EtSERPIN1 binding with chicken ANXA2 is essential for Eimeria tenella attachment and invasion process

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Serpin protease inhibitors (SERPINs) in protozoa play crucial roles in various biological processes, including the invasion of host cells. However, the precise roles and molecular mechanisms underlying SERPIN-mediated invasion of parasite remain poorly understand. In this study, we provide evidence that surface-expressed Eimeria tenella SERPIN1 (EtSERPIN1) on sporozoites is involved in adhesion and invasion processes. To elucidate the molecular target responsible for mediating EtSERPIN1-induced invasion, we utilized GST pull-down and yeast two-hybrid verification to screen and identify host cell membrane proteins interacting with EtSERPIN1. Our findings revealed an interaction between EtSERPIN1 and a membrane protein called annexin A2 (ANXA2). Recombinant GgANXA2 was able to bind to the sporozoite surface. Furthermore, treatment with GgANXA2-specific antibody or recombinant GgANXA2 protein resulted in a dose-dependent inhibition of EtSERPIN1 binding to host cells as well as sporozoite invasion. These results suggest that EtSERPIN1 and GgANXA2 interaction plays a critical role in both adhesion and invasion processes of E. tenella sporozoites. Finally, we investigated the impact of recombinant GgANXA2 and EtSERPIN1 proteins on E. tenellainfection. Our results demonstrated that incubation with GgANXA2 protein significantly attenuated sporozoite infectivity, as evidenced by a significantly reduction in parasite burden within the chicken cecum. Immunization with recombinant EtSERPIN1 exhibited potent anti-E. tenella activity, with higher body weight gains, lower cecal lesions and oocyst output, as well as elevated levels of cecal mucosa antibodies. These findings suggest that targeting GgANXA2 through EtSERPIN1 mediates adhesion and invasion processes of E. tenella, highlighting its potential as a novel therapeutic target.
Full text 130,261 characters · extracted from preprint-html · click to expand
EtSERPIN1 binding with chicken ANXA2 is essential for Eimeria tenella attachment and invasion process | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article EtSERPIN1 binding with chicken ANXA2 is essential for Eimeria tenella attachment and invasion process Zengbao Wang, Taifeng Li, Yingying Jiang, Xue Wang, Hongmei Li, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5715652/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Jul, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Abstract Serpin protease inhibitors (SERPINs) in protozoa play crucial roles in various biological processes, including the invasion of host cells. However, the precise roles and molecular mechanisms underlying SERPIN-mediated invasion of parasite remain poorly understand. In this study, we provide evidence that surface-expressed Eimeria tenella SERPIN1 (EtSERPIN1) on sporozoites is involved in adhesion and invasion processes. To elucidate the molecular target responsible for mediating EtSERPIN1-induced invasion, we utilized GST pull-down and yeast two-hybrid verification to screen and identify host cell membrane proteins interacting with EtSERPIN1. Our findings revealed an interaction between EtSERPIN1 and a membrane protein called annexin A2 (ANXA2). Recombinant GgANXA2 was able to bind to the sporozoite surface. Furthermore, treatment with GgANXA2-specific antibody or recombinant GgANXA2 protein resulted in a dose-dependent inhibition of EtSERPIN1 binding to host cells as well as sporozoite invasion. These results suggest that EtSERPIN1 and GgANXA2 interaction plays a critical role in both adhesion and invasion processes of E. tenella sporozoites. Finally, we investigated the impact of recombinant GgANXA2 and EtSERPIN1 proteins on E. tenella infection. Our results demonstrated that incubation with GgANXA2 protein significantly attenuated sporozoite infectivity, as evidenced by a significantly reduction in parasite burden within the chicken cecum. Immunization with recombinant EtSERPIN1 exhibited potent anti- E. tenella activity, with higher body weight gains, lower cecal lesions and oocyst output, as well as elevated levels of cecal mucosa antibodies. These findings suggest that targeting GgANXA2 through EtSERPIN1 mediates adhesion and invasion processes of E. tenella , highlighting its potential as a novel therapeutic target. Eimeria tenella EtSERPIN1 GgANXA2 Adhesion Invasion Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Avian coccidiosis, caused by intestinal infection with one or multiple Eimeria species, leads to great economic losses worldwide [ 1 ]. The current approach to controlling avian Eimeria primarily relies on the utilization of anti-coccidial drugs and live coccidia vaccines. However, the use of anticoccidial drugs is increasingly limited due to issues such as drug resistance, residues, regulatory restrictions and limitations during animal feeding [ 2 , 3 ]. Moreover, the elevated production cost, potential pathogenicity, and restricted production capacity of live Eimeria strains vaccination have hindered their widespread application in the poultry industry [ 4 ]. A comprehensive understanding of coccidia-host interactions and molecular mechanisms will facilitate the development of novel control strategies. The initial step in establishing an infection by Eimeria spp. involves the invasion of host cells, which consists of four sequential processes: attachment, apical reorientation, formation of a moving junction, and establishment of a protective parasitophorous vacuole (PV). These invasion steps are facilitated by proteins secreted from organelles located at the apical end of the parasite [ 5 ]. It is known that microneme proteins (MICs) have been identified as crucial players in parasite attachment progress [ 6 , 7 ], relying on an assortment of domains such as apple, microneme adhesive repeat regions (MARR), integrin-like A, lectin and epidermal growth factor (EGF)-like domains [ 8 , 9 , 10 , 11 ]. However, knockout experiments targeting MICs only partially inhibit sporozoite invasion, indicating that other proteins may also be involved in parasite adhesion to host cells [ 12 , 13 ]. One group of these proteins is serpin protease inhibitors (SERPINs), which have been reported to participate in the process of parasite adhesion and invasion [ 14 , 15 ]. SERPINs are members of a highly conserved superfamily of proteins that exhibit a well-preserved tertiary structure and have functional presence across various organisms, ranging from viruses to mammals [ 16 ]. They function as potent inhibitors of serine proteases and play crucial roles in numerous fundamental biological processes, including blood coagulation, fibrinolysis, angiogenesis, programmed cell death, development, and inflammation [ 17 ]. Toxoplasma gondii SERPIN1 (TgPI) was initially identified in protozoan parasites [ 15 , 18 , 19 ]. Subsequently, several other SERPINs were discovered in Neospora caninum , Entamoeba histolytica , and Eimeria spp. [ 14 , 15 , 18 , 20 ]. In Eimeria spp., the presence of SERPINs has been confirmed in both E. tenella and Eimeria acervulina through studies conducted by Jiang et al. [ 14 ] and Fetterer et al. [ 15 ]. Since then, the involvement of SERPINs in Eimeria spp. cell invasion has been established. However, the precise role played by SERPINs during sporozoite invasion process remains unclear for Eimeria spp. Therefore, this study aims to identify membrane proteins interacting with E. tenella SERPIN1 (EtSERPIN1) using pulldown assays coupled with mass spectrometry analysis to elucidate the molecular mechanism underlying sporozoites invasion mediated by EtSERPIN1. Materials and methods Plasmids, yeast, parasites, cells and animals The pCTCON2 and Saccharomyces cerevisiae EYB100 stored in our laboratory were used for yeast surface display system and adhesion assay [ 11 ]. The wild type strain E. tenella Shandong strain-01 (SD-01) was isolated and stored in our laboratory [ 21 ]. Chicken embryo fibroblast cell line (DF-1) cells stored in our laboratory were maintained in Dulbecco’s minimal essential medium (DMEM) (Gibco, new york, NY, USA) containing 10% fetal bovine serum (FBS) (Biological Industries, Israel) and 1% penicillin-streptomycin (Gibco, new york, NY, USA ) at 37°C in 5% CO 2 . All cells were confirmed to be negative for mycoplasma contamination using a mycoplasma detection kit (Cat# CA1080, Solarbio, Beijing, China). BALB/c mice purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd were utilized for the production polyclonal antibodies (pAb) following previously described [ 21 ]. Coccidia-free 1-day old Hy-Line layer chicken were purchased from Dongyue Breeder Company (Tai’an, China). All animals were maintained under sterile conditions and provided with appropriate feed and water without the use of coccidiostats. Subcellular localization of EtSERPIN1 Indirect immunofluorescence assay (IFA) was performed according to the previously published protocol to determine the subcellular localization of EtSERPIN1 in E. tenella [ 11 ]. Briefly, E. tenella sporozoites, second-generation schizonts and gametophytes were fixed, permeabilized, and sequentially incubated with anti-EtSERPIN1 pAb and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG antibody (Solarbio, Beijing, China). Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) (Solarbio, Beijing, China). Images were visualized and acquired using fluorescence microscopy (Nikon-ECLIPSE; Japan). Glutathione S-transferase (GST) pull-down assay Preparation of membrane proteins from the chicken caecum epithelium: The cecal mucosa of healthy chickens was scraped and stored at -80°C. Membrane proteins from the chicken caecum epithelium were extracted using the Membrane Protein Extraction kit (Solarbio, Beijing, China), following the manufacturer's instructions. The GST pull-down assay was performed according to a previously described method [ 22 ]. Firstly, recombinant GST-tag EtSERPIN1 protein (rGST-EtSERPIN1) was expressed in BL21. Then, glutathione resins (Solarbio, Beijing, China) were separately incubated with rGST-EtSERPIN1 or GST-tag (control) at 4°C for 5 h. After three washes to remove non-resin bound proteins, the glutathione resins were mixed with membrane protein from the chicken caecum epithelium at 4°C for 2 h, followed by elution of the bait-prey mixture using elution buffer (10 mmol/L reduced glutathione, pH 8.0). Finally, the samples were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Mass spectrometry The silver staining and mass spectrometry were performed following previously described methods [ 23 ]. Briefly, rGST-EtSERPIN1 and GST-tag interaction complexes were separated by SDS-PAGE and subjected to Fast stain silver kit according to the manufacturer's instructions (Beyotime, Shanghai, China). Subsequently, distinct protein bands between the rGST-EtSERPIN1 and GST-tag groups were excised from the gel, trypsin-digested, and analyzed using mass spectrometry (MS) based on a standardized protocol employing QSTAR XL instrument (Applied Biosystems, CA, USA). All experimental procedures were performed by BPI Genomics Company (Shenzhen, China). Yeast two-hybrid verification test (Y2H) The yeast two-hybrid verification assay was carried out according to previously described methods [ 22 ]. Briefly, the coding sequence (CDS) of EtSERPIN1 was cloned into the pGBKT7 plasmid to construct the bait plasmid (pGBKT7-EtSERPIN1). The CDS sequence of chicken annexin A ( ANXA ) genes, including GgANXA 2, 3, 5, and 13, were cloned into pGADT7 plasmid as potential prey. Subsequently, co-transformation of pGBKT7-EtSERPIN1 with either pGADT7-GgANXA2 or pGADT7-GgANXA3 or pGADT7-GgANXA5 or pGADT7-GgANXA13 into Y2H Gold strain was carried out using the Y2HGold-GAL4 Y2H interaction proving kit (Coolaber, Beijing, China). The interaction between the EtSERPIN1 and potential prey proteins was confirmed by the growth of co-transformants on DDO/X/A and QDO/X/A plate at 30°C for 3–5 days. The positive control used was pGBKT7-p53. Western blot The western blot assay was conducted according to previously described [ 24 ]. The isolated protein or GST pull-down samples were resolved on a 12% SDS-PAGE gel and subsequently transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore) for immunoblotting analysis using specific antibodies. The bound complexes were visualized using the NcmECL Ultra substrate (New Cell and Molecular Biotech, Suzhou, China) following the manufacturer's protocol. Adhesion assay Yeast surface display adhesion assay was performed according to the method described by Wang et al [ 25 ]. For the adhesion assay, DF-1 cells were incubated with 100 yeast displayed EtSERPIN1 for 2 hours at 30°C. The cells were subsequently washed three times with PBS and plated on synthetic defined medium with casamino acids (SDCAA: 0.67% yeast extract, 2% glucose, 0.5% casein acid hydrolysate, 0.15% agar powder, and 10% ampicillin) containing 0.8% agar. After culturing for 24 hours, the adhesion rate was calculated as previously described [ 11 ]. Yeasts transfected with pCTCON2 plasmid were used as control. Adhesion inhibition assays were conducted using two methods: first, yeast cells displaying EtSERPIN1 were pre-incubated with different concentrations of recombinant His-tag GgANXA2 protein (rHis-GgANXA2) for one hour before being added to DF-1 cells for calculation of the adhesion rate; in the other, DF-1 cells cells were incubated with anti-ANXA2 pAb prior to addition of yeast-displayed EtSERPIN1 for calculating the adhesion rate. Then, yeast displayed EtSERPIN1 were added into DF-1 cells for adhesion rate calculation. Yeasts or DF-1 treated with an equivalent dose of PBS or healthy IgG served as controls. The experiment was repeated three times. Binding of GgANXA2 to chicken caecum The ability of EtSERPIN1 to bind to chicken caecum was determined using immunohistochemical assay [ 26 ]. Briefly, the caecum was washed with sterile PBS, fixed with 4% paraformaldehyde and embedded in paraffin. Subsequently, the samples were boiled for 10 minutes in sodium citrate buffer (Servicebio, Wuhan, China), followed by blocking with tris-buffered saline and polysorbate 20 (TBST) containing 5% bovine serum albumin (BSA). Next, tissue sections were incubated sequentially with rHis-EtSERPIN1 or PBS (negative control) at 37°C for 1 h. Afterwards, the sections were incubated overnight at 4°C with anti-EtSERPIN1 pAb as a primary antibody and then treated with FITC-conjugated goat anti-mouse IgG as a secondary antibody at 37 ℃ for another hour. Nuclei were stained with DAPI (Solarbio, Beijing, China) for 5 min. For the binding inhibition assay, the sections were pre-treated with anti-ANXN2 pAb for 1 h at 37°C. Images were visualized and acquired using fluorescence microscopy (Nikon-ECLIPSE; Japan). Sporozoite invasion assay The impact of GgANXA2 on sporozoite invasion of host cells was investigated using an in vitro and in vivo sporozoite invasion inhibition assay [ 22 ]. In the in vitro assay, sporozoites were incubated with varying doses of rHis-GgANXA2 (50, 100, 150 µg/mL) or DF-1 cells were blocked by anti-GgANXA2 pAb (0, 100, 200, 300 µg/mL) respectively at 37 ℃ for 2 h. After three washes with PBS, the pretreated sporozoites (2×10 5 ) were added to a 12-well plate containing DF-1 cells and unpretreated sporozoites were used to invade pretreated DF-1 cells. Following a 40 min incubation period, non-invaded sporozoites were harvested and counted. The inhibition rates were calculated as follows: (1-the number of unblocked sporozoites/the total sporozoites) ×100%. Sporozoites incubated with PBS or DF-1 incubated with the same dose of mouse IgG served as negative control. The experiment was conducted three times. For the in vivo assay, sporozoites pretreated by rHis-GgANXA2 or PBS were infected chicken by cloacal injection. The cecal lesion score and cecal parasite load were detected at 5 day post-infection (dpi) as described previously [ 11 , 27 ]. The oocyst output were counted at 7–10 days post-infection (dpi) [ 28 ], respectively. Reverse transcription and quantitative real-time PCR (qPCR) The chickens were orally infected with sporulated E. tenella oocysts (2×10 4 /chicken) for 0, 12, 24 h. Total RNA was isolated from the duodenum, jejunum, ileum, and caecum using an RNA purification Kit (Promega, Madison, WI, USA). Subsequently, reverse transcription of 1 µg RNA to cDNA was performed using M-MLV reverse transcriptase with RNase inhibitor. QPCR analysis was conducted in triplicate using RealStar Green Fast Mixture (A303; GenStar, Beijing, China) on an ABI Q5 instrument (ABI, Thermo Fisher Scientific Inc., MA, USA). Threshold cycle numbers were normalized to triplicate samples amplified with GgGAPDH gene. The qPCR primers used for GgANXA2 and GgGAPDH gene are listed in Table 1 . Table 1 Primers used in this study Gene Forward sequence (5’-3’) Reverse sequence (5’-3’) GgANXA2 AGGGCCTGGGAACTGATGAA GCCAGGGCAACCATTAGCTT GgGAPDH CACCGCTATTCCTTATAAAGAAAGT AAACACTTTCTTTATAAGGAATAGC Protective effect of rHis-EtSERPIN1 on E. tenella infection Seven-day-old chickens were randomly divided into three groups (n = 35/group). The immune program was carried out as described previously [ 11 ]. In brief, chicken of EtSERPIN1 were immunized subcutaneously with purified rHis-EtSERPIN1 in Freund’s complete adjuvant (FCA; Sigma). Group PBS-I and PBS-II were immunized with PBS-FCA. At 7 days post-immunization, chickens were administered a booster immunization of rHis-EtSERPIN1 in Freund’s incomplete adjuvant (FIA; Sigma) or PBS-FIA respectively. At seven days after secondary immunization, all chickens, except for PBS-I group, were orally infected with E. tenella sporulated oocysts (1×10 4 per chicken). The protective efficacy was evaluated by calculated ACI based on the survival rate, weight gains, oocyst output and cecal lesion score. The body weight gains in each group were determined during 0 dpi to 10 dpi. Oocyst output was estimated by counting the oocysts per gram of feces during 7 dpi and 10 dpi. The cecal lesion score of chicken (n = 8) were recorded at 5 dpi as described method previously. ACI of each group was evaluated as described previously [ 27 ]. Serum IgG and cecal sIgA level The levels of serum IgG and cecal secretory IgA (sIgA) in each group of chickens (n = 3) were determined using ELISA, following the protocol described previously [ 29 ]. Briefly, ELISA plates coated with recombinant His-EtSERPIN1 protein were used to quantify IgG in serum and sIgA in caeca. Horseradish peroxidase-conjugated rabbit anti-chicken IgG antibodies were employed as the secondary antibodies. All samples were analyzed in triplicate, and the optical density at 450 nm was measured using an automated microplate reader (Biotek, USA). Data statistical analysis The independent experiments were conducted in triplicate, with three technical replicates for each experiment. All statistical analyses were performed using GraphPad Prism 9.0 software. Student's t -test was utilized to determine the significance of the results, and the data were presented as mean ± SD. P value < 0.05 was considered statistically significant. Results EtSERPIN1 expressed on the surface of sporozoites is involved in adhesion and invasion process It has been previously reported that EtSERPIN1 is expressed in both sporozoites and schizogony stages [ 14 ]. However, the expression of EtSERPIN1 during gametogony stage and its localization in sporozoites remain unclear. To clarify the expression and localization of EtSERPIN1, we expressed and purified rHis-EtSERPIN1 with a molecular weight of approximately 50 kDa (Fig. 1 A, lane 1) to prepare anti-EtSERPIN1 polyclonal antibody (pAb). Anti-EtSERPIN1 pAb prepared in mice recognized two protein bands at around 42 kDa and 45 kDa (Fig. 1 A, lane 2). Further investigation revealed a secreted protein band at around 42 kDa in sporozoite secretion proteins (Fig. 1 B), suggesting that native EtSERPIN1 may exist in two forms in E. tenella , with the lower molecular weight form being a secreted protein lacking signal peptide and cytoplasmic domain. Using anti-EtSERPIN1 pAb, we determined the expression and localization of EtSERPIN1 during sporozoite invasion process as well as gametogony stage. Immunofluorescence results found that EtSERPIN1 has been labeled on the surface of sporozoites and expressed in the schizonts and gametogony stages (Fig. 1 C). These results indicated that EtSERPIN1 is a membrane and secreted protein that expressed in the all stage of E. tenella life stages. Previous studies have demonstrated the inhibitory effect of anti-EtSERPIN1 antibody on sporozoite invasion, suggesting its involvement in the parasite invasion proces [ 14 ]. Our antibody inhibition test results also revealed that pretreatment with anti-EtSERPIN1 pAb effectively reduced the invasion ability of parasites in DF-1 cells in a dose-dependent manner (Fig. 1 E). At a concentration of 300 µg/mL, anti-EtSERPIN1 pAb blocked 48.77% of sporozoites from invading DF-1 cells, which was significantly higher than the control (14.6% ) ( P < 0.05) (Fig. 1 D). Additionally, to elucidate the role of surface EtSERPIN1, we investigated its impact on sporozoite adhesion and invasion processes. The binding ability of EtSERPIN1 was assessed using yeast display system and immunohistochemical assays as described in Materials and Methods. Yeast expressing surface-bound EtSERPIN1 (Fig. 1 E) exhibited significantly enhanced adhesion to DF-1 cells compared to controls (Fig. 1 F) ( P < 0.05). Immunohistochemistry confirmed specific binding between rHis-EtSERPIN1 and cecum tissue sections labeled with anti-EtSERPIN1 pAb (Fig. 1 G), further supporting the adhesive function of EtSERPIN1. EtSERPIN1 interacts with GgANXA2 To identify the binding protein of EtSERPIN1 associated with adhesion and invasion processes, the membrane protein of chicken cecal epithelial cells interacting with EtSERPIN1 were screened and identified by GST pull-down and MS analysis. The recombinant EtSERPIN1 protein tagged with GST was successfully expressed and purified (Fig. 2 A). Differential protein bands were observed in the rGST-EtSERPIN1 pull-down mixture compared to the GST-tag control (Fig. 2 B). MS analysis revealed a total of 27 candidate host proteins potentially associated with EtSERPIN1. Subsequently, we predicted the sub-cellular localization of these 27 proteins using WoLF PSORT analysis ( https://www.genscript.com/tools/wolf-psort ) and UniProt database ( https://www.uniprot.org ), which identified four proteins located on the cell membrane, including GgANXA2/3/5/13. Considering that adhesion and invasion processes are mediated by interactions between parasite proteins and surface receptors on host cells, we selected these four membrane proteins as candidates for further identification studies. To validate the interaction between EtSERPIN1and four membrane proteins, a point-to-point Y2H assay was performed. Yeast cells transformed with pGBKT7-EtSERPIN1 and either pGADT7-GgANXA2 or pGADT7-GgANXA13 displayed blue colonies on DDO/X/A and QDO/X/A media, while those transformed with GgANXA3 or GgANXA5 constructs did not exhibit any color change (Fig. 2 C), indicating potential interactions between EtSERPIN1 and GgANXA2/GgANXA13. Additionally, a GST pull-down assay was conducted to confirm direct interactions between EtSERPIN1 and GgANXA2/GgANXA13. rGST-GgANXA2 and rGST-GgANXA13 protein were expressed and purified successfully (Fig. 2 D). The results from the GST pull-down experiment demonstrated that His-EtSERPIN1 could be pulled down by rGST-GgANXA2 but not by the negative control containing only GST tag (Fig. 2 E). However, no interaction between rHis-EtSERPIN1 was observed in the eluate obtained from the rGST-GgANX13 pull-down experiment (Fig. 2 F). These findings provide evidence for an interaction between EtSERPIN1 and GgANXA2, a chicken membrane protein. Recombinant GgANXA2 protein binds to sporozoites To further validate the interaction between EtSERPIN1 and GgANXA2, we initially incubated sporozoites with rHis-GgANXA2 protein and employed western blot to assess the binding affinity of rHis-GgANXA2 protein towards sporozoites. The western blot analysis revealed detectable levels of rHis-GgANXA2 in sporozoites incubated with rHis-GgANXA2, while no signal was observed in the control group (Fig. 3 A). Additionally, IFA using anti-His monoclonal antibody (mAb) demonstrated surface localization of sporozoites incubated with rHis-GgANXA2 protein (Fig. 3 B). These findings provide compelling evidence that GgANXA2 effectively interacts with the surface of sporozoites, thereby confirming its association with EtSERPIN1. Recombinant GgANXA2 protein and GgANXA2-specific antibody inhibited EtSERPIN1 binding to host cells To further elucidate the role of GgANXA2 in EtSERPIN1-mediated adhesion to host cells, we conducted an attachment assay using the yeast surface display model. The adhesion rate of yeast cells displaying EtSERPIN1 was significantly reduced in the presence of recombinant GgANAX2 proteins (44.32%) compared to the PBS group (26.75%) ( P < 0.05) (Fig. 4 A). We performed cell blocking with anti-ANAX2 antibody and assessed its impact on EtSERPIN1 adhesion. Pre-blocking cells with anti-ANXA2 antibody resulted in a significantly lower adhesion rate compared to incubation with IgG alone (Fig. 4 B). Consistent with these findings, anti-ANAX2 antibody effectively inhibited the binding of rHis-EtSERPIN1 to cecum tissue (Fig. 4 C). These results suggest that GgANXA2 may be essential for mediating EtSERPIN1's adherence to host cells. Recombinant GgANXA2 inhibited sporozoites invasion in vitro and in vivo Furthermore, we investigated the impact of GgANXA2 recombinant protein and anti-ANAX2 antibody on sporozoite invasion both in vitro and in vivo. The findings demonstrated that incubation with recombinant GgANXA2 protein or cell blocking using anti-ANXA2 antibodies significantly reduced the invasion rate of sporozoites in a dose-dependent manner (Fig. 5 A and B). These results indicate that both GgANXA2 protein and anti-ANXN2 antibodies blockade effectively inhibit the invasion of sporozoites into host cells. In vivo experiments evaluated the effect of GgANXN2 recombinant protein on sporozoite infection, including cecal load, cecal lesions, and fecal oocyst excretion. Compared to the control group, there was a significant reduction in E. tenella parasite load within the cecum (Fig. 5 C) as well as oocyst excretion following sporozoites incubated with recombinant GgANXA2 protein (Fig. 5 D). In vivo, Additionally, at 5 days post-infection (dpi), cecal lesion scores were significantly lower in the GgANXA2 protein incubation group compared to those observed in the control group (Fig. 5 E). These findings suggest that GgANXA2 protein blockade possesses inhibitory potential against sporozoite infection. The expression of GgANXA2 in the cecum is regulated by E. tenella infection Further, we examined the transcriptional levels of GgANXA2 in duodenum, jejunum, ileum and caecum during E. tenella infection. The results of qPCR revealed no significant difference in GgANXA2 transcriptional levels between the duodenum, jejunum, and ileum at 12 hours post-infection (hpi). However, there was a significant increase in GgANXA2 expression in the cecum compared to 0 hpi (Fig. 6 ). These findings suggest a positive association between cecal ANXA2 transcription and sporozoite invasion. Recombinant EtSERPIN1 immunization induced higher anti- E. tenella activity Considering the involvement of EtSERPIN1 in the adhesion and invasion process of E. tenella , we postulated that antibodies induced by EtSERPIN1 possess anti- E. tenella activity. Subsequently, we evaluated the anti- E. tenella activity elicited by immunization with rHis-EtSERPIN1 protein through assessments of survival rate, body weight, cecal lesions, and oocyst count. Throughout the experiment, no deaths occurred due to E. tenella infection in any group, resulting in a 100% survival rate. Remarkably increased relative weight gain was observed in chickens immunized with rHis-EtSERPIN1 protein compared to those in the control group (Table 2 ). Additionally, chickens receiving rHis-EtSERPIN1 protein exhibited significantly lower cecal lesion scores than those in the control group ( P < 0.05). Moreover, oocyst shedding was significantly reduced in chickens immunized with EtSERPIN1 compared to PBS controls. Finally, ACI calculation results revealed an anti- E. tenella index of 170.14 for rHis-EtSERPIN1 protein (Table 1 ). Collectively, these findings demonstrate that immunization with recombinant EtSERPIN1 protein induces a moderate level of anti- E.tenella activity in chickens and supports its candidacy as an antigen. Table 2 Protective effect of the recombinant EtSERPIN1 against E. tenella infection in chicken Group Average body weight gain (g) Oocyst shedding (×10 5 /g) Lesion score ACI PBS-I 167.4 ± 4.85 a 0 0 200 PBSII 95.4 ± 4.33 c 6.83 ± 0.29 b 1.4 ± 0.1 b 81.99 EtSERPIN1 157.6 ± 4.95 b 3.03 ± 0.24 a 3.5 ± 0.16 a 170.14 Values with different letters in same column are significantly different ( P 180; moderate activity: 179 > ACI > 160; limited activity: 159 > ACI > 120; nonactivity: ACI < 120. Recombinant EtSERPIN1 induced high levels of IgG and sIgA To assess the capacity of EtSERPIN1 to elicit humoral immunity, we measured the serum IgG and cecal secretory IgA (sIgA) levels specific to EtSERPIN1 seven days post the second immunization. As depicted in Fig. 7 , the EtSERPIN1-immunized group exhibited significantly elevated levels of IgG in serum (Fig. 7 A) and sIgA (Fig. 7 B) in the cecum. These findings indicate that EtSERPIN1 possesses the ability to stimulate both humoral and mucosal immune responses. Discussion Chick Eimeria spp. encompasses various developmental stages, including developmental stages such as sporogenesis, schizogony and gametogenesis, with gene expression in each stage typically associated with their respective functions. Previous studies have reported the expression of EtSEPRIN1 in oocysts, sporozoites, and merozoites [ 14 ]; however, its expression during the gamete stage remains unknown. In this study, indirect immunofluorescence assay revealed that EtSERPIN1 is also expressed during gamete development, indicating its continuous expression throughout the developmental history of E. tenella and suggesting potential multifunctionality for EtSERPIN1. Bioinformatics analysis further identified a signal peptide and transmembrane domain in EtSERPIN1 protein sequence, implying its classification as a membrane protein [ 14 ]. Additionally, our findings demonstrated the localization of EtSERPIN1 on the sporozoite membrane which aligns with theoretical predictions and provides insights into its role in adhesion invasion. The coding sequence of EtSERPIN1 produces a protein of approximately 45 kDa [ 14 ]. However, the anti-EtSERPIN1 antibody detected two protein bands with different molecular weights in sporozoite whole proteins, consistent with previous findings on T. gondii SERPIN [ 19 ]. Previous evidence suggests that T. gondii secretes SERPIN into host cells to prevent protease degradation [ 19 ]. Based on this, we hypothesize that immature EtSERPIN1 exists in the parasite cytoplasm as a large band without protease inhibitory activity, while mature and cleaved EtSERPIN1 is secreted extracellularly to perform its function, resulting in smaller molecular weight. Fetterer et al. reported detection of EtSERPIN1 in host cells after sporozoite infection, and our study showed expression of surface-bound and secretory properties for EtSERPIN1 on E. tenella sporozoites [ 15 ], suggesting potential for protease inhibition by externally-secreted or cell-surface bound EtSERPIN1. The invasion process of E. tenella , a highly pathogenic parasite that causes significant economic losses to the poultry industry, is complex and involves multiple proteins [ 30 , 31 ]. The role of secretory proteins, particularly in the early stages of invasion, has garnered considerable attention due to their potential to facilitate parasite entry into host cells. Previous studies have reported crucial roles played by rhoptry proteins and microneme proteins in the invasion process of apicomplexan protozoan parasites [ 31 , 32 ]. Among these, microneme proteins (MIC) are primarily involved in the adhesion process of sporozoites to host cells, such as MIC2, MIC3 and MIC8, etc [ 11 , 12 , 33 ]. The rod-neck protein forms a moving junction with apical membrane antigen (AMA1), mediating the invasion process of the parasite including rhoptry neck protein 2, 4,5, and 8 (RON2/4/5/8) [ 34 , 35 ]. However, our understanding of sporozoite invasion processes in Eimeria spp remains extremely limited. A previous study demonstrated higher expression levels of EtSERPIN1 in sporozoites compared to other developmental stages [ 36 ]. Subsequent studies found that EtSERPIN1 was expressed at the apical end during sporozoite invasion [ 15 ], and and anti-EtSERPIN1 antibodies were shown to block sporozoite invasion process [ 14 ]. In our study, we also observed that anti-EtSERPIN1 antibodies reduced the rate of sporozoite invasion in a dose-dependent manner. Furthermore, we investigated the role of EtSERPIN1 for sporozoite invasion using immunohistochemistry and yeast surface display system [ 22 ]. Our results revealed that EtSERPIN1 significantly enhanced yeast adhesion to host cells and recombinant EtSERPIN1 protein exhibited adhesive properties towards cecum tissue. The findings of this study suggest that EtSERPIN1 may play a crucial role in the invasion of sporozoites by facilitating their adhesion to host cells. Protein-protein interactions are indispensable for the proper functioning of proteins [ 37 ]. Investigating the precise functions of invasion-related molecules in E. tenella and identifying their interacting partners would be a significant breakthrough in understanding the functional mechanisms of parasites and discovering novel antigen targets [ 38 ]. Recently, several studies have been conducted on invasion related molecules of Eimeria spp, such as EtMIC8, EtCab, and EtCDPK4, play a crucial role in the process of sporozoite invasion into the host cell [ 11 , 25 , 39 ]. However, the investigation of adhesion and invasion receptors associated with host epithelial cells remains limited. Zhang et al. [ 40 ] reported that E. acervulina microneme 3 protein (EaMIC3) specifically binds to chicken ubiquitin-binding enzyme E2F (UBE2F), thereby mediating the invasion process. Sun et al. [ 22 ] discovered that the interaction between EtMIC8-EGF and chicken epithelial cell adhesion molecule (GgEPCAM) is essential for attachment and invasion of E. tenella sporozoites [ 22 ]. Our study, in conjunction with previous reports, has confirmed the involvement of EtSERPIN1 in sporozoite invasion process [ 14 ]. To elucidate the specific mechanism by which EtSERPIN1 mediates adhesion, we identified membrane proteins that interact with EtSERPIN1 through mass spectrometry, yeast two-hybrid assays, and pull-down experiments. These analyses confirmed an interaction between EtSERPIN1 and GgANXN2. Furthermore, subsequent experiments demonstrated that both recombinant GgANXN2 protein blockade and anti-GgANXA2 antibody inhibition could impede the adhesive role of EtSERPIN1 as well as sporozoite invasion process, thus confirming a certain role played by EtSERPIN1-GgANXN2 interaction during sporozoite development. Adhesion and invasion are crucial steps in establishing infection by apicomplexan protozoa. Therefore, host-produced antibodies against these processes can block sporozoite invasion and reduce infection rates. For instance, apical membrane antigen (AMA1) and rhoptry neck protein 4 (RON4) of Neospora Canis induce high titers of antibodies against neosporosis, while Eimeria spp's MIC2, AMA1, MIC3, and MIC8 proteins elicit moderate to excellent anti-coccidia activity [ 11 , 41 , 42 , 43 ]. In this study, recombinant EtSERPIN1 protein demonstrated high immunogenicity and protective efficacy as evidenced by increased body weight gains along with significantly lower fecal oocyst shedding levels and lesion scores. Consistent with these results were the increases in serum IgG levels and cecal mucosa sIgA antibody levels following immunization with recombinant EtSERPIN1 protein. Mucosal immunity is the first line of defense against infections; sIgA plays a critical role in defending against intestinal parasites challenge [ 44 , 45 ]. Davis and Porter [ 46 ] found that anti- E. tenella sIgA present in cecal contents could disrupt parasite development highlighting the importance of mucosal immunity to E. tenella infection in chickens. Thus high titers of anti-EtSERPIN1-specific sIgA antibodies contribute to resistance to E. tenella infection. Conclusion In conclusion, our study reveals that EtSERPIN1, a protease inhibitor in E. tenella , interacts with host cell membrane protein GgANXA2, playing a crucial role in sporozoite adhesion and invasion. Recombinant GgANXA2 inhibits EtSERPIN1 binding and sporozoite invasion, while EtSERPIN1 immunization exhibits anti- E. tenella activity. These findings suggest that targeting the EtSERPIN1-GgANXA2 interaction may offer a novel therapeutic approach for E. tenella treatment. Further studies are needed to elucidate the underlying mechanisms and explore potential applications. Declarations Authors’ contributions The work was mainly conceived and designed by NZ, XZ, and XZ; YJ and ZW performed the experiments; XW, HL and TL collected and analyzed the experimental data. The manuscript was mainly written by ZW and NZ. The manuscript was revised by NZ. All authors have read and agreed to the published version of the manuscript. Acknowledgements Not applicable. Funding This work was supported by the grants from the National Natural Science Foundation of China (grant no. 32402917) and the Science and Technology Project of Tibet Autonomous Region (grant no. QYXTZX-RKZ2024-03-3). Availability of data and materials All data from this study are available from the corresponding author upon reasonable request. Ethics approval and consent to participate The study protocol and all animal studies were approved by the Shandong Agricultural University Animal Care and Use Committee (SDAU-2024-015). Experiments were carried out in accordance with the approved guidelines and regulations. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Liu Q, Liu X, Zhao X, Zhu XQ, Suo X. Live attenuated anticoccidial vaccines for chickens. Trends Parasitol. 2023;39(12):1087-1099. Clark EL, Tomley FM, Blake DP. Are Eimeria Genetically Diverse, and Does It Matter? Trends Parasitol. 2017;33(3):231-241. Clarke L, Fodey TL, Crooks SR, Moloney M, O'Mahony J, Delahaut P, O'Kennedy R, Danaher M. A review of coccidiostats and the analysis of their residues in meat and other food. Meat Sci. 2014;97(3):358-74. Witcombe DM, Smith NC. Strategies for anti-coccidial prophylaxis. Parasitology. 2014;141(11):1379-89. Aikawa M, Miller LH, Johnson J, Rabbege J. Erythrocyte entry by malarial parasites. A moving junction between erythrocyte and parasite. J Cell Biol. 1978;77(1):72-82 Venugopal K, Marion S. Secretory organelle trafficking in Toxoplasma gondii: A long story for a short travel. Int J Med Microbiol. 2018;308(7):751-760. Arredondo SA, Schepis A, Reynolds L, Kappe SHI. Secretory Organelle Function in the Plasmodium Sporozoite. Trends Parasitol. 2021;37(7):651-663 Blumenschein TM, Friedrich N, Childs RA, Saouros S, Carpenter EP, Campanero-Rhodes MA, Simpson P, Chai W, Koutroukides T, Blackman MJ, Feizi T, Soldati-Favre D, Matthews S. Atomic resolution insight into host cell recognition by Toxoplasma gondii. EMBO J. 2007;26(11):2808-20. Brecht S, Carruthers VB, Ferguson DJ, Giddings OK, Wang G, Jakle U, Harper JM, Sibley LD, Soldati D. The toxoplasma micronemal protein MIC4 is an adhesin composed of six conserved apple domains. J Biol Chem. 2001;276(6):4119-27. Soldati D, Dubremetz JF, Lebrun M. Microneme proteins: structural and functional requirements to promote adhesion and invasion by the apicomplexan parasite Toxoplasma gondii. Int J Parasitol. 2001;31(12):1293-302. Zhao N, Ming S, Sun L, Wang B, Li H, Zhang X, Zhao X. Identification and Characterization of Eimeria tenella Microneme Protein (EtMIC8). Microbiol Spectr. 2021;9(1): e0022821. Huynh MH, Carruthers VB. Toxoplasma MIC2 is a major determinant of invasion and virulence. PLoS Pathog. 2006;2(8): e84. Carruthers VB, Tomley FM. Microneme proteins in apicomplexans. Subcell Biochem. 2008;47:33-45. Jiang L, Lin J, Han H, Zhao Q, Dong H, Zhu S, Huang B. Identification and partial characterization of a serine protease inhibitor (serpin) of Eimeria tenella. Parasitol Res. 2012;110(2):865-74. Fetterer RH, Miska KB, Jenkins MC, Barfield RC, Lillehoj H. Identification and characterization of a serpin from Eimeria acervulina. J Parasitol. 2008;94(6):1269-74. Laskowski M Jr, Kato I. Protein inhibitors of proteinases. Annu Rev Biochem. 1980;49:593-626. van Gent D, Sharp P, Morgan K, Kalsheker N. Serpins: structure, function and molecular evolution. Int J Biochem Cell Biol. 2003;35(11):1536-47. Bruno S, Duschak VG, Ledesma B, Ferella M, Andersson B, Guarnera EA, Angel SO. Identification and characterization of serine proteinase inhibitors from Neospora caninum. Mol Biochem Parasitol. 2004;136(1):101-7. Pszenny V, Angel SO, Duschak VG, Paulino M, Ledesma B, Yabo MI, Guarnera E, Ruiz AM, Bontempi EJ. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol Biochem Parasitol. 2000;107(2):241-9. Riahi Y, Siman-Tov R, Ankri S. Molecular cloning, expression and characterization of a serine proteinase inhibitor gene from Entamoeba histolytica. Mol Biochem Parasitol. 2004;133(2):153-62. Liu Q, Chen Z, Shi W, Sun H, Zhang J, Li H, Xiao Y, Wang F, Zhao X. Preparation and initial application of monoclonal antibodies that recognize Eimeria tenella microneme proteins 1 and 2. Parasitol Res. 2014;113(11):4151-61. Sun L, Li C, Zhao N, Wang B, Li H, Wang H, Zhang X, Zhao X. Host protein EPCAM interacting with EtMIC8-EGF is essential for attachment and invasion of Eimeria tenella in chickens. Microb Pathog. 2024;188:106549. Li J, Xiao Q, Tan Q, Chen J, Sun L, Chen X, Chu Z, Wu H, Zhang Z, Li H, Zhao X, Zhang X. TgMORN2, a MORN Family Protein Involved in the Regulation of Endoplasmic Reticulum Stress in Toxoplasma gondii. Int J Mol Sci. 2023;24(12):10228. Zhao N, Wang F, Kong Z, Shang Y. Pseudorabies Virus Tegument Protein UL13 Suppresses RLR-Mediated Antiviral Innate Immunity through Regulating Receptor Transcription. Viruses. 2022;14(7):1465. Wang Y, Zhou X, Wang H, Sun L, Wang B, Jiang Y, Li H, Zhang X, Li H, Zhao X. The role of Eimeria tenella EtCab protein in the attachment and invasion of host cells. Vet Parasitol. 2021;292:109415. Li W, Wang M, Chen Y, Chen C, Liu X, Sun X, Jing C, Xu L, Yan R, Li X, Song X. EtMIC3 and its receptors BAG1 and ENDOUL are essential for site-specific invasion of Eimeria tenella in chickens. Vet Res. 2020;51(1):90. Johnson J, Reid WM. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 1970;28(1):30-6. Song X, Li Y, Chen S, Jia R, Huang Y, Zou Y, Li L, Zhao X, Yin Z. Anticoccidial Effect of Herbal Powder "Shi Ying Zi" in Chickens Infected with Eimeria tenella. Animals (Basel). 2020;10(9):1484. Chen Z, Wang X, Zhao N, Han L, Wang F, Li H, Cui Y, Zhao X. Improving the immunogenicity and protective efficacy of the EtMIC2 protein against Eimeria tenella infection through random mutagenesis. Vaccine. 2018;36(18):2435-2441. Zhang Y, Lai BS, Juhas M, Zhang Y. Toxoplasma gondii secretory proteins and their role in invasion and pathogenesis. Microbiol Res. 2019;227:126293. Sparvoli D, Delabre J, Penarete-Vargas DM, Kumar Mageswaran S, Tsypin LM, Heckendorn J, Theveny L, Maynadier M, Mendonça Cova M, Berry-Sterkers L, Guérin A, Dubremetz JF, Urbach S, Striepen B, Turkewitz AP, Chang YW, Lebrun M. An apical membrane complex for triggering rhoptry exocytosis and invasion in Toxoplasma. EMBO J. 2022;41(22): e111158. Bonhomme A, Bouchot A, Pezzella N, Gomez J, Le Moal H, Pinon JM. Signaling during the invasion of host cells by Toxoplasma gondii. FEMS Microbiol Rev. 1999;23(5):551-61. Zhang D, Jiang N, Chen Q. ROP9, MIC3, and SAG2 are heparin-binding proteins in Toxoplasma gondii and involved in host cell attachment and invasion. Acta Trop. 2019;192:22-29. Takemae H, Kobayashi K, Sugi T, Han Y, Gong H, Ishiwa A, Recuenco FC, Murakoshi F, Takano R, Murata Y, Nagamune K, Horimoto T, Akashi H, Kato K. Toxoplasma gondii RON4 binds to heparan sulfate on the host cell surface. Parasitol Int. 2018;67(2):123-130. Straub KW, Peng ED, Hajagos BE, Tyler JS, Bradley PJ. The moving junction protein RON8 facilitates firm attachment and host cell invasion in Toxoplasma gondii. PLoS Pathog. 2011;7(3): e1002007. Ng ST, Sanusi Jangi M, Shirley MW, Tomley FM, Wan KL. Comparative EST analyses provide insights into gene expression in two asexual developmental stages of Eimeria tenella. Exp Parasitol. 2002;101(2-3):168-73. Pratt EP, Owens JL, Hockerman GH, Hu CD. Bimolecular Fluorescence Complementation (BiFC) Analysis of Protein-Protein Interactions and Assessment of Subcellular Localization in Live Cells. Methods Mol Biol. 2016;1474:153-70. Blake DP, Tomley FM. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 2014;30(1):12-9. Lv L, Huang B, Zhao Q, Zhao Z, Dong H, Zhu S, Chen T, Yan M, Han H. Identification of an interaction between calcium-dependent protein kinase 4 (EtCDPK4) and serine protease inhibitor (EtSerpin) in Eimeria tenella. Parasit Vectors. 2018;11(1):259. Zhang Z, Zhou Z, Huang J, Sun X, Haseeb M, Ahmed S, Shah MAA, Yan R, Song X, Xu L, Li X. Molecular characterization of a potential receptor of Eimeria acervulina microneme protein 3 from chicken duodenal epithelial cells. Parasite. 2020;27:18. Zhang J, Chen P, Sun H, Liu Q, Wang L, Wang T, Shi W, Li H, Xiao Y, Wang P, Wang F, Zhao X. Pichia pastoris expressed EtMic2 protein as a potential vaccine against chicken coccidiosis. Vet Parasitol. 2014;205(1-2):62-9. Li J, Wang F, Ma C, Huang Y, Wang D, Ma D. Recombinant lactococcus lactis expressing Eimeria tenella AMA1 protein and its immunological effects against homologous challenge. Exp Parasitol. 2018;191:1-8. Zhao N, Lv J, Lu Y, Jiang Y, Li H, Liu Y, Zhang X, Zhao X. Prolonging and enhancing the protective efficacy of the EtMIC3-C-MAR against eimeria tenella through delivered by attenuated salmonella typhimurium. Vet Parasitol. 2020;279:109061. Konjufca V, Jenkins M, Wang S, Juarez-Rodriguez MD, Curtiss R 3rd. Immunogenicity of recombinant attenuated Salmonella enterica serovar Typhimurium vaccine strains carrying a gene that encodes Eimeria tenella antigen SO7. Infect Immun. 2008;76(12):5745-53. Carrero JC, Cervantes-Rebolledo C, Aguilar-Díaz H, Díaz-Gallardo MY, Laclette JP, Morales-Montor J. The role of the secretory immune response in the infection by Entamoeba histolytica. Parasite Immunol. 2007;29(7):331-8. Davis PJ, Porter P. A mechanism for secretory IgA-mediated inhibition of the cell penetration and intracellular development of Eimeria tenella. Immunology. 1979;36(3):471-7. Cite Share Download PDF Status: Published Journal Publication published 10 Jul, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5715652","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":402040086,"identity":"453ca888-aeed-4f47-86db-b4fa3bc2c6e4","order_by":0,"name":"Zengbao Wang","email":"","orcid":"","institution":"Shandong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zengbao","middleName":"","lastName":"Wang","suffix":""},{"id":402040087,"identity":"d29347c3-3f1b-4900-8791-735a14fe792e","order_by":1,"name":"Taifeng Li","email":"","orcid":"","institution":"The Affiliated Taian City Central Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Taifeng","middleName":"","lastName":"Li","suffix":""},{"id":402040088,"identity":"11b7b148-9b90-4806-a596-184bbc00f12c","order_by":2,"name":"Yingying Jiang","email":"","orcid":"","institution":"Shandong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingying","middleName":"","lastName":"Jiang","suffix":""},{"id":402040089,"identity":"6633f170-6d5b-4571-aad3-3ff614cd4dd7","order_by":3,"name":"Xue Wang","email":"","orcid":"","institution":"Shandong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Wang","suffix":""},{"id":402040090,"identity":"300e277b-c72b-4fdc-81f5-559f4bf64517","order_by":4,"name":"Hongmei Li","email":"","orcid":"","institution":"Shandong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongmei","middleName":"","lastName":"Li","suffix":""},{"id":402040091,"identity":"bc873101-1fa8-4dee-b5f4-2d3f76167afd","order_by":5,"name":"Xiaomin Zhao","email":"","orcid":"","institution":"Shandong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaomin","middleName":"","lastName":"Zhao","suffix":""},{"id":402040092,"identity":"15ae5f3f-0ab0-42ad-9e17-e42b8657320f","order_by":6,"name":"Xiao Zhang","email":"","orcid":"","institution":"Shandong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Zhang","suffix":""},{"id":402040093,"identity":"eadd198e-a97f-400e-b518-1b3463904133","order_by":7,"name":"Ningning Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYDACZhBhAMQSQPzBwMaONC2MMwrSkkmwDqiFmefDIcYGQgrN2XkPvy4ouGM3f3bzw8c2BgeYGdgPH92AT4tlM1+a9QyDZ8mNc44ZG+cY3OFj4ElLu4FPi8FhHjNjHoPDycwSCWbSOQbPmBkkeMyI08Imkf5N2sLgMGMDEVqMHwO12PFI5JhJMxCpxYwZqCVBQiKn2LDHIC2ZjaBfzp8x/szz57C9/Iz0jQ9+/LGx42c/fAyvFiBgA8V7YgOcS0A5CDB/ABL2RCgcBaNgFIyCkQoAN0tEdljR7KUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-4056-8488","institution":"Shandong Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Ningning","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2024-12-26 11:02:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5715652/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5715652/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13567-025-01532-w","type":"published","date":"2025-07-10T15:57:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":73987859,"identity":"5de1f042-9c38-4d93-8f0d-fd4875def230","added_by":"auto","created_at":"2025-01-16 16:22:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":692612,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEtSERPIN1expressed on the surface of sporozoite is involved in adhesion process\u003c/strong\u003e. (A) SDS-PAGE analysis of purified recombinant His-EtSERPIN1 protein (lane 1). EtSERPIN1 expressed in sporozoites of \u003cem\u003eE. tenella\u003c/em\u003e was detected by western blot using an anti-EtSERPIN1 pAb as the primary antibody (lane 2), with chicken cecum protein used as a control (lane 3). (B) Western blot analysis of whole sporozoite proteins and secreted sporozoite proteins, using anti-EtSERPIN1 pAb and anti-GAPDH pAb. GAPDH was used as a loading control. (C) Localization of EtSERPIN1 in \u003cem\u003eE. tenella\u003c/em\u003e sporozoites, merozoites and gametophytes by IFA, using anti-EtSERPIN1 pAb as primary antibody. (D) Inhibition of sporozoite invasion by anti-EtSERPIN1 pAb at various concentrations. (E) Surface expression of EtSERPIN1 on yeast cells was confirmed by IFA. (F) Adhesion rate of yeast cells displaying EtSERPIN1 to host cells. (G) Cecum tissues were incubated with or without His-EtSERPIN1 protein, and His-EtSERPIN1 was detected using an anti-His mAb as the primary antibody and FITC-conjugated goat anti-mouse antibody as the secondary antibody. The nucleus was stained with DAPI. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figures1.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/b528e1b01b7c6f594121d4f7.png"},{"id":73987866,"identity":"3f93e7f6-77ed-4d8a-b2e4-692cb23773d7","added_by":"auto","created_at":"2025-01-16 16:22:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":804381,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEtSERPIN1 interacts with GgANXA2.\u003c/strong\u003e (A) SDS-PAGE analysis of purified rGST-EtSERPIN1 protein. (B) SDS-PAGE identification of cecal membrane proteins interacting with rGST-EtSERPIN1. M: protein marker; Lane 1: GST-tag protein expressed in\u003cem\u003eE. coli\u003c/em\u003e BL21; Lane 2: GST-pulldown products of GST-tag; Lane 3: rGST-EtSERPIN1 expressed in E. coli BL21; Lane 4: GST-pulldown products of rGST-EtSERPIN1. (C) Yeast two-hybrid (GY2H) assay to test interactions between EtSERPIN1 and host proteins. p53 was used as a positive control. (D) SDS-PAGE analysis of purified rGST-GgANXA2 and rGST-GgANXA13 proteins. (E, F) GST pull-down assays to detect interactions between rHis-EtSERPIN1 and rGST-GgANXA2 (E) or rGST-GgANXA13 (F). The binding of rHis-EtSERPIN1 to GST-GgANXA2 or GST-GgANXA13 was confirmed by western blotting using anti-His monoclonal antibody (mAb) or anti-GST mAb.\u003c/p\u003e","description":"","filename":"Figures2.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/42184326362200bab6d60b77.png"},{"id":73987862,"identity":"f629e829-35c7-4679-8ce7-9e28d8adaa1e","added_by":"auto","created_at":"2025-01-16 16:22:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":210481,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRecombinant GgANXA2 protein bind to the surface of sporozoites.\u003c/strong\u003e \u003cem\u003eE. tenella\u003c/em\u003e sporozoites were incubated with rHis-GgANXA2 protein and subsequently analyzed by western blotting (A) and immunofluorescence assay (IFA) (B), using an anti-His mAb as the primary antibody.\u003c/p\u003e","description":"","filename":"Figures3.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/8dcce4a21202c59b9e9cece9.png"},{"id":73988652,"identity":"e653533d-fe7f-4fdc-8d4f-29a89234682d","added_by":"auto","created_at":"2025-01-16 16:30:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":437869,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRecombinant GgANXA2 protein and anti-GgANXA2 specific antibody inhibit EtSERPIN1 binding to host cell.\u003c/strong\u003e (A) Yeast cells displaying EtSERPIN1 were pre-incubated with recombinant GgANXA2 protein or PBS (control). The adhesion rate of yeast cells was then measured. (B) DF-1 cells were pre-treated with anti-ANXA2 pAb or IgG (control). Yeast cells displaying EtSERPIN1 or an empty plasmid were subsequently added to the cells, and the adhesion rate of yeast cells was calculated. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05. (C) Cecal tissues were pre-treated with anti-ANXA2 pAb. The samples were incubated with or without rHis-EtSERPIN1 protein, followed by detection of rHis-EtSERPIN1 using anti-His mAb as the primary antibody and FITC-conjugated goat anti-mouse antibody as the secondary antibody. Nuclei were stained with DAPI.\u003c/p\u003e","description":"","filename":"Figures4.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/c804d51458791874fe53cd5d.png"},{"id":73988653,"identity":"56b3e5c9-5253-4c4d-8616-0f7b8bd79669","added_by":"auto","created_at":"2025-01-16 16:30:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":290875,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRecombinant GgANXA2 protein and anti-GgANXA2 specific antibody inhibits sporozoites invasion in vitro and in vivo.\u003c/strong\u003e (A) Sporozoites of \u003cem\u003eE. tenella\u003c/em\u003e were incubated with rHis-GgANXA2 protein at different concentration. The invasion rate of sporozoites was then measured. (B) DF-1 cells were treated with anti-ANXA2 pAb at various concentrations, followed by infection with sporozoites, and the invasion rate was calculated. (C-E) \u003cem\u003eE. tenella \u003c/em\u003esporozoites were incubated with rHis-GgANXA2 protein, and then infected via the rectum. At 5 days post-infection (dpi), parasite load in the cecum was determined by qPCR (C), and lesion scores were recorded (D). The number of oocysts per gram of feces was counted from 7 dpi to 10 dpi. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figures5.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/fd9277a1964074835dc319e3.png"},{"id":73987870,"identity":"06aa6f9d-d258-4899-b319-1370a26279f6","added_by":"auto","created_at":"2025-01-16 16:22:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":152948,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUpregulation of GgANXA2 transcription following \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. tenella\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e infection. \u003c/strong\u003eThe mRNA levels of GgANXA2 in the duodenum, jejunum, ileum, and caecum of chickens were quantified by qPCR at 0, 12, and 24 hours post-infection (hpi). *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 indicates statistically significant differences.\u003c/p\u003e","description":"","filename":"Figures6.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/be3fd3678a9facee3d0c9dd4.png"},{"id":73987867,"identity":"f07e2eb4-32fb-4f4b-adff-a4b0407b72af","added_by":"auto","created_at":"2025-01-16 16:22:33","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":117707,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSerum IgG and cecal sIgA levels.\u003c/strong\u003e (A) The serum IgG antibody levels against EtSERPIN1 were measured seven days after the second immunization. (B) The cecal sIgA antibody levels against EtSERPIN1 were measured at 10 dpi. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 denotes statistically significant differences.\u003c/p\u003e","description":"","filename":"Figures7.png","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/9d0045af19d6a9ffa7fa5372.png"},{"id":86699437,"identity":"a443b2eb-9e16-4a38-ae14-5a584007c8d2","added_by":"auto","created_at":"2025-07-14 16:09:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4453362,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5715652/v1/f329b091-f26e-41af-8d66-3192de43a521.pdf"}],"financialInterests":"","formattedTitle":"EtSERPIN1 binding with chicken ANXA2 is essential for Eimeria tenella attachment and invasion process","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAvian coccidiosis, caused by intestinal infection with one or multiple \u003cem\u003eEimeria\u003c/em\u003e species, leads to great economic losses worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The current approach to controlling avian \u003cem\u003eEimeria\u003c/em\u003e primarily relies on the utilization of anti-coccidial drugs and live coccidia vaccines. However, the use of anticoccidial drugs is increasingly limited due to issues such as drug resistance, residues, regulatory restrictions and limitations during animal feeding [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Moreover, the elevated production cost, potential pathogenicity, and restricted production capacity of live \u003cem\u003eEimeria\u003c/em\u003e strains vaccination have hindered their widespread application in the poultry industry [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. A comprehensive understanding of coccidia-host interactions and molecular mechanisms will facilitate the development of novel control strategies.\u003c/p\u003e \u003cp\u003eThe initial step in establishing an infection by \u003cem\u003eEimeria\u003c/em\u003e spp. involves the invasion of host cells, which consists of four sequential processes: attachment, apical reorientation, formation of a moving junction, and establishment of a protective parasitophorous vacuole (PV). These invasion steps are facilitated by proteins secreted from organelles located at the apical end of the parasite [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. It is known that microneme proteins (MICs) have been identified as crucial players in parasite attachment progress [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], relying on an assortment of domains such as apple, microneme adhesive repeat regions (MARR), integrin-like A, lectin and epidermal growth factor (EGF)-like domains [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, knockout experiments targeting MICs only partially inhibit sporozoite invasion, indicating that other proteins may also be involved in parasite adhesion to host cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. One group of these proteins is serpin protease inhibitors (SERPINs), which have been reported to participate in the process of parasite adhesion and invasion [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSERPINs are members of a highly conserved superfamily of proteins that exhibit a well-preserved tertiary structure and have functional presence across various organisms, ranging from viruses to mammals [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. They function as potent inhibitors of serine proteases and play crucial roles in numerous fundamental biological processes, including blood coagulation, fibrinolysis, angiogenesis, programmed cell death, development, and inflammation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. \u003cem\u003eToxoplasma gondii\u003c/em\u003e SERPIN1 (TgPI) was initially identified in protozoan parasites [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Subsequently, several other SERPINs were discovered in \u003cem\u003eNeospora caninum\u003c/em\u003e, \u003cem\u003eEntamoeba histolytica\u003c/em\u003e, and \u003cem\u003eEimeria\u003c/em\u003e spp. [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In \u003cem\u003eEimeria\u003c/em\u003e spp., the presence of SERPINs has been confirmed in both \u003cem\u003eE. tenella\u003c/em\u003e and \u003cem\u003eEimeria acervulina\u003c/em\u003e through studies conducted by Jiang et al. [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and Fetterer et al. [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Since then, the involvement of SERPINs in \u003cem\u003eEimeria\u003c/em\u003e spp. cell invasion has been established. However, the precise role played by SERPINs during sporozoite invasion process remains unclear for \u003cem\u003eEimeria\u003c/em\u003e spp. Therefore, this study aims to identify membrane proteins interacting with \u003cem\u003eE. tenella\u003c/em\u003e SERPIN1 (EtSERPIN1) using pulldown assays coupled with mass spectrometry analysis to elucidate the molecular mechanism underlying sporozoites invasion mediated by EtSERPIN1.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlasmids, yeast, parasites, cells and animals\u003c/h2\u003e \u003cp\u003eThe pCTCON2 and \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e EYB100 stored in our laboratory were used for yeast surface display system and adhesion assay [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The wild type strain \u003cem\u003eE. tenella\u003c/em\u003e Shandong strain-01 (SD-01) was isolated and stored in our laboratory [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Chicken embryo fibroblast cell line (DF-1) cells stored in our laboratory were maintained in Dulbecco\u0026rsquo;s minimal essential medium (DMEM) (Gibco, new york, NY, USA) containing 10% fetal bovine serum (FBS) (Biological Industries, Israel) and 1% penicillin-streptomycin (Gibco, new york, NY, USA ) at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. All cells were confirmed to be negative for mycoplasma contamination using a mycoplasma detection kit (Cat# CA1080, Solarbio, Beijing, China).\u003c/p\u003e \u003cp\u003eBALB/c mice purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd were utilized for the production polyclonal antibodies (pAb) following previously described [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Coccidia-free 1-day old Hy-Line layer chicken were purchased from Dongyue Breeder Company (Tai\u0026rsquo;an, China). All animals were maintained under sterile conditions and provided with appropriate feed and water without the use of coccidiostats.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSubcellular localization of EtSERPIN1\u003c/h3\u003e\n\u003cp\u003eIndirect immunofluorescence assay (IFA) was performed according to the previously published protocol to determine the subcellular localization of EtSERPIN1 in \u003cem\u003eE. tenella\u003c/em\u003e [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Briefly, \u003cem\u003eE. tenella\u003c/em\u003e sporozoites, second-generation schizonts and gametophytes were fixed, permeabilized, and sequentially incubated with anti-EtSERPIN1 pAb and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG antibody (Solarbio, Beijing, China). Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) (Solarbio, Beijing, China). Images were visualized and acquired using fluorescence microscopy (Nikon-ECLIPSE; Japan).\u003c/p\u003e\n\u003ch3\u003eGlutathione S-transferase (GST) pull-down assay\u003c/h3\u003e\n\u003cp\u003ePreparation of membrane proteins from the chicken caecum epithelium: The cecal mucosa of healthy chickens was scraped and stored at -80\u0026deg;C. Membrane proteins from the chicken caecum epithelium were extracted using the Membrane Protein Extraction kit (Solarbio, Beijing, China), following the manufacturer's instructions.\u003c/p\u003e \u003cp\u003eThe GST pull-down assay was performed according to a previously described method [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Firstly, recombinant GST-tag EtSERPIN1 protein (rGST-EtSERPIN1) was expressed in BL21. Then, glutathione resins (Solarbio, Beijing, China) were separately incubated with rGST-EtSERPIN1 or GST-tag (control) at 4\u0026deg;C for 5 h. After three washes to remove non-resin bound proteins, the glutathione resins were mixed with membrane protein from the chicken caecum epithelium at 4\u0026deg;C for 2 h, followed by elution of the bait-prey mixture using elution buffer (10 mmol/L reduced glutathione, pH 8.0). Finally, the samples were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).\u003c/p\u003e\n\u003ch3\u003eMass spectrometry\u003c/h3\u003e\n\u003cp\u003eThe silver staining and mass spectrometry were performed following previously described methods [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Briefly, rGST-EtSERPIN1 and GST-tag interaction complexes were separated by SDS-PAGE and subjected to Fast stain silver kit according to the manufacturer's instructions (Beyotime, Shanghai, China). Subsequently, distinct protein bands between the rGST-EtSERPIN1 and GST-tag groups were excised from the gel, trypsin-digested, and analyzed using mass spectrometry (MS) based on a standardized protocol employing QSTAR XL instrument (Applied Biosystems, CA, USA). All experimental procedures were performed by BPI Genomics Company (Shenzhen, China).\u003c/p\u003e\n\u003ch3\u003eYeast two-hybrid verification test (Y2H)\u003c/h3\u003e\n\u003cp\u003eThe yeast two-hybrid verification assay was carried out according to previously described methods [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Briefly, the coding sequence (CDS) of EtSERPIN1 was cloned into the pGBKT7 plasmid to construct the bait plasmid (pGBKT7-EtSERPIN1). The CDS sequence of chicken annexin A (\u003cem\u003eANXA\u003c/em\u003e) genes, including GgANXA 2, 3, 5, and 13, were cloned into pGADT7 plasmid as potential prey. Subsequently, co-transformation of pGBKT7-EtSERPIN1 with either pGADT7-GgANXA2 or pGADT7-GgANXA3 or pGADT7-GgANXA5 or pGADT7-GgANXA13 into Y2H Gold strain was carried out using the Y2HGold-GAL4 Y2H interaction proving kit (Coolaber, Beijing, China). The interaction between the EtSERPIN1 and potential prey proteins was confirmed by the growth of co-transformants on DDO/X/A and QDO/X/A plate at 30\u0026deg;C for 3\u0026ndash;5 days. The positive control used was pGBKT7-p53.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eThe western blot assay was conducted according to previously described [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The isolated protein or GST pull-down samples were resolved on a 12% SDS-PAGE gel and subsequently transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore) for immunoblotting analysis using specific antibodies. The bound complexes were visualized using the NcmECL Ultra substrate (New Cell and Molecular Biotech, Suzhou, China) following the manufacturer's protocol.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAdhesion assay\u003c/h3\u003e\n\u003cp\u003eYeast surface display adhesion assay was performed according to the method described by Wang et al [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. For the adhesion assay, DF-1 cells were incubated with 100 yeast displayed EtSERPIN1 for 2 hours at 30\u0026deg;C. The cells were subsequently washed three times with PBS and plated on synthetic defined medium with casamino acids (SDCAA: 0.67% yeast extract, 2% glucose, 0.5% casein acid hydrolysate, 0.15% agar powder, and 10% ampicillin) containing 0.8% agar. After culturing for 24 hours, the adhesion rate was calculated as previously described [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Yeasts transfected with pCTCON2 plasmid were used as control. Adhesion inhibition assays were conducted using two methods: first, yeast cells displaying EtSERPIN1 were pre-incubated with different concentrations of recombinant His-tag GgANXA2 protein (rHis-GgANXA2) for one hour before being added to DF-1 cells for calculation of the adhesion rate; in the other, DF-1 cells cells were incubated with anti-ANXA2 pAb prior to addition of yeast-displayed EtSERPIN1 for calculating the adhesion rate. Then, yeast displayed EtSERPIN1 were added into DF-1 cells for adhesion rate calculation. Yeasts or DF-1 treated with an equivalent dose of PBS or healthy IgG served as controls. The experiment was repeated three times.\u003c/p\u003e\n\u003ch3\u003eBinding of GgANXA2 to chicken caecum\u003c/h3\u003e\n\u003cp\u003eThe ability of EtSERPIN1 to bind to chicken caecum was determined using immunohistochemical assay [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Briefly, the caecum was washed with sterile PBS, fixed with 4% paraformaldehyde and embedded in paraffin. Subsequently, the samples were boiled for 10 minutes in sodium citrate buffer (Servicebio, Wuhan, China), followed by blocking with tris-buffered saline and polysorbate 20 (TBST) containing 5% bovine serum albumin (BSA). Next, tissue sections were incubated sequentially with rHis-EtSERPIN1 or PBS (negative control) at 37\u0026deg;C for 1 h. Afterwards, the sections were incubated overnight at 4\u0026deg;C with anti-EtSERPIN1 pAb as a primary antibody and then treated with FITC-conjugated goat anti-mouse IgG as a secondary antibody at 37 ℃ for another hour. Nuclei were stained with DAPI (Solarbio, Beijing, China) for 5 min. For the binding inhibition assay, the sections were pre-treated with anti-ANXN2 pAb for 1 h at 37\u0026deg;C. Images were visualized and acquired using fluorescence microscopy (Nikon-ECLIPSE; Japan).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSporozoite invasion assay\u003c/h2\u003e \u003cp\u003eThe impact of GgANXA2 on sporozoite invasion of host cells was investigated using an in vitro and in vivo sporozoite invasion inhibition assay [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In the in vitro assay, sporozoites were incubated with varying doses of rHis-GgANXA2 (50, 100, 150 \u0026micro;g/mL) or DF-1 cells were blocked by anti-GgANXA2 pAb (0, 100, 200, 300 \u0026micro;g/mL) respectively at 37 ℃ for 2 h. After three washes with PBS, the pretreated sporozoites (2\u0026times;10\u003csup\u003e5\u003c/sup\u003e) were added to a 12-well plate containing DF-1 cells and unpretreated sporozoites were used to invade pretreated DF-1 cells. Following a 40 min incubation period, non-invaded sporozoites were harvested and counted. The inhibition rates were calculated as follows: (1-the number of unblocked sporozoites/the total sporozoites) \u0026times;100%. Sporozoites incubated with PBS or DF-1 incubated with the same dose of mouse IgG served as negative control. The experiment was conducted three times. For the in vivo assay, sporozoites pretreated by rHis-GgANXA2 or PBS were infected chicken by cloacal injection. The cecal lesion score and cecal parasite load were detected at 5 day post-infection (dpi) as described previously [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The oocyst output were counted at 7\u0026ndash;10 days post-infection (dpi) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eReverse transcription and quantitative real-time PCR (qPCR)\u003c/h2\u003e \u003cp\u003eThe chickens were orally infected with sporulated \u003cem\u003eE. tenella\u003c/em\u003e oocysts (2\u0026times;10\u003csup\u003e4\u003c/sup\u003e/chicken) for 0, 12, 24 h. Total RNA was isolated from the duodenum, jejunum, ileum, and caecum using an RNA purification Kit (Promega, Madison, WI, USA). Subsequently, reverse transcription of 1 \u0026micro;g RNA to cDNA was performed using M-MLV reverse transcriptase with RNase inhibitor. QPCR analysis was conducted in triplicate using RealStar Green Fast Mixture (A303; GenStar, Beijing, China) on an ABI Q5 instrument (ABI, Thermo Fisher Scientific Inc., MA, USA). Threshold cycle numbers were normalized to triplicate samples amplified with \u003cem\u003eGgGAPDH\u003c/em\u003e gene. The qPCR primers used for \u003cem\u003eGgANXA2\u003c/em\u003e and \u003cem\u003eGgGAPDH\u003c/em\u003e gene are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGgANXA2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGCCTGGGAACTGATGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCAGGGCAACCATTAGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGgGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCGCTATTCCTTATAAAGAAAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAACACTTTCTTTATAAGGAATAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eProtective effect of rHis-EtSERPIN1 on\u003c/b\u003e \u003cb\u003eE. tenella\u003c/b\u003e \u003cb\u003einfection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSeven-day-old chickens were randomly divided into three groups (n\u0026thinsp;=\u0026thinsp;35/group). The immune program was carried out as described previously [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In brief, chicken of EtSERPIN1 were immunized subcutaneously with purified rHis-EtSERPIN1 in Freund\u0026rsquo;s complete adjuvant (FCA; Sigma). Group PBS-I and PBS-II were immunized with PBS-FCA. At 7 days post-immunization, chickens were administered a booster immunization of rHis-EtSERPIN1 in Freund\u0026rsquo;s incomplete adjuvant (FIA; Sigma) or PBS-FIA respectively. At seven days after secondary immunization, all chickens, except for PBS-I group, were orally infected with \u003cem\u003eE. tenella\u003c/em\u003e sporulated oocysts (1\u0026times;10\u003csup\u003e4\u003c/sup\u003e per chicken).\u003c/p\u003e \u003cp\u003eThe protective efficacy was evaluated by calculated ACI based on the survival rate, weight gains, oocyst output and cecal lesion score. The body weight gains in each group were determined during 0 dpi to 10 dpi. Oocyst output was estimated by counting the oocysts per gram of feces during 7 dpi and 10 dpi. The cecal lesion score of chicken (n\u0026thinsp;=\u0026thinsp;8) were recorded at 5 dpi as described method previously. ACI of each group was evaluated as described previously [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSerum IgG and cecal sIgA level\u003c/h2\u003e \u003cp\u003eThe levels of serum IgG and cecal secretory IgA (sIgA) in each group of chickens (n\u0026thinsp;=\u0026thinsp;3) were determined using ELISA, following the protocol described previously [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Briefly, ELISA plates coated with recombinant His-EtSERPIN1 protein were used to quantify IgG in serum and sIgA in caeca. Horseradish peroxidase-conjugated rabbit anti-chicken IgG antibodies were employed as the secondary antibodies. All samples were analyzed in triplicate, and the optical density at 450 nm was measured using an automated microplate reader (Biotek, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eData statistical analysis\u003c/h2\u003e \u003cp\u003eThe independent experiments were conducted in triplicate, with three technical replicates for each experiment. All statistical analyses were performed using GraphPad Prism 9.0 software. Student's \u003cem\u003et\u003c/em\u003e-test was utilized to determine the significance of the results, and the data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. \u003cem\u003eP\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEtSERPIN1 expressed on the surface of sporozoites is involved in adhesion and invasion process\u003c/h2\u003e \u003cp\u003eIt has been previously reported that EtSERPIN1 is expressed in both sporozoites and schizogony stages [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, the expression of EtSERPIN1 during gametogony stage and its localization in sporozoites remain unclear. To clarify the expression and localization of EtSERPIN1, we expressed and purified rHis-EtSERPIN1 with a molecular weight of approximately 50 kDa (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, lane 1) to prepare anti-EtSERPIN1 polyclonal antibody (pAb). Anti-EtSERPIN1 pAb prepared in mice recognized two protein bands at around 42 kDa and 45 kDa (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, lane 2). Further investigation revealed a secreted protein band at around 42 kDa in sporozoite secretion proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), suggesting that native EtSERPIN1 may exist in two forms in \u003cem\u003eE. tenella\u003c/em\u003e, with the lower molecular weight form being a secreted protein lacking signal peptide and cytoplasmic domain. Using anti-EtSERPIN1 pAb, we determined the expression and localization of EtSERPIN1 during sporozoite invasion process as well as gametogony stage. Immunofluorescence results found that EtSERPIN1 has been labeled on the surface of sporozoites and expressed in the schizonts and gametogony stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). These results indicated that EtSERPIN1 is a membrane and secreted protein that expressed in the all stage of \u003cem\u003eE. tenella\u003c/em\u003e life stages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have demonstrated the inhibitory effect of anti-EtSERPIN1 antibody on sporozoite invasion, suggesting its involvement in the parasite invasion proces [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Our antibody inhibition test results also revealed that pretreatment with anti-EtSERPIN1 pAb effectively reduced the invasion ability of parasites in DF-1 cells in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). At a concentration of 300 \u0026micro;g/mL, anti-EtSERPIN1 pAb blocked 48.77% of sporozoites from invading DF-1 cells, which was significantly higher than the control (14.6% ) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Additionally, to elucidate the role of surface EtSERPIN1, we investigated its impact on sporozoite adhesion and invasion processes. The binding ability of EtSERPIN1 was assessed using yeast display system and immunohistochemical assays as described in Materials and Methods. Yeast expressing surface-bound EtSERPIN1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) exhibited significantly enhanced adhesion to DF-1 cells compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Immunohistochemistry confirmed specific binding between rHis-EtSERPIN1 and cecum tissue sections labeled with anti-EtSERPIN1 pAb (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), further supporting the adhesive function of EtSERPIN1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEtSERPIN1 interacts with GgANXA2\u003c/h2\u003e \u003cp\u003eTo identify the binding protein of EtSERPIN1 associated with adhesion and invasion processes, the membrane protein of chicken cecal epithelial cells interacting with EtSERPIN1 were screened and identified by GST pull-down and MS analysis. The recombinant EtSERPIN1 protein tagged with GST was successfully expressed and purified (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Differential protein bands were observed in the rGST-EtSERPIN1 pull-down mixture compared to the GST-tag control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). MS analysis revealed a total of 27 candidate host proteins potentially associated with EtSERPIN1. Subsequently, we predicted the sub-cellular localization of these 27 proteins using WoLF PSORT analysis (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genscript.com/tools/wolf-psort\u003c/span\u003e\u003cspan address=\"https://www.genscript.com/tools/wolf-psort\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and UniProt database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.uniprot.org\u003c/span\u003e\u003cspan address=\"https://www.uniprot.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), which identified four proteins located on the cell membrane, including GgANXA2/3/5/13. Considering that adhesion and invasion processes are mediated by interactions between parasite proteins and surface receptors on host cells, we selected these four membrane proteins as candidates for further identification studies.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo validate the interaction between EtSERPIN1and four membrane proteins, a point-to-point Y2H assay was performed. Yeast cells transformed with pGBKT7-EtSERPIN1 and either pGADT7-GgANXA2 or pGADT7-GgANXA13 displayed blue colonies on DDO/X/A and QDO/X/A media, while those transformed with GgANXA3 or GgANXA5 constructs did not exhibit any color change (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), indicating potential interactions between EtSERPIN1 and GgANXA2/GgANXA13. Additionally, a GST pull-down assay was conducted to confirm direct interactions between EtSERPIN1 and GgANXA2/GgANXA13. rGST-GgANXA2 and rGST-GgANXA13 protein were expressed and purified successfully (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The results from the GST pull-down experiment demonstrated that His-EtSERPIN1 could be pulled down by rGST-GgANXA2 but not by the negative control containing only GST tag (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). However, no interaction between rHis-EtSERPIN1 was observed in the eluate obtained from the rGST-GgANX13 pull-down experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). These findings provide evidence for an interaction between EtSERPIN1 and GgANXA2, a chicken membrane protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eRecombinant GgANXA2 protein binds to sporozoites\u003c/h2\u003e \u003cp\u003eTo further validate the interaction between EtSERPIN1 and GgANXA2, we initially incubated sporozoites with rHis-GgANXA2 protein and employed western blot to assess the binding affinity of rHis-GgANXA2 protein towards sporozoites. The western blot analysis revealed detectable levels of rHis-GgANXA2 in sporozoites incubated with rHis-GgANXA2, while no signal was observed in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Additionally, IFA using anti-His monoclonal antibody (mAb) demonstrated surface localization of sporozoites incubated with rHis-GgANXA2 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These findings provide compelling evidence that GgANXA2 effectively interacts with the surface of sporozoites, thereby confirming its association with EtSERPIN1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eRecombinant GgANXA2 protein and GgANXA2-specific antibody inhibited EtSERPIN1 binding to host cells\u003c/h2\u003e \u003cp\u003eTo further elucidate the role of GgANXA2 in EtSERPIN1-mediated adhesion to host cells, we conducted an attachment assay using the yeast surface display model. The adhesion rate of yeast cells displaying EtSERPIN1 was significantly reduced in the presence of recombinant GgANAX2 proteins (44.32%) compared to the PBS group (26.75%) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). We performed cell blocking with anti-ANAX2 antibody and assessed its impact on EtSERPIN1 adhesion. Pre-blocking cells with anti-ANXA2 antibody resulted in a significantly lower adhesion rate compared to incubation with IgG alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Consistent with these findings, anti-ANAX2 antibody effectively inhibited the binding of rHis-EtSERPIN1 to cecum tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These results suggest that GgANXA2 may be essential for mediating EtSERPIN1's adherence to host cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRecombinant GgANXA2 inhibited sporozoites invasion\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand in\u003c/b\u003e \u003cb\u003evivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFurthermore, we investigated the impact of GgANXA2 recombinant protein and anti-ANAX2 antibody on sporozoite invasion both in vitro and in vivo. The findings demonstrated that incubation with recombinant GgANXA2 protein or cell blocking using anti-ANXA2 antibodies significantly reduced the invasion rate of sporozoites in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B). These results indicate that both GgANXA2 protein and anti-ANXN2 antibodies blockade effectively inhibit the invasion of sporozoites into host cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn vivo experiments evaluated the effect of GgANXN2 recombinant protein on sporozoite infection, including cecal load, cecal lesions, and fecal oocyst excretion. Compared to the control group, there was a significant reduction in \u003cem\u003eE. tenella\u003c/em\u003e parasite load within the cecum (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) as well as oocyst excretion following sporozoites incubated with recombinant GgANXA2 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). In vivo, Additionally, at 5 days post-infection (dpi), cecal lesion scores were significantly lower in the GgANXA2 protein incubation group compared to those observed in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These findings suggest that GgANXA2 protein blockade possesses inhibitory potential against sporozoite infection.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe expression of GgANXA2 in the cecum is regulated by\u003c/b\u003e \u003cb\u003eE. tenella\u003c/b\u003e \u003cb\u003einfection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFurther, we examined the transcriptional levels of GgANXA2 in duodenum, jejunum, ileum and caecum during \u003cem\u003eE. tenella\u003c/em\u003e infection. The results of qPCR revealed no significant difference in GgANXA2 transcriptional levels between the duodenum, jejunum, and ileum at 12 hours post-infection (hpi). However, there was a significant increase in GgANXA2 expression in the cecum compared to 0 hpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These findings suggest a positive association between cecal ANXA2 transcription and sporozoite invasion.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRecombinant EtSERPIN1 immunization induced higher anti-\u003c/b\u003e \u003cb\u003eE. tenella\u003c/b\u003e \u003cb\u003eactivity\u003c/b\u003e\u003c/p\u003e \u003cp\u003eConsidering the involvement of EtSERPIN1 in the adhesion and invasion process of \u003cem\u003eE. tenella\u003c/em\u003e, we postulated that antibodies induced by EtSERPIN1 possess anti-\u003cem\u003eE. tenella\u003c/em\u003e activity. Subsequently, we evaluated the anti-\u003cem\u003eE. tenella\u003c/em\u003e activity elicited by immunization with rHis-EtSERPIN1 protein through assessments of survival rate, body weight, cecal lesions, and oocyst count. Throughout the experiment, no deaths occurred due to \u003cem\u003eE. tenella\u003c/em\u003e infection in any group, resulting in a 100% survival rate. Remarkably increased relative weight gain was observed in chickens immunized with rHis-EtSERPIN1 protein compared to those in the control group (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Additionally, chickens receiving rHis-EtSERPIN1 protein exhibited significantly lower cecal lesion scores than those in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Moreover, oocyst shedding was significantly reduced in chickens immunized with EtSERPIN1 compared to PBS controls. Finally, ACI calculation results revealed an anti-\u003cem\u003eE. tenella\u003c/em\u003e index of 170.14 for rHis-EtSERPIN1 protein (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Collectively, these findings demonstrate that immunization with recombinant EtSERPIN1 protein induces a moderate level of anti-\u003cem\u003eE.tenella\u003c/em\u003e activity in chickens and supports its candidacy as an antigen.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eProtective effect of the recombinant EtSERPIN1 against \u003cem\u003eE. tenella\u003c/em\u003e infection in chicken\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAverage body\u003c/p\u003e \u003cp\u003eweight gain (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOocyst shedding (\u0026times;10\u003csup\u003e5\u003c/sup\u003e/g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLesion score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eACI\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePBS-I\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e167.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.85\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePBSII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e95.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.33\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e81.99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEtSERPIN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e157.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.95\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e170.14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eValues with different letters in same column are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Excellent activity: ACI\u0026thinsp;\u0026gt;\u0026thinsp;180; moderate activity: 179\u0026thinsp;\u0026gt;\u0026thinsp;ACI\u0026thinsp;\u0026gt;\u0026thinsp;160; limited activity: 159\u0026thinsp;\u0026gt;\u0026thinsp;ACI\u0026thinsp;\u0026gt;\u0026thinsp;120; nonactivity: ACI\u0026thinsp;\u0026lt;\u0026thinsp;120.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eRecombinant EtSERPIN1 induced high levels of IgG and sIgA\u003c/h2\u003e \u003cp\u003eTo assess the capacity of EtSERPIN1 to elicit humoral immunity, we measured the serum IgG and cecal secretory IgA (sIgA) levels specific to EtSERPIN1 seven days post the second immunization. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, the EtSERPIN1-immunized group exhibited significantly elevated levels of IgG in serum (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) and sIgA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB) in the cecum. These findings indicate that EtSERPIN1 possesses the ability to stimulate both humoral and mucosal immune responses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eChick \u003cem\u003eEimeria\u003c/em\u003e spp. encompasses various developmental stages, including developmental stages such as sporogenesis, schizogony and gametogenesis, with gene expression in each stage typically associated with their respective functions. Previous studies have reported the expression of EtSEPRIN1 in oocysts, sporozoites, and merozoites [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]; however, its expression during the gamete stage remains unknown. In this study, indirect immunofluorescence assay revealed that EtSERPIN1 is also expressed during gamete development, indicating its continuous expression throughout the developmental history of \u003cem\u003eE. tenella\u003c/em\u003e and suggesting potential multifunctionality for EtSERPIN1. Bioinformatics analysis further identified a signal peptide and transmembrane domain in EtSERPIN1 protein sequence, implying its classification as a membrane protein [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Additionally, our findings demonstrated the localization of EtSERPIN1 on the sporozoite membrane which aligns with theoretical predictions and provides insights into its role in adhesion invasion.\u003c/p\u003e \u003cp\u003eThe coding sequence of EtSERPIN1 produces a protein of approximately 45 kDa [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, the anti-EtSERPIN1 antibody detected two protein bands with different molecular weights in sporozoite whole proteins, consistent with previous findings on \u003cem\u003eT. gondii\u003c/em\u003e SERPIN [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Previous evidence suggests that \u003cem\u003eT. gondii\u003c/em\u003e secretes SERPIN into host cells to prevent protease degradation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Based on this, we hypothesize that immature EtSERPIN1 exists in the parasite cytoplasm as a large band without protease inhibitory activity, while mature and cleaved EtSERPIN1 is secreted extracellularly to perform its function, resulting in smaller molecular weight. Fetterer et al. reported detection of EtSERPIN1 in host cells after sporozoite infection, and our study showed expression of surface-bound and secretory properties for EtSERPIN1 on \u003cem\u003eE. tenella\u003c/em\u003e sporozoites [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], suggesting potential for protease inhibition by externally-secreted or cell-surface bound EtSERPIN1.\u003c/p\u003e \u003cp\u003eThe invasion process of \u003cem\u003eE. tenella\u003c/em\u003e, a highly pathogenic parasite that causes significant economic losses to the poultry industry, is complex and involves multiple proteins [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The role of secretory proteins, particularly in the early stages of invasion, has garnered considerable attention due to their potential to facilitate parasite entry into host cells. Previous studies have reported crucial roles played by rhoptry proteins and microneme proteins in the invasion process of apicomplexan protozoan parasites [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Among these, microneme proteins (MIC) are primarily involved in the adhesion process of sporozoites to host cells, such as MIC2, MIC3 and MIC8, etc [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The rod-neck protein forms a moving junction with apical membrane antigen (AMA1), mediating the invasion process of the parasite including rhoptry neck protein 2, 4,5, and 8 (RON2/4/5/8) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, our understanding of sporozoite invasion processes in \u003cem\u003eEimeria\u003c/em\u003e spp remains extremely limited. A previous study demonstrated higher expression levels of EtSERPIN1 in sporozoites compared to other developmental stages [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Subsequent studies found that EtSERPIN1 was expressed at the apical end during sporozoite invasion [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and and anti-EtSERPIN1 antibodies were shown to block sporozoite invasion process [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In our study, we also observed that anti-EtSERPIN1 antibodies reduced the rate of sporozoite invasion in a dose-dependent manner. Furthermore, we investigated the role of EtSERPIN1 for sporozoite invasion using immunohistochemistry and yeast surface display system [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Our results revealed that EtSERPIN1 significantly enhanced yeast adhesion to host cells and recombinant EtSERPIN1 protein exhibited adhesive properties towards cecum tissue. The findings of this study suggest that EtSERPIN1 may play a crucial role in the invasion of sporozoites by facilitating their adhesion to host cells.\u003c/p\u003e \u003cp\u003eProtein-protein interactions are indispensable for the proper functioning of proteins [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Investigating the precise functions of invasion-related molecules in \u003cem\u003eE. tenella\u003c/em\u003e and identifying their interacting partners would be a significant breakthrough in understanding the functional mechanisms of parasites and discovering novel antigen targets [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Recently, several studies have been conducted on invasion related molecules of \u003cem\u003eEimeria\u003c/em\u003e spp, such as EtMIC8, EtCab, and EtCDPK4, play a crucial role in the process of sporozoite invasion into the host cell [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, the investigation of adhesion and invasion receptors associated with host epithelial cells remains limited. Zhang et al. [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] reported that \u003cem\u003eE. acervulina\u003c/em\u003e microneme 3 protein (EaMIC3) specifically binds to chicken ubiquitin-binding enzyme E2F (UBE2F), thereby mediating the invasion process. Sun et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] discovered that the interaction between EtMIC8-EGF and chicken epithelial cell adhesion molecule (GgEPCAM) is essential for attachment and invasion of \u003cem\u003eE. tenella\u003c/em\u003e sporozoites [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Our study, in conjunction with previous reports, has confirmed the involvement of EtSERPIN1 in sporozoite invasion process [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. To elucidate the specific mechanism by which EtSERPIN1 mediates adhesion, we identified membrane proteins that interact with EtSERPIN1 through mass spectrometry, yeast two-hybrid assays, and pull-down experiments. These analyses confirmed an interaction between EtSERPIN1 and GgANXN2. Furthermore, subsequent experiments demonstrated that both recombinant GgANXN2 protein blockade and anti-GgANXA2 antibody inhibition could impede the adhesive role of EtSERPIN1 as well as sporozoite invasion process, thus confirming a certain role played by EtSERPIN1-GgANXN2 interaction during sporozoite development.\u003c/p\u003e \u003cp\u003eAdhesion and invasion are crucial steps in establishing infection by apicomplexan protozoa. Therefore, host-produced antibodies against these processes can block sporozoite invasion and reduce infection rates. For instance, apical membrane antigen (AMA1) and rhoptry neck protein 4 (RON4) of \u003cem\u003eNeospora Canis\u003c/em\u003e induce high titers of antibodies against neosporosis, while \u003cem\u003eEimeria\u003c/em\u003e spp's MIC2, AMA1, MIC3, and MIC8 proteins elicit moderate to excellent anti-coccidia activity [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, recombinant EtSERPIN1 protein demonstrated high immunogenicity and protective efficacy as evidenced by increased body weight gains along with significantly lower fecal oocyst shedding levels and lesion scores. Consistent with these results were the increases in serum IgG levels and cecal mucosa sIgA antibody levels following immunization with recombinant EtSERPIN1 protein. Mucosal immunity is the first line of defense against infections; sIgA plays a critical role in defending against intestinal parasites challenge [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Davis and Porter [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] found that anti-\u003cem\u003eE. tenella\u003c/em\u003e sIgA present in cecal contents could disrupt parasite development highlighting the importance of mucosal immunity to \u003cem\u003eE. tenella\u003c/em\u003e infection in chickens. Thus high titers of anti-EtSERPIN1-specific sIgA antibodies contribute to resistance to \u003cem\u003eE. tenella\u003c/em\u003e infection.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our study reveals that EtSERPIN1, a protease inhibitor in\u0026nbsp;\u003cem\u003eE. tenella\u003c/em\u003e, interacts with host cell membrane protein GgANXA2, playing a crucial role in sporozoite adhesion and invasion. Recombinant GgANXA2 inhibits EtSERPIN1 binding and sporozoite invasion, while EtSERPIN1 immunization exhibits anti-\u003cem\u003eE. tenella\u003c/em\u003e activity. These findings suggest that targeting the EtSERPIN1-GgANXA2 interaction may offer a novel therapeutic approach for\u0026nbsp;\u003cem\u003eE. tenella\u003c/em\u003e treatment. Further studies are needed to elucidate the underlying mechanisms and explore potential applications.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe work was mainly conceived and designed by NZ, XZ, and XZ; YJ and ZW performed the experiments; XW, HL and TL collected and analyzed the experimental data. The manuscript was mainly written by ZW and NZ. The manuscript was revised by NZ. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grants from the National Natural Science Foundation of China (grant no. 32402917) and the Science and Technology Project of Tibet Autonomous Region (grant no. QYXTZX-RKZ2024-03-3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data from this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol and all animal studies were approved by the Shandong Agricultural University Animal Care and Use Committee (SDAU-2024-015). Experiments were carried out in accordance with the approved guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLiu Q, Liu X, Zhao X, Zhu XQ, Suo X. Live attenuated anticoccidial vaccines for chickens. Trends Parasitol. 2023;39(12):1087-1099.\u003c/li\u003e\n\u003cli\u003eClark EL, Tomley FM, Blake DP. Are Eimeria Genetically Diverse, and Does It Matter? Trends Parasitol. 2017;33(3):231-241.\u003c/li\u003e\n\u003cli\u003eClarke L, Fodey TL, Crooks SR, Moloney M, O\u0026apos;Mahony J, Delahaut P, O\u0026apos;Kennedy R, Danaher M. A review of coccidiostats and the analysis of their residues in meat and other food. Meat Sci. 2014;97(3):358-74.\u003c/li\u003e\n\u003cli\u003eWitcombe DM, Smith NC. Strategies for anti-coccidial prophylaxis. Parasitology. 2014;141(11):1379-89.\u003c/li\u003e\n\u003cli\u003eAikawa M, Miller LH, Johnson J, Rabbege J. Erythrocyte entry by malarial parasites. A moving junction between erythrocyte and parasite. J Cell Biol. 1978;77(1):72-82\u003c/li\u003e\n\u003cli\u003eVenugopal K, Marion S. Secretory organelle trafficking in Toxoplasma gondii: A long story for a short travel. Int J Med Microbiol. 2018;308(7):751-760.\u003c/li\u003e\n\u003cli\u003eArredondo SA, Schepis A, Reynolds L, Kappe SHI. Secretory Organelle Function in the Plasmodium Sporozoite. Trends Parasitol. 2021;37(7):651-663\u003c/li\u003e\n\u003cli\u003eBlumenschein TM, Friedrich N, Childs RA, Saouros S, Carpenter EP, Campanero-Rhodes MA, Simpson P, Chai W, Koutroukides T, Blackman MJ, Feizi T, Soldati-Favre D, Matthews S. Atomic resolution insight into host cell recognition by Toxoplasma gondii. EMBO J. 2007;26(11):2808-20.\u003c/li\u003e\n\u003cli\u003eBrecht S, Carruthers VB, Ferguson DJ, Giddings OK, Wang G, Jakle U, Harper JM, Sibley LD, Soldati D. The toxoplasma micronemal protein MIC4 is an adhesin composed of six conserved apple domains. J Biol Chem. 2001;276(6):4119-27.\u003c/li\u003e\n\u003cli\u003eSoldati D, Dubremetz JF, Lebrun M. Microneme proteins: structural and functional requirements to promote adhesion and invasion by the apicomplexan parasite Toxoplasma gondii. Int J Parasitol. 2001;31(12):1293-302.\u003c/li\u003e\n\u003cli\u003eZhao N, Ming S, Sun L, Wang B, Li H, Zhang X, Zhao X. Identification and Characterization of Eimeria tenella Microneme Protein (EtMIC8). Microbiol Spectr. 2021;9(1): e0022821.\u003c/li\u003e\n\u003cli\u003eHuynh MH, Carruthers VB. Toxoplasma MIC2 is a major determinant of invasion and virulence. PLoS Pathog. 2006;2(8): e84.\u003c/li\u003e\n\u003cli\u003eCarruthers VB, Tomley FM. Microneme proteins in apicomplexans. Subcell Biochem. 2008;47:33-45.\u003c/li\u003e\n\u003cli\u003eJiang L, Lin J, Han H, Zhao Q, Dong H, Zhu S, Huang B. Identification and partial characterization of a serine protease inhibitor (serpin) of Eimeria tenella. Parasitol Res. 2012;110(2):865-74.\u003c/li\u003e\n\u003cli\u003eFetterer RH, Miska KB, Jenkins MC, Barfield RC, Lillehoj H. Identification and characterization of a serpin from Eimeria acervulina. J Parasitol. 2008;94(6):1269-74.\u003c/li\u003e\n\u003cli\u003eLaskowski M Jr, Kato I. Protein inhibitors of proteinases. Annu Rev Biochem. 1980;49:593-626.\u003c/li\u003e\n\u003cli\u003evan Gent D, Sharp P, Morgan K, Kalsheker N. Serpins: structure, function and molecular evolution. Int J Biochem Cell Biol. 2003;35(11):1536-47.\u003c/li\u003e\n\u003cli\u003eBruno S, Duschak VG, Ledesma B, Ferella M, Andersson B, Guarnera EA, Angel SO. Identification and characterization of serine proteinase inhibitors from Neospora caninum. Mol Biochem Parasitol. 2004;136(1):101-7.\u003c/li\u003e\n\u003cli\u003ePszenny V, Angel SO, Duschak VG, Paulino M, Ledesma B, Yabo MI, Guarnera E, Ruiz AM, Bontempi EJ. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol Biochem Parasitol. 2000;107(2):241-9.\u003c/li\u003e\n\u003cli\u003eRiahi Y, Siman-Tov R, Ankri S. Molecular cloning, expression and characterization of a serine proteinase inhibitor gene from Entamoeba histolytica. Mol Biochem Parasitol. 2004;133(2):153-62.\u003c/li\u003e\n\u003cli\u003eLiu Q, Chen Z, Shi W, Sun H, Zhang J, Li H, Xiao Y, Wang F, Zhao X. Preparation and initial application of monoclonal antibodies that recognize Eimeria tenella microneme proteins 1 and 2. Parasitol Res. 2014;113(11):4151-61.\u003c/li\u003e\n\u003cli\u003eSun L, Li C, Zhao N, Wang B, Li H, Wang H, Zhang X, Zhao X. Host protein EPCAM interacting with EtMIC8-EGF is essential for attachment and invasion of Eimeria tenella in chickens. Microb Pathog. 2024;188:106549.\u003c/li\u003e\n\u003cli\u003eLi J, Xiao Q, Tan Q, Chen J, Sun L, Chen X, Chu Z, Wu H, Zhang Z, Li H, Zhao X, Zhang X. TgMORN2, a MORN Family Protein Involved in the Regulation of Endoplasmic Reticulum Stress in Toxoplasma gondii. Int J Mol Sci. 2023;24(12):10228.\u003c/li\u003e\n\u003cli\u003eZhao N, Wang F, Kong Z, Shang Y. Pseudorabies Virus Tegument Protein UL13 Suppresses RLR-Mediated Antiviral Innate Immunity through Regulating Receptor Transcription. Viruses. 2022;14(7):1465.\u003c/li\u003e\n\u003cli\u003eWang Y, Zhou X, Wang H, Sun L, Wang B, Jiang Y, Li H, Zhang X, Li H, Zhao X. The role of Eimeria tenella EtCab protein in the attachment and invasion of host cells. Vet Parasitol. 2021;292:109415.\u003c/li\u003e\n\u003cli\u003eLi W, Wang M, Chen Y, Chen C, Liu X, Sun X, Jing C, Xu L, Yan R, Li X, Song X. EtMIC3 and its receptors BAG1 and ENDOUL are essential for site-specific invasion of Eimeria tenella in chickens. Vet Res. 2020;51(1):90.\u003c/li\u003e\n\u003cli\u003eJohnson J, Reid WM. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 1970;28(1):30-6.\u003c/li\u003e\n\u003cli\u003eSong X, Li Y, Chen S, Jia R, Huang Y, Zou Y, Li L, Zhao X, Yin Z. Anticoccidial Effect of Herbal Powder \u0026quot;Shi Ying Zi\u0026quot; in Chickens Infected with Eimeria tenella. Animals (Basel). 2020;10(9):1484.\u003c/li\u003e\n\u003cli\u003eChen Z, Wang X, Zhao N, Han L, Wang F, Li H, Cui Y, Zhao X. Improving the immunogenicity and protective efficacy of the EtMIC2 protein against Eimeria tenella infection through random mutagenesis. Vaccine. 2018;36(18):2435-2441.\u003c/li\u003e\n\u003cli\u003eZhang Y, Lai BS, Juhas M, Zhang Y. Toxoplasma gondii secretory proteins and their role in invasion and pathogenesis. Microbiol Res. 2019;227:126293.\u003c/li\u003e\n\u003cli\u003eSparvoli D, Delabre J, Penarete-Vargas DM, Kumar Mageswaran S, Tsypin LM, Heckendorn J, Theveny L, Maynadier M, Mendon\u0026ccedil;a Cova M, Berry-Sterkers L, Gu\u0026eacute;rin A, Dubremetz JF, Urbach S, Striepen B, Turkewitz AP, Chang YW, Lebrun M. An apical membrane complex for triggering rhoptry exocytosis and invasion in Toxoplasma. EMBO J. 2022;41(22): e111158.\u003c/li\u003e\n\u003cli\u003eBonhomme A, Bouchot A, Pezzella N, Gomez J, Le Moal H, Pinon JM. Signaling during the invasion of host cells by Toxoplasma gondii. FEMS Microbiol Rev. 1999;23(5):551-61.\u003c/li\u003e\n\u003cli\u003eZhang D, Jiang N, Chen Q. ROP9, MIC3, and SAG2 are heparin-binding proteins in Toxoplasma gondii and involved in host cell attachment and invasion. Acta Trop. 2019;192:22-29.\u003c/li\u003e\n\u003cli\u003eTakemae H, Kobayashi K, Sugi T, Han Y, Gong H, Ishiwa A, Recuenco FC, Murakoshi F, Takano R, Murata Y, Nagamune K, Horimoto T, Akashi H, Kato K. Toxoplasma gondii RON4 binds to heparan sulfate on the host cell surface. Parasitol Int. 2018;67(2):123-130.\u003c/li\u003e\n\u003cli\u003eStraub KW, Peng ED, Hajagos BE, Tyler JS, Bradley PJ. The moving junction protein RON8 facilitates firm attachment and host cell invasion in Toxoplasma gondii. PLoS Pathog. 2011;7(3): e1002007.\u003c/li\u003e\n\u003cli\u003eNg ST, Sanusi Jangi M, Shirley MW, Tomley FM, Wan KL. Comparative EST analyses provide insights into gene expression in two asexual developmental stages of Eimeria tenella. Exp Parasitol. 2002;101(2-3):168-73.\u003c/li\u003e\n\u003cli\u003ePratt EP, Owens JL, Hockerman GH, Hu CD. Bimolecular Fluorescence Complementation (BiFC) Analysis of Protein-Protein Interactions and Assessment of Subcellular Localization in Live Cells. Methods Mol Biol. 2016;1474:153-70.\u003c/li\u003e\n\u003cli\u003eBlake DP, Tomley FM. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 2014;30(1):12-9.\u003c/li\u003e\n\u003cli\u003eLv L, Huang B, Zhao Q, Zhao Z, Dong H, Zhu S, Chen T, Yan M, Han H. Identification of an interaction between calcium-dependent protein kinase 4 (EtCDPK4) and serine protease inhibitor (EtSerpin) in Eimeria tenella. Parasit Vectors. 2018;11(1):259.\u003c/li\u003e\n\u003cli\u003eZhang Z, Zhou Z, Huang J, Sun X, Haseeb M, Ahmed S, Shah MAA, Yan R, Song X, Xu L, Li X. Molecular characterization of a potential receptor of Eimeria acervulina microneme protein 3 from chicken duodenal epithelial cells. Parasite. 2020;27:18. \u003c/li\u003e\n\u003cli\u003eZhang J, Chen P, Sun H, Liu Q, Wang L, Wang T, Shi W, Li H, Xiao Y, Wang P, Wang F, Zhao X. Pichia pastoris expressed EtMic2 protein as a potential vaccine against chicken coccidiosis. Vet Parasitol. 2014;205(1-2):62-9. \u003c/li\u003e\n\u003cli\u003eLi J, Wang F, Ma C, Huang Y, Wang D, Ma D. Recombinant lactococcus lactis expressing Eimeria tenella AMA1 protein and its immunological effects against homologous challenge. Exp Parasitol. 2018;191:1-8.\u003c/li\u003e\n\u003cli\u003eZhao N, Lv J, Lu Y, Jiang Y, Li H, Liu Y, Zhang X, Zhao X. Prolonging and enhancing the protective efficacy of the EtMIC3-C-MAR against eimeria tenella through delivered by attenuated salmonella typhimurium. Vet Parasitol. 2020;279:109061. \u003c/li\u003e\n\u003cli\u003eKonjufca V, Jenkins M, Wang S, Juarez-Rodriguez MD, Curtiss R 3rd. Immunogenicity of recombinant attenuated Salmonella enterica serovar Typhimurium vaccine strains carrying a gene that encodes Eimeria tenella antigen SO7. Infect Immun. 2008;76(12):5745-53.\u003c/li\u003e\n\u003cli\u003eCarrero JC, Cervantes-Rebolledo C, Aguilar-D\u0026iacute;az H, D\u0026iacute;az-Gallardo MY, Laclette JP, Morales-Montor J. The role of the secretory immune response in the infection by Entamoeba histolytica. Parasite Immunol. 2007;29(7):331-8.\u003c/li\u003e\n\u003cli\u003eDavis PJ, Porter P. A mechanism for secretory IgA-mediated inhibition of the cell penetration and intracellular development of Eimeria tenella. Immunology. 1979;36(3):471-7. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Eimeria tenella, EtSERPIN1, GgANXA2, Adhesion, Invasion","lastPublishedDoi":"10.21203/rs.3.rs-5715652/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5715652/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSerpin protease inhibitors (SERPINs) in protozoa play crucial roles in various biological processes, including the invasion of host cells. However, the precise roles and molecular mechanisms underlying SERPIN-mediated invasion of parasite remain poorly understand. In this study, we provide evidence that surface-expressed \u003cem\u003eEimeria tenella \u003c/em\u003eSERPIN1 (EtSERPIN1) on sporozoites is involved in adhesion and invasion processes. To elucidate the molecular target responsible for mediating EtSERPIN1-induced invasion, we utilized GST pull-down and yeast two-hybrid verification to screen and identify host cell membrane proteins interacting with EtSERPIN1. Our findings revealed an interaction between EtSERPIN1 and a membrane protein called annexin A2 (ANXA2). Recombinant GgANXA2 was able to bind to the sporozoite surface. Furthermore, treatment with GgANXA2-specific antibody or recombinant GgANXA2 protein resulted in a dose-dependent inhibition of EtSERPIN1 binding to host cells as well as sporozoite invasion. These results suggest that EtSERPIN1 and GgANXA2 interaction plays a critical role in both adhesion and invasion processes of \u003cem\u003eE. tenella\u003c/em\u003e sporozoites. Finally, we investigated the impact of recombinant GgANXA2 and EtSERPIN1 proteins on \u003cem\u003eE. tenella\u003c/em\u003einfection. Our results demonstrated that incubation with GgANXA2 protein significantly attenuated sporozoite infectivity, as evidenced by a significantly reduction in parasite burden within the chicken cecum. Immunization with recombinant EtSERPIN1 exhibited potent anti-\u003cem\u003eE. tenella\u003c/em\u003e activity, with higher body weight gains, lower cecal lesions and oocyst output, as well as elevated levels of cecal mucosa antibodies. These findings suggest that targeting GgANXA2 through EtSERPIN1 mediates adhesion and invasion processes of \u003cem\u003eE. tenella\u003c/em\u003e, highlighting its potential as a novel therapeutic target.\u003c/p\u003e","manuscriptTitle":"EtSERPIN1 binding with chicken ANXA2 is essential for Eimeria tenella attachment and invasion process","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-16 16:22:28","doi":"10.21203/rs.3.rs-5715652/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b4158b0e-4697-4b2f-bea7-2660472aeee2","owner":[],"postedDate":"January 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-07-14T16:03:25+00:00","versionOfRecord":{"articleIdentity":"rs-5715652","link":"https://doi.org/10.1186/s13567-025-01532-w","journal":{"identity":"veterinary-research","isVorOnly":false,"title":"Veterinary Research"},"publishedOn":"2025-07-10 15:57:50","publishedOnDateReadable":"July 10th, 2025"},"versionCreatedAt":"2025-01-16 16:22:28","video":"","vorDoi":"10.1186/s13567-025-01532-w","vorDoiUrl":"https://doi.org/10.1186/s13567-025-01532-w","workflowStages":[]},"version":"v1","identity":"rs-5715652","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5715652","identity":"rs-5715652","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00