TFAM Signaling Molecule Alleviates Mitochondrial damage of Cerebral Ischemia-Reperfusion | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article TFAM Signaling Molecule Alleviates Mitochondrial damage of Cerebral Ischemia-Reperfusion ying song, wen jun wang, yi biao shi, si tian qiu, xi chen, Xiao Min Zhang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6213424/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 08 Jan, 2026 Read the published version in Cell Death Discovery → Version 1 posted You are reading this latest preprint version Abstract Objectives: In the present study, we aimed to investigate the antioxidant and therapeutic protective effects of mitochondrial transcription factor A (TFAM) signaling molecules on Mitochondrial damage of cerebral ischemia-reperfusion through. Methods: PC12 cells were stimulated with H 2 O 2 in vivo, and healthy SD rats were used to establish MCAO model in vitro. Longa neurological score was used to measure the behavior of SD rats. TTC staining was used to observe the ischemic infarction in the cerebral hemisphere of the lesion area. TEM was used to observe the morphological changes of mitochondria in nerve cells of brain tissue and PC12 cells. ROS/SDO/MDA/ATP detection kit was used to detect the corresponding indicators. RT-qPCR was used to detect the mRNA level of target gene and mtDNA copy number changes. Immunofluorescence and Western blot were used to detect the expression of target protein. Based on the Tfam gene study, we used lentivirus to down-regulate the Tfam gene by brain injection in vitro and by cell transfection in vitro. Results: After oxidative stress in the MCAO model of SD rats, the neurological score increased, the volume of ischemic area of cerebral infarction increased, the morphology of nerve cells in brain tissue and PC12 cells was disordered, the mitochondria appeared vacuolated, the contents of ROS and MDA increased, and the activity of SOD decreased. Oxidative stress causes mitochondrial dysfunction, resulting in the reduction of mtDNA copy number and the decreased expression of Tfam in brain tissue nerve cells and PC12 cells, which in turn affects mitochondrial transcription biogenesis and decreases the expression of Polrmt and Tfb 2 M molecules. CAA promotes intracellular TFAM expression and activates its antioxidant pathway, thereby protecting mtDNA and alleviating oxidative stress and mitochondrial damage caused by MCAO in vitro and H 2 O 2 stimulation in vivo. Lentivirus down-regulates the expression of Tfam , and under its action, the antioxidant and mitochondrial protection effects of CAA are weakened. When Tfam was disrupted, the protective effect of CAA on mitochondria was inhibited. Conclusion: TFAM signaling molecules alleviates CIRI. Biological sciences/Neuroscience/Cognitive neuroscience/Cognitive control Health sciences/Diseases/Neurological disorders/Stroke TFAM Oxidative Stress Mitochondria Mitochondrial DNA CAA MCAO Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Stroke, commonly known as stroke, is divided into two types: ischemic stroke and hemorrhagic stroke [ 1 ]. It is a disease caused by a variety of reasons, resulting in focal or global brain tissue damage. Therefore, restoring blood flow as soon as possible is the goal of treatment [ 2 ]. However, with the rapid supply of blood flow, it will cause a large amount of ROS to overflow and damage mitochondrial function, that is, cerebral ischemia-reperfusion injury [ 3 , 4 ]. Among them, oxidative stress is one of the key mechanisms closely related to the pathophysiology of CIRI [ 5 , 6 ]. Mitochondria, a two-layer membrane-coated organelle present in most cells, is the main site of aerobic respiration in cells, and its function plays a crucial role in maintaining the homeostasis of the body [ 7 , 8 ]. Tfam , a nuclear gene encoding mitochondrial transcription factor, is a DNA-binding protein and an important factor in maintaining the normal function of mtDNA [ 9 ]. It can not only stabilize mtDNA, but also initiate mtDNA replication, which plays a crucial role in mtDNA metabolism [ 10 ]. The relationship between Tfam and mitochondria is reciprocal. Tfam can protect mitochondrial DNA from ROS attack, while mitochondrial DNA protects Tfam from degradation by Lon protease [ 11 , 12 ]. Mitochondrial biogenesis refers to a regenerative program that maintains mitochondrial numbers, replacing old and damaged mitochondria with new and healthy ones [ 13 ]. Among them, the related factors of mitochondrial biogenesis include Tfam , Polrmt , Tfb2M , etc. Mitochondrial transcription combines with mtDNA distortion and recruits Polrmt to form ternary complex, and then recruits Tfb2M to form quaternary complex, thus leading to mitochondrial transcription biogenesis [ 14 ]. CAA is obtained by acetylation of carvacrol, and in the medical and biological fields, several studies have shown that CAA shows higher antioxidant activity compared with other common volatile components of essential oils [ 15 ]. Studies have shown that CAA has a wide range of antibacterial, anti-inflammatory, analgesic and antioxidant activities [ 16 ], and also shows strong anti-epileptic, anti-anxiety and brain function protection in the central nervous system [ 17 , 18 ]. CAA has a protective and antioxidant effect on the body in terms of oxidative stress, which is related to mitochondrial function. In the present study, for the first time, we used the model of cerebral ischemia-reperfusion injury induced by MCAO in vivo and the model of oxidative stress induced by H 2 O 2 in SD rats in vitro , and combined with shTFAM lentivirus to explore the antioxidant effect of CAA/ED and the mechanism related to TFAM signaling molecules. 2. Results 2.1 CAA can alleviate CIRI in SD rats 2.1.1 CAA can reduce neurological scores and cerebral infarction volume The neurological scores of the in vivo experiment (FIG. 1A) showed that the neurological scores of the MCAO group increased compared with the Sham group, and the neurological scores of the drug group decreased, while the symptoms of the shTFAM + MCAO group worsened. The therapeutic effect of the shTFMA + drug group was lower than that of the normal drug group, and the normal experimental group and the shTFAM experimental group had statistically significant differences ( P <0.05). TTC staining was used to observe the infarct area of brain tissue in rats (FIG. 1B-C). Compared with the Sham group, the cerebral infarction area in the MCAO group was significantly increased, and the infarct area was reduced after CAA treatment, but the cerebral infarction area in the shTFAM group was significantly increased, and the therapeutic effect of drug was also inhibited accordingly. There was significant difference between the normal experimental group and the shTFAM experimental group ( P <0.001). 2.1.2 CAA can improve the pathological changes of brain tissue induced by CIRI The results of HE and Nissl staining of brain tissue sections showed (FIG. 1D) that the morphology of nerve cells in the Sham group was clearly visible, and the cells were densely arranged, while the number of nerve cells in the model group was reduced, the cells were arranged disorderly, and the cell body was atrophed. After drug treatment, the degree of injury was alleviated. However, the degree of cell injury was increased in the shTFAM group, and the degree of remission was weakened by drug treatment. 2.1.3 CAA can alleviate oxidative stress injury induced by CIRI The results of oxidative stress indexes in brain tissue showed that the ROS level and MDA content in MCAO group were higher than those in Sham group, and the SOD activity was decreased. After CAA treatment, all three indexes were improved. The degree of oxidative stress was aggravated in shTFAM + MCAO group, and the relief effect of shTFAM + drug group was lower than that of normal drug group (FIG. 1E, F, G). 2.1.4 CAA could reduce mitochondrial morphological damage induced by CIRI By observing the morphology of mitochondria in tissue cells under TEM transmission electron microscope ((FIG. 2A), compared with the Sham group, the mitochondria in the model group were damaged, which were manifested as decreased number of mitochondria, swelling of mitochondria, and increased degree of vacuolization. After drug treatment, the degree of mitochondrial damage was alleviated, some mitochondria were recovered, and the number of damaged mitochondria was reduced. However, in the shTFAM + MCAO group, the degree of mitochondrial damage was aggravated, the mitochondrial cristae disappeared, the degree of vacuolization was aggravated, and the therapeutic effects of shTFAM + ED and CAA drugs were also partially inhibited. 2.1.5 CAA could improve the changes of ATP content and Ca 2+ content induced by CIRI The results of ATP content and Ca 2+ content detection showed ((FIG. 2B-C) that compared with the Sham group, the ATP content decreased and Ca 2+ content increased, mitochondrial function damage increased, membrane permeability increased in the MCAO model group. After ED and CAA drug treatment, ATP content increased significantly and Ca 2+ content decreased significantly. However, in the shTFAM group, mitochondrial function and membrane permeability were aggravated. 2.1.6 CAA can regulate mtDNA copy number and TFB 2 M expression The detection of mtDNA copy number in brain tissue showed that the mtDNA copy number in the model group would decrease due to mitochondrial dysfunction, and this phenomenon was relieved and restored after the treatment with ED and CAA drugs. However, when TFAM was interfered, mtDNA copy number decreased significantly, and the therapeutic effect of drugs was also partially inhibited. The results of RT-qPCR and Western blot analysis of TFB 2 M signaling molecules (FIG. 2E-G) showed that Tfb 2 M mRNA level and protein expression were decreased, and their expression was increased by ED and CAA administration. It may be suggested that CAA may alleviate oxidative stress injury by regulating the expression of mitochondrial transcription biogenesis genes. After shTFAM lentivirus treatment, the expression of Tfb 2 M in the model group was significantly decreased, and the increase of Tfb 2 M in the drug group was also partially inhibited. 2.1.7 CAA can regulate TFAM and POLRMT We detected Tfam and Polrmt genes in the brain tissue of SD rats by immunofluorescence technology, and detected Tfam expression in the brain tissue by immunohistochemistry. The results of Tfam and Polrmt expression analysis by RT-qPCR and Western bolt showed that (FIG. 3A-I), The expression of Tfam and Polrmt decreased in the MCAO model group, and increased after drug treatment. However, after shTFAM lentivirus treatment, the expression of Tfam and Polrmt decreased significantly (P<0.05, P<0.01). 2.2 CAA can alleviate H 2 O 2 -induced oxidative stress in PC12 cells 2.2.1 Selection of optimal drug concentration According to the MTT results, the working concentration of H 2 O 2 was selected as 400 μM, the working concentration of CAA was 100 μM, and the working concentration of ED was 200 μM (Figure 4A-C). According to the fluorescence results of shTFAM transfected PC12 cells, we finally selected MOI = 125 as our experimental condition for subsequent experiments (FIG. 4D). 2.2.2 CAA can alleviate oxidative stress injury induced by H 2 O 2 The results of oxidative stress indexes of PC12 cells showed that the ROS level and MDA content in the H 2 O 2 group were higher than those in the Control group, and the SOD activity was lower than that in the control group. After CAA treatment, the three indexes were improved, and the results were consistent with the in vivo experiments. After down-regulation of TFAM gene by lentivirus, oxidative stress was aggravated in the shTFAM + model group. 2.2.3 CAA could reduce mitochondrial morphological damage induced by H 2 O 2 The results of TEM transmission electron microscopy showed that compared with the control group, the mitochondria in the model group were damaged, while after drug treatment, the degree of mitochondrial damage was alleviated, some mitochondria were recovered, and the number of damaged mitochondria was reduced. However, in the shTFAM group, the degree of mitochondrial damage was aggravated, the disappearance of mitochondrial cristae and the degree of vacuolization were aggravated, and the therapeutic effects of ED and CAA drugs were also partially inhibited. 2.2.4 CAA can improve the changes of ATP content and Ca 2+ content induced by H 2 O 2 The results of detection of ATP content and Ca 2+ content in PC12 cells showed that, compared with the Control group, the ATP content in the H 2 O 2 model group decreased and the Ca 2+ content increased, and both were improved after CAA treatment. However, when TFAM was down-regulated, the ATP content in the H 2 O 2 model group decreased significantly and the Ca 2+ content increased significantly, and the improvement effect of the drug was weakened. 2.2.5 CAA could alleviate H 2 O 2 -induced mtDNA copy number and TFB 2 M expression The detection of mtDNA copy number in brain tissue showed that the mtDNA copy number of the model group decreased, while the mtDNA copy number of the CAA drug group increased. When Tfam was interfered, mtDNA copy number decreased significantly, suggesting a close relationship between the therapeutic mechanism of CAA and mtDNA copy number. Subsequently, Tfb 2 M signaling molecules were detected by RT-qPCR and Western bolt. As shown in FIG. 5E-G, the mRNA level and protein expression of Tfb 2 M in the PC12 cell model group were significantly lower than those in the Control group. The mRNA and protein expression of Tfb 2 M in the ED and CAA drug groups were higher than those in the H 2 O 2 group, which was consistent with the in vivo results. After shTFAM lentivirus treatment, the expression of Tfb 2 M in the model group was significantly lower than that in the normal group. 2.2.6 CAA could regulate the expression of TFAM and POLRMT induced by H 2 O 2 Tfam and Polrmt genes in PC12 cells were detected by immunofluorescence as well as RT-qPCR and Western bolt, and the results shown in Figure 6A-G showed that the expression of Tfam and Polrmt was reduced in the H 2 O 2 group compared with the control group. Compared with the model group, both expressions were increased. The expression of Tfam and Polrmt in shTFAM lentivirus transfected group was lower than that in the normal group. 3. Experimental methods and materials 3.1 Experimental Materials Edaravone (ED) was purchased from Jiangsu Simcere Pharmaceutical Co., LTD. CAA was purchased from EXTRASYNTHESE (France) with a purity above 95%; Fetal bovine serum (FBS) was purchased from Hangzhou Sijiqing Company; DMEM high glucose medium was purchased from Wuhan Punosai Technology Co., LTD. Rabbit polyclonal TFAM antibody (ab307302) and sheep polyclonal TFB 2 M antibody (ab118321) were purchased from Abcam, USA. Rabbit polyclonal POLRMT (PA5-116630) antibody was purchased from Thermo Fisher Scientific; MCAO wire bolt was purchased from Beijing Xinong Technology Co., LTD. TFAM lentivirus was purchased from Shanghai Jima Pharmaceutical Technology Co., LTD. MDA, SOD and ROS were purchased from Nanjing Jiancheng BioEngineering Institute. 3.2 SD rats All male SD rats were housed in separate cages in the rat housing room of the BSL-1 level laboratory of the Animal Experiment Center of Zhejiang University of Technology. The feeding environment was as follows: quiet, room temperature 21–25 ℃, 50% humidity, and 12 hours light-dark cycle. SD male rats were fed and watered AD libitum. After one week of adaptive feeding, MCAO animal experiments were performed. All surgical procedures related to animals in the experiment were carried out after the approval of the Experimental Animal Ethics Committee of Zhejiang University of Technology. 3.3 PC12 cells culture and treatment PC12 cells were obtained from Institute of Biology, Chinese Academy of Sciences. The cells were cultured in DMEM high glucose medium (containing 10% fetal bovine serum and 1% anti-penicillin-streptomycin and gentamicin) at 37 ℃ in 5% CO 2 incubator. PC12 cells were treated with different concentrations of H 2 O 2 (200, 400, 600, 800, 1000 µM), ED (50, 100, 200, 400, 800 µM), and CAA (50, 100, 200, 400, 800 µM) for 24 hours to explore the drug concentration. shTFAM cell transfection: (1) Suitable PC12 cells were seeded in 96-well plates. (2) After overnight culture, the original medium was replaced by half the volume of virus working solution containing different MOI (MOI = 50, 100, 125, 150). (3) After 4 hours, half volume of dye assistant solution containing 6 µg/ml polybrene was added and incubated at 37 ℃. (4) PC12 cells with Tfam gene knockdown were selected by changing to normal culture medium at 24 hours, and culture medium containing 2 µg/ml puromycin was added at 3 days. (5) The transfection efficiency of lentivirus was observed by fluorescence microscope. (6) The optimal MOI of transfection was used for subsequent experiments. 3.4 Experimental grouping The experiment was divided into two parts, in vivo and in vitro, with 8 groups in each part. In vivo experiment: Sham operation group, Sham + shTFAM group, MCAO group, MCAO + shTFAM group, ED positive drug group, ED + shTFAM group, CAA treatment group, CAA + shTFAM group; In vitro experiment: control group, control + shTFAM group, H 2 O 2 group, H 2 O 2 + shTFAM group, ED positive drug group, ED + shTFAM group, CAA treatment group, CAA + shTFAM group. 3.5 MCAO model The left common carotid artery was exposed after the rats were anesthetized. The vagus nerve and parasympathetic nerve were gently separated, and the common carotid artery and external carotid artery were ligated. The common carotid artery was opened with a V-shaped opening, the thread was inserted into the internal carotid artery, and the thread was fixed. Cerebral ischemia-reperfusion injury was achieved by removing the thread plug 90 minutes later. Normal saline and corresponding drugs were administered at 0h and 12h after thrombectomy. 3.6 Neurological score Behavioral analyses were performed by a double-blind method. 24 hours after cerebral ischemia-reperfusion, the neurological function was evaluated by Longa neurological scoring system. 3.7 TTC The brain tissue of SD rats was removed and rinsed gently in normal saline, then placed at -20 ℃, and then quickly sectioned along the coronal plane of the brain with a sharp blade, with a thickness of about 2 mm. A total of 6 pieces were cut, and an appropriate amount of TTC staining solution was added and placed in a constant temperature oven at 37 ℃, and stained in the dark for 30 min to make it in uniform contact with the liquid. Image Pro plus software was used to analyze and calculate the infarct volume of brain tissue. The percentage of infarct volume = infarct volume/infarct side half brain volume×100%. 3.8 H&E staining Following cardiac perfusion with 0.9% saline, brain tissues were fixed in 4% paraformaldehyde at 4°C overnight. Sections were mounted with neutral gum. Results were visualized using scanning software. 3.9 Nissl staining Paraffin embedding and sectioning steps were performed as H&E staining. Sections were subjected to 95% ethanol for 5 seconds, absolute ethanol for 1 minute, and xylene three times for 2 minutes each. Scanning software was used to observe the results. 3.10 TEM was used to observe mitochondrial morphology Brain tissues and PC12 cells were fixed in 2.5% glutaraldehyde (PBS) at 4°C overnight, rinsed with 0.1 M phosphate buffer (3 × 15 min), and post-fixed in 0.1 M osmic acid for 2 h. Mitochondrial morphology was analyzed by TEM. 3.11 Immunofluorescence staining Cells grown on cover slides were fixed with 4% paraformaldehyde solution and then blocked for 1 h at room temperature. After blocking, the primary antibody was dropped onto the sections and incubated overnight at 4 ℃. Secondary antibodies (Beyotime) were added and incubated for 2 hours at 37 ℃. Sections were observed under a fluorescence microscope and photographed. 3.12 Detection of oxidative stress indicators ROS content: DCFH-DA probe was used to load tissue homogenate and cells, with ROS detected by fluorescence microplate reader (Ex: 488 nm, Em: 525 nm). Results were normalized to protein concentration. SOD activity: Samples were lysed on ice for 15 min, centrifuged at 14000 g (4 ℃, 10 min), and supernatants collected. Protein concentration was measured by BCA assay, and SOD activity was determined using a detection kit, normalized to protein concentration. MDA content: Samples were processed as for SOD, and MDA levels were measured using a detection kit, normalized to protein concentration. 3.13 Mitochondrial index detection ATP content determination: ATP lysate was added to the homogenate tissue and PC12 cells, and after lysis, the supernatant was removed by centrifugation at 12000 g for 5 min at 4 ℃ and used for subsequent determination. ATP content in brain tissue and PC12 cells was determined according to the instructions of the Enhanced ATP Assay Kit (Beyotime, Shanghai, China) and normalized by protein concentration. Ca 2+ content detection: After the homogenate tissue and PC12 cells were collected, an appropriate amount of detection lysate was added, and the supernatant was collected by centrifugation at 14000g for 5 minutes at 4 ℃. Calcium content in tissue homogenates and PC12 cells was determined according to the instructions of the Calcium content chromogenic detection kit (Shanghai Biyuntian Biotechnology Co., LTD.) and normalized by protein concentration. 3.14 RT-qPCR and mtDNA copy number Total RNA from tissues and PC12 cells was extracted using Trizol (Invitrogen, USA, 12183-555) and reverse transcribed using a kit (Invitrogen, USA, 11752-050). Primer sequences (Sangon, Shanghai, China) are shown in Table 1 . For analysis of mitochondrial DNA content, total DNA was extracted from tissues and cells using the Universal Genomic DNA kit (CW2298S, CWBIO, Beijing, China), and 10 ng of DNA was used for qPCR analysis. MtDNA copy number was measured using the mitochondrial D-LOOP gene. Primer sequences (Shenggong, Shanghai, China) are shown in Table 1 . Table 1 Primers for real-time PCR Genes Primer sequence(5'to3') Tfam F: TTTCTCCGAAGCATGTGGGG R: CTTCAGCTTTTCCTGCGGTG Polrmt F: ACTCACCACAACAACCAAGACAAG R: CGTCCGTCAGCATGATGAACAC Tfb 2 M F: AAGAATGCGGATGGAGAGTTACAAG R:GAACACCTGCTGACCAAGGAAC Mtdna F: GGTTCTTACTTCAGGGCCATCA R: TGATTAGACCCGTTACCATCGA 3.15 Western blot PC12 cells were washed 3 times with ice-cold PBS and lysed in RIPA buffer for 15 minutes on ice. Brain tissue (20 mg) was homogenized in RIPA buffer at 60 Hz, centrifuged at 15000 rcf, and the supernatant collected as protein samples. Protein concentration was measured using a BCA kit (Basted). Equal protein amounts were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk at room temperature. Membranes were incubated with primary antibodies at 4 ℃ overnight, followed by HRP-conjugated secondary antibodies for 1 h at room temperature after TBST washing. Bands were visualized using a ChemiDoc XRS + system (Bio-Rad) and quantified with ImageJ (1.8.0). Tubulin served as the loading control. 3.16 Statistical analysis All results are expressed as mean ± SD. All data processing was performed using GraphPad Prism software, version 5.0. Results between treatments were compared using one-way ANOVA or two-way ANOVA. Results were considered significantly different at p < 0.05. 4. Discussion Given the brain's high sensitivity to oxygen deprivation, hypoxia emerges as a pivotal factor in the pathogenesis of cerebral ischemia-reperfusion injury. During the ischemic and reperfusion phases, a substantial surge in ROS is observed. This ROS escalation subsequently modulates vascular reactivity, inflicts damage on vascular endothelial cells, and compromises the integrity of the blood-brain barrier [ 19 ]. Furthermore, ROS instigates lipid peroxidation of unsaturated fatty acids, precipitating the degradation and impairment of cellular and organellar membranes [ 20 ]. Consequently, these events culminate in a cascade of detrimental effects including cerebral edema, inflammatory responses, neuronal apoptosis, and the expansion of the infarcted region, progressively exacerbating brain tissue damage and potentially leading to mortality [ 21 ]. ED, recognized as a classical neuroprotective agent and free radical scavenger, exerts its protective effects by neutralizing free radicals and curtailing lipid peroxidation, thereby mitigating oxidative damage to cerebral, vascular endothelial, and neuronal cells [ 22 , 23 ]. CAA, a natural phytochemical, exhibits multifaceted therapeutic properties including anti-epileptic, anxiolytic, antidepressant, and antioxidative effects. However, the precise antioxidative mechanisms of CAA remain to be fully elucidated. In this context, we employed ED as a positive control to investigate the therapeutic mechanisms of CAA against oxidative stress induced by cerebral ischemia-reperfusion injury, with a particular focus on the potential interplay between CAA's antioxidative properties and Tfam . Tfam , a nuclear-encoded mitochondrial transcription factor, functions as a DNA-binding protein essential for the maintenance of mtDNA integrity [ 24 ]. It plays a dual role in stabilizing mtDNA and initiating its replication, thereby being indispensable for mtDNA metabolism. As a cornerstone of mitochondrial biogenesis, Tfam 's significance is underscored during oxidative stress, where ROS activates the Pgc-1α-Nrf2 signaling pathway, subsequently upregulating Tfam . This pathway is a critical antioxidant mechanism, enhancing cellular antioxidant defenses [ 25 , 26 ]. In our experimental paradigm, lentiviral-mediated knockdown of Tfam was achieved 24 hours post-ventricular injection, following established protocols [ 27 , 28 ]. We observed a marked upregulation of TFAM expression in both brain tissue and PC12 cells following treatment with ED and CAA. Moreover, TFAM interference exacerbated oxidative stress and tissue damage, as evidenced by elevated ROS levels and MDA content, further affirming Tfam 's pivotal role in oxidative stress mitigation. Mitochondria, as the epicenter of bioenergetic metabolism, are critically implicated in oxidative stress dynamics [ 13 ]. Our experimental assessments of mitochondrial function, through measurements of Ca 2+ and ATP levels alongside mtDNA copy number, revealed that oxidative stress impairs mitochondrial function, as indicated by decreased ATP and increased Ca 2+ levels, and reduced mtDNA copy number in the model group. Treatment with ED and CAA ameliorated these mitochondrial dysfunctions, suggesting their potential in enhancing mitochondrial resilience against oxidative stress. Delving deeper into the TFAM signaling cascade, we uncovered that Tfam is instrumental in mtDNA transcription, facilitating both replication and transcription processes. Specifically, Tfam binds to mitochondrial promoters, recruits Polrmt , and subsequently engages Tfb2M to initiate mtDNA transcription [ 13 , 29 ]. This transcriptional activity enables the replacement of damaged mitochondria, thereby ameliorating oxidative stress-induced mitochondrial damage. Post-treatment with ED and CAA, an upregulation in the expression of these transcription factors was noted, highlighting their protective pathways. Lentiviral knockdown of Tfam resulted in diminished expression of Polrmt and Tfb2M across all groups, underscoring TFAM's critical role in mitochondrial transcription and biogenesis. Thus, we conclude that ED and CAA alleviate oxidative stress by modulating Tfam , thereby safeguarding mitochondrial integrity and mitigating oxidative damage through the regulatory interplay between Tfam and mitochondrial transcription biogenesis. 5. Conclusions Tfam plays a crucial role in protecting the body from oxidative stress damage, including protecting mitochondrial function, alleviating oxidative stress damage and promoting mitochondrial transcription biogenesis, etc. The antioxidant mechanism of the body was further explored by the use of ED and CAA. These findings may provide new research avenues for the prevention and treatment of ischemic stroke. We will continue to explore these studies in depth to elucidate the relevant antioxidant protective mechanisms. Declarations Funding This research was funded by grants from the National Natural Science Foundation of China, grant number 82174038 and Zhejiang Provincial Natural Science Foundation of China, grant number LD22H090002. Acknowledgments This study was supported by grants from the National Natural Science Foundation of China (No. 82174038), the major of Zhejiang Provincial Natural Science Foundation of China (No. LD22H090002). Declaration of interests No interests are declared. References Paul S, Candelario-Jalil E (2021) Emerging neuroprotective strategies for the treatment of ischemic stroke: An overview of clinical and preclinical studies. Experimental neurology 335:113518. doi:10.1016/j.expneurol.2020.113518 Lee EC, Ha TW, Lee DH, Hong DY, Park SW, Lee JY, Lee MR, Oh JS (2022) Utility of Exosomes in Ischemic and Hemorrhagic Stroke Diagnosis and Treatment. International journal of molecular sciences 23 (15). doi:10.3390/ijms23158367 Mao Z, Tian L, Liu J, Wu Q, Wang N, Wang G, Wang Y, Seto S (2022) Ligustilide ameliorates hippocampal neuronal injury after cerebral ischemia reperfusion through activating PINK1/Parkin-dependent mitophagy. Phytomedicine : international journal of phytotherapy and phytopharmacology 101:154111. doi:10.1016/j.phymed.2022.154111 Sharma D, Maslov LN, Singh N, Jaggi AS (2020) Remote ischemic preconditioning-induced neuroprotection in cerebral ischemia-reperfusion injury: Preclinical evidence and mechanisms. European journal of pharmacology 883:173380. doi:10.1016/j.ejphar.2020.173380 Peoples JN, Saraf A, Ghazal N, Pham TT, Kwong JQ (2019) Mitochondrial dysfunction and oxidative stress in heart disease. Experimental & molecular medicine 51 (12):1-13. doi:10.1038/s12276-019-0355-7 Cai W, Chong K, Huang Y, Huang C, Yin L (2024) Empagliflozin improves mitochondrial dysfunction in diabetic cardiomyopathy by modulating ketone body metabolism and oxidative stress. Redox biology 69:103010. doi:10.1016/j.redox.2023.103010 Jassim AH, Fan Y, Pappenhagen N, Nsiah NY, Inman DM (2021) Oxidative Stress and Hypoxia Modify Mitochondrial Homeostasis During Glaucoma. Antioxidants & redox signaling 35 (16):1341-1357. doi:10.1089/ars.2020.8180 Davidson SM, Lopaschuk GD, Spedding M, Beart PM (2014) Mitochondrial pharmacology: energy, injury and beyond. British journal of pharmacology 171 (8):1795-1797. doi:10.1111/bph.12679 Song Y, Wang W, Wang B, Shi Q (2024) The Protective Mechanism of TFAM on Mitochondrial DNA and its Role in Neurodegenerative Diseases. Molecular neurobiology 61 (7):4381-4390. doi:10.1007/s12035-023-03841-7 Zhao M, Wang Y, Li L, Liu S, Wang C, Yuan Y, Yang G, Chen Y, Cheng J, Lu Y, Liu J (2021) Mitochondrial ROS promote mitochondrial dysfunction and inflammation in ischemic acute kidney injury by disrupting TFAM-mediated mtDNA maintenance. Theranostics 11 (4):1845-1863. doi:10.7150/thno.50905 Liu H, Zhen C, Xie J, Luo Z, Zeng L, Zhao G, Lu S, Zhuang H, Fan H, Li X, Liu Z, Lin S, Jiang H, Chen Y, Cheng J, Cao Z, Dai K, Shi J, Wang Z, Hu Y, Meng T, Zhou C, Han Z, Huang H, Zhou Q, He P, Feng D (2024) TFAM is an autophagy receptor that limits inflammation by binding to cytoplasmic mitochondrial DNA. Nature cell biology 26 (6):878-891. doi:10.1038/s41556-024-01419-6 Huang Q, Wu D, Zhao J, Yan Z, Chen L, Guo S, Wang D, Yuan C, Wang Y, Liu X, Xing J (2022) TFAM loss induces nuclear actin assembly upon mDia2 malonylation to promote liver cancer metastasis. The EMBO journal 41 (11):e110324. doi:10.15252/embj.2021110324 Popov LD (2020) Mitochondrial biogenesis: An update. Journal of cellular and molecular medicine 24 (9):4892-4899. doi:10.1111/jcmm.15194 Liu L, Li Y, Chen G, Chen Q (2023) Crosstalk between mitochondrial biogenesis and mitophagy to maintain mitochondrial homeostasis. Journal of biomedical science 30 (1):86. doi:10.1186/s12929-023-00975-7 Zhou HL, Wang BB, Fan XL, Zhang XM, Song Y (2024) Carvacrol acetate activated Nrf2 modulates mitophagy for the treatment of neurocyte oxidative stress induced by chlorpyrifos. Ecotoxicology and environmental safety 289:117484. doi:10.1016/j.ecoenv.2024.117484 Souza RL, Opretzka LCF, Morais MC, Melo CO, Oliveira BEG, Sousa DP, Villarreal CF, Oliveira EE (2023) Nanoemulsion Improves the Anti-Inflammatory Effect of Intraperitoneal and Oral Administration of Carvacryl Acetate. Pharmaceuticals (Basel, Switzerland) 17 (1). doi:10.3390/ph17010017 Akan T, Aydın Y, Korkmaz OT, Ulupınar E, Saydam F (2023) The Effects of Carvacrol on Transient Receptor Potential (TRP) Channels in an Animal Model of Parkinson's Disease. Neurotoxicity research 41 (6):660-669. doi:10.1007/s12640-023-00660-5 Zare Mehrjerdi F, Niknazar S, Yadegari M, Akbari FA, Pirmoradi Z, Khaksari M (2020) Carvacrol reduces hippocampal cell death and improves learning and memory deficits following lead-induced neurotoxicity via antioxidant activity. Naunyn-Schmiedeberg's archives of pharmacology 393 (7):1229-1237. doi:10.1007/s00210-020-01866-6 Zeng X, Zhang YD, Ma RY, Chen YJ, Xiang XM, Hou DY, Li XH, Huang H, Li T, Duan CY (2022) Activated Drp1 regulates p62-mediated autophagic flux and aggravates inflammation in cerebral ischemia-reperfusion via the ROS-RIP1/RIP3-exosome axis. Military Medical Research 9 (1):25. doi:10.1186/s40779-022-00383-2 Wang B, Wang Y, Zhang J, Hu C, Jiang J, Li Y, Peng Z (2023) ROS-induced lipid peroxidation modulates cell death outcome: mechanisms behind apoptosis, autophagy, and ferroptosis. Archives of toxicology 97 (6):1439-1451. doi:10.1007/s00204-023-03476-6 Shen L, Gan Q, Yang Y, Reis C, Zhang Z, Xu S, Zhang T, Sun C (2021) Mitophagy in Cerebral Ischemia and Ischemia/Reperfusion Injury. Frontiers in aging neuroscience 13:687246. doi:10.3389/fnagi.2021.687246 Dang R, Wang M, Li X, Wang H, Liu L, Wu Q, Zhao J, Ji P, Zhong L, Licinio J, Xie P (2022) Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/Gpx4 pathway. Journal of neuroinflammation 19 (1):41. doi:10.1186/s12974-022-02400-6 Zhu G, Zeng Y, Peng W, Lu C, Cai H, Abuduxukuer Z, Chen Y, Chen K, Song X, Song Y, Ye L, Wang J, Jin M (2024) Edaravone alleviated allergic airway inflammation by inhibiting oxidative stress and endoplasmic reticulum stress. European journal of pharmacology 966:176317. doi:10.1016/j.ejphar.2024.176317 Kozhukhar N, Alexeyev MF (2023) 35 Years of TFAM Research: Old Protein, New Puzzles. Biology 12 (6). doi:10.3390/biology12060823 Shen Q, Fang J, Guo H, Su X, Zhu B, Yao X, Wang Y, Cao A, Wang H, Wang L (2023) Astragaloside IV attenuates podocyte apoptosis through ameliorating mitochondrial dysfunction by up-regulated Nrf2-ARE/TFAM signaling in diabetic kidney disease. Free radical biology & medicine 203:45-57. doi:10.1016/j.freeradbiomed.2023.03.022 Guo B, Zheng C, Cao J, Luo F, Li H, Hu S, Mingyuan Lee S, Yang X, Zhang G, Zhang Z, Sun Y, Wang Y (2024) Tetramethylpyrazine nitrone exerts neuroprotection via activation of PGC-1α/Nrf2 pathway in Parkinson's disease models. Journal of advanced research 64:195-211. doi:10.1016/j.jare.2023.11.021 Shi, X. W., Jia, F., Lyu, P., & Xu, F. Q. (2022). A new anterograde trans-synaptic tracer based on Sindbis virus. Neural regeneration research, 17(12), 2761–2764. doi.org/10.4103/1673-5374.339495 Liu, S., Zhu, S., Zou, Y., Wang, T., & Fu, X. (2015). Knockdown of IL-1β improves hypoxia-ischemia brain associated with IL-6 up-regulation in cell and animal models. Molecular neurobiology, 51(2), 743–752. doi.org/10.1007/s12035-014-8764-z Hsieh AH, Reardon SD, Munozvilla-Cabellon JH, Shen J, Patel SS, Mishanina TV (2023) Expression and Purification of Recombinant Human Mitochondrial RNA Polymerase (POLRMT) and the Initiation Factors TFAM and TFB2M. Bio-protocol 13 (23):e4892. doi:10.21769/BioProtoc.4892 Additional Declarations There is NO Competing Interest. Supplementary Files Authoragreementofsong20250302.docx author agreement of song GraphicalAbstract.docx Cite Share Download PDF Status: Published Journal Publication published 08 Jan, 2026 Read the published version in Cell Death Discovery → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6213424","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":433321056,"identity":"dcc33979-621d-4a85-a9c8-d000541c5861","order_by":0,"name":"ying song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYNACAwYGfgaGBBCTsYFoLZINQC0HiNcC0gVUTpwW+fbew695Cu7YbT5/4Jn0BwYb2Q0HmJ89wGv4mXNp1jwGz5K3HTiQJnGAIc14wwE2cwO8WiRyzIx5DA4nmx1sAGk5nLjhAA+bBF6HzYBqMW5mAGn5T1gLw40c48dALXYGbGAtBwhrMThzxoxxjsHhBIkzDMkWZwySjWceZjPD77D2HuMPb/4ctufvP5N4o6LCTrbvePMz/A5jYGCT4mFgSGxg4EkAxykDMwH1ICUffzAw2DMwsB8grHYUjIJRMApGJAAA561MtvsWc+8AAAAASUVORK5CYII=","orcid":"","institution":"zhejiang university of technology","correspondingAuthor":true,"prefix":"","firstName":"ying","middleName":"","lastName":"song","suffix":""},{"id":433321057,"identity":"5efbd2c7-8dee-4387-a281-4b9ec18fc034","order_by":1,"name":"wen jun wang","email":"","orcid":"","institution":"zhejiang universit of technology","correspondingAuthor":false,"prefix":"","firstName":"wen","middleName":"jun","lastName":"wang","suffix":""},{"id":433321058,"identity":"f682c136-98e9-4420-b1a4-15c779eafa5e","order_by":2,"name":"yi biao shi","email":"","orcid":"","institution":"zhe jiang university of technology","correspondingAuthor":false,"prefix":"","firstName":"yi","middleName":"biao","lastName":"shi","suffix":""},{"id":433321059,"identity":"6f17dbf5-cace-4f58-9917-fe6cd3d6a78b","order_by":3,"name":"si tian qiu","email":"","orcid":"","institution":"zhe jiang university of technology","correspondingAuthor":false,"prefix":"","firstName":"si","middleName":"tian","lastName":"qiu","suffix":""},{"id":433321060,"identity":"b1185630-1744-41d4-9796-1131c2ecf895","order_by":4,"name":"xi chen","email":"","orcid":"","institution":"zhe jiang university of technology","correspondingAuthor":false,"prefix":"","firstName":"xi","middleName":"","lastName":"chen","suffix":""},{"id":433321061,"identity":"5bb8b902-6265-4530-a088-f6a0e7025e2e","order_by":5,"name":"Xiao Min Zhang","email":"","orcid":"","institution":"zhe jiang university of technology","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"Min","lastName":"Zhang","suffix":""},{"id":433321062,"identity":"cbf6d535-e874-423d-8d84-3e8c328c211a","order_by":6,"name":"qi song li","email":"","orcid":"","institution":"zhejiang university of technology","correspondingAuthor":false,"prefix":"","firstName":"qi","middleName":"song","lastName":"li","suffix":""}],"badges":[],"createdAt":"2025-03-12 15:35:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6213424/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6213424/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41420-025-02930-x","type":"published","date":"2026-01-08T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":88212977,"identity":"258dd256-40ee-4152-b819-5b739c42b369","added_by":"auto","created_at":"2025-08-04 05:54:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2283215,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAA can alleviate CIRI in SD rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eSham group: control group; Sh-TFAM: TFAM down-regulated group; MCAO: cerebral ischemia reperfusion model group; ED: edaravone administration group; CAA: carvacrol acetate administration group. (A) Neurological scores of SD rats (n=8). (B) Analysis of TTC cerebral infarction in SD rats (n=3). (C) TTC was used to observe cerebral infarction in SD rats. (D) HE\u0026amp;Nissl staining in the cerebral cortex of SD rats. (E) ROS levels in brain tissue (n=6). (F) SOD activity in brain tissue (n=6). (G) MDA content in brain tissue (n=6). \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e*\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e**\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e***\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. Sham; \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e#\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e##\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e###\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. MCAO;\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. sh-TFAM.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/021aa3a1da6c09e27b7e0bbd.png"},{"id":88212979,"identity":"5fbbe042-2b86-45a0-9b81-f94ec8ad0466","added_by":"auto","created_at":"2025-08-04 05:54:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":873722,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAA can improve mitochondrial dysfunction to alleviate CIRI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eSham group: control group; sh-TFAM: TFAM down-regulated group; MCAO: cerebral ischemia reperfusion model group; ED: edaravone administration group; CAA: carvacrol acetate administration group. (A) The morphology of mitochondria in the cerebral cortex of SD rats was observed by transmission electron microscopy. (B) ATP content in brain tissue (n=6). (C) Brain Ca\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e content (n=6). (D) mtDNA copy number in brain tissue (n=3). (E) Tfb\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eM mRNA levels in brain tissues (n=3). (F) TFB\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eM protein content in brain tissue (n=3). (G) Analysis of TFB\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eM protein ratio in brain tissue (n=3). \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e**\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e***\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. Sham; \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e#\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e##\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e###\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. MCAO;\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. sh-TFAM.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/ffb27acef7560986edd60c62.png"},{"id":88212369,"identity":"8cfead2a-1221-4b35-9e7f-912d75c034d4","added_by":"auto","created_at":"2025-08-04 05:46:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1276244,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAA regulates mitochondrial transcription of biogenesis genes to alleviate CIRI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eSham group: control group; sh-TFAM: TFAM down-regulated group; MCAO: cerebral ischemia reperfusion model group; ED: edaravone administration group; CAA: carvacrol acetate administration group. (A) Immunofluorescence and ratio analysis of TFAM in cerebral cortex of brain tissue (n=3). (B) Immunohistochemistry of TFAM in cerebral cortex of brain tissue. (C) Tfam mRNA levels in brain tissues (n=3). (D) TFAM protein content in brain tissue (n=3). (E) Analysis of TFAM protein ratio in brain tissue (n=3). (F) immunofluorescence and ratio analysis of POLRMT in cerebral cortex. (n=3). (G) Polrmt mRNA levels in brain tissues (n=3). (H) POLRMT protein content in brain tissue (n=3). (I) Analysis of POLRMT protein ratio in brain tissue (n=3).\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e*\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e**\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e***\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. Sham; \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e#\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e##\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e###\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. MCAO;\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. sh-TFAM.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/7fa450bba69530718555f296.png"},{"id":88212984,"identity":"616c5f25-29a7-4861-9c4d-80b200365d0c","added_by":"auto","created_at":"2025-08-04 05:54:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":393372,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAA can alleviate oxidative stress injury induced by H\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eControl: Control group; sh-TFAM: TFAM down-regulated group; H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e: oxidative stress stimulation group; ED: edaravone administration group; CAA: carvacrol acetate administration group. (A) Effect of H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e concentration on PC12 cell survival (n=6). (B) Effect of CAA concentration on PC12 cell survival (n=6). (C) Effect of ED concentration on PC12 cell survival (n=6). (D) Fluorescence pattern of PC12 cells transfected with shTFAM at different MOI concentrations. (E) ROS levels in PC12 cells (n=6). (F) SOD activity in PC12 cells (n=6). (G) MDA content in PC12 cells (n=6). \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e**\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e***\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. C; \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e###\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e;\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. sh-TFAM.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/72ed49c311784b3e7b2351d1.png"},{"id":88212372,"identity":"94c2093b-1aa9-44b4-b2b6-d52da2aedcb3","added_by":"auto","created_at":"2025-08-04 05:46:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":866817,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAA can ameliorate mitochondrial dysfunction to alleviate H\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e -induced oxidative stress injury\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eControl: Control group; sh-TFAM: Tfam down-regulated group; H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e: oxidative stress stimulation group; ED: edaravone administration group; CAA: carvacrol acetate administration group. (A) Mitochondrial morphology of PC12 cells was observed by TEM transmission electron microscope. (B) ATP content of PC12 cells (n=6). (C) Ca\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e content of PC12 cells (n=6). (D) MtDNA copy number of PC12 cells (n=3). (E) Tfb\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eM mRNA levels in PC12 cells (n=3). (F) TFB\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eM protein content in PC12 cells (n=3). (G) Analysis of TFB\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eM protein ratio in PC12 cells (n=3). \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e**\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e***\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. C; \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e##\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e###\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e;\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. sh-TFAM.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/53534aa7225db7880d1ef4b8.png"},{"id":88212371,"identity":"621c0710-36c4-4f05-afdb-20961239ca9c","added_by":"auto","created_at":"2025-08-04 05:46:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":819928,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAA can modify mitochondrial pathway biogenesis genes to alleviate oxidative stress injury induced by H\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eControl: Control group; sh-TFAM: TFam down-regulated group; H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e: oxidative stress stimulation group; ED: edaravone administration group; CAA: carvacrol acetate administration group. (A) TFAM immunofluorescence and ratio analysis in PC12 cells (n=3). (B) TFam mRNA levels in PC12 cells (n=3). (C) TFAM protein content in PC12 cells (n=3). (D) Analysis of TFAM protein ratio in PC12 cells (n=3). (E) POLRMT immunofluorescence and ratio analysis in PC12 cells (n=3). (F) Polrmt mRNA levels in PC12 cells (n=3). (G) POLRMT protein content in PC12 cells (n=3). (H) Analysis of POLRMT protein ratio in PC12 cells (n=3). \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e*\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e**\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e***\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. C;\u0026nbsp; \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e#\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e##\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e###\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. H\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e;\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.05, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.01, \u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003eP\u0026lt;0.001 vs. sh-TFAM.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/a0c86499d1081dcb23f6bf76.png"},{"id":102095196,"identity":"09268e2d-2a88-4558-aa9d-0f6395ab01d6","added_by":"auto","created_at":"2026-02-07 08:20:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9219129,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/233e3fdd-5598-4088-b85d-641940a8bee0.pdf"},{"id":88213080,"identity":"385a7d3d-2a1a-42de-8eb2-dc346ec9afc4","added_by":"auto","created_at":"2025-08-04 06:02:34","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":94083,"visible":true,"origin":"","legend":"author agreement of song","description":"","filename":"Authoragreementofsong20250302.docx","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/99a643e204ccedf2fe9d68be.docx"},{"id":88212365,"identity":"e8084348-eb31-4906-8968-065553f56be4","added_by":"auto","created_at":"2025-08-04 05:46:34","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":423138,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-6213424/v1/4d7a15a0b9f331e41e3d9d28.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"TFAM Signaling Molecule Alleviates Mitochondrial damage of Cerebral Ischemia-Reperfusion","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eStroke, commonly known as stroke, is divided into two types: ischemic stroke and hemorrhagic stroke [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is a disease caused by a variety of reasons, resulting in focal or global brain tissue damage. Therefore, restoring blood flow as soon as possible is the goal of treatment [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, with the rapid supply of blood flow, it will cause a large amount of ROS to overflow and damage mitochondrial function, that is, cerebral ischemia-reperfusion injury [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Among them, oxidative stress is one of the key mechanisms closely related to the pathophysiology of CIRI [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMitochondria, a two-layer membrane-coated organelle present in most cells, is the main site of aerobic respiration in cells, and its function plays a crucial role in maintaining the homeostasis of the body [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. \u003cem\u003eTfam\u003c/em\u003e, a nuclear gene encoding mitochondrial transcription factor, is a DNA-binding protein and an important factor in maintaining the normal function of mtDNA [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. It can not only stabilize mtDNA, but also initiate mtDNA replication, which plays a crucial role in mtDNA metabolism [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The relationship between Tfam and mitochondria is reciprocal. Tfam can protect mitochondrial DNA from ROS attack, while mitochondrial DNA protects Tfam from degradation by Lon protease [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMitochondrial biogenesis refers to a regenerative program that maintains mitochondrial numbers, replacing old and damaged mitochondria with new and healthy ones [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Among them, the related factors of mitochondrial biogenesis include \u003cem\u003eTfam\u003c/em\u003e, \u003cem\u003ePolrmt\u003c/em\u003e, \u003cem\u003eTfb2M\u003c/em\u003e, etc. Mitochondrial transcription combines with mtDNA distortion and recruits \u003cem\u003ePolrmt\u003c/em\u003e to form ternary complex, and then recruits \u003cem\u003eTfb2M\u003c/em\u003e to form quaternary complex, thus leading to mitochondrial transcription biogenesis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCAA is obtained by acetylation of carvacrol, and in the medical and biological fields, several studies have shown that CAA shows higher antioxidant activity compared with other common volatile components of essential oils [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Studies have shown that CAA has a wide range of antibacterial, anti-inflammatory, analgesic and antioxidant activities [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], and also shows strong anti-epileptic, anti-anxiety and brain function protection in the central nervous system [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. CAA has a protective and antioxidant effect on the body in terms of oxidative stress, which is related to mitochondrial function.\u003c/p\u003e \u003cp\u003eIn the present study, for the first time, we used the model of cerebral ischemia-reperfusion injury induced by MCAO \u003cem\u003ein vivo\u003c/em\u003e and the model of oxidative stress induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in SD rats \u003cem\u003ein vitro\u003c/em\u003e, and combined with shTFAM lentivirus to explore the antioxidant effect of CAA/ED and the mechanism related to TFAM signaling molecules.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cp\u003e\u003cstrong\u003e2.1 CAA can alleviate CIRI in SD rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.1 CAA can reduce neurological scores and cerebral infarction volume\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe neurological scores of the in vivo experiment (FIG. 1A) showed that the neurological scores of the MCAO group increased compared with the Sham group, and the neurological scores of the drug group decreased, while the symptoms of the shTFAM + MCAO group worsened. The therapeutic effect of the shTFMA + drug group was lower than that of the normal drug group, and the normal experimental group and the shTFAM experimental group had statistically significant differences (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). TTC staining was used to observe the infarct area of brain tissue in rats (FIG. 1B-C). Compared with the Sham group, the cerebral infarction area in the MCAO group was significantly increased, and the infarct area was reduced after CAA treatment, but the cerebral infarction area in the shTFAM group was significantly increased, and the therapeutic effect of drug was also inhibited accordingly. There was significant difference between the normal experimental group and the shTFAM experimental group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.2 CAA can improve the pathological changes of brain tissue induced by CIRI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of HE and Nissl staining of brain tissue sections showed (FIG. 1D) that the morphology of nerve cells in the Sham group was clearly visible, and the cells were densely arranged, while the number of nerve cells in the model group was reduced, the cells were arranged disorderly, and the cell body was atrophed. After drug treatment, the degree of injury was alleviated. However, the degree of cell injury was increased in the shTFAM group, and the degree of remission was weakened by drug treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.3 CAA can alleviate oxidative stress injury induced by CIRI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of oxidative stress indexes in brain tissue showed that the ROS level and MDA content in MCAO group were higher than those in Sham group, and the SOD activity was decreased. After CAA treatment, all three indexes were improved. The degree of oxidative stress was aggravated in shTFAM + MCAO group, and the relief effect of shTFAM + drug group was lower than that of normal drug group (FIG. 1E, F, G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.4 CAA could reduce mitochondrial morphological damage induced by CIRI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBy observing the morphology of mitochondria in tissue cells under TEM transmission electron microscope ((FIG. 2A), compared with the Sham group, the mitochondria in the model group were damaged, which were manifested as decreased number of mitochondria, swelling of mitochondria, and increased degree of vacuolization. After drug treatment, the degree of mitochondrial damage was alleviated, some mitochondria were recovered, and the number of damaged mitochondria was reduced. However, in the shTFAM + MCAO group, the degree of mitochondrial damage was aggravated, the mitochondrial cristae disappeared, the degree of vacuolization was aggravated, and the therapeutic effects of shTFAM + ED and CAA drugs were also partially inhibited.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.5 CAA could improve the changes of ATP content and Ca\u003csup\u003e2+\u003c/sup\u003e content induced by CIRI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of ATP content and Ca\u003csup\u003e2+\u003c/sup\u003e content detection showed ((FIG. 2B-C) that compared with the Sham group, the ATP content decreased and Ca\u003csup\u003e2+\u003c/sup\u003e content increased, mitochondrial function damage increased, membrane permeability increased in the MCAO model group. After ED and CAA drug treatment, ATP content increased significantly and Ca\u003csup\u003e2+\u003c/sup\u003e content decreased significantly. However, in the shTFAM group, mitochondrial function and membrane permeability were aggravated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.6 CAA can regulate mtDNA copy number and TFB\u003csub\u003e2\u003c/sub\u003eM expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe detection of mtDNA copy number in brain tissue showed that the mtDNA copy number in the model group would decrease due to mitochondrial dysfunction, and this phenomenon was relieved and restored after the treatment with ED and CAA drugs. However, when TFAM was interfered, mtDNA copy number decreased significantly, and the therapeutic effect of drugs was also partially inhibited. The results of RT-qPCR and Western blot analysis of TFB\u003csub\u003e2\u003c/sub\u003eM signaling molecules (FIG. 2E-G) showed that \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e mRNA level and protein expression were decreased, and their expression was increased by ED and CAA administration. It may be suggested that CAA may alleviate oxidative stress injury by regulating the expression of mitochondrial transcription biogenesis genes. After shTFAM lentivirus treatment, the expression of \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e in the model group was significantly decreased, and the increase of \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e in the drug group was also partially inhibited.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.7 CAA can regulate TFAM and POLRMT\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe detected \u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e genes in the brain tissue of SD rats by immunofluorescence technology, and detected \u003cem\u003eTfam\u003c/em\u003e expression in the brain tissue by immunohistochemistry. The results of \u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e expression analysis by RT-qPCR and Western bolt showed that (FIG. 3A-I), The expression of \u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e decreased in the MCAO model group, and increased after drug treatment. However, after shTFAM lentivirus treatment, the expression of \u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e decreased significantly (P\u0026lt;0.05, P\u0026lt;0.01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 CAA can alleviate H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced oxidative stress in PC12 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.1 Selection of optimal drug concentration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the MTT results, the working concentration of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was selected as 400 \u0026mu;M, the working concentration of CAA was 100 \u0026mu;M, and the working concentration of ED was 200 \u0026mu;M (Figure 4A-C). According to the fluorescence results of shTFAM transfected PC12 cells, we finally selected MOI = 125 as our experimental condition for subsequent experiments (FIG. 4D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.2 CAA can alleviate oxidative stress injury induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of oxidative stress indexes of PC12 cells showed that the ROS level and MDA content in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group were higher than those in the Control group, and the SOD activity was lower than that in the control group. After CAA treatment, the three indexes were improved, and the results were consistent with the in vivo experiments. After down-regulation of TFAM gene by lentivirus, oxidative stress was aggravated in the shTFAM + model group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.3 CAA could reduce mitochondrial morphological damage induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of TEM transmission electron microscopy showed that compared with the control group, the mitochondria in the model group were damaged, while after drug treatment, the degree of mitochondrial damage was alleviated, some mitochondria were recovered, and the number of damaged mitochondria was reduced. However, in the shTFAM group, the degree of mitochondrial damage was aggravated, the disappearance of mitochondrial cristae and the degree of vacuolization were aggravated, and the therapeutic effects of ED and CAA drugs were also partially inhibited.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.4 CAA can improve the changes of ATP content and Ca\u003csup\u003e2+\u003c/sup\u003e content induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of detection of ATP content and Ca\u003csup\u003e2+\u003c/sup\u003e content in PC12 cells showed that, compared with the Control group, the ATP content in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e model group decreased and the Ca\u003csup\u003e2+\u003c/sup\u003e content increased, and both were improved after CAA treatment. However, when TFAM was down-regulated, the ATP content in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e model group decreased significantly and the Ca\u003csup\u003e2+\u003c/sup\u003e content increased significantly, and the improvement effect of the drug was weakened.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.5 CAA could alleviate H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced mtDNA copy number and TFB\u003csub\u003e2\u003c/sub\u003eM expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe detection of mtDNA copy number in brain tissue showed that the mtDNA copy number of the model group decreased, while the mtDNA copy number of the CAA drug group increased. When \u003cem\u003eTfam\u003c/em\u003e was interfered, mtDNA copy number decreased significantly, suggesting a close relationship between the therapeutic mechanism of CAA and mtDNA copy number. Subsequently, \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e signaling molecules were detected by RT-qPCR and Western bolt. As shown in FIG. 5E-G, the mRNA level and protein expression of \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e in the PC12 cell model group were significantly lower than those in the Control group. The mRNA and protein expression of \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e in the ED and CAA drug groups were higher than those in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group, which was consistent with the in vivo results. After shTFAM lentivirus treatment, the expression of \u003cem\u003eTfb\u003csub\u003e2\u003c/sub\u003eM\u003c/em\u003e in the model group was significantly lower than that in the normal group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.6 CAA could regulate the expression of TFAM and POLRMT induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e genes in PC12 cells were detected by immunofluorescence as well as RT-qPCR and Western bolt, and the results shown in Figure 6A-G showed that the expression of \u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e was reduced in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group compared with the control group. Compared with the model group, both expressions were increased. The expression of \u003cem\u003eTfam\u003c/em\u003e and \u003cem\u003ePolrmt\u003c/em\u003e in shTFAM lentivirus transfected group was lower than that in the normal group.\u003c/p\u003e"},{"header":"3. Experimental methods and materials","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Experimental Materials\u003c/h2\u003e \u003cp\u003eEdaravone (ED) was purchased from Jiangsu Simcere Pharmaceutical Co., LTD. CAA was purchased from EXTRASYNTHESE (France) with a purity above 95%; Fetal bovine serum (FBS) was purchased from Hangzhou Sijiqing Company; DMEM high glucose medium was purchased from Wuhan Punosai Technology Co., LTD. Rabbit polyclonal TFAM antibody (ab307302) and sheep polyclonal TFB\u003csub\u003e2\u003c/sub\u003eM antibody (ab118321) were purchased from Abcam, USA. Rabbit polyclonal POLRMT (PA5-116630) antibody was purchased from Thermo Fisher Scientific; MCAO wire bolt was purchased from Beijing Xinong Technology Co., LTD. TFAM lentivirus was purchased from Shanghai Jima Pharmaceutical Technology Co., LTD. MDA, SOD and ROS were purchased from Nanjing Jiancheng BioEngineering Institute.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.2 SD rats\u003c/h2\u003e \u003cp\u003eAll male SD rats were housed in separate cages in the rat housing room of the BSL-1 level laboratory of the Animal Experiment Center of Zhejiang University of Technology. The feeding environment was as follows: quiet, room temperature 21\u0026ndash;25 ℃, 50% humidity, and 12 hours light-dark cycle. SD male rats were fed and watered AD libitum. After one week of adaptive feeding, MCAO animal experiments were performed. All surgical procedures related to animals in the experiment were carried out after the approval of the Experimental Animal Ethics Committee of Zhejiang University of Technology.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.3 PC12 cells culture and treatment\u003c/h2\u003e \u003cp\u003ePC12 cells were obtained from Institute of Biology, Chinese Academy of Sciences. The cells were cultured in DMEM high glucose medium (containing 10% fetal bovine serum and 1% anti-penicillin-streptomycin and gentamicin) at 37 ℃ in 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. PC12 cells were treated with different concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (200, 400, 600, 800, 1000 \u0026micro;M), ED (50, 100, 200, 400, 800 \u0026micro;M), and CAA (50, 100, 200, 400, 800 \u0026micro;M) for 24 hours to explore the drug concentration.\u003c/p\u003e \u003cp\u003eshTFAM cell transfection: (1) Suitable PC12 cells were seeded in 96-well plates. (2) After overnight culture, the original medium was replaced by half the volume of virus working solution containing different MOI (MOI\u0026thinsp;=\u0026thinsp;50, 100, 125, 150). (3) After 4 hours, half volume of dye assistant solution containing 6 \u0026micro;g/ml polybrene was added and incubated at 37 ℃. (4) PC12 cells with \u003cem\u003eTfam\u003c/em\u003e gene knockdown were selected by changing to normal culture medium at 24 hours, and culture medium containing 2 \u0026micro;g/ml puromycin was added at 3 days. (5) The transfection efficiency of lentivirus was observed by fluorescence microscope. (6) The optimal MOI of transfection was used for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Experimental grouping\u003c/h2\u003e \u003cp\u003eThe experiment was divided into two parts, in vivo and in vitro, with 8 groups in each part. In vivo experiment: Sham operation group, Sham\u0026thinsp;+\u0026thinsp;shTFAM group, MCAO group, MCAO\u0026thinsp;+\u0026thinsp;shTFAM group, ED positive drug group, ED\u0026thinsp;+\u0026thinsp;shTFAM group, CAA treatment group, CAA\u0026thinsp;+\u0026thinsp;shTFAM group; In vitro experiment: control group, control\u0026thinsp;+\u0026thinsp;shTFAM group, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;shTFAM group, ED positive drug group, ED\u0026thinsp;+\u0026thinsp;shTFAM group, CAA treatment group, CAA\u0026thinsp;+\u0026thinsp;shTFAM group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.5 MCAO model\u003c/h2\u003e \u003cp\u003eThe left common carotid artery was exposed after the rats were anesthetized. The vagus nerve and parasympathetic nerve were gently separated, and the common carotid artery and external carotid artery were ligated. The common carotid artery was opened with a V-shaped opening, the thread was inserted into the internal carotid artery, and the thread was fixed. Cerebral ischemia-reperfusion injury was achieved by removing the thread plug 90 minutes later. Normal saline and corresponding drugs were administered at 0h and 12h after thrombectomy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Neurological score\u003c/h2\u003e \u003cp\u003eBehavioral analyses were performed by a double-blind method. 24 hours after cerebral ischemia-reperfusion, the neurological function was evaluated by Longa neurological scoring system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.7 TTC\u003c/h2\u003e \u003cp\u003eThe brain tissue of SD rats was removed and rinsed gently in normal saline, then placed at -20 ℃, and then quickly sectioned along the coronal plane of the brain with a sharp blade, with a thickness of about 2 mm. A total of 6 pieces were cut, and an appropriate amount of TTC staining solution was added and placed in a constant temperature oven at 37 ℃, and stained in the dark for 30 min to make it in uniform contact with the liquid. Image Pro plus software was used to analyze and calculate the infarct volume of brain tissue. The percentage of infarct volume\u0026thinsp;=\u0026thinsp;infarct volume/infarct side half brain volume\u0026times;100%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.8 H\u0026amp;E staining\u003c/h2\u003e \u003cp\u003eFollowing cardiac perfusion with 0.9% saline, brain tissues were fixed in 4% paraformaldehyde at 4\u0026deg;C overnight. Sections were mounted with neutral gum. Results were visualized using scanning software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e3.9 Nissl staining\u003c/h2\u003e \u003cp\u003eParaffin embedding and sectioning steps were performed as H\u0026amp;E staining. Sections were subjected to 95% ethanol for 5 seconds, absolute ethanol for 1 minute, and xylene three times for 2 minutes each. Scanning software was used to observe the results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e3.10 TEM was used to observe mitochondrial morphology\u003c/h2\u003e \u003cp\u003eBrain tissues and PC12 cells were fixed in 2.5% glutaraldehyde (PBS) at 4\u0026deg;C overnight, rinsed with 0.1 M phosphate buffer (3 \u0026times; 15 min), and post-fixed in 0.1 M osmic acid for 2 h. Mitochondrial morphology was analyzed by TEM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e3.11 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eCells grown on cover slides were fixed with 4% paraformaldehyde solution and then blocked for 1 h at room temperature. After blocking, the primary antibody was dropped onto the sections and incubated overnight at 4 ℃. Secondary antibodies (Beyotime) were added and incubated for 2 hours at 37 ℃. Sections were observed under a fluorescence microscope and photographed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003e3.12 Detection of oxidative stress indicators\u003c/h2\u003e \u003cp\u003eROS content: DCFH-DA probe was used to load tissue homogenate and cells, with ROS detected by fluorescence microplate reader (Ex: 488 nm, Em: 525 nm). Results were normalized to protein concentration.\u003c/p\u003e \u003cp\u003eSOD activity: Samples were lysed on ice for 15 min, centrifuged at 14000 g (4 ℃, 10 min), and supernatants collected. Protein concentration was measured by BCA assay, and SOD activity was determined using a detection kit, normalized to protein concentration.\u003c/p\u003e \u003cp\u003eMDA content: Samples were processed as for SOD, and MDA levels were measured using a detection kit, normalized to protein concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003e3.13 Mitochondrial index detection\u003c/h2\u003e \u003cp\u003eATP content determination: ATP lysate was added to the homogenate tissue and PC12 cells, and after lysis, the supernatant was removed by centrifugation at 12000 g for 5 min at 4 ℃ and used for subsequent determination. ATP content in brain tissue and PC12 cells was determined according to the instructions of the Enhanced ATP Assay Kit (Beyotime, Shanghai, China) and normalized by protein concentration.\u003c/p\u003e \u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e content detection: After the homogenate tissue and PC12 cells were collected, an appropriate amount of detection lysate was added, and the supernatant was collected by centrifugation at 14000g for 5 minutes at 4 ℃. Calcium content in tissue homogenates and PC12 cells was determined according to the instructions of the Calcium content chromogenic detection kit (Shanghai Biyuntian Biotechnology Co., LTD.) and normalized by protein concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003e3.14 RT-qPCR and mtDNA copy number\u003c/h2\u003e \u003cp\u003eTotal RNA from tissues and PC12 cells was extracted using Trizol (Invitrogen, USA, 12183-555) and reverse transcribed using a kit (Invitrogen, USA, 11752-050). Primer sequences (Sangon, Shanghai, China) are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eFor analysis of mitochondrial DNA content, total DNA was extracted from tissues and cells using the Universal Genomic DNA kit (CW2298S, CWBIO, Beijing, China), and 10 ng of DNA was used for qPCR analysis. MtDNA copy number was measured using the mitochondrial D-LOOP gene. Primer sequences (Shenggong, Shanghai, China) are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence(5'to3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTfam\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTTCTCCGAAGCATGTGGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTTCAGCTTTTCCTGCGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePolrmt\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTCACCACAACAACCAAGACAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CGTCCGTCAGCATGATGAACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTfb\u003c/em\u003e\u003csub\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sub\u003e\u003cem\u003eM\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AAGAATGCGGATGGAGAGTTACAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:GAACACCTGCTGACCAAGGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMtdna\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTTCTTACTTCAGGGCCATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TGATTAGACCCGTTACCATCGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec33\" class=\"Section2\"\u003e \u003ch2\u003e3.15 Western blot\u003c/h2\u003e \u003cp\u003ePC12 cells were washed 3 times with ice-cold PBS and lysed in RIPA buffer for 15 minutes on ice. Brain tissue (20 mg) was homogenized in RIPA buffer at 60 Hz, centrifuged at 15000 rcf, and the supernatant collected as protein samples. Protein concentration was measured using a BCA kit (Basted). Equal protein amounts were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk at room temperature. Membranes were incubated with primary antibodies at 4 ℃ overnight, followed by HRP-conjugated secondary antibodies for 1 h at room temperature after TBST washing. Bands were visualized using a ChemiDoc XRS\u0026thinsp;+\u0026thinsp;system (Bio-Rad) and quantified with ImageJ (1.8.0). Tubulin served as the loading control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section2\"\u003e \u003ch2\u003e3.16 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. All data processing was performed using GraphPad Prism software, version 5.0. Results between treatments were compared using one-way ANOVA or two-way ANOVA. Results were considered significantly different at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eGiven the brain's high sensitivity to oxygen deprivation, hypoxia emerges as a pivotal factor in the pathogenesis of cerebral ischemia-reperfusion injury. During the ischemic and reperfusion phases, a substantial surge in ROS is observed. This ROS escalation subsequently modulates vascular reactivity, inflicts damage on vascular endothelial cells, and compromises the integrity of the blood-brain barrier [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Furthermore, ROS instigates lipid peroxidation of unsaturated fatty acids, precipitating the degradation and impairment of cellular and organellar membranes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Consequently, these events culminate in a cascade of detrimental effects including cerebral edema, inflammatory responses, neuronal apoptosis, and the expansion of the infarcted region, progressively exacerbating brain tissue damage and potentially leading to mortality [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eED, recognized as a classical neuroprotective agent and free radical scavenger, exerts its protective effects by neutralizing free radicals and curtailing lipid peroxidation, thereby mitigating oxidative damage to cerebral, vascular endothelial, and neuronal cells [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. CAA, a natural phytochemical, exhibits multifaceted therapeutic properties including anti-epileptic, anxiolytic, antidepressant, and antioxidative effects. However, the precise antioxidative mechanisms of CAA remain to be fully elucidated. In this context, we employed ED as a positive control to investigate the therapeutic mechanisms of CAA against oxidative stress induced by cerebral ischemia-reperfusion injury, with a particular focus on the potential interplay between CAA's antioxidative properties and \u003cem\u003eTfam\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eTfam\u003c/em\u003e, a nuclear-encoded mitochondrial transcription factor, functions as a DNA-binding protein essential for the maintenance of mtDNA integrity [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. It plays a dual role in stabilizing mtDNA and initiating its replication, thereby being indispensable for mtDNA metabolism. As a cornerstone of mitochondrial biogenesis, \u003cem\u003eTfam\u003c/em\u003e's significance is underscored during oxidative stress, where ROS activates the \u003cem\u003ePgc-1α-Nrf2\u003c/em\u003e signaling pathway, subsequently upregulating \u003cem\u003eTfam\u003c/em\u003e. This pathway is a critical antioxidant mechanism, enhancing cellular antioxidant defenses [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In our experimental paradigm, lentiviral-mediated knockdown of \u003cem\u003eTfam\u003c/em\u003e was achieved 24 hours post-ventricular injection, following established protocols [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We observed a marked upregulation of TFAM expression in both brain tissue and PC12 cells following treatment with ED and CAA. Moreover, TFAM interference exacerbated oxidative stress and tissue damage, as evidenced by elevated ROS levels and MDA content, further affirming \u003cem\u003eTfam\u003c/em\u003e's pivotal role in oxidative stress mitigation.\u003c/p\u003e \u003cp\u003eMitochondria, as the epicenter of bioenergetic metabolism, are critically implicated in oxidative stress dynamics [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Our experimental assessments of mitochondrial function, through measurements of Ca\u003csup\u003e2+\u003c/sup\u003e and ATP levels alongside mtDNA copy number, revealed that oxidative stress impairs mitochondrial function, as indicated by decreased ATP and increased Ca\u003csup\u003e2+\u003c/sup\u003e levels, and reduced mtDNA copy number in the model group. Treatment with ED and CAA ameliorated these mitochondrial dysfunctions, suggesting their potential in enhancing mitochondrial resilience against oxidative stress.\u003c/p\u003e \u003cp\u003eDelving deeper into the TFAM signaling cascade, we uncovered that \u003cem\u003eTfam\u003c/em\u003e is instrumental in mtDNA transcription, facilitating both replication and transcription processes. Specifically, \u003cem\u003eTfam\u003c/em\u003e binds to mitochondrial promoters, recruits \u003cem\u003ePolrmt\u003c/em\u003e, and subsequently engages \u003cem\u003eTfb2M\u003c/em\u003e to initiate mtDNA transcription [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This transcriptional activity enables the replacement of damaged mitochondria, thereby ameliorating oxidative stress-induced mitochondrial damage. Post-treatment with ED and CAA, an upregulation in the expression of these transcription factors was noted, highlighting their protective pathways. Lentiviral knockdown of \u003cem\u003eTfam\u003c/em\u003e resulted in diminished expression of \u003cem\u003ePolrmt\u003c/em\u003e and \u003cem\u003eTfb2M\u003c/em\u003e across all groups, underscoring TFAM's critical role in mitochondrial transcription and biogenesis. Thus, we conclude that ED and CAA alleviate oxidative stress by modulating \u003cem\u003eTfam\u003c/em\u003e, thereby safeguarding mitochondrial integrity and mitigating oxidative damage through the regulatory interplay between \u003cem\u003eTfam\u003c/em\u003e and mitochondrial transcription biogenesis.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003e \u003cem\u003eTfam\u003c/em\u003e plays a crucial role in protecting the body from oxidative stress damage, including protecting mitochondrial function, alleviating oxidative stress damage and promoting mitochondrial transcription biogenesis, etc. The antioxidant mechanism of the body was further explored by the use of ED and CAA. These findings may provide new research avenues for the prevention and treatment of ischemic stroke. We will continue to explore these studies in depth to elucidate the relevant antioxidant protective mechanisms.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by grants from the National Natural Science Foundation of China, grant number 82174038 and Zhejiang Provincial Natural Science Foundation of China, grant number LD22H090002.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants from the National Natural Science Foundation of China (No. 82174038), the major of Zhejiang Provincial Natural Science Foundation of China (No. LD22H090002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo interests are declared.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003ePaul S, Candelario-Jalil E (2021) Emerging neuroprotective strategies for the treatment of ischemic stroke: An overview of clinical and preclinical studies. Experimental neurology 335:113518. doi:10.1016/j.expneurol.2020.113518\u003c/li\u003e\n \u003cli\u003eLee EC, Ha TW, Lee DH, Hong DY, Park SW, Lee JY, Lee MR, Oh JS (2022) Utility of Exosomes in Ischemic and Hemorrhagic Stroke Diagnosis and Treatment. International journal of molecular sciences 23 (15). doi:10.3390/ijms23158367\u003c/li\u003e\n \u003cli\u003eMao Z, Tian L, Liu J, Wu Q, Wang N, Wang G, Wang Y, Seto S (2022) Ligustilide ameliorates hippocampal neuronal injury after cerebral ischemia reperfusion through activating PINK1/Parkin-dependent mitophagy. Phytomedicine : international journal of phytotherapy and phytopharmacology 101:154111. doi:10.1016/j.phymed.2022.154111\u003c/li\u003e\n \u003cli\u003eSharma D, Maslov LN, Singh N, Jaggi AS (2020) Remote ischemic preconditioning-induced neuroprotection in cerebral ischemia-reperfusion injury: Preclinical evidence and mechanisms. European journal of pharmacology 883:173380. doi:10.1016/j.ejphar.2020.173380\u003c/li\u003e\n \u003cli\u003ePeoples JN, Saraf A, Ghazal N, Pham TT, Kwong JQ (2019) Mitochondrial dysfunction and oxidative stress in heart disease. Experimental \u0026amp; molecular medicine 51 (12):1-13. doi:10.1038/s12276-019-0355-7\u003c/li\u003e\n \u003cli\u003eCai W, Chong K, Huang Y, Huang C, Yin L (2024) Empagliflozin improves mitochondrial dysfunction in diabetic cardiomyopathy by modulating ketone body metabolism and oxidative stress. Redox biology 69:103010. doi:10.1016/j.redox.2023.103010\u003c/li\u003e\n \u003cli\u003eJassim AH, Fan Y, Pappenhagen N, Nsiah NY, Inman DM (2021) Oxidative Stress and Hypoxia Modify Mitochondrial Homeostasis During Glaucoma. Antioxidants \u0026amp; redox signaling 35 (16):1341-1357. doi:10.1089/ars.2020.8180\u003c/li\u003e\n \u003cli\u003eDavidson SM, Lopaschuk GD, Spedding M, Beart PM (2014) Mitochondrial pharmacology: energy, injury and beyond. British journal of pharmacology 171 (8):1795-1797. doi:10.1111/bph.12679\u003c/li\u003e\n \u003cli\u003eSong Y, Wang W, Wang B, Shi Q (2024) The Protective Mechanism of TFAM on Mitochondrial DNA and its Role in Neurodegenerative Diseases. Molecular neurobiology 61 (7):4381-4390. doi:10.1007/s12035-023-03841-7\u003c/li\u003e\n \u003cli\u003eZhao M, Wang Y, Li L, Liu S, Wang C, Yuan Y, Yang G, Chen Y, Cheng J, Lu Y, Liu J (2021) Mitochondrial ROS promote mitochondrial dysfunction and inflammation in ischemic acute kidney injury by disrupting TFAM-mediated mtDNA maintenance. Theranostics 11 (4):1845-1863. doi:10.7150/thno.50905\u003c/li\u003e\n \u003cli\u003eLiu H, Zhen C, Xie J, Luo Z, Zeng L, Zhao G, Lu S, Zhuang H, Fan H, Li X, Liu Z, Lin S, Jiang H, Chen Y, Cheng J, Cao Z, Dai K, Shi J, Wang Z, Hu Y, Meng T, Zhou C, Han Z, Huang H, Zhou Q, He P, Feng D (2024) TFAM is an autophagy receptor that limits inflammation by binding to cytoplasmic mitochondrial DNA. Nature cell biology 26 (6):878-891. doi:10.1038/s41556-024-01419-6\u003c/li\u003e\n \u003cli\u003eHuang Q, Wu D, Zhao J, Yan Z, Chen L, Guo S, Wang D, Yuan C, Wang Y, Liu X, Xing J (2022) TFAM loss induces nuclear actin assembly upon mDia2 malonylation to promote liver cancer metastasis. The EMBO journal 41 (11):e110324. doi:10.15252/embj.2021110324\u003c/li\u003e\n \u003cli\u003ePopov LD (2020) Mitochondrial biogenesis: An update. Journal of cellular and molecular medicine 24 (9):4892-4899. doi:10.1111/jcmm.15194\u003c/li\u003e\n \u003cli\u003eLiu L, Li Y, Chen G, Chen Q (2023) Crosstalk between mitochondrial biogenesis and mitophagy to maintain mitochondrial homeostasis. Journal of biomedical science 30 (1):86. doi:10.1186/s12929-023-00975-7\u003c/li\u003e\n \u003cli\u003eZhou HL, Wang BB, Fan XL, Zhang XM, Song Y (2024) Carvacrol acetate activated Nrf2 modulates mitophagy for the treatment of neurocyte oxidative stress induced by chlorpyrifos. Ecotoxicology and environmental safety 289:117484. doi:10.1016/j.ecoenv.2024.117484\u003c/li\u003e\n \u003cli\u003eSouza RL, Opretzka LCF, Morais MC, Melo CO, Oliveira BEG, Sousa DP, Villarreal CF, Oliveira EE (2023) Nanoemulsion Improves the Anti-Inflammatory Effect of Intraperitoneal and Oral Administration of Carvacryl Acetate. Pharmaceuticals (Basel, Switzerland) 17 (1). doi:10.3390/ph17010017\u003c/li\u003e\n \u003cli\u003eAkan T, Aydın Y, Korkmaz OT, Ulupınar E, Saydam F (2023) The Effects of Carvacrol on Transient Receptor Potential (TRP) Channels in an Animal Model of Parkinson\u0026apos;s Disease. Neurotoxicity research 41 (6):660-669. doi:10.1007/s12640-023-00660-5\u003c/li\u003e\n \u003cli\u003eZare Mehrjerdi F, Niknazar S, Yadegari M, Akbari FA, Pirmoradi Z, Khaksari M (2020) Carvacrol reduces hippocampal cell death and improves learning and memory deficits following lead-induced neurotoxicity via antioxidant activity. Naunyn-Schmiedeberg\u0026apos;s archives of pharmacology 393 (7):1229-1237. doi:10.1007/s00210-020-01866-6\u003c/li\u003e\n \u003cli\u003eZeng X, Zhang YD, Ma RY, Chen YJ, Xiang XM, Hou DY, Li XH, Huang H, Li T, Duan CY (2022) Activated Drp1 regulates p62-mediated autophagic flux and aggravates inflammation in cerebral ischemia-reperfusion via the ROS-RIP1/RIP3-exosome axis. Military Medical Research 9 (1):25. doi:10.1186/s40779-022-00383-2\u003c/li\u003e\n \u003cli\u003eWang B, Wang Y, Zhang J, Hu C, Jiang J, Li Y, Peng Z (2023) ROS-induced lipid peroxidation modulates cell death outcome: mechanisms behind apoptosis, autophagy, and ferroptosis. Archives of toxicology 97 (6):1439-1451. doi:10.1007/s00204-023-03476-6\u003c/li\u003e\n \u003cli\u003eShen L, Gan Q, Yang Y, Reis C, Zhang Z, Xu S, Zhang T, Sun C (2021) Mitophagy in Cerebral Ischemia and Ischemia/Reperfusion Injury. Frontiers in aging neuroscience 13:687246. doi:10.3389/fnagi.2021.687246\u003c/li\u003e\n \u003cli\u003eDang R, Wang M, Li X, Wang H, Liu L, Wu Q, Zhao J, Ji P, Zhong L, Licinio J, Xie P (2022) Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/Gpx4 pathway. Journal of neuroinflammation 19 (1):41. doi:10.1186/s12974-022-02400-6\u003c/li\u003e\n \u003cli\u003eZhu G, Zeng Y, Peng W, Lu C, Cai H, Abuduxukuer Z, Chen Y, Chen K, Song X, Song Y, Ye L, Wang J, Jin M (2024) Edaravone alleviated allergic airway inflammation by inhibiting oxidative stress and endoplasmic reticulum stress. European journal of pharmacology 966:176317. doi:10.1016/j.ejphar.2024.176317\u003c/li\u003e\n \u003cli\u003eKozhukhar N, Alexeyev MF (2023) 35 Years of TFAM Research: Old Protein, New Puzzles. Biology 12 (6). doi:10.3390/biology12060823\u003c/li\u003e\n \u003cli\u003eShen Q, Fang J, Guo H, Su X, Zhu B, Yao X, Wang Y, Cao A, Wang H, Wang L (2023) Astragaloside IV attenuates podocyte apoptosis through ameliorating mitochondrial dysfunction by up-regulated Nrf2-ARE/TFAM signaling in diabetic kidney disease. Free radical biology \u0026amp; medicine 203:45-57. doi:10.1016/j.freeradbiomed.2023.03.022\u003c/li\u003e\n \u003cli\u003eGuo B, Zheng C, Cao J, Luo F, Li H, Hu S, Mingyuan Lee S, Yang X, Zhang G, Zhang Z, Sun Y, Wang Y (2024) Tetramethylpyrazine nitrone exerts neuroprotection via activation of PGC-1\u0026alpha;/Nrf2 pathway in Parkinson\u0026apos;s disease models. Journal of advanced research 64:195-211. doi:10.1016/j.jare.2023.11.021\u003c/li\u003e\n \u003cli\u003eShi, X. W., Jia, F., Lyu, P., \u0026amp; Xu, F. Q. (2022). A new anterograde trans-synaptic tracer based on Sindbis virus. Neural regeneration research, 17(12), 2761\u0026ndash;2764. doi.org/10.4103/1673-5374.339495\u003c/li\u003e\n \u003cli\u003eLiu, S., Zhu, S., Zou, Y., Wang, T., \u0026amp; Fu, X. (2015). Knockdown of IL-1\u0026beta; improves hypoxia-ischemia brain associated with IL-6 up-regulation in cell and animal models. Molecular neurobiology, 51(2), 743\u0026ndash;752. doi.org/10.1007/s12035-014-8764-z\u003c/li\u003e\n \u003cli\u003eHsieh AH, Reardon SD, Munozvilla-Cabellon JH, Shen J, Patel SS, Mishanina TV (2023) Expression and Purification of Recombinant Human Mitochondrial RNA Polymerase (POLRMT) and the Initiation Factors TFAM and TFB2M. Bio-protocol 13 (23):e4892. doi:10.21769/BioProtoc.4892\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"TFAM, Oxidative Stress, Mitochondria, Mitochondrial DNA, CAA, MCAO","lastPublishedDoi":"10.21203/rs.3.rs-6213424/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6213424/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjectives: \u003c/strong\u003eIn the present study, we aimed to investigate the antioxidant and therapeutic protective effects of\u0026nbsp; mitochondrial transcription factor A (TFAM) signaling molecules on Mitochondrial damage of cerebral ischemia-reperfusion through.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003ePC12 cells were stimulated with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in vivo, and healthy SD rats were used to establish MCAO model in vitro. Longa neurological score was used to measure the behavior of SD rats. TTC staining was used to observe the ischemic infarction in the cerebral hemisphere of the lesion area. TEM was used to observe the morphological changes of mitochondria in nerve cells of brain tissue and PC12 cells. ROS/SDO/MDA/ATP detection kit was used to detect the corresponding indicators. RT-qPCR was used to detect the mRNA level of target gene and mtDNA copy number changes. Immunofluorescence and Western blot were used to detect the expression of target protein. Based on the \u003cem\u003eTfam\u003c/em\u003e gene study, we used lentivirus to down-regulate the \u003cem\u003eTfam\u003c/em\u003e gene by brain injection in vitro and by cell transfection in vitro.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eAfter oxidative stress in the MCAO model of SD rats, the neurological score increased, the volume of ischemic area of cerebral infarction increased, the morphology of nerve cells in brain tissue and PC12 cells was disordered, the mitochondria appeared vacuolated, the contents of ROS and MDA increased, and the activity of SOD decreased. Oxidative stress causes mitochondrial dysfunction, resulting in the reduction of mtDNA copy number and the decreased expression of \u003cem\u003eTfam\u003c/em\u003e in brain tissue nerve cells and PC12 cells, which in turn affects mitochondrial transcription biogenesis and decreases the expression of \u003cem\u003ePolrmt\u003c/em\u003e and \u003cem\u003eTfb\u003c/em\u003e\u003csub\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sub\u003e\u003cem\u003eM\u003c/em\u003e molecules. CAA promotes intracellular TFAM expression and activates its antioxidant pathway, thereby protecting mtDNA and alleviating oxidative stress and mitochondrial damage caused by MCAO in vitro and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e stimulation in vivo. Lentivirus down-regulates the expression of \u003cem\u003eTfam\u003c/em\u003e, and under its action, the antioxidant and mitochondrial protection effects of CAA are weakened. When \u003cem\u003eTfam\u003c/em\u003e was disrupted, the protective effect of CAA on mitochondria was inhibited.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eTFAM signaling molecules alleviates CIRI.\u003c/p\u003e","manuscriptTitle":"TFAM Signaling Molecule Alleviates Mitochondrial damage of Cerebral Ischemia-Reperfusion","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-04 05:46:29","doi":"10.21203/rs.3.rs-6213424/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bd2cb0a3-3288-46e8-be92-46a1980dd307","owner":[],"postedDate":"August 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46140531,"name":"Biological sciences/Neuroscience/Cognitive neuroscience/Cognitive control"},{"id":46140532,"name":"Health sciences/Diseases/Neurological disorders/Stroke"}],"tags":[],"updatedAt":"2026-02-07T08:20:19+00:00","versionOfRecord":{"articleIdentity":"rs-6213424","link":"https://doi.org/10.1038/s41420-025-02930-x","journal":{"identity":"cell-death-discovery","isVorOnly":false,"title":"Cell Death Discovery"},"publishedOn":"2026-01-08 05:00:00","publishedOnDateReadable":"January 8th, 2026"},"versionCreatedAt":"2025-08-04 05:46:29","video":"","vorDoi":"10.1038/s41420-025-02930-x","vorDoiUrl":"https://doi.org/10.1038/s41420-025-02930-x","workflowStages":[]},"version":"v1","identity":"rs-6213424","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6213424","identity":"rs-6213424","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.