Results
IL-1R2 was first identified and characterized in mammals ( McMahan et al., 1991 ), bovines ( Yu et al., 1997 ), and fish ( Yang et al., 2013 ), and it may act as a prototypical decoy receptor ( Mantovani et al., 2001 ). Recently, the family of decoy receptors has been identified and characterized as IL-18, TNF, and IL-27 ( Mantovani et al., 2001 ). In mammals, such as humans and mice, the transmembrane regions were similar in IL-1R2 and IL-1R1 but only having a 28% homology in their extracellular domains ( Dale and Nicklin, 1999 ). The structure of IL-1R2 is similar to that of IL-1R1, which includes a signal peptide, 3 Ig-like extracellular domains, and a single helical transmembrane domain and cytoplasmic domain; however, the length of the cytoplasmic domain in IL-1R2 is shorter than that of IL-1R1, which is approximately 200 amino acids, critical to the TIR domain ( Slack et al., 2000 ). Moreover, it has been shown that that most decoy receptors including IL-1R2, can not transduce signals because of the lack of an intracellular TIR domain, a conserved region shared by IL-1R1 and Toll-like receptors ( TLRs ) as part of the IL-1/TLR superfamily ( Colotta et al., 1993 ). In our study, chicken IL-1R2 (chIL-1R2) encoded 412 amino acids (aa), including 27 aa of the signal peptides, 3 aa of the Ig-like extracellular domains, 22 aa of the transmembrane domains, and 17 aa of the cytoplasmic domains ( Figure 1 ). These results suggest that the structure of the chIL-1R2 gene is similar to that of mammals, such as humans and mice. Figure 1 Multiple sequence alignment of the predicted chicken IL-1R2 with selected vertebrate mammalian IL-1R2 sequences was performed using the ClustalX program. The signal peptide, Ig domain, N-linked glycosylation sites, transmembrane, and cytoplasm domain are indicated in dark black, underline, bold, bold-underline, and dashed-underline, respectively. GenBank accession number NP_004624 for human, XP_010726144 for turkey, NP_446405 for mouse, AJA72724 for zebrafish, XP_009441272 for chimpanzee, NP_001075285 for horse, and XP_012029107 for sheep. Figure 1
Multiple sequence alignment of the predicted chicken IL-1R2 with selected vertebrate mammalian IL-1R2 sequences was performed using the ClustalX program. The signal peptide, Ig domain, N-linked glycosylation sites, transmembrane, and cytoplasm domain are indicated in dark black, underline, bold, bold-underline, and dashed-underline, respectively. GenBank accession number NP_004624 for human, XP_010726144 for turkey, NP_446405 for mouse, AJA72724 for zebrafish, XP_009441272 for chimpanzee, NP_001075285 for horse, and XP_012029107 for sheep.
When this sequence was compared with other known sequences of IL-1R2, IL-1R1, and IL-18R1 in a phylogenetic tree, we observed a higher degree of amino acid similarity to the IL-1R2 sequences than to the IL-1R1 sequences ( Figure 2 A). The chIL-1R2 protein was most closely related to chicken and turkey IL-1R2 with 94.7% and 96.4%, respectively ( Table 1 ). The predicted amino acid sequence of the chIL-1R2 was approximately 42% identical to that of chimpanzee and human IL-1R2; 39% identical to sheep and cattle; 36.5% identical to rat and mouse IL-1R2; and 16.3% and 20.6% identical to zebrafish and salmon IL-1R2, respectively ( Table 1 ). When conservative amino acid substitutions were included in the analysis, the similarity values increased to 51% with chimpanzee and human IL-1R2, about 49% to 51% with the ruminant IL-1R2, 44% with the rodent (mouse and rat); about 27.6% to 30% identical to fish IL-1R2 ( Table 1 ). The domain organization of chIL-1R2 further confirmed that this receptor corresponds to the mammalian IL-1R2 ortholog, which has three Ig-like domains in the extracellular region but lacks an intracellular signaling TIR domain ( Figure 1 ). In the extracellular membrane region, six cysteine residues were conserved in chicken and all mammals compared at positions C 75 , C 135 , C 177 , C 232 , C 284 , and C 352 . Among the six conserved cysteine residues, the last four backbone residues formed interchain disulfide bonds in the Ig-like (C-x*-C) domain. In addition, four proline residues at positions P 124 , P 128 , P 262 , and P 267 related to signal transduction in IL-1R2 were conserved among all species examined ( Kuno et al., 1993 ). The phylogenetic tree showed that chIL-1R2 sequences formed a cluster with those of mammalian IL-1R2, whereas IL-1R1 and IL-18R1 proteins formed a separate branch ( Figure 2 A). The chIL-1R2 cDNA was subcloned into the pET32a (+) vector, expressed in E. coli BL21, and purified using HisPur cobalt with a polyhistidine tag. A single protein band with an apparent molecular mass of approximately 70.0 kDa was observed ( Figure 2 B). The increased size over the predicted 47.5 kDa was due to several epitope tags, such as polyhistidine, S-protein, and thioredoxin in the recombinant protein. Figure 2 Phylogenetic and western blot analysis. ( A ) Phylogenetic tree illustrating the relationships between interleukin (IL)-1 receptor 2 (IL-1R2) cytokine family members in chickens and other vertebrates. ( B ) Western blot analysis of chIL-1R2 recombinant protein using anti-His (C-Term)-HRP antibody. Figure 2
Phylogenetic and western blot analysis. ( A ) Phylogenetic tree illustrating the relationships between interleukin (IL)-1 receptor 2 (IL-1R2) cytokine family members in chickens and other vertebrates. ( B ) Western blot analysis of chIL-1R2 recombinant protein using anti-His (C-Term)-HRP antibody.
Human IL-1R2 could be used as a biomarker and plays a pivotal role in human diseases, such as arthritis, endometriosis, sepsis/sickness behavior, organ transplantation, diabetes, atherosclerosis, Alzheimer's disease, autoimmune inner ear disease (AIED), and ulcerative colitis ( Vambutas et al., 2009 ; Peters et al., 2013 ; Liu et al., 2015 ; Chen et al., 2016 ). In this study, the gene expression pattern of chIL-1R2 was investigated in 17 healthy chicken tissue samples ( Figure 3 ) using qRT-PCR analysis and showed that the chIL-1R2 gene was highly expressed in the chicken kidney, lung, spleen, small intestine, and liver under normal conditions ( Figure 3 A). Contrastingly, chIL-1R2 was also moderately expressed in chicken pancreas, trachea, ceca, cloaca, duodenum, thymus, and heart tissues. In addition, chIL-1R2 was expressed in other tissues, including the crop, gizzard, and muscle ( Figure 3 A). In mammals, IL-1R2 is expressed in all healthy adult tissues and cell types, and is especially highly expressed in immune cells and tissues ( Peters et al., 2013 ). In our study, we showed that ch IL-1R2 was highly expressed in immune tissues, such as the lung, spleen, kidney, and small intestine. At present, information on the physiological role of chIL-1R2 is limited. Interestingly, the expression of ch IL-1R2 is the highest in the lung, spleen, kidney, and small intestine, and further studies are warranted to understand its role in normal conditions as well as inflammatory conditions caused by viral pathogens. Figure 3 ( A ) The expression of chicken IL-1R2 mRNA in healthy chicken tissues. Gene expression levels were normalized to GAPDH . Data are presented as the mean ± standard error (SEM) of three independent experiments, and the values with different superscript characters (a, b, and c) indicate significant differences between the control and treatment groups determined by one-way ANOVA ( P < 0.05). ( B ) Reactivity of recombinant chIL-1R2 with IL-1β. Microtiter plates were coated with serial dilutions of recombinant chIL-1R2 (red line) and Trx-Tag protein (black line), then incubated with 20 pmol/well of chIL-1β protein, and sequentially incubated with chIL-1β antibody, and then the HRP-goat anti-chicken IgG and TMB substrate were added. Figure 3
( A ) The expression of chicken IL-1R2 mRNA in healthy chicken tissues. Gene expression levels were normalized to GAPDH . Data are presented as the mean ± standard error (SEM) of three independent experiments, and the values with different superscript characters (a, b, and c) indicate significant differences between the control and treatment groups determined by one-way ANOVA ( P < 0.05). ( B ) Reactivity of recombinant chIL-1R2 with IL-1β. Microtiter plates were coated with serial dilutions of recombinant chIL-1R2 (red line) and Trx-Tag protein (black line), then incubated with 20 pmol/well of chIL-1β protein, and sequentially incubated with chIL-1β antibody, and then the HRP-goat anti-chicken IgG and TMB substrate were added.
Engagement of IL-1β and its receptors, that is,IL-1R1 and IL-1R2, play an important role in mediating inflammation and initiating the immune response against virus infections in humans ( Liu et al., 2013 ), mice ( Schmitz et al., 2005 ; Szretter et al., 2007 ), dogs ( Kang et al., 2013 ), ducks ( Cornelissen et al., 2012 ), and chickens ( Gao et al., 2017 ). Recent studies have demonstrated that IL-1β, IL-1R1, and IL-1R2 are highly upregulated in infected organs such as the lungs, intestine, trachea, spleen, bursa of Fabricius, gut, brain, thymus, and blood, which is considered a host defense response to influenza virus infection ( Schmitz et al., 2005 ; Szretter et al., 2007 ; Cornelissen et al., 2012 ). Moreover, the binding of the IL-1β and IL-1R1 have already been shown to play a critical role in inducing the expression of pro-inflammatory cytokines including IL-1β, IL-6, TNF-α, and trypsin in mouse lungs and human alveolar A549 cells in the early phase of infection ( Schmitz et al., 2005 ). Furthermore, it has been demonstrated that the engagement of IL-1β and IL-1R1 play essential roles in viral infectious diseases ( Schmitz et al., 2005 ). Moreover, recent research has shown that IL-1R2 may serve as a local regulatory point involved in IL-1β-mediated immune responses, thereby controlling the inflammatory process in humans, mice, and teleost fish ( Peters et al., 2013 ; Yang et al., 2013 ; Liu et al., 2015 ). In this study, the receptor-binding specificity of the recombinant protein of chIL-1R2 binding to IL-1β was evaluated using quantitative ELISA, which showed that the affinity of rchIL-1R2 binding to IL-1β was much higher than that of the control group with IL-1β ( Figure 3 B). This not only helps to understand the functional role of chIL-R2 but also suggests additional applications for targeting chicken IL-1β signal transduction pathways.
Poly (I:C), a synthetic analog of double-stranded RNA (dsRNA), is one of the classes of pathogen-associated molecular patterns associated with viral infections ( Maeda et al., 2019 ). Poly(I:C) activates the antiviral pattern recognition receptors TLR3, RIG-I/MDA5, and PKR, thereby inducing multiple inflammatory pathways including NF-κB and IRF ( Maeda et al., 2019 ). To understand the expression pattern of this gene, the transcriptional profiles of chIL-1R1 and chIL-1R2 were investigated in chicken DF1 cells stimulated with the TLR3 agonist poly (I:C). To verify whether the expression of ch IL-1R1 and ch IL-1R2 genes is regulated by TLR3 signaling, the expression of ch IL-8L1 , which is known to be induced by TLR3 signaling, was also examined in addition to ch IL-1R1 and chIL-1R2 expression. Stimulation with 5 μg/mL poly (I:C) after 24 h significantly upregulated the expression of both ch IL-1R1 and ch IL-1R2 ( Figure 4 A). Research in other species, such as humans, mice, and fish, demonstrated that the regulation of IL-1 receptors, such as IL-1R1 and IL-1R2, is possibly dependent on JNK, p42/44, and NF-κB signaling pathways ( Dunne and O'Neill, 2003 ; Seo et al., 2012 ; Peters et al., 2013 ; Yang et al., 2013 ). In contrast, the regulation of chIL-1R1 or chIL-1R2 signaling pathways in chickens remains to be determined whether the transcription factor NF-κB is responsible for ch IL-1R1 and ch IL-1R2 transcription. DF-1 cells were pretreated with NF-κB inhibitor before poly (I:C) stimulation ( Figure 4 B). The expression of both ch IL-1R2 and ch IL-1R1 was upregulated after treatment with 5 μg/mL poly (I:C) in the absence of inhibitors. However, in the presence of a transcriptional NF-κB inhibitor, the expression of ch IL-1R2 and ch IL-1R1 was significantly downregulated compared with that in the poly (I:C)-only treated control, in which ch IL-1R1 expression was completely inhibited (more than 69%) by BAY as an NF-κB inhibitor only compared to poly (I:C)-only treated control ( P < 0.05). The results demonstrated that the regulation of ch IL-1R1 was mediated by the IκBα subunit of NF-κB ( Figure 4 B). In contrast, the expression of ch IL-1R2 was significantly decreased up to 48% induced by NF-κB inhibitor compared to poly (I:C)-only treated control ( Figure 4 B), indicating that the expression of chicken IL-1R1 is regulated by one of the other signaling pathways. In contrast, recent research has shown that the expression of chIL-1β is suppressed by inhibitors of the transcriptional factors, which is BAY for NF-κB ( Lee et al., 2019 ). These results indicated that poly (I:C) can induce the expression of chIL-1β and chicken IL-1 receptors, including chIL-1R1 and chIL-1R2 , through the activation of NF-κB transcriptional factors. Therefore, for the typical TLR3 signaling pathway, the expression of ch IL-1R1 and ch IL-1R2 can be induced by NF-κB in response to poly (I:C) treatment, and the expression of ch IL-1R1 and ch IL-1R2 is regulated by the TLR3 signaling pathway. Figure 4 The expression of chIL-1R1 and chIL-1R2 mRNA in DF-1 cell line stimulated with Poly (I:C) in the presence of chemical inhibitors/inhibitors. ( A ) Chicken DF-1 cells were treated with 0.5 μg/mL of poly (I:C) for 24 h, and the expression of chIL-1R2 and chIL-1R1 were analyzed by qRT-PCR. ( B ) Effects of NFκB inhibitor (BAY11-7085; BAY) on the expressions of chIL-1R1 and chIL-1R2 after stimulation with poly (I:C) in chicken DF-1 cells. The cells were treated with or without 5 μM of BAY for 3 h in the presence or absence of 5 μg/mL of poly (I:C) for 3 h. ( C ) Effects of p38, JNK and MEK inhibitors on the expressions of chIL-1R1 and chIL-1R2 after stimulation with poly (I:C) in chicken DF-1 cells. The cells were treated with or without p38 (10 μM), JNK (25 μM), MEK (10 μM) in the presence of 5 μg/mL of poly (I:C) for 6 h. The expression levels of chIL-1R1 and chIL-1R2 were analyzed by qRT-PCR. Chicken IL-8L2 was used as a positive control. Each experiment was repeated thrice (n = 3). The expression is shown as the fold induction compared with untreated control ± standard error. * P < 0.05, ** P < 0.01 and *** P < 0.001 between the infected and control cells. Figure 4
The expression of chIL-1R1 and chIL-1R2 mRNA in DF-1 cell line stimulated with Poly (I:C) in the presence of chemical inhibitors/inhibitors. ( A ) Chicken DF-1 cells were treated with 0.5 μg/mL of poly (I:C) for 24 h, and the expression of chIL-1R2 and chIL-1R1 were analyzed by qRT-PCR. ( B ) Effects of NFκB inhibitor (BAY11-7085; BAY) on the expressions of chIL-1R1 and chIL-1R2 after stimulation with poly (I:C) in chicken DF-1 cells. The cells were treated with or without 5 μM of BAY for 3 h in the presence or absence of 5 μg/mL of poly (I:C) for 3 h. ( C ) Effects of p38, JNK and MEK inhibitors on the expressions of chIL-1R1 and chIL-1R2 after stimulation with poly (I:C) in chicken DF-1 cells. The cells were treated with or without p38 (10 μM), JNK (25 μM), MEK (10 μM) in the presence of 5 μg/mL of poly (I:C) for 6 h. The expression levels of chIL-1R1 and chIL-1R2 were analyzed by qRT-PCR. Chicken IL-8L2 was used as a positive control. Each experiment was repeated thrice (n = 3). The expression is shown as the fold induction compared with untreated control ± standard error. * P < 0.05, ** P < 0.01 and *** P < 0.001 between the infected and control cells.
To further investigate the mechanism of signaling pathway of the chIL-1 receptors in the DF-1, we examined the expression of chIL-1 receptors in DF-1 cells treated with p38, JNK, and MEK inhibitors alone or with poly (I:C). Our results showed that the expression of ch IL-1R1 was significantly decreased by poly (I: C) treatment in the presence of p38 (10 μM), JNK (25 μM), and MEK (10 μM) inhibitors ( Figure 4 C). In contrast, the expression of chicken IL-1R2 was significantly downregulated in the presence of JNK (25 μM) and MEK (10 μM) inhibitors with poly (I:C) treatment and was not changed by p38 (10 μM) inhibitor stimulation ( Figure 4 C). Recent research in other species indicated that the mechanism of IL-1 receptors was mediated by JNK/MEK signaling pathways ( Yang et al., 2013 ; Freiberger et al., 2015 ) while other research showed that IL1-R1, but not IL-1R2 expression, was dependent on p38 MAPK signaling pathways ( Dunne and O'Neill, 2003 ). Our results indicated that the regulation of ch IL-1R1 and ch IL-1R2 mRNA is mediated by the JNK and MEK subunit signaling pathways. Moreover, the chIL-1R1 signaling pathway, but not chIL-1R2, is regulated by the p38 MAPK signaling pathway.
Moreover, to gain insight into the regulation of ch IL-1β , ch IL-1R1 , and ch IL-1R2 expression, we examined their expression in chickens that were infected with highly pathogenic avian influenza virus (HPAI, H5N1; Figure 5 ). As shown in Figure 5 , the expression levels of ch IL-1β and ch IL-1R1 in the four organs of chickens infected with HPAIV significantly increased from day 1 to day 3 post infection ( Figure 5 ). The expression level of ch IL-1R2 was significantly increased as early as day 1, and considerably decreased further until day 3 in the four organs of HPAI-infected chickens ( Figure 5 ). However, previous studies have shown that the IL-1R2 is mainly involved and plays an essential role in the host response to influenza virus ( Szretter et al., 2007 ; Chen et al., 2016 ) because it regulates the expression of cytokines and immune-related genes through the JAK-STAT, NF-κB, PI3K, and JNK signaling pathways ( Tsukada et al., 1996 ; Oh et al., 2016 ). To the best of our knowledge, this study is the first to report that ch IL-1R2 mRNA is expressed in healthy tissues and tissues infected with HPAI in chickens. However, recent research has demonstrated a novel function of IL-1R2 as a positive or negative regulator of transduction signaling pathways that activate IL-6/VEGF-A, IFNγ, IL-12, and IL-17 synthesis ( Szretter et al., 2007 ; Peters et al., 2013 ), which are essential proinflammatory cytokines and angiogenic factors. Overall, these results suggest that ch IL-1R2 expression is specifically associated with anti-viral host response and may thus be correlated with IL-1β-mediated cellular responses. Figure 5 The expression levels of IL-1β, IL-1R1 , and IL-1R2 mRNA in tissues of high pathogenic avian influenza (HPAI)-infected chickens were analyzed by qRT-PCR. The White Leghorn chickens were infected with 10 4 EID50 of A/chicken/Vietnam/NA-01/2019 (H5N1) and the samples from lung, spleen, small intestine, kidney, and trachea were collected at d 1, d 2, and d 3 postinfection. The expression is shown as the fold induction compared with uninfected birds ± standard error. * P < 0.05, ** P < 0.01 and *** P < 0.001 between infected and control chickens. Figure 5
The expression levels of IL-1β, IL-1R1 , and IL-1R2 mRNA in tissues of high pathogenic avian influenza (HPAI)-infected chickens were analyzed by qRT-PCR. The White Leghorn chickens were infected with 10 4 EID50 of A/chicken/Vietnam/NA-01/2019 (H5N1) and the samples from lung, spleen, small intestine, kidney, and trachea were collected at d 1, d 2, and d 3 postinfection. The expression is shown as the fold induction compared with uninfected birds ± standard error. * P < 0.05, ** P < 0.01 and *** P < 0.001 between infected and control chickens.
Materials
A/chicken/Vietnam/NA-01/2019 (H5N1), a highly pathogenic avian influenza virus ( HPAIV ) was used in this study. The viral isolate was propagated in 10-day-old embryonated chicken eggs at 37°C for 48 h. The allantoic fluid ( AF ) of the eggs was then harvested, and aliquots of the AF were stored at −80°C until use, according to the OIE guidelines (Chapter 3.3.4) ( OIE, 2018 ). The infectious egg dose of 50% ( EID50 ) of the influenza virus was determined as previously described ( Huprikar and Rabinowitz, 1980 ). Briefly, serial 10-fold dilutions of the virus were prepared in phosphate-buffered saline ( PBS ), and 100 μL of each dilution was inoculated into the chorioallantoic cavities of 10-day-old embryonated chicken eggs. Five eggs were infected with each of the virus dilution and the eggs were incubated at 37°C for 96 h. Harvested AF was tested for haemagglutination test (HA) activity using 0.5% red blood cells ( RBC s) according to the OIE guidelines (Chapter 3.3.4) ( OIE, 2018 ). The EID50/mL of the virus suspension was calculated using the Reed and Muench mathematical method ( Reed and Muench, 1938 ).
Specific pathogen-free White Leghorn chickens (4 wk old) were purchased from the Poultry Research Centre of the National Institute of Animal Science, Ha Noi, Vietnam. Fifteen chickens (White Leghorn chickens per group) were intranasally inoculated with allantoic fluid (AF) containing 10 4 EID50 of A/chicken/Vietnam/NA-01/2019 (H5N1) in 200 µL. The control group consisted of 15 uninfected White Leghorn chickens. Following viral infection, the chickens were checked for clinical signs of disease and the samples were collected from the lung, spleen, small intestine, kidney, and trachea on d 1, 2, and 3 after infection, following the World Health Organization Manual on Animal Influenza Diagnosis and Surveillance ( WHO, 2013 ).
To clone the full-length coding sequence of chIL-1R2, the predicted chIL-1R2 coding sequence (GenBank accession # XM_015277810 ) was amplified from the total RNA of the spleen using restriction enzyme-anchored primers Eco RI-anchored forward primer and Hin dIII-anchored reverse primer (restriction sites are underlined in Table 1 ). Total RNA was isolated from the spleen of White Leghorn chickens using TRizol reagent (Invitrogen, Carlsbad, CA) as described previously ( Truong et al., 2015 ). Reverse transcription with random primers (Invitrogen) was conducted using MMLV Reverse Transcriptase (Promega, Madison, WI), according to the manufacturer's protocol. Polymerase chain reaction ( PCR ) was performed to amplify the full-length coding sequences of chIL-1R2 cDNA under the following conditions: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 60 s; and a final extension at 72°C for 5 min. The correct size of the PCR product was inserted directly into the pCR2.1-TOPO vector (Invitrogen), followed by transformation into Escherichia coli ( E.coli ) TOP10 (Invitrogen). Transformed E. coli TOP10 cells were cultured overnight in Luria-Bertani medium (Difco and BBL, NJ) at 37°C. A transformant was selected using a combination of PCR screening and sequencing (First BASE, The Gemini, Singapore Science Park II, Singapore). The chIL-1R2-expressing plasmid was then digested with the endonucleases Eco RI (Invitrogen) and Hin dIII (Promega). The digested chIL-1R2 fragment was purified from an agarose gel using a QIAQuick gel extraction kit (Qiagen, Valencia, CA) and ligated into digested pET32a (Novagen, San Diego, CA). To express rchIL-1R2 in E. coli , purified chIL-1R2-pET32a plasmid was introduced into E. coli BL21 (Invitrogen). Table 1 Similarity (top) and identity (grey) between chicken IL-1R2 and other IL-1R2 molecules. Table 1 1 2 3 4 5 6 7 8 9 10 11 Acc.no 1. Zebrafish 42.69 26.94 27.66 30.24 29.08 30.50 30.30 31.76 31.90 31.90 AJA72724 2. Salmon 32.25 30.33 30.09 32.92 31.73 33.75 33.58 32.75 34.42 34.67 NP_001138892 3. Turkey 15.77 20.63 96.35 44.63 44.90 50.00 48.23 48.63 50.00 50.25 XP_010726144 4. Chicken 16.26 20.63 94.66 44.63 44.90 51.25 49.49 48.88 51.00 51.25 XP_416914 5. Mouse 19.02 21.46 36.58 36.58 92.19 67.25 65.65 66.50 68.34 68.84 CAJ18390 6. Rat 18.50 20.43 36.65 36.65 90.00 68.50 65.90 67.49 69.34 69.84 NP_446405 7. Cattle 17.25 22.75 39.50 39.75 57.75 58.75 94.44 77.00 77.38 78.14 NP_001039675 8. Sheep 17.42 22.47 38.38 38.63 57.32 57.07 93.18 73.98 75.50 76.26 XP_012029111 9. Horse 19.35 22.82 40.69 40.94 58.80 58.80 70.00 66.66 76.38 76.13 NP_001075285 10. Human 20.10 24.12 41.45 41.70 61.30 62.06 70.35 68.43 69.09 99.24 NP_004624 11. Chimpanzee 20.10 24.37 41.70 41.95 61.80 62.56 71.10 69.19 68.84 99.24 XP_009441272
Similarity (top) and identity (grey) between chicken IL-1R2 and other IL-1R2 molecules.
Recombinant protein expression and purification have been described previously ( Truong et al., 2017 ; Truong et al., 2018a ; Truong et al., 2018b ). Briefly, the expression of chIL-1R2 was induced by adding 1 mM isopropyl ß-D-1-thiogalactopyranoside (IPTG) (USB Corporation, Cleveland, OH), and bacteria were cultured at 37°C overnight at 250 rpm. The bacterial cells were collected and pelleted by centrifugation at 3,500 × g for 30 min at 4°C. Total protein from the cells was extracted using B-PER bacterial protein extraction reagent (Thermo Scientific, Waltham, MA) according to the manufacturer's protocol. Recombinant chIL-1R2 was purified using HisPur cobalt resin (Thermo Scientific) in the first step of purification according to the manufacturer's instructions. The purified chIL-1R2 recombinant protein was concentrated, and the buffer was changed by ultrafiltration using a 3,000-molecular-weight-cutoff membrane (Millipore, Burlington, MA). The chIL-1R2 protein was dialyzed in PBS (pH 7.2) overnight using SnakeSkin dialysis tubing (Thermo Scientific) with stirring and was analyzed by SDS-PAGE.
Western blotting was performed as described previously ( Truong et al., 2017 ; Truong et al., 2018a ; Truong et al., 2018b ). Recombinant proteins (100 ng/µL) were subjected to SDS-PAGE, and the separated proteins were transferred to a polyvinylidene difluoride ( PVDF ) membrane (Invitrogen) using a mini Trans-Blot System (Bio-Rad, CA) according to the manufacturer's protocol. The transferred PVDF membrane was blocked with 5% non-fat milk Sigma-Aldrich (St. Louis, MO) dissolved in PBS containing 0.05% Tween 20 ( PBST ). The membrane was incubated with the primary antibody overnight at 4°C, washed thrice with PBST, and further incubated with HRP-conjugated secondary antibodies for 1 h at room temperature (25°C). Immunoreactive bands were detected using Western Lightning Plus-ECL substrate (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions.
The chicken DF-1 cell line was purchased from American Tissue Culture Collection (CRL-12203, Manassas, VA). DF-1 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and 100 U/mL each of penicillin and streptomycin (Thermo Scientific, Logan, UT) at 37°C in a humidified atmosphere of 5% CO 2 .
Polyinosinic-polycytidylic acid (poly (I:C)) was purchased from Invitrogen, dissolved in endotoxin- and nuclease-free water, and stored at −20°C until use. DF-1 cells were treated for 24 h with 5 μg/mL poly (I:C) to evaluate the time kinetics of mRNA expression.
BAY 11–7085 (BAY, inhibitor of IκBα phosphorylation) was purchased from Sigma-Aldrich (St. Louis, MO). SB203580 (p38 MAPK inhibitor) and SP600125 (JNK inhibitor) were purchased from InvivoGen (San Diego, CA). PD98059 (MEK inhibitor) was purchased from MedChem Express (Monmouth Junction, NJ). BAY inhibits IκBα phosphorylation, resulting in the prevention of NF-κB activation and is used as an NF-κB inhibitor ( Kogut et al., 2008 ).
BAY 11-7085 (5 μM) was applied to DF-1 cells for 3 h before being stimulated with poly (I:C) (5 μg/mL) for 6 h. Furthermore, MEK was inhibited in DF-1 cells by treating them with 10 μM PD98059 for 18 h, followed by 6 h of stimulation with 5 μg/mL poly (I:C). p38 MAPK was inhibited in DF-1 cells for 1 h with 10 μM SB203580, followed by 6 h with 5 μg/mL poly (I:C). JNK was inhibited by treating DF-1 cells with 25 μM SP600125 for 1 h, followed by 6 h of stimulation with 5 μg/mL poly (I:C). The concentrations and times of the inhibitors were determined from preliminary experiments in this study. IL-8L2 was used as a positive control in all experiments with the chicken DF-1 cell line. Our previous study suggested that the expression of chicken IL-8L2 can be used as a positive control for TLR3 signaling in DF-1 cells ( Jang and Song, 2020 ).
Total RNA was extracted using TRIzol reagent (Invitrogen) as described above. For cDNA synthesis, up to 3 µg of RNA was treated with 1 unit of DNase I and 1 μL of 10 × reaction buffer (Thermo Scientific) and incubated for 30 min at 37°C. Subsequently, 1.0 μL of 50 mM EDTA was added and heated to 65°C for 10 min to inactivate DNase I and then reverse-transcribed using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific) according to the manufacturer's recommendations. Primers were designed using Lasergene software ( Table 2 ), and qRT-PCR was performed using 2 × Power SYBR Green Master Mix (Roche, Indianapolis, IN) with the LightCycler 96 system (Roche). Chicken GAPDH was used as an internal control to normalize the cytokine expression. The level of gene expression was calculated using the 2 −ΔΔCt method after normalization to GAPDH ( Livak and Schmittgen, 2001 ). All qRT-PCR experiments were performed in triplicate. Table 2 Primer sequences for cloning and real-time PCR analyses of cytokine transcription. Table 2 Genes F/R The nucleotide sequence (5′-3′) Accession no GAPDH Forward TGCTGCCCAGAACATCATCC NM_204305 Reverse ACGGCAGGTCAGGTCAACAA IL-1R2 Cloning Forward CG GAATTC ATGGTTGAAAGGATGCAGAA XM_416914 Reverse CC AAGCTT TTCCTTTGCGATTATGTATCC IL-8L2 Forward CCAAGCACACCTCTCTTCCA NM_205498 Reverse GCAAGGTAGGACGCTGGTAA IL-1R1 Forward GAATGCAACGTATCAAGTGGTGTG NM_205485 Reverse TGTTCCCTGTAAGTGCTGTCAAAG IL-1R2 Forward AACTGCCCAGATCACACCAT XM_416914 Reverse TCAAGGCAGAAAAATCCACAT IL-1β Forward TCGGGTTGGTTGGTGATG NM_204524 Reverse TGGGCATCAAGGGCTACA
Primer sequences for cloning and real-time PCR analyses of cytokine transcription.
Quantitative ELISA was used to analyze the binding of the chIL-1β (Bio-Rad) with rchIL-1R2. Briefly, increasing concentrations (from 25 nM to 1,000 nM/well) of rchIL-1R2 or Trx-Tag protein (control) were coated onto a 96-well plate (Sigma-Aldrich, Egham, UK) at 4°C overnight. After blocking with 5% bovine serum albumin at room temperature for 3 h, the chIL-1β protein (100 nM/well) was added to each well, and incubated at 4°C overnight. The wells were washed with PBST (0.05% Tween-20 in PBS) for 3 times and then only the chIL-1β antibody was added to each well (1:1000) and incubated at room temperature for 2 h. The wells were washed with PBST thrice and then incubated with HRP-conjugated (1:1000) at room temperature for 1 h. After washing, positive signals were developed with the substrate buffer (1 mg/ml of 3,3′,5,5′-Tetramethylbenzidine, TMB) (Sigma-Aldrich, Egham, UK) at room temperature for 15 to 20 min. The reactions were terminated by adding 2M H 2 SO 4, and the results were analyzed using an Elx800 microplate reader (Bio-Rad, Hercules, CA) at 450 nm. All samples were run in triplicates.
The study was conducted in compliance with the institutional rules for the care and use of laboratory animals and using a protocol approved by the Ministry of Agriculture and Rural Development of Vietnam (TCVN 8402:2010 and TCVN 8400-26:2014).
Protein identification was performed using the Expert Protein Analysis System (ExPASy; http://www.expasy.org/tools/ ) and multiple sequence alignments were performed using Lasergene software. Phylogenetic analyses of amino acid sequences of the IL1-R2 groups were performed using the neighbor-joining method with a bootstrap value of 1,000 in the MEGA6 program ( Tamura et al., 2013 ). Signal peptides were predicted using SignalP v.4.1 software ( Mitchell et al., 2015 ), and glycosylation motifs were constructed using NetOGlyc v.4.0 ( Steentoft et al., 2013 ). The immunoglobulin (Ig) domains, a transmembrane domain, and cytoplasmic region were analyzed using InterPro v.56.0 ( Mitchell et al., 2015 ).
Statistical analysis was performed using the IBM SPSS software (SPSS 25.0, IBM Corp., Armonk, NY). The results are expressed as mean values ± standard error (SE) of 3 independent experiments for each group (n = 3) and were compared between groups using Duncan's multiple comparison method.
Introduction
Interleukin-1β ( IL-1β ), a member of the interleukin-1 family ( Awomoyi et al., 2005 ), plays an important role in inflammatory responses and autoinflammatory diseases ( He et al., 2011 ). In mammals, IL-1 receptors ( IL-1R ) are divided into 2 types that include the type I IL-1 receptor ( IL-1R1 ) and the type II receptor ( IL-1R2 ). The biological activities of IL-1β are associated with IL-1R1, while IL-1R2 inhibits IL-1β activity ( Dale and Nicklin, 1999 ; Liu et al., 2015 ). IL-1β is associated with and induces the expression of proinflammatory cytokine genes such as IL-1β, IL-6, and IL-8 by associating and activating the JAK-STAT, NF-κB, PI3K, and JNK signaling pathways ( Tsukada et al., 1996 ; Oh et al., 2016 ). In contrast, IL-1β is overexpressed and induces IL-1β signaling inhibitors in T-cells, such as the IL-1 receptor antagonist ( IL-1Ra ), rilonacept ( IL-1 Trap ), and IL-1R2, which are endogenous inhibitors of IL-1β activity ( Molto and Olive, 2010 ). In mammals, IL-1Ra can bind to IL-1R with similar affinity to IL-1α and IL-1β, resulting in IL-1 activity inhibition with reduced IL-1α, IL-1β, IL-2, IL-12, and IFNγ expression ( Molto and Olive, 2010 ). In parallel, IL-1R2 competes with IL-1R1 as a potential decoy receptor of IL-1β because IL-1R2 lacks the Toll/interleukin-1 receptor ( TIR ) domain and cannot transduce signals after IL-1β binding ( McMahan et al., 1991 ). IL-1R2 is expressed on the cell surfaces of neutrophils, monocytes, and B cells ( McMahan et al., 1991 ) and is a soluble receptor produced by alternative splicing ( Vambutas et al., 2009 ) or proteolysis ( Dale and Nicklin, 1999 ). These findings support the role of IL-1R2 as a naturally occurring inhibitor of IL-1β activity in mammals.
In mammals, IL-1R2 is expressed in macrophages, B cells, neutrophils, and monocytes and is induced in keratinocytes and endothelial cells ( McMahan et al., 1991 ; Lukiw et al., 1999 ). IL-1R2 expression is inhibited by pro-inflammatory agents, such as LPS ( Penton-Rol et al., 1999 ) and INFγ ( Chang et al., 2009 ), and is induced by anti-inflammatory or immunosuppressive agents, such as dexamethasone ( Re et al., 1994 ), prostaglandins ( Spriggs et al., 1992 ), glucocorticoids, IL-4 ( Colotta et al., 1993 ), IL-13 ( Colotta et al., 1994 ), IL-27 ( Kalliolias and Ivashkiv, 2008 ), and aspirin ( Daun et al., 1999 ). Although chicken IL-1R2 ( chIL-1R2 ) expression appears to be related to viral infection, the structure and expression pattern of this gene have not been studied. Furthermore, the mechanism underlying chIL-1R2 signaling has not yet been identified. Herein, we analyzed the amino acid sequence encoded by the chIL-1R2 gene by comparing it with IL-1R2 amino acid sequences from other species. Gene expression was investigated in various chicken tissues, and the expression pattern of the chIL-1R2 gene was evaluated after infection with highly pathogenic avian influenza in chickens. In addition, we examined the signaling of chIL-1R2 using the NF-kB signaling pathway in chicken embryonic fibroblast DF1 cell lines.