of Radhanagari wildlife sanctuary of Kolhapur district. \u003cem\u003eInternational Journal of Scientific Engineering and Research\u003c/em\u003e. (2015).\u003c/li\u003e\n\u003cli\u003eDhali, C. D. \u0026amp; Sureshan, M. P. Current status of freshwater faunal diversity in India in \u003cem\u003eZSI\u003c/em\u003e pp 339\u0026ndash;343 (2017).\u003c/li\u003e\n\u003cli\u003eNamrata, G., Rajib, B. \u0026amp; Aditya, M. Species diversity, abundance and habitat association of spiders with relation to their guild composition in different habitats of North Bengal Wild Animals Park (Bengal Safari). \u003cem\u003eInternational Journal of Life Sciences\u003c/em\u003e. \u003cstrong\u003e6\u003c/strong\u003e, 4 911-918 (2018).\u003c/li\u003e\n\u003cli\u003eSugumaran, M.P \u0026amp; Duraimurugan, B. Arthropod diversity in horticultural ecosystems in Keelaiyur block, Nagapattinam district, Tamil Nadu. \u003cem\u003eIndian Journal of Ecology.\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 4 889-891 (2019).\u003c/li\u003e\n\u003cli\u003eMarkandan, M. M., Vese, M., Gutolohe \u0026amp; Shohe, T. A preliminary study on spiders diversity from Watiyim village, Mokokchung district, Nagaland, India. \u003cem\u003eInternational Journal of Advanced Research in Biological Sciences\u003c/em\u003e. \u003cstrong\u003e8\u003c/strong\u003e, 10 (2021). \u003c/li\u003e\n\u003cli\u003eTiwari, A. K. \u0026amp; Singh, R. Diversity and distribution of Pisauridae (Araneae: Araneomorphae: Arachnida) in India. \u003cem\u003eInternational Journal of Entomology Research.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1 119-125 https://ssrn.com/abstract=3916139 (2021). \u003c/li\u003e\n\u003cli\u003eCarico, J.E. The nearctic species of the genus \u003cem\u003eDolomedes\u003c/em\u003e (araneae: pisauridae). \u003cem\u003eBulletin of the Museum of Comparative Zooloogy\u003c/em\u003e. \u003cstrong\u003e144\u003c/strong\u003e, 435\u0026ndash;488 (1973).\u003c/li\u003e\n\u003cli\u003eSierwald, P. Morphology and homologous features in the male palpal organ in Pisauridae and other spider families, with notes on the taxonomy of Pisauridae (Arachnida: Araneae).\u003cem\u003e Nemouria, Occasional Papers of the Delaware Museum of Natural History\u003c/em\u003e. \u003cstrong\u003e35\u003c/strong\u003e, 1\u0026ndash;59 (1990).\u003c/li\u003e\n\u003cli\u003eSierwald, P. Morphology and ontogeny of female copulatory organs in American Pisauridae, with special reference to homologous features (Arachnida: Araneae). \u003cem\u003eSmithsonian Contributions to Zoology\u003c/em\u003e \u003cstrong\u003e484\u003c/strong\u003e, 4841\u0026ndash;24 https://doi.org/10.5479/si.00810282.484 (1989).\u003c/li\u003e\n\u003cli\u003eFolmer, O., Black, M., Hoeh, W., Lutz, R., \u0026amp; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. \u003cem\u003eMolecular marine biology and biotechnology\u003c/em\u003e. \u003cstrong\u003e3,\u003c/strong\u003e5 (1994).\u003c/li\u003e\n\u003cli\u003eKatoh, K., Rozewicki, J. \u0026amp; Yamada, D. K. MAFFT onlinie service: multiple sequence alignment, interactive sequence choice and visualization. \u003cem\u003eBriefings in Bioinformatics\u003c/em\u003e. \u003cstrong\u003e20, \u003c/strong\u003e1160\u0026ndash;1166 https://doi.org/10.1093/bib/bbx108 (2019).\u003c/li\u003e\n\u003cli\u003eStamakis, A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. \u003cem\u003eBioinformatics. \u003c/em\u003e\u003cstrong\u003e30\u003c/strong\u003e, 9\u003cem\u003e \u003c/em\u003e(2014).\u003c/li\u003e\n\u003cli\u003eMiller, M.A., Pfeiffer, W. \u0026amp; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees in \u003cem\u003eProceedings of the Gateway Computing Environments Workshop (GCE). \u003c/em\u003e1\u0026ndash;8 (2010).\u003c/li\u003e\n\u003cli\u003eHuelsenbeck, J. P. \u0026amp; Ronquist, F. MRBAYES: Bayesian inference of phylogeny. \u003cem\u003eBioinformatics\u003c/em\u003e. \u003cstrong\u003e17\u003c/strong\u003e,754-755 https://doi.org/10.1093/bioinformatics/17.8.754 (2001).\u003c/li\u003e\n\u003cli\u003eNylander, J.A.A. MrModeltest 2.4. Program distributed by the author. Evolutionary Biology Centre, Uppsala University (2004).\u003c/li\u003e\n\u003cli\u003eSwofford, D. L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.\u003c/li\u003e\n\u003cli\u003eLetunic, I., Bork, P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. \u003cem\u003eNucleic Acids Research\u003c/em\u003e. \u003cstrong\u003e52\u003c/strong\u003e 5, 78\u0026ndash;82, https://doi.org/10.1093/nar/gkae268 (2024). \u003c/li\u003e\n\u003cli\u003eKimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. \u003cem\u003eJournal of Molecular Evolution.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e 111\u0026ndash;120 https://doi.org/10.1007/BF01731581 (1980).\u003c/li\u003e\n\u003cli\u003eKumar, S., Stecher, G., Li, M., Knyaz, C. \u0026amp; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. \u003cem\u003eMolecular Biology and Evolution\u003c/em\u003e. \u003cstrong\u003e35\u003c/strong\u003e 6 1547\u0026ndash;1549 https://doi.org/10.1093/molbev/msy096 (2018)\u003c/li\u003e\n\u003cli\u003eBrignoli, P. M. A catalogue of the Araneae described between 1940 and 1981. \u003cem\u003eManchester University Press\u003c/em\u003e. 755 pp. (1983).\u003c/li\u003e\n\u003cli\u003eZhang, J. X., Zhu, M. S. \u0026amp; Song, D. X. A review of the Chinese nursery-web spiders (Araneae, Pisauridae). \u003cem\u003eJournal of Arachnology\u003c/em\u003e. \u003cstrong\u003e32, \u003c/strong\u003e3 353-417 (2004).\u003c/li\u003e\n\u003cli\u003eJ\u0026auml;ger, P. Spiders from Laos with descriptions of new species (Arachnida: Araneae). \u003cem\u003eActa Arachnologica\u003c/em\u003e. \u003cstrong\u003e56\u003c/strong\u003e, 1 29-58 https://doi.org/10.2476/asjaa.56.29 (2007).\u003c/li\u003e\n\u003cli\u003eYin, C. M. et al. Fauna Hunan: Araneae in Hunan, China in \u003cem\u003eHunan Science and Technology Press, Changsha\u003c/em\u003e. 1590 pp (2012).\u003c/li\u003e\n\u003cli\u003eZhang, Z. Schwartz, S., Wagner, L., \u0026amp; Miller, M. A greedy algorithm for aligning DNA sequences. \u003cem\u003eJournal of Computational Biology.\u003c/em\u003e \u003cstrong\u003e7, \u003c/strong\u003e1-2 203-14 (2000).\u003c/li\u003e\n\u003cli\u003eYu, K. et al. Dolomedes fishing spider biology: gaps and opportunities for future research. \u003cem\u003eFrontiers in Arachnid Science. \u003c/em\u003e\u003cstrong\u003e3\u003c/strong\u003e https://doi.org/10.3389/frchs.2024.1501653 (2024).\u003c/li\u003e\n\u003cli\u003eKralj-Fiser, S. et al. Mate choice and sexual size dimorphism, not personality, explain female aggression and sexual cannibalism in raft spiders. \u003cem\u003eAnimal Behaviour\u003c/em\u003e. \u003cstrong\u003e111\u003c/strong\u003e, https://doi.org/10.1016/j.anbehav.2015.10.013 (2016).\u003c/li\u003e\n\u003cli\u003eWilliams, D. S. The feeding behaviour of New Zealand \u003cem\u003eDolomedes\u003c/em\u003e species (Araneae: Pisauridae). \u003cem\u003eNew Zealand Journal of Zoology\u003c/em\u003e. \u003cstrong\u003e6, \u003c/strong\u003e1 95-105 https://doi.org/10.1080/03014223.1979.10428352 (1979).\u003c/li\u003e\n\u003cli\u003eBond, J. E., et al. Improving taxonomic practices and enhancing its extensibility\u0026mdash;an example from araneology. \u003cem\u003eDiversity\u003c/em\u003e. \u003cstrong\u003e14, \u003c/strong\u003e1 https://doi.org/10.3390/d14010005 (2022).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7043304/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7043304/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIndia is a biodiverse-rich country with four global hotspots and a high level of endemism. These locations continue to be re-counted with new species discoveries. The present exploratory study was conducted at Wayanad, Kerala which is part of the Western Ghats. The genus \u003cem\u003eDolomedes \u003c/em\u003eLatreille, 1804 commonly known as Raft or Fishing spiders belonging to the family Dolomedidae Simon, 1876, is widely distributed across the globe except Antarctica. However, the genus and family have never been scientifically described from India. However, several checklists and articles have mentioned the presence of this\u003cem\u003e \u003c/em\u003egenus in the country. This study details the first record of the family Dolomedidae and the genus \u003cem\u003eDolomedes\u003c/em\u003e with a new species \u003cem\u003eDolomedes indicus \u003c/em\u003esp. nov from both sexes. This study used both classical and molecular taxonomic method for more robust species-level identification. A basic phylogenetic tree of the \u003cem\u003eDolomedes\u003c/em\u003e genus with novel species was created using the MT-CO1 gene.\u003c/p\u003e","manuscriptTitle":"Fishing spider in India: first record of family Dolomedidae with the description of a new species","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-23 16:38:53","doi":"10.21203/rs.3.rs-7043304/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-04T06:31:41+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-01T06:50:41+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-21T09:13:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"287098944228920821260819411331760607773","date":"2025-07-21T08:24:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"251238104954802855113605767330809735244","date":"2025-07-21T03:04:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-20T18:39:49+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-14T11:40:30+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-07-14T10:42:39+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-11T06:30:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-07-11T06:25:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"40eb5480-a224-42b5-9fd3-470cc773c05c","owner":[],"postedDate":"July 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":51845606,"name":"Biological sciences/Ecology"},{"id":51845607,"name":"Earth and environmental sciences/Ecology"},{"id":51845608,"name":"Biological sciences/Evolution"},{"id":51845609,"name":"Biological sciences/Genetics"},{"id":51845610,"name":"Biological sciences/Zoology"}],"tags":[],"updatedAt":"2025-12-01T16:14:51+00:00","versionOfRecord":{"articleIdentity":"rs-7043304","link":"https://doi.org/10.1038/s41598-025-26308-2","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-11-26 15:57:59","publishedOnDateReadable":"November 26th, 2025"},"versionCreatedAt":"2025-07-23 16:38:53","video":"","vorDoi":"10.1038/s41598-025-26308-2","vorDoiUrl":"https://doi.org/10.1038/s41598-025-26308-2","workflowStages":[]},"version":"v1","identity":"rs-7043304","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7043304","identity":"rs-7043304","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.