Full text
56,324 characters
· extracted from
preprint-html
· click to expand
Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegans View ORCID Profile Thiago L. Knittel , Brooke E. Montgomery , Reese A. Sprister , Colin N. Magelky , Margaret J. Smith , Maritza Soto-Ojeda , Melissa Guthrie , View ORCID Profile Carolyn M. Phillips , View ORCID Profile Taiowa A. Montgomery doi: https://doi.org/10.1101/2025.05.06.652520 Thiago L. Knittel 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Thiago L. Knittel Brooke E. Montgomery 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Reese A. Sprister 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Colin N. Magelky 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Margaret J. Smith 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Maritza Soto-Ojeda 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Melissa Guthrie 2 Department of Biological Sciences, University of Southern California , Los Angeles, CA 90089, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Carolyn M. Phillips 2 Department of Biological Sciences, University of Southern California , Los Angeles, CA 90089, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Carolyn M. Phillips Taiowa A. Montgomery 1 Department of Biology, Colorado State University , Fort Collins, CO 80523, USA 3 Cell and Molecular Biology Program, Colorado State University , Fort Collins, CO 80523, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Taiowa A. Montgomery For correspondence: tai.montgomery{at}colostate.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF SUMMARY Small RNAs, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), associate with Argonaute proteins to control gene expression, impacting a wide range of cellular processes, such as antiviral defense, transposon silencing, and development 1 . Plants and animals typically have several classes of small RNAs, along with multiple Argonautes 2 . These Argonautes often confer distinct functionality to the various classes of small RNAs 3 . But how small RNAs are selectively loaded into the appropriate Argonaute is not well understood. miRNAs and siRNAs are typically generated from double-stranded RNA (dsRNA) precursors by the endoribonuclease Dicer 4 . siRNAs are often processed from fully base-paired precursors derived from various endogenous and exogenous sources, whereas miRNAs typically originate from genetically encoded partially base-paired hairpins 1 . In C. elegans , Dicer/DCR-1 processing of siRNAs and a related small RNA class, known as 26G- RNAs, is mediated by the dsRNA-binding protein RDE-4 5 - 7 . Here, we show that RDE-4 also facilitates loading of siRNAs (but not miRNAs) into the Argonaute RDE-1, but not into ALG-1, and loading of 26G-RNAs into the Argonaute ERGO-1. Although we do not find evidence that ALG-3/4 associated 26G-RNAs require RDE-4 for Argonaute loading, their levels are strongly reduced in rde-4 mutants indicating that RDE-4 is broadly required for their formation or stability. Our findings reveal a role for RDE-4 as a critical determinant of small RNA loading specificity and provide insight into the mechanisms by which small RNAs are selectively paired with their corresponding Argonautes. RESULTS AND DISCUSSION Requirement of RDE-4 in endogenous and exogenous small RNA pathways RDE-4 was first identified for its role in exogenous RNA interference (RNAi) over two decades ago 8 . It interacts with dsRNA and resides in a complex containing DCR-1, and the RIG-I ortholog DRH-1, which processes dsRNA into siRNAs 8 - 17 . RDE-4 has been implicated in antiviral defense, exogenous RNAi, and multiple endogenous small RNA pathways 18 - 20 . The protein functions analogously to Loqs-PD in Drosophila , which is also required for processing dsRNA into siRNAs 21 - 26 . In Drosophila, another dsRNA-binding protein called R2D2 is necessary for assembling siRNAs into the Argonaute Ago2 silencing complex, however, an equivalent protein has not been identified in C. elegans 27 - 30 . Loqs-PD, R2D2, and RDE-4 each contain two dsRNA binding domains that adopt α-β-β-β-α folds ( Figure 1A ). Based on this structural similarity, we hypothesized that RDE-4 performs the functions of both Loqs-PD and R2D2. The potential role of RDE-4 in connecting dsRNA processing and Argonaute loading was initially proposed by Liu et al. 27 based on its sequence similarity to R2D2. However, to our knowledge, this has not been experimentally tested. We reasoned that if RDE-4 facilitates Argonaute-siRNA interactions, siRNAs would be depleted in Argonaute co-immunoprecipitates (co-IPs) from rde-4 mutants. However, because a comprehensive analysis of small RNAs in rde-4 mutants was lacking, it was unclear if sufficient levels of residual siRNAs are present in rde-4 mutants to assess their association with Argonautes. Thus, we first assessed the global impact of loss of rde-4 on small RNAs using small RNA high-throughput sequencing (sRNA-seq). Download figure Open in new tab Figure 1. Requirement of rde-4 across different small RNA pathways. (A) AlphaFold3-predicted structures of C. elegans RDE-4, and Drosophila R2D2 and Loqs-PD. dsRNA binding domains are highlighted. (B) Schematic overview of C. elegans small RNA classes, indicating their Argonaute-binding partners, DCR-1 processing dependency, and whether they are synthesized by RdRPs. Exo, exogenous. Endo, endogenous. (C, D) Scatter plots showing individual small RNA features as the average log 2 GM-normalized sRNA-seq reads in wild-type (x-axis) and rde-4 mutant (y-axis) animals. Small RNA classes are color-coded. Exogenous siRNAs mapping to nrfl-1 and oma-1 are circled. Samples are from L4 stage larvae (C) or gravid adults (D). RNA was treated with RppH. n=3 biological replicates. (E) Relative rpm-normalized abundance of small RNA classes in wild-type and rde-4 mutant L4 larvae (data as in C). Error bars represent standard deviation (SD) from the mean. p -values were calculated using two-sample t-tests. (F) Same as in (E), but with gravid adult wild-type, and rde-4 and rde-1 mutant animals (data as in D). Error bars represent SD from the mean. p -values were calculated using two-sample t-tests. (G) Scatter plot as in (C-D), comparing wild-type (x-axis) and rde-1 mutant (y-axis) gravid adults. Small RNA classes are color-coded; nrfl-1 and oma-1 siRNAs are circled. n=3 biological replicates (data also in F). C. elegans contains several classes of small RNA, some of which are directly processed by DCR-1 and others that are not ( Figure 1B ) 31 . miRNAs were not affected in rde-4 mutants in either L4 larval stage or gravid adult animals ( Figures 1C-1F ; Tables S1-S2). In contrast endogenous canonical siRNAs, also called 23H-RNAs, were modestly depleted in rde-4 mutants ( Figures 1C-1F ; Tables S1-S2) 32 . The adult stage animals used in these sRNA-seq experiments were subjected to exogenous RNAi targeting both nrfl-1 and oma-1 , genes that can be depleted without leading to obvious developmental defects 33 . Exogenous siRNAs derived from the nrfl-1 and oma-1 dsRNA administered to the animals were also modestly reduced in rde-4 mutants ( Figures 1D and 1F ; Tables S1-S2). C. elegans contains two classes of non-canonical siRNAs that are 26-nucleotides (nt) long and possess a 5’G. One class is produced in sperm development during the L4 stage and bind the Argonautes ALG-3 and ALG-4 and the other is produced from a largely non-overlapping set of genes during oocyte formation, mostly in the adult stage, and bind the Argonaute ERGO-1 ( Figure 1B ). These so-called 26G-RNAs are produced from RNA-dependent RNA polymerase (RdRP) products, which are processed by DCR-1, but mechanistic details are lacking 5 , 6 , 34 - 36 . Both ALG-3/4 and ERGO-1 classes of 26G-RNAs, were strongly depleted in rde-4 mutants ( Figures 1C-1F ; Tables S1-S2). Exogenous siRNAs, 23H-RNAs, and ERGO-1 class 26G-RNAs trigger the production of secondary small RNAs called 22G-RNAs, which are not made by DCR-1 ( Figure 1B ) 5 , 6 , 37 , 38 . These secondary 22G-RNAs were also depleted in rde-4 mutants ( Figures 1C-1F ; Tables S1-S2). However, most 22G-RNAs are not dependent on 1° siRNAs for their formation and these small RNAs, as well as DCR-1-independent piwi-interacting RNAs (piRNAs), were not depleted in rde-4 mutants ( Figures 1C-1F ; Tables S1-S2) 31 . Thus, RDE-4 is specific to DCR-1-dependent siRNA pathways, although the extent to which it is required for small RNA formation or stability differs between these pathways. Both exogenous siRNAs and 23H-RNAs associate with the Argonautes RDE-1, ALG-1, and ALG-2, but are particularly enriched in RDE-1 32 . Despite the strong bias of RDE-1 for canonical siRNAs their levels were not reduced in rde-1 mutants, indicating that this association is not important for siRNA stability ( Figures 1F-1G ; Table S2) 32 . However, the secondary 22G-RNAs generated downstream are depleted, as their production relies on RDE-1, which is not compensated for by ALG-1 or ALG-2 ( Figures 1F-1G ; Table S2) 8 , 32 . The substantial presence of DCR-1-dependent siRNAs remaining in rde-4 mutants enabled us to test our hypothesis that RDE-4 plays a role in Argonaute loading. RDE-4 facilitates loading of exogenous siRNAs into RDE-1 To assess whether RDE-4 promotes the association of exogenous siRNAs with RDE-1, we co-IP’d GFP::RDE-1 from either rde-4+/+ or rde-4-/- animals undergoing RNAi against nrfl-1. We sequenced the associated small RNAs and compared them to those present in the input cell lysates. In both cell lysates and co-IP fractions from rde-4+/+ and rde-4-/- animals, nrfl-1 1° siRNAs displayed similar size and 5’ nucleotide distribution profiles, with an enrichment of 23-nt reads ( Figures 2A-2B ). Consistent with our findings above, we observed a 1.7-fold decrease in nrfl-1 1° siRNA levels in cell lysates from rde-4-/- animals, confirming the requirement of RDE-4 for siRNA formation or stability ( Figure 2A ). However, in GFP::RDE-1 co-IP fractions, we observed a 42-fold reduction in nrfl-1 1° siRNA reads in rde-4-/- animals, which is nearly 25-fold greater than the reduction observed in cell lysates ( Figure 2B ). Additionally, nrfl-1 1° siRNA reads in GFP::RDE-1 co-IPs from rde-4+/+ animals were enriched 56.5-fold relative to the input cell lysates, whereas enrichment was reduced to only 1.3-fold in rde-4-/- animals ( Figure 2C ). This indicates that a reduction in siRNA formation or stability was not solely responsible for the lower levels of siRNAs in GFP::RDE-1 co-IPs from rde-4 mutant animals. Download figure Open in new tab Figure 2. RDE-4 facilitates association of exogenous siRNAs with RDE-1. (A-B) Size distribution and 5′-nucleotide identity of nrfl-1 sense siRNAs from cell lysates ( A ) and GFP::RDE-1 co-IPs ( B ) from rde-4+/+ or rde-4-/- mutant gravid adults. One representative of 3 biological replicates is shown. The plots on the right show the average rpm-normalized counts for nrfl-1 sense siRNA reads from three biological replicates. (C) Enrichment of total nrfl-1 sense exogenous siRNA reads in GFP::RDE-1 co-IPs relative to corresponding cell lysates from rde-4+/+ or rde-4-/- mutant gravid adults (data as in A-B). Error bars represent SD from the mean of three biological replicates. (D) rpm-normalized small RNA-seq read distribution across the sense strand of nrfl-1 from cell lysates and GFP::RDE-1 co-IPs from rde-4+/+ or rde-4-/- animals. siRNAs were modestly and uniformly depleted across nrfl-1 dsRNA in cell lysates from rde-4-/- animals ( Figure 2D ). The strong enrichment observed in GFP::RDE-1 co-IPs from rde-4+/+ animals was also uniformly lost in rde-4-/- mutants, demonstrating that RDE-4 is broadly required for optimal siRNA association with RDE-1 ( Figure 2D ). Similar results were obtained in an independent experiment utilizing animals treated with both nrlf-1 and oma-1 RNAi (Figures S1A-S1F). That siRNAs still associate with RDE-1 in the absence of rde-4 , albeit at much lower levels, likely explains why the RNAi defects of rde-4 mutants can be overcome by injecting high levels of dsRNA 39 . Endogenous siRNAs require RDE-4 for optimal loading into RDE-1 We next tested whether RDE-4 facilitates loading of endogenous siRNAs (i.e. 23H-RNAs) into RDE-1. Individual 23H-RNAs were highly enriched in RDE-1 co-IPs relative to cell lysates, comparable to nrfl-1 exogenous siRNAs, following geometric mean (GM)-based normalization ( Figure 3A ; Table S3). Numerous miRNAs were also enriched in GFP::RDE-1 co-IPs, but generally to a much lesser extent than 23H-RNAs ( Figure 3A ; Table S3). Strikingly, the enrichment of nrfl-1 1° siRNAs and 23H-RNAs was reduced to levels similar to miRNAs in rde-4-/- animals ( Figure 3B ; Table S3). The ratio of total 23H-RNA reads, normalized by million mapped reads (rpm), in GFP::RDE-1 co-IPs relative to cell lysates was reduced by ∼36-fold in rde-4-/- animals, while miRNA enrichment was unchanged ( Figure 3C ). Unlike GM normalization, rpm normalization does not account for variation in individual small RNAs across samples. While GM normalization more accurately identifies differences in individual small RNAs, it is generally less reliable when assessing total reads for a specific class of small RNAs, based on our experience. Download figure Open in new tab Figure 3. RDE-4 directs endogenous siRNA association with RDE-1 but not ALG-1. (A-B) Scatter plots showing individual small RNA features as the average log 2 GM-normalized sRNA-seq reads in cell lysates (x-axis) and GFP::RDE-1 co-IPs (y-axis) from rde-4+/+ (A) or rde-4-/- (B) animals undergoing nrfl-1 RNAi. Small RNA classes are color-coded. n=3 biological replicates. (C) Average enrichment of total rpm-normalized 23H-RNA and miRNA reads in GFP::RDE-1 co-IP libraries relative to corresponding cell lysates (data as in A-B). p -values were calculated using two-sample t-tests. (D) rpm-normalized small RNA-seq read distribution across the sense strand of Y57G11C.57 from cell lysates and GFP::RDE-1 co-IPs from rde-4+/+ or rde-4-/- animals. (E-F) Scatter plots as in (A-B) but comparing cell lysates (x-axis) and HA::ALG-1 co-IPs (y-axis). n=3 biological replicates. (G) Average enrichment of total rpm-normalized 23H-RNA and miRNA reads in HA::ALG-1 co-IPs relative to corresponding cell lysates (data as in E-F). p -values were calculated using two-sample t-tests. The reduction in siRNA enrichment in GFP::RDE-1 co-IPs from rde-4-/- animals could be indirect, resulting from reduced siRNA abundances in cell lysates, such that the residual siRNAs are competed away from RDE-1. To test this possibility, we co-IP’d GFP::RDE-1 from animals undergoing RNAi against dcr-1 , which, like loss of rde-4 , resulted in a reduction in the levels of a representative endogenous 23H-RNA derived from the F43E2.6 locus, as determined by quantitative real-time PCR (qRT-PCR) (Figures S1G-S1H). Although the levels of the F43E2.6 23H-RNA were reduced, its enrichment in RDE-1 co-IPs was unchanged in dcr-1 RNAi treated animals (Figure S1H). This suggests that impaired loading of siRNAs into RDE-1 in rde-4 mutants is not due to reduced siRNA abundance. Furthermore, even 23H-RNAs that normally associate strongly with RDE-1 but that were not depleted in the cell lysates of rde-4-/- animals were nevertheless depleted in GFP::RDE-1 co-IPs from rde-4-/- animals ( Figure 3D ; Table S3). We observed a similar loss of hyperenrichment of 23H-RNAs and exogenous nrfl-1 and oma-1 1°siRNAs in GFP::RDE-1 co-IPs from rde-4 mutants in an independent experiment (Figures S2A-S2B). We conclude that although not absolutely required for loading siRNAs into RDE-1, RDE-4 facilitates their preferential association over miRNAs. Because siRNAs are typically much less abundant than miRNAs, RDE-4 may be necessary to ensure that sufficient siRNA-RDE-1 complexes are formed during RNAi. RDE-4 does not promote ALG-1-siRNA interactions Exogenous siRNAs and 23H-RNAs also associate with the major miRNA Argonautes ALG-1 and ALG-2 32 , 40 , 41 . We questioned whether RDE-4 is required for loading siRNAs into these Argonautes as well. To address this, we subjected small RNAs from HA::ALG-1 co-IPs and cell lysates from rde-4+/+ and rde-4-/- animals treated with nrfl-1 RNAi to sRNA-seq. miRNAs, nrfl-1 exogenous siRNAs, and 23H-RNAs were all similarly enriched in HA::ALG-1 co-IPs compared to cell lysates in rde-4+/+ animals, consistent with ALG-1 binding siRNAs and miRNAs with similar affinity ( Figure 3E ; Table S4) 32 . Furthermore, unlike in GFP::RDE-1 co-IPs, there was no detectable difference in the enrichment of nrfl-1 exogenous siRNAs and 23H-RNAs in HA::ALG-1 co-IPs from rde-4-/- compared to rde-4+/+ animals ( Figures 3F-3G ; Table S4). Therefore, RDE-4 does not promote siRNA association with ALG-1. These results indicate that RDE-4 has a critical role in directing siRNA association with RDE-1 but not ALG-1. This role for RDE-4 likely ensures that siRNAs are preferentially paired with RDE-1 because of its ability to trigger high levels of 2° siRNAs from target mRNAs 38 . Based on our earlier observation that siRNAs and 23H-RNAs are not depleted in rde-1 mutants, these small RNAs do not require RDE-1 for stability. Therefore, the reduction in exogenous siRNA and 23H-RNA levels we observed in rde-4 mutants is consistent with RDE-4 having a direct role in their biogenesis, rather than the decrease being an indirect consequence of RDE-1-dependent stability. This is supported by previous studies showing that RDE-4 is required for DCR-1 processing of siRNAs in vitro 10 , 13 . Together, these finding indicate that RDE-4 has dual functions in RNAi: first in facilitating DCR-1 processing of siRNAs, and second, in promoting their loading into RDE-1. Role of RDE-4 in 26G-RNA pathways RDE-4 has also been implicated in the ALG-3/4 and ERGO-1 26G-RNA pathways, consistent with our earlier results showing widespread reductions in these small RNAs in rde-4 mutants ( Figures 1C-1F ) 6 , 7 , 42 . We therefore tested if ALG-3 and ERGO-1 depend on RDE-4 for 26G-RNA association. Despite a strong reduction in ALG-3/4 class 26G-RNAs in rde-4-/- compared to rde-4+/+ cell lysates, their relative enrichment in GFP::ALG-3 co-IPs was unchanged ( Figure 4A ; Table S5). This indicates that while RDE-4 is essential for the formation or stability of ALG-3/4 class 26G-RNAs, it may not facilitate their binding with ALG-3. In contrast, both the levels and relative enrichment of ERGO-1 class 26G-RNAs in GFP::ERGO-1 co-IPs were strongly reduced in rde-4-/- compared to rde-4+/+ animals, indicating that RDE-4 promotes 26G-RNA association with ERGO-1 ( Figure 4B ; Table S6). Download figure Open in new tab Figure 4. RDE-4 promotes 26G-RNA association with ERGO-1. (A-B) Scatter plots showing individual 26G-RNA features as the average log 2 rpm-normalized sRNA-seq reads in cell lysates (x-axis) and in GFP::ALG-3 ( A ) or GFP::ERGO-1 co-IPs ( B ) (y-axis) from rde-4+/+ or rde-4-/- animals. n=2 biological replicates. Western blot images above each scatter plot show GFP::ALG-3 ( A ) or GFP::ERGO-1 ( B ) levels in co-IP (IP) and cell lysate input (in) fractions. Tubulin is shown as a loading control. (C) Fertility of individual wild-type or rde-1, ergo-1, alg-3/4 , or rde-4 mutants grown at 25°C. Each point represents the total progeny from a single animal. Blue horizontal bars show means. Vertical bars show SD. p -values were calculated using the Mann-Whitney U test. n=8 (wild-type, rde-1, ergo-1, alg-3/4 ), or 11 ( rde-4 ). It is unclear why RDE-4 would be required for loading 26G-RNAs into ERGO-1 but not ALG-3. However, we and others have observed evidence that their immediate precursors are structurally distinct 43 - 46 . For example, ERGO-1 class 26G-RNA appear to derive from duplexes with presumed passenger strand sequences that are ∼19-20-nt long, which for reasons that are unclear match almost exclusively to the mRNA template and not the RdRP product 43 . Whereas the guide strand is almost exclusively antisense to the mRNA and thus produced from the RdRP transcript. The passenger strand is readily detectable in ERGO-1 co-IPs, comprising nearly 30% of 26G-RNA loci reads, suggesting that the 26G-RNA dsRNA duplex is loaded into ERGO-1 and the passenger strand is then discarded (Figures S3A-S3B). In ERGO-1 co-IPs from rde-4-/- animals, the passenger strand is still detectable, albeit at much lower levels, consistent with a role for RDE-4 in promoting the loading of the duplex into ERGO-1 (Figure S3C). In contrast, ALG-3 does not efficiently co-IP with sequences sense to the mRNA, with only ∼1% of 26G-RNA loci reads derived from the sense strand, corresponding to the hypothetical passenger strand (Figures S3D-S3F). Thus, we speculate that ALG-3 may load single-stranded 26G-RNAs, thereby bypassing the requirement for RDE-4 in siRNA loading, possibly utilizing a single-stranded RNA binding protein instead. How might RDE-4 promote loading of small RNAs into Argonautes? One possibility is that it works similarly to R2D2 in Drosophila , which is proposed to position the siRNA duplex in the right orientation for loading into the Argonaute Ago2 30 . Another possibility is that RDE-4 functions similarly to the proposed, albeit questionable, role of the dsRNA-binding protein TRBP in mammals, acting as a bridge between Argonautes and Dicer to facilitate the formation of the RNA silencing complex 47 , 48 . This could indirectly influence loading by bringing the proteins into close proximity. RDE-4 has been shown to be in complexes with both DCR-1 and RDE-1, supporting either of these models 9 , 14 , 49 . RDE-4’s role in fertility likely relates to its function in the ALG-3/4 pathway 23H-RNAs and ERGO-1 class 26G-RNAs do not have clear roles in development, whereas ALG-3/4 class 26G-RNAs are required for proper sperm development 32,34,35,50-52 . RDE-4 is required for efficient exogenous RNAi, antiviral defense, proper chemotaxis, and optimal fertility at elevated temperatures 7,8,15,53,54 . Given our results demonstrating its global requirement in ALG-3/4 class 26G-RNA formation, we hypothesized that RDE-4’s role in fertility is related to its function within this pathway. Indeed, we observed a significant reduction in the mean number of progeny produced by rde-4 mutants ( Figure 4C ). However, the total number of progeny produced by rde-4 was still greater than that of alg-3 alg-4 mutants likely because low levels of ALG-3/4 class 26G RNAs are still present and loaded into ALG-3, and likely also ALG-4, in rde-4 mutants ( Figure 4C ). ergo-1 and rde-1 mutants did not have reduced brood sizes, suggesting that the lower numbers of progeny produced by rde-4 mutants is due specifically to RDE-4’s role in the ALG-3/4 pathway ( Figure 4C ) 32 , 52 . Thus, RDE-4 has roles in antiviral defense, behavior, fertility, and development through its modular participation in multiple distinct small RNA pathways. Conclusions rde-4 was among the first RNAi factors identified by the Mello lab over twenty-five years ago 8 , 49 . These early studies pointed to a role for RDE-4 in siRNA biogenesis, which was later confirmed in elegant biochemical studies from the Bass lab 10 , 11 , 13 . However, our research uncovers a critical function for RDE-4 that was not evident in previous studies: its involvement in pairing siRNAs with the correct Argonautes. These findings highlight a dual role for RDE-4 in both exogenous and select endogenous siRNA pathways, broadening our understanding of its molecular functions and furthering our understanding of RNAi. In future studies, it will be important to identify the mechanism by which RDE-4 promotes Argonaute loading and whether other dsRNA-binding proteins fulfill this role in small RNA pathways where RDE-4 is not necessary. Supplemental Information Document S1: Figures S1-S3. Related to Figures 2-4. Tables S1-S4: Excel files containing geometric mean-normalized sRNA-seq counts and differential expression analysis. Related to Figures 1-3. Tables S5-S6. Excel files containing rpm-normalized sRNA-seq counts. Related to Figure 4. RESOURCE AVAILABILITY Lead contact Requests for additional information and resources should be directed to and will be fulfilled by the lead contact, Taiowa A. Montgomery, tai.montgomery{at}colostate.edu . Material availability The rde-4 deletion allele generated in this study will be made available from the Caenorhabditis Genetics Center upon publication. Strains not distributed by the CGC are available on request. Data and code availability Raw and processed high-throughput sequencing data generated in this study are available from the NCBI Gene Expression Omnibus (GEO; https://www.ncbi.nlm.nih.gov/geo/ ) under accession number GSE293782). The tinyRNA software used for analysis of sRNA-seq data is freely available from https://github.com/MontgomeryLab/tinyRNA. METHODS Strains WM45[ rde-1 (ne300) V], TAM151[ rde-1(ram40) V] ,WM158[ ergo-1(tm1860) V], WM300[ alg-4(ok1041) III; alg-3(tm1155) IV], JMC205[ alg-3(tor141[GFP::3xFLAG::alg-3]) IV], JMC211[ ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V], TAM10[ unc-119(ed3); ram4([pCMP2]alg-1::3XHA::TEV::alg-1 + Cbr-unc-119(+)) ], and USC1080[ rde-1(cmp133[(gfp + loxP + 3xFLAG)::rde-1]) V] were previously described 8,32,35,41,51,55,56 . PHX6665[ rde-4(syb6665) III] was generated by SunyBiotech (Fuzhou, China) using CRISPR/Cas9 genome editing 57 - 60 . TAM122[ rde-4(syb6665) III ; ram4([pCMP2]alg-1::3XHA::TEV::alg-1 + Cbr-unc-119(+)) IV] was generated by crossing PHX6665 with TAM10. TAM98[ rde-4(syb6665) III ; rde-1(cmp133[(gfp + loxP + 3xFLAG)::rde-1]) V] was generated by crossing USC1080 to PHX6665. TAM104[ rde-4(syb6665) III ; alg-3(tor141[GFP::3xFLAG::alg-3]) IV] was generated by crossing JMC205 to PHX6665. TAM106[ rde-4(syb6665) III ; ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V] was generated by crossing JMC211 to PHX6665. USC1557[ dcr-1(cmp321[dcr-1::2xHA]) III] and USC1556[ rde-4(cmp320[rde-4::2xFLAG]) III] were generated via CRISPR-Cas9 genome editing in wild-type animals by injecting purified Cas9 protein along with guide RNAs and repair templates 61 . For USC1556, the guide RNA sequence was: /AltR1/rUrUrUrCrArArCrArCrCrUrArUrGrArUrUrUrCrArGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/. The repair template sequence was: tataatcattcagacgcttcatttttcaggaatacgcaataatatttTCATTTGTCATCATCGTCTTTATAATCCTTATCGTCG TCATCCTTGTAGTCATCgGTGAAATCATAGGTGTTGAAATGGATAATCGCCGATTTACAAGCACACT GTTTA. For CMP1557, the guide RNA sequence was: /AltR1/rUrUrUrUrCrArGrArCrCrArArUrArArUrGrGrUrCrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/. The repair template sequence was: attgtaatttttgaacattatcaattttccctgttttcagaccaataATGTATCCTTATGATGTACCTGATTATGCCTACCCATA CGACGTTCCAGACTACGCTGTCAGGGTAAGAGCTGATTTACAATGTTTTAACCCCAGGGACTACC AGgt. Animal growth conditions Animals were cultured at 20°C on NGM plates (3 g/l NaCl, 17 g/l agar, 2.5 g/l peptone, 1 mM CaCl 2 , 5 µg/ml cholesterol, 1 mM MgSO 4 , and 25 mM KPO 4 buffer) seeded with 2 mL (10 cm plates) or 0.5 mL (6 cm plates) of E. coli OP50 culture. The bacteria was grown overnight at 37°C in LB Broth (NaCl, 5 g/L, Tryptone, 10 g/L, Yeast Extract, 5 g/L – Sigma, cat# L3022), then applied to plates and allowed to air dry with lids closed for approximately 3-4 days to allow the formation of a bacterial lawn. The NGM was supplemented with 1% Nystatin and 2.5% Streptomycin to prevent contamination. Stage synchronization To obtain embryos, gravid adult hermaphrodites were collected from NGM plates by washing with M9 buffer into a 15 mL conical tube. After removing excess buffer, leaving 1.5 mL, a bleaching solution (2.5 mL of 1 M NaOH and 1 mL of 5% sodium hypochlorite) was added to lyse hermaphrodites while preserving the eggs. Samples were vortexed for ∼10 minutes, with periodic checks to ensure disintegration of carcasses. Once the solution consisted of mostly embryos, samples were centrifuged at 1.9 krcf for 30 seconds, and the supernatant was carefully discarded without disturbing the egg pellet. The pellet was washed three times by resuspension in 15 mL of M9 followed by centrifugation at 1.9 krcf for 30 seconds. Synchronized L1-arrested larvae were obtained by incubating the isolated embryos in 2 mL of M9 buffer (composition detailed below) at 15°C with gentle rotation (∼15 rpm) for 72 hours. Protein structure analysis Structures of Drosophila R2D2 and Loqs-PD and of C. elegans RDE-4 were predicted using AlphaFold3 with protein sequences obtained from UniProt 62 , 63 . The structures were analyzed and images generated using ChimeraX 64 . RNA isolation To extract RNA from whole animals at either gravid adult stage (72 hours at 20°C following L1 synchronization) or L4 larval stage (52 hours at 20°C post-synchronization) animals were harvested from plates, washed three times with M9 buffer, and immediately flash-frozen in liquid nitrogen. Co-IPs and corresponding cell lysates were used directly for RNA extraction. RNA isolation was performed using TRIzol reagent (Life Technologies, cat# 15596018) following the manufacturer’s protocol, with the addition of a second chloroform extraction step to improve purity. sRNA-seq RNA ranging from ∼16 to 30 nucleotides was size-selected by gel extraction using 17% polyacrylamide/urea gels, from RNA, in some instances pre-treated with RNA 5′ pyrophosphohydrolase (New England Biolabs, cat# M0356S) to convert 5′ triphosphates to 5’ monophosphates (as noted in figure legends), which enhances ligation efficiency of 22G-RNAs 65 . Library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB, cat# E7300S), following the manufacturer’s instructions, except that the 3′ ligation step was carried out at 16°C for 18 hours to optimize recovery of methylated small RNAs. PCR amplified small RNA libraries were size-selected on 10% polyacrylamide non-denaturing gels, and sequencing was conducted on an Illumina HiSeq X or NovaSeq X Plus (PE150) by Novogene. Only forward strand reads were retained for analysis. sRNA-seq data analysis Small RNA sequencing data was processed and visualized using the tinyRNA pipeline with default settings 66 - 69 . Analyses were conducted using the C. elegans WS279 reference genome sequences and annotations 33 . Annotations for 23H-RNAs and other small RNA classes were previously published in GFF3 format 32 . Computing of normalized counts using the geometric mean method and statistical analysis using the Wald test were performed within the tinyRNA framework using the DESeq2 R package 70 . Additional plotting and statistical analyses were carried out using Matplotlib, R, IGV, and Adobe Illustrator 71 - 73 . RNAi Synchronized L1 larvae were plated on RNAi plates (NGM supplemented with IPTG [1.2 mg/mL] and Carbenicillin [25 ug/mL]) seeded with E. coli HT115 bacteria expressing dsRNA matching dcr-1, nrfl-1, oma-1 , or empty vector (L4440) 74 . Animals were grown for 72 hours at 20°C and gravid adults were collected for protein and RNA isolation, where applicable. For HA::DCR-1 protein isolation, animals were flash frozen in liquid nitrogen and then ground using mortars and pestles, following the same protocol as for Co-IPs. Co-IPs Co-IPs were performed for GFP::3xFLAG::RDE-1, 3xHA::TEV::ALG-1, GFP::3xFLAG::ALG-3, and GFP::3xFLAG::ERGO-1 from 2-3 biological replicates, each containing ∼12,000 gravid adult C. elegans grown for 52 hours (L4 larvae for GFP::3xFLAG::ALG-3 co-IPs) or 72 hours (adults, all other co-IPs) after L1 synchronization. Animals were harvested from NGM plates to 15 mL tubes using M9 buffer (3 g/l KH 2 PO 4 , 6 g/l Na 2 HPO 4 , 5 g/l NaCl, 1 mM MgSO 4 ) and washed three times with ∼10 mL of M9 buffer to remove bacteria. The buffer was removed, and 1.2 mL of lysis buffer was added (50 mM Tris-Cl pH 8.0, 100 mM KCl, 2.5 mM MgCl 2 , 0.1% Igepal CA-630, and 1X protease inhibitor cocktail - Pierce, cat# 88266). The solution was flash-frozen when transferred to a mortar with liquid nitrogen and ground using pestles. Lysates were transferred to 1.5 mL tubes and clarified by centrifugation at 12,000 × g for 10 minutes at 4°C. Supernatants were divided into input and co-IP fractions. For co-IP, 25 µL of GFP-Trap Magnetic Agarose Beads (ChromoTek, Proteintech, cat# gtma-100) or HA Affinity Matrix (Roche, cat# 11815016001) was incubated with the lysates (1 mL) for 1 hour at 4°C while rotating. Beads were then separated on a magnetic rack or by centrifugation at 500 rcf and washed three times with 1 mL of lysis buffer. Following 3 washes, beads were split between protein and RNA fractions. For protein fractions, samples were denatured by heating at 95°C for 5 minutes in lysis buffer with 1×Blue Protein Loading Dye (New England Biolabs, cat# B7703S: 62.5 mM Tris-HCl (pH 6.8), 2% (w/v) SDS, 10% glycerol, 0.01% (w/v) bromophenol blue) supplemented with 50 mM DTT. RNA fractions were treated as described above. qRT-PCR qRT-PCR was performed using a custom TaqMan Gene Expression Assay for an F43E2.6 23H-RNA (Life Technologies, cat# 4331348, target sequence: UUUGCCGAUGUUUCUGAGAUGUC) or miR-1 (Life Technologies, assay name: hsa-miR-1, cat# 4427975) according to the manufacturer’s protocol. Expression levels of the F43E2.6 23H-RNA and miR-1 were measured on a Bio-Rad CFX96 Real-Time PCR Detection System. Ct values were averaged from three technical replicates for each of three independent biological samples. Relative quantification of the F43E2.6 23H-RNA normalized to miR-1 was determined using the 2^-ΔΔCt method 75 . Plotting and statistics were conducted in Microsoft Excel and GraphPad Prism. Western blots Protein samples from co-IPs and their corresponding cell lysates were separated on 4-12% Bolt Bis-Tris Plus 15-well gels (Invitrogen, cat# NW04125BOX). After separation, proteins were transferred to nitrocellulose membranes and probed with anti-GFP (Santa Cruz Biotechnology, cat# sc-9996 HRP; 1:100), anti-HA (Roche, distributed by Merck, cat# 12013819001 HRP; 1:500), and anti-tubulin (Abcam, cat# ab40742 HRP; 1:1000) antibodies. Blots were imaged using a FluorChem E Imaging System (ProteinSimple). Fertility Fertility was assessed in animals grown since conception at 25°C. These animals were obtained by transferring their parents from the maintenance temperature of 20°C to 25°C at the L4 stage, before the onset of reproduction. The animals grown at 25°C were singled out onto individual plates at the L4 stage and transferred daily to new plates to allow for a clear distinction between the adult parent and the developing larval stage progeny. After the parent was removed from a plate, the number of L2-L3 larval stage progeny was counted on a stereoscope. The total number of progeny produced by each animal across its reproductive span was summed. The experiment was ended when no viable progeny were produced for 24 hours. Statistics Mann-Whitney U tests were used to calculate p -values using GraphPad Prism when evaluating the fertility assay data. Two-sample t-tests were applied to qRT-PCR, Western blot quantifications, and comparisons between co-IP and corresponding input fractions, with calculations performed in Microsoft Excel. When multiple comparisons were made, p -values were adjusted using the Bonferroni correction. ACKNOWLEDGEMENTS Thanks to Alivia Ball for help with media and solutions. Some strains used in this study were provided by the CGC, which is funded by the National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440). This work was supported by the National Institutes of Health [R35GM119775 to T.A.M. and R35GM119656 to C.M.P.]. Funder Information Declared National Institutes of Health, https://ror.org/01cwqze88 , R35GM119775 , R35GM119656 REFERENCES ↵ Ketting , R. F. The many faces of RNAi . Dev Cell 20 , 148 – 161 ( 2011 ). OpenUrl CrossRef PubMed Web of Science ↵ Chapman , E. J. & Carrington , J. C. Specialization and evolution of endogenous small RNA pathways . Nat Rev Genet 8 , 884 – 896 ( 2007 ). OpenUrl CrossRef PubMed Web of Science ↵ Czech , B. & Hannon , G. J. Small RNA sorting: matchmaking for Argonautes . Nat Rev Genet 12 , 19 – 31 ( 2011 ). OpenUrl CrossRef PubMed ↵ Jouravleva , K. & Zamore , P. D. A guide to the biogenesis and functions of endogenous small non-coding RNAs in animals . Nat Rev Mol Cell Biol ( 2025 ). ↵ Gent , J. I. et al. Distinct phases of siRNA synthesis in an endogenous RNAi pathway in C. elegans soma . Mol Cell 37 , 679 – 689 ( 2010 ). OpenUrl CrossRef PubMed Web of Science ↵ Vasale , J. J. et al. Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway . Proc Natl Acad Sci U S A 107 , 3582 – 3587 ( 2010 ). OpenUrl Abstract / FREE Full Text ↵ Welker , N. C. et al. Dicer’s helicase domain is required for accumulation of some, but not all, C. elegans endogenous siRNAs . RNA 16 , 893 – 903 ( 2010 ). OpenUrl Abstract / FREE Full Text ↵ Tabara , H. et al. The rde-1 gene, RNA interference, and transposon silencing in C. elegans . Cell 99 , 123 – 132 ( 1999 ). OpenUrl CrossRef PubMed Web of Science ↵ Duchaine , T. F. et al. Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways . Cell 124 , 343 – 354 ( 2006 ). OpenUrl CrossRef PubMed Web of Science ↵ Parker , G. S. , Eckert , D. M. & Bass , B. L. RDE-4 preferentially binds long dsRNA and its dimerization is necessary for cleavage of dsRNA to siRNA . RNA 12 , 807 – 818 ( 2006 ). OpenUrl Abstract / FREE Full Text ↵ Parker , G. S. , Maity , T. S. & Bass , B. L. dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi . J Mol Biol 384 , 967 – 979 ( 2008 ). OpenUrl CrossRef PubMed Chiliveri , S. C. & Deshmukh , M. V. Structure of RDE-4 dsRBDs and mutational studies provide insights into dsRNA recognition in the Caenorhabditis elegans RNAi pathway . Biochem J 458 , 119 – 130 ( 2014 ). OpenUrl Abstract / FREE Full Text ↵ Consalvo , C. D. et al. Caenorhabditis elegans Dicer acts with the RIG-I-like helicase DRH-1 and RDE-4 to cleave dsRNA . Elife 13 ( 2024 ). ↵ Thivierge , C. et al. Tudor domain ERI-5 tethers an RNA-dependent RNA polymerase to DCR-1 to potentiate endo-RNAi . Nat Struct Mol Biol 19 , 90 – 97 ( 2012 ). OpenUrl CrossRef PubMed Felix , M. A. et al. Natural and experimental infection of Caenorhabditis nematodes by novel viruses related to nodaviruses . PLoS Biol 9 , e1000586 ( 2011 ). OpenUrl CrossRef PubMed Ashe , A. et al. A deletion polymorphism in the Caenorhabditis elegans RIG-I homolog disables viral RNA dicing and antiviral immunity . Elife 2 , e00994 ( 2013 ). OpenUrl CrossRef PubMed ↵ Parrish , S. & Fire , A. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans . RNA 7 , 1397 – 1402 ( 2001 ). OpenUrl Abstract ↵ Wilkins , C. et al. RNA interference is an antiviral defence mechanism in Caenorhabditis elegans . Nature 436 , 1044 – 1047 ( 2005 ). OpenUrl CrossRef PubMed Web of Science Lee , R. C. , Hammell , C. M. & Ambros , V. Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans . RNA 12 , 589 – 597 ( 2006 ). OpenUrl Abstract / FREE Full Text ↵ Grishok , A. , Hoersch , S. & Sharp , P. A. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans . Proc Natl Acad Sci U S A 105 , 20386 – 20391 ( 2008 ). OpenUrl Abstract / FREE Full Text ↵ Zhou , R. et al. Processing of Drosophila endo-siRNAs depends on a specific Loquacious isoform . RNA 15 , 1886 – 1895 ( 2009 ). OpenUrl Abstract / FREE Full Text Czech , B. et al. An endogenous small interfering RNA pathway in Drosophila . Nature 453 , 798 – 802 ( 2008 ). OpenUrl CrossRef PubMed Web of Science Okamura , K. et al. The Drosophila hairpin RNA pathway generates endogenous short interfering RNAs . Nature 453 , 803 – 806 ( 2008 ). OpenUrl CrossRef PubMed Web of Science Hartig , J. V. , Esslinger , S. , Bottcher , R. , Saito , K. & Forstemann , K. Endo-siRNAs depend on a new isoform of loquacious and target artificially introduced, high-copy sequences . EMBO J 28 , 2932 – 2944 ( 2009 ). OpenUrl Abstract / FREE Full Text Miyoshi , K. , Miyoshi , T. , Hartig , J. V. , Siomi , H. & Siomi , M. C. Molecular mechanisms that funnel RNA precursors into endogenous small-interfering RNA and microRNA biogenesis pathways in Drosophila . RNA 16 , 506 – 515 ( 2010 ). OpenUrl Abstract / FREE Full Text ↵ Su , S. et al. Structural insights into dsRNA processing by Drosophila Dicer-2-Loqs-PD . Nature 607 , 399 – 406 ( 2022 ). OpenUrl CrossRef PubMed ↵ Liu , Q. et al. R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway . Science 301 , 1921 – 1925 ( 2003 ). OpenUrl Abstract / FREE Full Text Marques , J. T. et al. Loqs and R2D2 act sequentially in the siRNA pathway in Drosophila . Nat Struct Mol Biol 17 , 24 – 30 ( 2010 ). OpenUrl CrossRef PubMed Web of Science Tomari , Y. , Matranga , C. , Haley , B. , Martinez , N. & Zamore , P. D. A protein sensor for siRNA asymmetry . Science 306 , 1377 – 1380 ( 2004 ). OpenUrl Abstract / FREE Full Text ↵ Yamaguchi , S. et al. Structure of the Dicer-2-R2D2 heterodimer bound to a small RNA duplex . Nature 607 , 393 – 398 ( 2022 ). OpenUrl CrossRef PubMed ↵ Billi , A. C. , Fischer , S. E. & Kim , J. K. Endogenous RNAi pathways in C. elegans . WormBook , 1 – 49 ( 2014 ). ↵ Knittel , T. L. et al. A low-abundance class of Dicer-dependent siRNAs produced from a variety of features in C. elegans . Genome Res 34 , 2203 – 2216 ( 2024 ). OpenUrl Abstract / FREE Full Text ↵ Sternberg , P. W. et al. WormBase 2024: status and transitioning to Alliance infrastructure . Genetics 227 ( 2024 ). ↵ Han , T. et al. 26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans . Proc Natl Acad Sci U S A 106 , 18674 – 18679 ( 2009 ). OpenUrl Abstract / FREE Full Text Conine , C. C. et al. Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans . Proc Natl Acad Sci U S A 107 , 3588 – 3593 ( 2010 ). OpenUrl Abstract / FREE Full Text ↵ Ruby , J. G. et al. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans . Cell 127 , 1193 – 1207 ( 2006 ). OpenUrl CrossRef PubMed Web of Science ↵ Gu , W. et al. Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline . Mol Cell 36 , 231 – 244 ( 2009 ). OpenUrl CrossRef PubMed Web of Science ↵ Pak , J. & Fire , A. Distinct populations of primary and secondary effectors during RNAi in C. elegans . Science 315 , 241 – 244 ( 2007 ). OpenUrl Abstract / FREE Full Text ↵ Habig , J. W. , Aruscavage , P. J. & Bass , B. L. In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4 . PLoS One 3 , e4052 ( 2008 ). OpenUrl CrossRef PubMed ↵ Grishok , A. et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing . Cell 106 , 23 – 34 ( 2001 ). OpenUrl CrossRef PubMed Web of Science ↵ Brown , K. C. , Svendsen , J. M. , Tucci , R. M. , Montgomery , B. E. & Montgomery , T. A. ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline . Nucleic Acids Res 45 , 9093 – 9107 ( 2017 ). OpenUrl CrossRef PubMed ↵ Gent , J. I. et al. A Caenorhabditis elegans RNA-directed RNA polymerase in sperm development and endogenous RNA interference . Genetics 183 , 1297 – 1314 ( 2009 ). OpenUrl Abstract / FREE Full Text ↵ Fischer , S. E. et al. The ERI-6/7 Helicase Acts at the First Stage of an siRNA Amplification Pathway That Targets Recent Gene Duplications . PLoS genetics 7 , e1002369 ( 2011 ). OpenUrl CrossRef Chaves , D. A. et al. The RNA phosphatase PIR-1 regulates endogenous small RNA pathways in C. elegans . Mol Cell 81 , 546 – 557 e545 ( 2021 ). OpenUrl CrossRef PubMed Blumenfeld , A. L. & Jose , A. M. Reproducible features of small RNAs in C. elegans reveal NU RNAs and provide insights into 22G RNAs and 26G RNAs . RNA 22 , 184 – 192 ( 2016 ). OpenUrl Abstract / FREE Full Text ↵ Warf , M. B. , Shepherd , B. A. , Johnson , W. E. & Bass , B. L. Effects of ADARs on small RNA processing pathways in C. elegans . Genome Res 22 , 1488 – 1498 ( 2012 ). OpenUrl Abstract / FREE Full Text ↵ Chendrimada , T. P. et al. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing . Nature 436 , 740 – 744 ( 2005 ). OpenUrl CrossRef PubMed Web of Science ↵ Kim , Y. et al. Deletion of human tarbp2 reveals cellular microRNA targets and cell-cycle function of TRBP . Cell Rep 9 , 1061 – 1074 ( 2014 ). OpenUrl CrossRef PubMed ↵ Tabara , H. , Yigit , E. , Siomi , H. & Mello , C. C. The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans . Cell 109 , 861 – 871 ( 2002 ). OpenUrl CrossRef PubMed Web of Science Conine , C. C. et al. Argonautes Promote Male Fertility and Provide a Paternal Memory of Germline Gene Expression in C. elegans . Cell 155 , 1532 – 1544 ( 2013 ). OpenUrl CrossRef PubMed Web of Science Yigit , E. et al. Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi . Cell 127 , 747 – 757 ( 2006 ). OpenUrl CrossRef PubMed Web of Science ↵ Pavelec , D. M. , Lachowiec , J. , Duchaine , T. F. , Smith , H. E. & Kennedy , S. Requirement for the ERI/DICER complex in endogenous RNA interference and sperm development in Caenorhabditis elegans . Genetics 183 , 1283 – 1295 ( 2009 ). OpenUrl Abstract / FREE Full Text Blanchard , D. et al. On the nature of in vivo requirements for rde-4 in RNAi and developmental pathways in C. elegans . RNA Biol 8 , 458 – 467 ( 2011 ). OpenUrl CrossRef PubMed Web of Science Posner , R. et al. Neuronal Small RNAs Control Behavior Transgenerationally . Cell 177 , 1814 – 1826 e1815 ( 2019 ). OpenUrl CrossRef PubMed Svendsen , J. M. et al. henn-1/HEN1 Promotes Germline Immortality in Caenorhabditis elegans . Cell Rep 29 , 3187 – 3199 ( 2019 ). OpenUrl CrossRef PubMed Seroussi , U. et al. A comprehensive survey of C. elegans argonaute proteins reveals organism-wide gene regulatory networks and functions . Elife 12 ( 2023 ). ↵ Cong , L. et al. Multiplex genome engineering using CRISPR/Cas systems . Science 339 , 819 – 823 ( 2013 ). OpenUrl Abstract / FREE Full Text Jinek , M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity . Science 337 , 816 – 821 ( 2012 ). OpenUrl Abstract / FREE Full Text Gasiunas , G. , Barrangou , R. , Horvath , P. & Siksnys , V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria . Proc Natl Acad Sci U S A 109 , E2579 – 2586 ( 2012 ). OpenUrl Abstract / FREE Full Text ↵ Mali , P. et al. RNA-guided human genome engineering via Cas9 . Science 339 , 823 – 826 ( 2013 ). OpenUrl Abstract / FREE Full Text ↵ Dickinson , D. J. , Ward , J. D. , Reiner , D. J. & Goldstein , B. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination . Nat Methods 10 , 1028 – 1034 ( 2013 ). OpenUrl CrossRef PubMed Web of Science ↵ Abramson , J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3 . Nature 630 , 493 – 500 ( 2024 ). OpenUrl CrossRef PubMed ↵ UniProt , C. UniProt: the Universal Protein Knowledgebase in 2025 . Nucleic Acids Res ( 2024 ). ↵ Meng , E. C. et al. UCSF ChimeraX: Tools for structure building and analysis . Protein Sci 32 , e4792 ( 2023 ). OpenUrl CrossRef PubMed ↵ Almeida , M. V. , de Jesus Domingues , A. M. , Lukas , H. , Mendez-Lago , M. & Ketting , R. F. RppH can faithfully replace TAP to allow cloning of 5’-triphosphate carrying small RNAs . MethodsX 6 , 265 – 272 ( 2019 ). OpenUrl CrossRef PubMed ↵ Tate , A. J. , Brown , K. C. & Montgomery , T. A. tiny-count: a counting tool for hierarchical classification and quantification of small RNA-seq reads with single-nucleotide precision . Bioinform Adv 3 , vbad065 ( 2023 ). OpenUrl Chen , S. , Zhou , Y. , Chen , Y. & Gu , J. fastp: an ultra-fast all-in-one FASTQ preprocessor . Bioinformatics 34 , i884 – i890 ( 2018 ). OpenUrl CrossRef PubMed Langmead , B. , Trapnell , C. , Pop , M. & Salzberg , S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome . Genome Biol 10 , R25 ( 2009 ). OpenUrl CrossRef PubMed ↵ Anders , S. , Pyl , P. T. & Huber , W. HTSeq--a Python framework to work with high-throughput sequencing data . Bioinformatics 31 , 166 – 169 ( 2015 ). OpenUrl CrossRef PubMed Web of Science ↵ Love , M. I. , Huber , W. & Anders , S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol 15 , 550 ( 2014 ). OpenUrl CrossRef PubMed ↵ Hunter , J. D. Matplotlib: A 2D graphics environment . Comput Sci Eng 9 , 90 – 95 ( 2007 ). OpenUrl CrossRef PubMed Robinson , J. T. et al. Integrative genomics viewer . Nat Biotechnol 29 , 24 – 26 ( 2011 ). OpenUrl CrossRef PubMed Web of Science ↵ R Core Team . R Foundation for Statistical Computing , Vienna, Austria ( 2021 ). ↵ Kamath , R. S. et al. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi . Nature 421 , 231 – 237 ( 2003 ). OpenUrl CrossRef PubMed Web of Science ↵ Livak , K. J. & Schmittgen , T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method . Methods 25 , 402 – 408 ( 2001 ). OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted May 07, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegans Thiago L. Knittel , Brooke E. Montgomery , Reese A. Sprister , Colin N. Magelky , Margaret J. Smith , Maritza Soto-Ojeda , Melissa Guthrie , Carolyn M. Phillips , Taiowa A. Montgomery bioRxiv 2025.05.06.652520; doi: https://doi.org/10.1101/2025.05.06.652520 Share This Article: Copy Citation Tools Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegans Thiago L. Knittel , Brooke E. Montgomery , Reese A. Sprister , Colin N. Magelky , Margaret J. Smith , Maritza Soto-Ojeda , Melissa Guthrie , Carolyn M. Phillips , Taiowa A. Montgomery bioRxiv 2025.05.06.652520; doi: https://doi.org/10.1101/2025.05.06.652520 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17645) Bioengineering (13867) Bioinformatics (41873) Biophysics (21420) Cancer Biology (18550) Cell Biology (25447) Clinical Trials (138) Developmental Biology (13361) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24289) Genetics (15587) Genomics (22473) Immunology (17707) Microbiology (40322) Molecular Biology (17144) Neuroscience (88457) Paleontology (666) Pathology (2826) Pharmacology and Toxicology (4815) Physiology (7634) Plant Biology (15111) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9813) Zoology (2268)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.