Incidence of Methicillin-resistant Staphylococcus aureus in milk and dairy and assessment genotypic and phenotypic properties of antibiotic resistance

Incidence of Methicillin-resistant Staphylococcus aureus in milk and dairy and assessment genotypic and phenotypic properties of antibiotic resistance | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Incidence of Methicillin-resistant Staphylococcus aureus in milk and dairy and assessment genotypic and phenotypic properties of antibiotic resistance Zohreh Mashak, Fatemeh Khadivi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3928012/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Methicillin-resistant Staphylococcus aureus bacteria are considered an emerging food-borne pathogens. This study aimed to evaluate the MRSA incidence and its genotypic and phenotypic properties of antibiotic resistance in raw milk and dairy. Methods Three hundred and eighty raw milk and traditional dairy samples were collected. S. aureus was examined by culture method. MRSA was identified as simultaneous resistance against cefoxitin and oxacillin. MRSA genotypic and phenotypic antibiotic resistance was evaluated by PCR and disk diffusion, respectively. Results S. aureus contamination rate in milk and dairy samples was 15.78% (70 of 380 samples). Thirty-eight out of 60 (63.33%) S. aureus isolates were identified as MRSA. MRSA distribution among isolates with sources of raw milk and dairy was 55.55% and 66.66%, respectively. MRSA isolates revealed the maximum resistance rate toward cefotaxime (100%), ceftriaxone (100%), penicillin (100%), erythromycin (85.78%), tetracycline (84.21%) and gentamicin (73.68%). Resistance of raw milk and dairy MRSA isolates against more than 7 antibiotic agents was 20% and 32.14%, respectively. The blaZ (100%), blaCTX-M (100%), tetK (55.26%), msrA (50%), aacA-D (47.36%), ermA (44.73%), mefA (44.73%) and gyrA (42.10%) were the most predominant genes encode resistance. Conclusions Dairy and milk in traditional and raw formats may be MDR-MRSA sources with boosted hygienic threats to consumers. Incidence Methicillin-resistant Staphylococcus aureus Traditional dairy Raw milk Antibiotic resistance Figures Figure 1 Figure 2 Introduction Milk, as a healthy food, is a rich source of appropriate materials for human health [ 1 ]. It is full of unique proteins, carbohydrates, fats, minerals, and vitamins [ 2 – 4 ]. Milk of animal species can processed into diverse kinds of healthy and popular dairy products including cheese, cream, butter, yogurt, kashk, and doogh [ 5 , 6 ]. Doogh and kashk are general traditional dairies in the Middle East. Kashk has liquid or dried types both are made from cheese-making leftover milk after well boiling [ 4 ]. Doogh is a pleasant yogurt-based beverage with acidic content [ 7 ]. Traditional dairy products are known as those produced traditionally without any industrial techniques and machines, particularly in small producing units or homes. Higher human involvement in the milking and production of traditional dairy products makes them more prone to microbial contamination [ 8 – 11 ]. Milk and dairies in raw and traditional forms are mainly sale in Iran. Otherwise, farmer´s markets, retail, or supermarkets can sale diverse kinds of dairy products in Iran. Staphylococcus aureus ( S. aureus ) is a pathogenic bacterium originated from the upper respiratory tract and skin [ 12 , 13 ]. Additionally, the mammary glands of animals, the dairy environment (including milking hall and equipment), and milkers’ hands can be important sources of S. aureus . Furthermore, dairy products can become contaminated with S. aureus during manufacturing and subsequent handling. Staphylococcus aureus is mostly responsible for the occurrence of food poisoning and food-borne diseases known with nausea, crmps of the abdomen, vomiting, rarely diarrhea, and toxic shock syndrome (TSS), and nosocomial infections [ 12 , 13 ]. Currently, methicillin-resistant S. aureus (MRSA) has become a substantial threat globally [ 14 ]. Moreover, several investigation reported the high MRSA prevalence in foodstuffs, particularly milk and dairy [ 15 – 17 ] which may show the importance of these kinds of food samples as MRSA source [ 15 – 17 ]. Boosted MRSA resistance, particularly against fluoroquinolones, cephalosporins, macrolides, lincosamides, aminoglycosides, penicillins, folate pathway inhibitors, tetracyclines, phenicols, and glycopeptides, is another substantial issue in its control and treatment [ 18 , 19 ]. Some specific genes are responsible for the occurrence of antibiotic resistance amongst the Staphylococcus bacteria. Incidence of the genes that encode resistance toward penicillins ( blaZ ), cephalosporins ( blaCTX ), aminoglycosides ( aacA ), glycopeptides ( van ), folate pathway inhibitors ( dfrA1 ), macrolides ( mef , msr , and erm ), tetracyclines ( tet ), lincosamides ( linA ), ansamycins ( rpoB ), fluoroquinolones ( gyrA and grlA ) and phenicols ( cfr ) antibiotics was abundant amongst MRSA bacteria [ 18 , 19 ]. Despite the high number of investigation on MRSA dynamics, additional inquiries are obligatory to ontain more MRSA epidemiological aspects. Consequently, this study was aimed to evaluate the incidence the MRSA amongst the milk and dairy samples and to apprise their genotypic and phenotypic properties of antibiotic resistance. Materials and methods Sampling From September 2021 to March 2022, a total of 380 raw milk and traditionally produced dairy samples including cow milk (n = 50), sheep milk (n = 40), goat milk (n = 50), cheese (n = 40), cream (n = 40), butter (n = 40), yogurt (n = 40), doogh (n = 40) and kashk (n = 40) were collected from different shopping centers, Urmia, Iran. The mean S. aureus prevalnce in food samples collected from previous surveys was applied to determine the sample size [ 16 , 20 – 23 ]. All samples were stored at refrigerator. A total of fifty grams were collected from each raw milk and dairy samples. Cool bags were applied for samples rapid trasnferring. Samples appearance and physical properties, including color, odor, and density was normal. S. aureus isolation amd MRSA identification Samples (25 g each) were added to peptone water (225 mL and buffered type) and homogenized (Stomacher, Interscience, France). From an achieved solution, 5 µl was poured into a tube contained Trypticase Soy Broth (50 mL). Media were complemented with sodium pyruvate (1%) and NaCl (10%) and incubated at 35°C for 18 h. Formerly, a loopful of the TSB culture was transferred into egg yolk tellurite emulsion Baird-Parker agar. Incubation was done for 24 h at 37°C. Balck colonies with shiny appearance were initially recognized as S. aureus and examined with supplementary tests, including Gram staining, bacitracin resistance, oxidase, urease, coagulase, hemolysis, and catalase activity, mannitol and other carbohydrates fermentation, phosphatase, nitrate reduction, and voges-proskaver (VP) test (All media were purchased from Merck, Germany) [ 24 ]. After S. aureus identification, MRSA was determined using cefoxitin (30 µg) and oxacillin (1 µg) susceptibility examination [ 25 , 26 ]. The presence of mecA gene was also assessed in MRSA isolates [ 20 ]. MRSA phenotypic resistance MRSA phenotypic antibiotic resistance was evaluated by disk diffusion regarding the Clinical and Laboratory Standard Institute (CLSI) instructions on Mueller–Hinton agar (MHA, Merck, Germany) [ 27 ]. Initially, 0.5 McFarland concentration was prepared from MRSA isolates and then bacterial were cultured superficially on the mha media. Dissimilar antibiotic disks, including clindamycin (2 µg/disk), ciprofloxacin, rifampin, vancomycin, and levofloxacin (5 µg/disk), gentamicin and penicillin (10 µg/disk), erythromycin and azithromycin (15 µg/disk), trimethoprim-sulfamethoxazole (25 µg/disk), amikacin, doxycycline, cefotaxime, tetracycline, ceftriaxone, and chloramphenicol (30 µg/disk) (Oxoid, UK) were placed with significant distance from eachothers on the MHA media contained the MRSA. Media contained MRSA and disks were incubated (37°C for 24 h) and the diameter of the growth inhibition zone surround each disk was measred, comopared with CLSI guidelines [ 28 ], and resistant isolates were determined. Multidrug resistant (MDR)-MRSA prevalence was also determined rendering the percent of bacteria resist to more than three antibiotic agent. Methicillin-resistant S. aureus ATCC 43300 was used as a positive control. MRSA genotypic resistance MRSA isolates sub-cultured one-night period on TSB was applied for DNA extraction using kit (Thermo Fisher Scientific, Germany) regarding the guidlines. Extracted DNA’s purity (A260/A280) was evaluated using NanoDrop (NanoDrop, Thermo Scientific, USA). PCR programs and thermal cycles for antibiotic resistance encoding genes were revealed in Table 1 [ 29 – 36 ]. Thermocycler device with determined program (Eppendorf Mastercycler 5330, Germany) was applied. Visualization was done by electrophoresis (120 V/208 mA) in agarose gel (2.5%) contained 0.4 µg/ml ethidium bromide. Presence or absence of significant bands in obtained gels were screened by the UVIDoc (Jencons PLC, UK). MRSA (ATCC 43300 and ATCC 33591) strains were applied as positive and PCR-grade water was applied as negative controls. All reagents and materials were purchased from Thermo Fisher Scientific, Germany. Table 1 PCR programs [ 28 – 36 ]. Target gene Sequence (5'-3') PCR product (bp) Programs Volume (50µL) aacA-D F: TAATCCAAGAGCAATAAGGGC R: GCCACACTATCATAACCACTA 227 1 cycle: 94°C, 5 min. 25 cycles: 94°C, 60 s 55°C, 70 s 72°C, 60 s 1 cycle: 72°C, 10 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL ermA F: AAGCGGTAAACCCCTCTGA R: TTCGCAAATCCCTTCTCAAC 190 tetK F: GTAGCGACAATAGGTAATAGT R: GTAGTGACAATAAACCTCCTA 360 ermB F: CCGTTTACGAAATTGGAACAGGTAAAGGGC R: GAATCGAGACTTGAGTGTGC 359 mefA F: ACTATCATTAATCACTAGTGC R: TTCTTCTGGTACTAAAAGTGG 346 grlA F: ACTTGAAGATGTTTTAGGTGAT R: TTAGGAAATCTTGATGGCAA 618 tetM F: AGTGGAGCGATTACAGAA R: CATATGTCCTGGCGTGTCTA 158 1 cycle: 94°C, 6 min. 34 cycles: 95°C, 50 s 55°C, 70 s 72°C, 60 s 1 cycle: 72°C, 8 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL gyrA F: AGTACATCGTCGTATACTATATGG R: ATCACGTAACAGTTCAAGTGTG 280 msrA F: GGCACAATAAGAGTGTTTAAAGG R: AAGTTATATCATGAATAGATTGTCCTGTT 940 1 cycle: 94°C, 6 min. 34 cycles: 95°C, 60 s 50°C, 70 s 72°C, 70 s 1 cycle: 72°C, 8 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL msrB F: TATGATATCCATAATAATTATCCAATC R: AAGTTATATCATGAATAGATTGTCCTGTT 595 dfrA1 F: CTCACGATAAACAAAGAGTCA R: CAATCATTGCTTCGTATAACG 201 linA F: GGTGGCTGGGGGGTAGATGTATTAACTGG R: GCTTCTTTTGAAATACATGGTATTTTTCGA 323 1 cycle: 94°C, 6 min. 30 cycles: 95°C, 60 s 57°C, 60 s 72°C, 60 s 1 cycle: 72°C, 10 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL blaZ F: TGAACCGTATGTTAGTGC R: GTCGTGTTAGCGTTGATA 681 1 cycle: 94°C, 6 min. 30 cycles: 95°C, 60 s 59°C, 60 s 72°C, 60 s 1 cycle: 72°C, 10 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL cfr F: TGAAGTATAAAGCAGGTTGGGAGTCA R: ACCATATAATTGACCACAAGCAGC 746 1 cycle: 94°C, 1 min. 34 cycles: 94°C, 2 min 48°C, 60 s 72°C, 3 min 1 cycle: 72°C, 10 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL rpoB F: ACCGTCGTTTACGTTCTGTA R: TCAGTGATAGCATGTGTATC 460 1 cycle: 94°C, 5 min. 40 cycles: 94°C, 40 s 45.5°C, 40 s 72°C, 90 s 1 cycle: 72°C, 8 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL blaCTX-M a F: ATGTGCAGYACCAGTAARGT R: TGGGTRAARTARGTSACCAGA 593 1 cycle: 94°C, 7 min. 35 cycles: 94°C, 50 s 50°C, 40 s 72°C, 60 s 1 cycle: 72°C, 5 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL vanA F: ATGAATAGAATAAAAGTTGC R: TCACCCCTTTAACGCTAATA 1032 1 cycle: 98°C, 2 min. 35 cycles: 98°C, 10 s 50°C, 60 s 72°C, 90 s 1 cycle: 72°C, 10 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL vanB F: GTGACAAACCGGAGGCGAGGA R: CCGCCATCCTCCTGCAAAAAA 430 1 cycle: 94°C, 10 min. 30 cycles: 94°C, 30 s 50°C, 45 s 72°C, 30 s 1 cycle: 72°C, 10 min 10X PCR buffer: 5 µL MgCl 2 : 1.5 mM dNTP: 200 µM Primers F & R: 0.5 µM each DNA polymerase (Taq): 1.25 U DNA: 2.5 µL a R is G or A; Y is T or C; S is C or G. Data analysis SPSS 21.0 software (SPSS, USA) was applied. Two tests, including Chi-square test and Fisher’s exact were applied to measure any significant association between the collected data. P value < 0.05 was considered as significant level. Results S. aureus and MRSA incidence Table 2 characterizes the S. aureus and MRSA incidence. S. aureus total contamination rate was 15.78% (60 of 380 samples). S. aureus raw milk and traditional dairy contamination rates was were 12.85% and 17.50%, respectively. Raw cow milk (18.00%) and traditional cheese (32.50%) samples had the maximum S. aureus contamination rates. Thirty-eight out of 60 (63.33%) S. aureus isolates harbored simultaneous resistance toward cefoxitin and oxacillin and were determined as MRSA. Additionally, all of the MRSA isolates harbored the mecA gene. Total incidence of MRSA amongst the S. aureus bacteria isolated from raw milk and dairy samples were 55.55% and 66.66%, respectively. Raw goat milk (66.66%) and traditional doogh (75.00%) samples had the highest contamination rates with the MRSA. Data anlysis revealed significant difference between sample types and S. aureus incidence and similarly for the MRSA ( P < 0.05). Table 2 S. aureus and MRSA incidence. Types of samples N * . collected samples N. samples positive for S. aureus (%) N. isolates determined as MRSA (%) Raw milk Cow 50 9 (18) 5 (55.55) Sheep 40 6 (15) 3 (50) Goat 50 3 (6) 2 (66.66) Total 140 18 (12.85) 10 (55.55) Traditional dairy Cheese 40 13 (32.50) 9 (69.23) Cream 40 9 (22.50) 6 (66.66) Butter 40 10 (25) 6 (60) Yogurt 40 3 (7.50) 2 (66.66) Doogh 40 4 (10) 3 (75) Kashk 40 3 (7.50) 2 (66.66) Total 240 42 (17.50) 28 (66.66) Total 380 60 (15.78) 38 (63.33) * Number MRSA phenotypic resistance Table 3 characterizes the MRSA phenotypic antibiotic resistance. Methicillin-resistant S. aureus bacteria presented the maximum resistance rate against cefotaxime (100%), ceftriaxone (100%), penicillin (100%), erythromycin (85.78%), tetracycline (84.21%) and gentamicin (73.68%) antibiotic agents. However, MRSA strains revealed the minimum rate of resistance against chloramphenicol (18.42%), rifampin (36.84%), vancomycin (39.47%), azithromycin (47.36%), and doxycycline (52.63%) antibiotic agents. Data anlysis revealed significant difference between MRSA phenotypic resistance and sample types ( P < 0.05). Table 3 MRSA phenotypic resistance. Type of samples (N. MRSA) N * (%) isolates resistant to each antibiotic Penicillins Aminoglycosides Tetracyclines Macrolides Cephalosporins Folate inhibitors Lincosamides Ansamycins Phenicols Fluoroquinolones Glycopeptides P10 ** Gen Amk Tet Dox Azi Ery Cft Cfr Tr-sul Cln Rif C30 Cip Lev Van Raw milk Cow (5) 5 (100) 3 (60) 3 (60) 4 (80) 3 (60) 2 (40) 3 (60) 5 (100) 5 (100) 3 (60) 2 (40) 1 (20) 1 (20) 3 (60) 2 (40) 2 (40) Sheep (3) 3 (100) 1 (33.33) 1 (33.33) 1 (33.33) 1 (33.33) 1 (33.33) 1 (33.33) 3 (100) 3 (100) 1 (33.33) 1 (33.33) 1 (33.33) - 1 (33.33) 1 (33.33) 1 (33.33) Goat (2) 2 (100) 1 (50) - 1 (50) 1 (50) - 1 (50) 2 (100) 2 (100) 1 (50) - - - 1 (50) 1 (50) - Total (10) 10 (100) 5 (50) 4 (40) 6 (60) 5 (50) 3 (30) 5 (50) 10 (100) 10 (100) 5 (50) 3 (30) 2 (20) 1 (10) 5 (50) 4 (40) 3 (30) Traditional dairy Cheese (9) 9 (100) 7 (77.77) 6 (66.66) 8 (88.88) 5 (55.55) 6 (66.66) 7 (77.77) 9 (100) 9 (100) 7 (77.77) 6 (66.66) 4 (44.44) 2 (22.22) 4 (44.44) 3 (33.33) 4 (44.44) Cream (6) 6 (100) 5 (83.33) 4 (66.66) 5 (83.33) 4 (66.66) 3 (50) 4 (66.66) 6 (100) 6 (100) 4 (66.66) 3 (50) 3 (50) 2 (33.33) 4 (66.66) 4 (66.66) 3 (50) Butter (6) 6 (100) 5 (83.33) 4 (66.66) 6 (100) 3 (50) 3 (50) 5 (83.33) 6 (100) 6 (100) 4 (66.66) 4 (66.66) 3 (50) 1 (16.66) 4 (66.66) 4 (66.66) 2 (33.33) Yogurt (2) 2 (100) 1 (50) 1 (50) 2 (100) 1 (50) 1 (50) 1 (50) 2 (100) 2 (100) 1 (50) 1 (50) - - 1 (50) 1 (50) 1 (50) Doogh (3) 3 (100) 2 (66.66) 1 (33.33) 3 (100) 1 (33.33) 1 (33.33) 2 (66.66) 3 (100) 3 (100) 2 (66.66) 2 (66.66) 1 (33.33) 1 (33.33) 2 (66.66) 2 (66.66) 1 (33.33) Kashk (2) 2 (100) 1 (50) 1 (50) 2 (100) 1 (50) 1 (50) 1 (50) 2 (100) 2 (100) 1 (50) 1 (50) 1 (50) - 1 (50) 1 (50) 1 (50) Total (28) 28 (100) 23 (82.14) 17 (60.71) 26 (92.85) 15 (53.57) 15 (53.57) 20 (71.42) 28 (100) 28 (100) 19 (67.85) 17 (60.71) 12 (42.85) 6 (21.42) 16 (57.14) 15 (53.57) 12 (42.85) Total (38) 38 (100) 28 (73.68) 21 (55.26) 32 (84.21) 20 (52.63) 18 (47.36) 25 (85.78) 38 (100) 38 (100) 24 (63.15) 20 (52.63) 14 (36.84) 7 (18.42) 21 (55.26) 19 (50) 15 (39.47) * Number; ** P10: penicillin (10 µg/disk), Gen: gentamicin (10 µg/disk), Amk: amikacin (30 µg/disk), Tet: tetracycline (30 µg/disk), Dox: doxycycline (30 µg/disk), Azi: azithromycin (15 µg/disk), Ery: erythromycin (15 µg/disk), Cft: cefotaxime (30 µg/disk), Cfr: ceftriaxone (30 µg/disk), Tri-Sul: trimethoprim-sulfamethoxazole (25 µg/disk), Cln: clindamycin (2 µg/disk), Rif: rifampin (5 µg/disk), C30: chloramphenicol (30 µg/disk), Cip: ciprofloxacin (5 µg/disk), Lev: levofloxacin (5 µg/disk), and Van: vancomycin (5 µg/disk). MDR -MRSA incidnece Figure 1 represents the MDR-MRSA incidence among raw milk samples. All MRSA bacteria with raw milk origin harbored resistance to at least one of the studied antibiotic disks. Resistance rate against 5 antibiotic agents was 40%. Rate of MDR resistance against more than 7 antibiotic agents was 20%. Figure 2 represents the MDR-MRSA incidence among dairy samples. All MRSA bacteria with dairy origin harbored resistance to at least one of the studied antibiotic disks. Resistance rate against 5 antibiotic agents was 64.28%. Rate of MDR resistance against more than 7 antibiotic agents was 32.14%. MRSA genotypic antibiotic resistance Table 4 represents the MRSA genotypic antibiotic resistance. The most commonly detected genes encode antibiotic resistance was blaZ (100%), blaCTX-M (100%), tetK (55.26%), msrA (50%), aacA-D (47.36%), ermA (44.73%), mefA (44.73%) and gyrA (42.10%). Incidence of msrB (15.78%), cfr (18.42%), vanB (18.42%), ermB (21.05%), rpoB (21.05%), and grlA (23.68%) was lower than other genes. MRSA bacteria with dairy origin harbored the highest distribution of genes encode antibiotic resistance ( P < 0.05). Data anlysis revealed significant difference between MRSA genotypic resistance and sample types ( P < 0.05). Moreover, significant difference was originated between the tetK and tetM , gyrA and grlA , vanA and vanB , ermA and ermB , and finally msrA and msrB ( P < 0.05) distribution. Discussion Resistant-bacteria and the genes encoding resistance toward microorganisms can trasnfere from food animals, particularly milk and meat, to humans. An imperative pathogen, MRSA, is presently endemic in many health care centers and also various foodstuffs, predominantly those have animal origins [ 37 ]. Findings of the present examination disclosed that the raw milk and traditional dairy contamination rate with MRSA was 10% (38/380) which was entirely higher than those reported from Germany (2.30%) [ 38 ], United Kingdom (2.30%) [ 39 ], China (2.10%) [ 40 ], Bangladesh (5.55%) [ 41 ], Singapore (2.20%) [ 42 ], and United States (4.00%) [ 43 ], while was lower than the incidence described from Turkey (17%) [ 39 ], Italy (20%) [ 44 ], Uganda (56.10%) [ 45 ], Brazil (23.30%) [ 46 ], Egypt (50.00%) [ 47 ], and Pakistan (34.00%) [ 48 ]. Surveys carried out in American, Asiana, African and European countries reported high incidence of MRSA amongst food and dairy samples [ 49 , 50 ]. Milk and dairy contamination rate with MRSA vary in dissimilar surveys. Differences in findings reported in various studies recommend that variations in time, season, sample types, sampling method and place, and even applied techniques may affect the surveys outcomes. Furthermore, differences in the milking halls and dairy producing units hygienic levels may cause changesin the bacterial incidence among dissimilar surveys [ 51 , 52 ]. The probable reasons for the high frequency or MRSA in milk and dairy in Iran is maybe the high prescription rate of antibiotic agents [ 53 – 55 ] and also low hygienic conditions of milking halls and traditional units of dairy production [ 53 – 55 ]. Findings of the present survey showed that MRSA bacteria had the higher incidence rate in traditionally produced dairy product than raw milk samples of animal species. Raw milk of animal species is probably contaminated due to the fact that some dairy animals are MRSA main sources. Additionally, some examined animals may harbored sub-clinical mastitis and shed the MRSA into their milk. Furthermore, the risk of MRSA transmission from infected staffs to milk and dairy should be considered [ 15 , 56 – 58 ]. Animals nutrition and habbits should also affect the MRSA distribution. In dairy samples, type of method of processing, may affect the MRSA incidence. In this regard, cooking or boiling time and temperature and also acidic level of dairy may affect the survival of MRSA and other bacteria. Kashak is mainly produce through boiling and doogh is mainly has acidic pH [ 6 ]. As a result, they they harbored the minimum MRSA contamination rate. Cheese contamination rate with MRSA was 22.50%. It is because of cheese production need low cooking time and temperature compared to other dairy products which facilitates the survival and growth of S. aureus . MRSA boosted resistance against cefotaxime, ceftriaxone, penicillin, tetracycline, erythromycin, and gentamicin was supported by the boosted incidence of blaCTX-M , blaZ , msrA , tetK , ermA and mefA , and aacA-D antibiotic resistance-encoding genes, respectively. Genotypic and phenotypic antibiotic resistance was assisted with the boosted distribution of MDR-MRSA. Uneven and unauthorize prescription of antibiotic agents are the probable reasons for boosted incidence of resistance in the present research [ 59 – 63 ]. Regarding the boosted rate of resistance, the above-mentioned antibiotics should be prescribed with caution for mastitis and also cases of food poisoning caused by MRSA in Iran. Similar MRSA rate of resistance against cefotaxime, ceftriaxone, penicillin, tetracycline, erythromycin, and gentamicin was reported from South Africa [ 64 ], Malaysia [ 65 ], Indonesia [ 66 ], Iran [ 67 ], Jordan [ 68 ], and Egypt [ 69 ]. Comparable S. aureus phenotypic resistance has been described against fluoroquinolones [ 69 – 75 ], aminoglycosides [ 69 – 75 ], macrolides [ 69 – 75 ], tetracyclines [ 69 – 73 ], cephems [ 69 – 75 ], folate inhibitors [ 69 – 75 ], penicillins [ 69 – 75 ], phenicols [ 69 – 73 ], lincosamides [ 69 – 75 ], and ansamycins [ 69 – 73 ], antibiotic groups. Similar MDR distribution was also reported previously [ 76 – 78 ]. Likewise, a survey on hospital foods [ 70 ] described that the MRSA resistance against gentamicin (81.08%), ceftaroline (100%), azithromycin (59.45%), ciprofloxacin (48.64%), trimethoprim-sulfamethoxazole (83.78%), rifampin (35.13%), penicillin (100%), erythromycin (86.47%), and tetracycline (100%) was combined with the boosted distribution of aacA-D (62.16%), msrA (64.86%), tetK (72.97%), vatA (45.94%), ermA (72.97%), and linA (43.24%) encoding genes. Correspondingly, Rahi et al. (2020) [ 79 ] stated that the MRSA resistance against doxycycline (71.42%), amikacin (17.85%), clindamycin (42.85%), erythromycin (82.14%), gentamicin (78.57%), trimethoprim-sulfamethoxazole (78.57%), ciprofloxacin (35.71%), tetracycline (100%), azithromycin (32.14%), penicillin (100%), levofloxacin (32.14%), rifampin (14.28%), and chloramphenicol (28.57%) was assisted with the boosted distribution of ermA (50%), blaZ (100%), msrA (35.71%), ermB (25%), gyrA (50%), aacA-D (67.85%), linA (28.57%), tetK (85.71%), mefA (35.71%), rpoB (10.71%) grlA (42.85%), tetM (35.71%), dfrA1 (71.42%), cfr (25%), and msrB (10.71%) resistance encoding genes. Previous epidemiological surveys were also reported that MRSA phenotypic resistance was mainly confirmed by the presence of specific antibiotic resistance-encoding genes [ 70 , 79 – 81 ]. Huang et al. (2023) [ 82 ] described that S. aureus bacteria isolated from raw milk in China harbored the boosted rate of resistance against erythromycin (21.60%), sulfamethoxazole (65.00%), and ampicillin (96.70%) with considerable distribution of tet (9.27%), fex (6.83%), and erm (4.39%) resistance-encoding genes. Similarly, Liu et al. (2022) [ 83 ] described that the S. aureus strains with raw cow milk revealed the maximum rate of resistance toward penicillin (50.00%), ampicillin (33.30%), cefoxitin (22.20%), oxacillin (16.70%), eyrthromicin (25.00%), clindamycin (2.80%), trimethoprim-sulfamethoxazole (8.30%), tetracycline (41.70%), kanamycin (19.40%), gentamicin (36.10%), streptomycin (22.20%), and chloramphenicol (16.70%). They also supported that the resistance-encoding genes, particularly blaZ (69.20%), mecA (23.10%), cfxA (23.10%), aacaph (50.00%), fexA (7.70%), tetM (38.50%), tetK (7.70%), ermB (11.50%), and msrB (15.40%), were predominant amongst the S. aureus isolates. As several mechanisms of antibiotic resistance other than the presence of the genes encode resistance existed in bacterial cells, it is not surprising that the examined MRSA bacteria had the higher phenotypically resistance toward antibiotic agents than genotypical. This conclusion was in agreement with those reported from previous investigations [ 12 , 76 , 79 ]. Akanbi et al. (2017) [ 84 ] described the boosted distribution of tet , erm , and mec resistance encode genes. Surveys conducted in Egypt [ 85 ], Germany [ 29 , 86 ], Iran [ 87 ], and Switzerland [ 88 ] also revealed the bossted incidence of tet , mec , vat , erm , and msr resistance encoding genes amongst the S. aureus of food origins. Kabiri and Mashak (2022) [ 89 ] also reported the boosted dfrA1 (44.44%), blaZ (100%), tetK (51.85%). aacA-D (62.96%), and cat1 (48.14%) incidence amongst the raw milk-borne MRSA in Iran. Similar to our findings, Hizlisoy et al. (2018) [ 90 ] described similar genotypic profile of resistance ( blaZ , tet , aacA , erm , mec , vat , and van ) of S. aureus in animal foods in Turkey. Higher distribution of ermA than ermB , vatA than vatB , tetK than tetM , msrA than msrB , gyrA than grlA , and vanA than vanB resistance encoding genes was described in the current study, which was entirely supported by the previous investigations [ 12 , 70 , 79 , 91 , 92 ]. MDR-MRSA was reported in 40% of milk-borne and 64.28% of dairy-borne isolates. Studies conducted on China [ 40 ], Bangladesh [ 41 ], Iran [ 12 , 13 , 70 , 71 , 76 , 78 , 79 ], United States [ 93 ], Kuwait [ 94 ], India [ 95 ], and Africa [ 63 ] also described the high incidence of MDR- S. aureus in food samples. Conclusions MRSA presence of in milk and dairy beside the boosted incidence of MDR and also dissimilar resistance-encoding genes were reported in the present survey. Traditional dairy product samples had the higher potential to transmission of MDR-MRSA. High incidence of resistance of MRSA against cefotaxime, ceftriaxone, penicillin, erythromycin, tetracycline and gentamicin which was supported by the presence of blaCTX-M , blaZ , msrA , ermA , aacA-D , mefA , tetK , and gyrA antibiotic encoding genes may recommend a substantial threat about the raw or unpasteurized milk and traditionally produced dairy product role in MDR-MRSA transmission into the community. It seems that cefotaxime, ceftriaxone, tetracycline, erythromycin, penicillin, and gentamicin antibiotic agents are not operative healing options in the cases of MRSA food-borne diseases in Iran. Appropriate raw milk boiling, pasteurization employment, cross-contamination deterrence, and disk diffusion-based antibiotic administration can moderate the MDR-MRSA transmission risk. Abbreviations S. aureus Staphylococcus aureus MRSA Methicillin-resistant Staphylococcus aureus PCR Polymerase Chain Reaction SPSS Statistical Package for the Social Sciences Declarations Ethical Approval As the project didn’t performed any human or animal-based examination, ethical approval was not applicable. Consent for publication There was no consent for publication. Competing interests The authors declare that they have no competing interests. Funding Not applicable. Availability of data and material All data generated or analyzed throughout this research are included in this published article. References Maryam M, Manzoor A. A comparative evaluation of five milk-producing mammals: Benefits and safety. Archives Veterinary Sci. 2023;28(4). Calvo MV, Fontecha J, Pérez-Gálvez A, Rodríguez-Alcalá LM. Milk lipids and their nutritional importance. InBioactive Lipids 2023 (pp. 269–95). Academic. ALKaisy QH, Al-Saadi JS, Al‐Rikabi AK, Altemimi AB, Hesarinejad MA, Abedelmaksoud TG. Exploring the health benefits and functional properties of goat milk proteins. Food Sci Nutr. 2023;11(10):5641–56. Pratelli G, Tamburini B, Badami GD, Lo Pizzo M, De Blasio A, Carlisi D, Di Liberto D. Cow’s Milk: A Benefit for Human Health? Omics Tools and Precision Nutrition for Lactose Intolerance Management. Nutrients. 2024;16(2):320. Safarpoor Dehkordi F, Yazdani F, Mozafari J, Valizadeh Y. Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products. BMC Res Notes. 2014;7:217. Shahrajabian MH, Sun W. Kashk and Doogh: The Yogurt-based National Persian Products. Curr Nutr Food Sci. 2023;19(9):922–7. Makhdoumi P, Hossini H, Mohammadi R, Limoee M. The prevalence of aflatoxin M1 (AFM1) in conventional and industrial dairy products (yogurt, cheese, kashk and dough) of Iran: a systematic review and meta-analysis. Rev Environ Health. 2022;37(1):123–35. Ogwaro BA, Gibson H, Hill DJ, O’Gara EA. Microbiological Quality of Typical Traditional Fermented Milk from Northern Uganda and Western Kenya. Dairy. 2023 J;4(3):445 – 61. Ranjbar R, Farsani FY, Dehkordi FS. Phenotypic analysis of antibiotic resistance and genotypic study of the vacA, cagA, iceA, oipA and babA genotypes of the Helicobacter pylori strains isolated from raw milk. Antimicrob Resist Infect Control. 2018;7:115. Ghali-Mohammed I, Odetokun IA, Raufu IA, Adetunji VO. Handling practices and contamination of raw milk sold for consumption in markets of Kwara State, Nigeria. Sokoto J Veterinary Sci. 2022;20(1):50–8. Normatova SA, Botirov MT, Ruzmatova KK, ugli Mamarasulov JO. Hygienic basis for contamination of food products and production of dairy products until 2030. Int J Health Med Sci. 2021;4(1):123–8. Zheng J, Liu L, Chen G, Xu W, Huang Y, Lei G, Huang W, Lv H, Yang X. Molecular Characteristics of Staphylococcus aureus Isolates form Food-Poisoning Outbreaks (2011–2022) in Sichuan, China. Foodborne Pathogens and Disease; 2024. Abdolmaleki Z, Mashak Z, Dehkordi FS. Phenotypic and genotypic characterization of antibiotic resistance in the methicillin-resistant Staphylococcus aureus strains isolated from hospital cockroaches. Antimicrob Resist Infect Control. 2019;8:54. Abdolmaleki Z, Mashak Z, Safarpoor Dehkordi F. Molecular and Virulence Characteristics of Methicillin-Resistant Staphylococcus aureus Bacteria Recovered From Hospital Cockroaches. Jundishapur J Microbiol. 2019;12. Kansaen R, Boueroy P, Hatrongjit R, Kamjumphol W, Kerdsin A, Chopjitt P. The Occurrence and Characteristics of Methicillin-Resistant Staphylococcal Isolates from Foods and Containers. Antibiotics. 2023;12(8):1287. Titouche Y, Hakem A, Houali K, Meheut T, Vingadassalon N, Ruiz-Ripa L, Salmi D, Chergui A, Chenouf N, Hennekinne J. Emergence of methicillin-resistant Staphylococcus aureus (MRSA) ST8 in raw milk and traditional dairy products in the Tizi Ouzou area of Algeria. J Dairy Sci. 2019;102:6876–84. Keyvan E, Yurdakul O, Demirtas A, Yalcin H, Bilgen N. Identification of Methicillin-Resistant Staphylococcus aureus in Bulk Tank Milk. Food Sci Techno. 2020;40:150–6. Silva AT, Gonçalves JL, Dantas ST, Rall VL, de Oliveira PR, Dos Santos MV, Peixoto RD, Mota RA. Genetic and phenotypic characterization of subclinical mastitis-causing multidrug-resistant Staphylococcus aureus. Antibiotics. 2023;12(9):1353. Ates A, Tastan C, Ermertcan S. Precision Genome Editing Unveils a Breakthrough in Reversing Antibiotic Resistance: CRISPR/Cas9 Targeting of Multi-Drug Resistance Genes in Methicillin-Resistant Staphylococcus aureus. bioRxiv. 2024:2023–12. Otarigho B, Falade MO. Analysis of antibiotics resistant genes in different strains of Staphylococcus aureus. Bioinformation. 2018;14:113. Hunduma D, Amenu K, Desta H, Grace D, Agga GE, Kerro Dego O. Prevalence and antimicrobial resistance of Escherichia coli O157: H7 and Salmonella, and the prevalence of Staphylococcus aureus in dairy cattle and camels under pastoral production system. Antibiotics. 2023;13(1):26. Wang W, Lin X, Jiang T, Peng Z, Xu J, Yi L, Li F, Fanning S, Baloch Z. Prevalence and characterization of Staphylococcus aureus cultured from raw milk taken from dairy cows with mastitis in Beijing, China. Front Microbiol. 2018;9:1123. Gajewska J, Zakrzewski A, Chajęcka-Wierzchowska W, Zadernowska A. Meta-analysis of the global occurrence of S. aureus in raw cattle milk and artisanal cheeses. Food Control. 2023:109603. Baymenov BM, Bulashev AK, Chuzhebayeva GD, Aliyeva GK, Beishova IS, Kokanov SK, Raketsky VA. Phenotypic and genotypic resistance to antibiotics in Staphylococcus aureus strains isolated from cattle milk in Northern Kazakhstan. Veterinary World. 2023;16(9):1815. Bonjean M, Hodille E, Dumitrescu O, Dupieux C, Nkoud Mongo C, Allam C, Beghin M, Paris M, Borrel O, Chardon H, Laurent F. Disk diffusion testing for detection of methicillin-resistant Staphylococci: Does Moxalactam improve upon Cefoxitin? J Clin Microbiol. 2016;54(12):2905–9. Madhavan A, Sachu A, Balakrishnan A, Vasudevan A, Balakrishnan S, Vasudevapanicker J. Comparison of PCR and phenotypic methods for the detection of methicillin resistant Staphylococcus aureus. Iran J Microbiol. 2021;13(1):31. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; 17th Informational Supplement. CLSI document M100-S17. 2007. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement. CLSI document M100-S25. 2015. Lina G, Quaglia A, Reverdy M-E, Leclercq R, Vandenesch F, Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob Agent Chemotherap. 1999;43:1062–6. Strommenger B, Kettlitz C, Werner G, Witte W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J Clin Microbiol. 2003;41:4089–94. Aboshkiwa M, Rowland G, Coleman G. Nucleotide sequence of the Staphylococcus aureus RNA polymerase rpoB gene and comparison of its predicted amino acid sequence with those of other bacteria. Biochim Biophys Acta. 1995;1262:73–8. Schmitz F-J, Jones ME, Hofmann B, Hansen B, Scheuring S, Lückefahr M, Fluit A, Verhoef J, Hadding U, Heinz H-P. Characterization of grlA, grlB, gyrA, and gyrB mutations in 116 unrelated isolates of Staphylococcus aureus and effects of mutations on ciprofloxacin MIC. Antimicrob Agent Chem. 1998;42:1249–52. Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob Agent Chem. 1999;43:2823–30. Tang J, Zhang R, Chen J, Zhao Y, Tang C, Yue H, Li J, Wang Q, Shi H. Incidence and characterization of Staphylococcus aureus strains isolated from food markets. Ann Microbiol. 2015;65:279–86. Kehrenberg C, Schwarz S. Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates. Antimicrob Agent Chem. 2006;50:1156–63. Pagani L, Dell'Amico E, Migliavacca R, D'Andrea MM, Giacobone E, Amicosante G, Romero E, Rossolini GM. Multiple CTX-M-type extended-spectrum β-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J Clin Microbiol. 2003;41:4264–9. Clark N, Cooksey R, Hill B, Swenson J, Tenover F. Characterization of glycopeptide-resistant enterococci from US hospitals. Antimicrob Agent Chem. 1993;37:2311–7. Kluytmans J. Methicillin-resistant Staphylococcus aureus in food products: cause for concern or case for complacency? Clin Microbiol Infect. 2010;16:11–5. Kreausukon K, Fetsch A, Kraushaar B, Alt K, Müller K, Krömker V, Zessin K-H, Käsbohrer A, Tenhagen B-A. Prevalence, antimicrobial resistance, and molecular characterization of methicillin-resistant Staphylococcus aureus from bulk tank milk of dairy herds. J Dairy Sci. 2012;95:4382–8. Türkyılmaz S, Tekbıyık S, Oryasin E, Bozdogan B. Molecular epidemiology and antimicrobial resistance mechanisms of methicillin-resistant Staphylococcus aureus isolated from bovine milk. Zoonos Pub Health. 2010;57:197–203. Wu S, Huang J, Zhang F, Wu Q, Zhang J, Pang R, Zeng H, Yang X, Chen M, Wang J. Prevalence and characterization of food-related methicillin-resistant Staphylococcus aureus (MRSA) in China. Front Microbiol. 2019;10:304. Islam MA, Parveen S, Rahman M, Huq M, Nabi A, Khan ZUM, Ahmed N, Wagenaar JA. Occurrence and characterization of methicillin resistant Staphylococcus aureus in processed raw foods and ready-to-eat foods in an urban setting of a developing country. Front Microbiol. 2019;10:503. Aung KT, Hsu LY, Koh TH, Hapuarachchi HC, Chau ML, Gutiérrez RA, Ng LC. Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in retail food in Singapore. Antimicrob Resist Infect Control. 2017;6:94. Haran K, Godden SM, Boxrud D, Jawahir S, Bender JB, Sreevatsan S. Prevalence and characterization of Staphylococcus aureus, including methicillin-resistant Staphylococcus aureus, isolated from bulk tank milk from Minnesota dairy farms. J Clin Microbiol. 2012;50:688–95. Riva A, Borghi E, Cirasola D, Colmegna S, Borgo F, Amato E, Pontello MM, Morace G. Methicillin-resistant Staphylococcus aureus in raw milk: Prevalence, SCC mec typing, enterotoxin characterization, and antimicrobial resistance patterns. J Food Protect. 2015;78:1142–6. Asiimwe BB, Baldan R, Trovato A, Cirillo DM. Prevalence and molecular characteristics of Staphylococcus aureus, including methicillin resistant strains, isolated from bulk can milk and raw milk products in pastoral communities of South-West Uganda. BMC Infect Dis. 2017;17:422. Guimarães F, Manzi M, Joaquim S, Richini-Pereira V, Langoni H. Outbreak of methicillin-resistant Staphylococcus aureus (MRSA)-associated mastitis in a closed dairy herd. J Dairy Sci. 2017;100:726–30. Awad A, Ramadan H, Nasr S, Ateya A, Atwa S. Genetic characterization, antimicrobial resistance patterns and virulence determinants of Staphylococcus aureus isolated form bovine mastitis. Pak J Biol Sci. 2017;20:298–305. Aqib AI, Ijaz M, Anjum AA, Malik MAR, Mehmood K, Farooqi SH, Hussain K. Antibiotic susceptibilities and prevalence of Methicillin resistant Staphylococcus aureus (MRSA) isolated from bovine milk in Pakistan. Acta Tropic. 2017;176:168–72. Sergelidis D, Angelidis A. Methicillin-resistant Staphylococcus aureus: a controversial food‐borne pathogen. Letter App Microbiol. 2017;64:409–18. Fowoyo P, Ogunbanwo S. Antimicrobial resistance in coagulase-negative staphylococci from Nigerian traditional fermented foods. Ann Clin Microbiol Antimicrob. 2017;16:4. Baghbaderani ZT, Shakerian A, Rahimi E. Phenotypic and Genotypic Assessment of Antibiotic Resistance of Staphylococcus aureus Bacteria Isolated from Retail Meat. Infect Drug Resist. 2020;13:1339. Zangoei-Fard S, Rahimi E, Shakerian A. Incidence and Phenotypic Pattern of Antibiotic Resistance of Vibrio Species Isolated from Seafood Samples Caught from the Persian Gulf. Egypt J Vet Sci. 2020;51:337–47. Abbasian H, Hajimolaali M, Yektadoost A, Zartab S. Antibiotic utilization in Iran 2000–2016: Pattern analysis and benchmarking with organization for economic co-operation and development Countries. J Res Pharma Pract. 2019;8:162. Mousavi S, Dehkordi FS. Virulence factors and antibiotic resistance of Helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran. J Venom Anim Toxin including Tropic Dis. 2014;20. Ghabbour R, Awad A, Younis G. Genetic Characterization and Antimicrobial-Resistant Profiles of Staphylococcus aureus Isolated from Different Food Sources. Biocontrol Sci. 2022;27(2):87–97. Patel K, Godden SM, Royster EE, Crooker BA, Johnson TJ, Smith EA, Sreevatsan S. Prevalence, antibiotic resistance, virulence and genetic diversity of Staphylococcus aureus isolated from bulk tank milk samples of US dairy herds. BMC Genomics. 2021;22(1):367. Bruce SA, Smith JT, Mydosh JL, Ball J, Needle DB, Gibson R, Andam CP. Shared antibiotic resistance and virulence genes in Staphylococcus aureus from diverse animal hosts. Sci Rep. 2022;12(1):4413. Hassani S, Moosavy MH, Gharajalar SN, Khatibi SA, Hajibemani A, Barabadi Z. High prevalence of antibiotic resistance in pathogenic foodborne bacteria isolated from bovine milk. Sci Rep. 2022;12(1):3878. Murray CJ, Ikuta KS, Sharara F, Swetschinski L, Aguilar GR, Gray A, Han C, Bisignano C, Rao P, Wool E, Johnson SC. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 2022;399(10325):629–55. Islam MW, Shahjahan M, Azad AK, Hossain MJ. Factors contributing to antibiotic misuse among parents of school-going children in Dhaka City, Bangladesh. Sci Rep. 2024;14(1):2318. Walsh TR, Gales AC, Laxminarayan R, Dodd PC. Antimicrobial resistance: addressing a global threat to humanity. PLoS Med. 2023;20(7):e1004264. Nadgir CA, Biswas DA, Nadgir C, Biswas D. Antibiotic Resistance and Its Impact on Disease Management. Cureus. 2023;15(4):e38251. Pekana A, Green E. Antimicrobial Resistance Profiles of Staphylococcus aureus Isolated from Meat Carcasses and Bovine Milk in Abattoirs and Dairy Farms of the Eastern Cape, South Africa. Int J Env Res Pub Health. 2018;15:2223. Sasidharan S, Prema B, Latha LY. Antimicrobial drug resistance of Staphylococcus aureus in dairy products. Asian Pac J Trop Biomed. 2011;1:130–2. Tyasningsih W, Effendi MH, Budiarto B, Syahputra IR. Antibiotic Resistance to Staphylococcus aureus and Methicillin Resistant Staphylococcus aureus (MRSA) Isolated from Dairy Farms in Surabaya, Indonesia. Indian Vet J. 2019;96:27–31. Azizkhani M, Tooryan F. Methicillin resistant Staphylococcus aureus (MRSA) in pastry cream products sold in Amol (Iran). Iran J Vet Med. 2018;12:167–74. Ismail ZB. Molecular characteristics, antibiogram and prevalence of multi-drug resistant Staphylococcus aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis. Asian Pac J Tropic Biomed. 2017;7:694–7. Elmonir W, Aglan H, Elmahallawy E, El-Tras W. Antimicrobial phenotypes of geographically matched staphylococcus aureus isolated from buffalo’s milk and clinical human cases in egypt: potential zoonotic risks. Slovenian Vet Res. 2019;56. Safarpoor Dehkordi F, Gandomi H, Akhondzadeh Basti A, Misaghi A, Rahimi E. Phenotypic and genotypic characterization of antibiotic resistance of methicillin-resistant Staphylococcus aureus isolated from hospital food. Antimicrob Resist Infect Control. 2017;6:104. Mbindyo CM, Gitao GC, Plummer PJ, Kulohoma BW, Mulei CM, Bett R. Antimicrobial resistance profiles and genes of Staphylococci isolated from mastitic cow’s milk in Kenya. Antibiotics. 2021;10(7):772. Shariatifar M, Salavati-Hamedani M, Rezaeian-Doloei R, Rezaeigolestani M, Mohsenzadeh M. Antibiotic resistance and enterotoxin gene profiles of Staphylococcus aureus isolated from raw milk in Iran. J Hellenic Veterinary Med Soc. 2023;74(1):5433–40. Tuncay RM, Sancak YC. Antimicrobial Resistance Properties, Biofilm, and mecA Gene Presence in Staphylococcus Aureus Isolated from Raw Milk Sold in Van, Türkiye. Turkish J Agriculture-Food Sci Technol. 2023;11(2):355–62. Ning K, Zhou R, Li M. Antimicrobial resistance and molecular typing of Staphylococcus aureus isolates from raw milk in Hunan Province. PeerJ. 2023;11:e15847. Sri Prabakusuma A, Zhu J, Shi Y, Ma Q, Zhao Q, Yang Z, Xu Y, Huang A. Prevalence and antimicrobial resistance profiling of Staphylococcus aureus isolated from traditional cheese in Yunnan, China. 3 Biotech. 2022;12:1–5. Juwita S, Indrawati A, Damajanti R, Safika S, Mayasari NL. Multiple antibiotic resistance and virulence factors of Staphylococcus aureus strains isolated from dairy farms in South Sulawesi, Indonesia. Biodiversitas J Biol Divers. 2022;23(2). Zhang Z, Chen Y, Li X, Wang X, Li H. Detection of antibiotic resistance, virulence gene, and drug resistance gene of Staphylococcus aureus isolates from bovine Mastitis. Microbiol Spectr. 2022;10(4):e00471–22. Karell J, Petzl W, Gangl A, Huber-Schlenstedt R, Sorge US. Changes in antimicrobial resistance of Staphylococcus aureus in bovine quarter milk samples from Southern Germany between 2012 and 2022. J Dairy Sci. 2023. Rahi A, Kazemeini H, Jafariaskari S, Seif A, Hosseini S, Dehkordi FS. Genotypic and Phenotypic-Based Assessment of Antibiotic Resistance and Profile of Staphylococcal Cassette Chromosome mec in the Methicillin-Resistant Staphylococcus aureus Recovered from Raw Milk. Infect Drug Resist. 2020;13:273. Li S-M, Zhou Y-F, Li L, Fang L-X, Duan J-H, Liu F-R, Liang H-Q, Wu Y-T, Gu W-Q, Liao X-P. Characterization of the Multi-Drug Resistance Gene cfr in Methicillin-Resistant Staphylococcus aureus (MRSA) Strains Isolated From Animals and Humans in China. Front Microbiol. 2018;9:2925. Wang Y-T, Lin Y-T, Wan T-W, Wang D-Y, Lin H-Y, Lin C-Y, Chen Y-C, Teng L-J. Distribution of antibiotic resistance genes among Staphylococcus species isolated from ready-to-eat foods. J Food Drug Analys. 2019;27(4):841–8. Huang J, Zhang W, Sun B, Jiang Q, Cao Y, Shang J, Zhang Y, Gu X, Lv C, Guo C, Li M. Genetic diversity, antibiotic resistance, and virulence characteristics of Staphylococcus aureus from raw milk over 10 years in Shanghai. Int J Food Microbiol. 2023:110273. Liu H, Dong L, Zhao Y, Meng L, Wang J, Wang C, Zheng N. Antimicrobial susceptibility, and molecular characterization of staphylococcus aureus isolated from different raw milk samples in China. Front Microbiol. 2022;13:840670. Akanbi OE, Njom HA, Fri J, Otigbu AC, Clarke AM. Antimicrobial Susceptibility of Staphylococcus aureus Isolated from Recreational Waters and Beach Sand in Eastern Cape Province of South Africa. Int J Env Res Pub Health. 2017;14:1001. Osman K, Badr J, Al-Maary KS, Moussa IM, Hessain AM, Girah Z, Amin M, Abo-shama UH, Orabi A, Saad A. Prevalence of the antibiotic resistance genes in coagulase-positive-and negative-Staphylococcus in chicken meat retailed to consumers. Front Microbiol. 2016;7:1846. Johler S, Layer F, Stephan R. Comparison of virulence and antibiotic resistance genes of food poisoning outbreak isolates of Staphylococcus aureus with isolates obtained from bovine mastitis milk and pig carcasses. J Food Protect. 2011;74:1852–9. Rahimi H, Saei HD, Ahmadi M. Nasal carriage of Staphylococcus aureus: Frequency and antibiotic resistance in healthy ruminants. Jundishapur J Microbiol. 2015;8. Merz A, Stephan R, Johler S. Staphylococcus aureus isolates from goat and sheep milk seem to be closely related and differ from isolates detected from bovine milk. Front Microbiol. 2016;7:319. Kabiri E, Mashak Z. Antimicrobial resistance properties and enterotoxigenic gene profile of methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolates from raw milk. J Posit School Psychol. 2022;6(8):1244–52. Hizlisoy H, ONMAZ NE, Karadal F, Serhat A, Yildirim Y, Gonulalan Z, Kilic H. Antibiotic Resistance Gene Profiles of Staphylococcus aureus Isolated From Foods of Animal Origin. Kafkas Üni Vet Fakült Derg. 2018;24. Martineau F, Picard FJ, Lansac N, Ménard C, Roy PH, Ouellette M, Bergeron MG. Correlation between the Resistance Genotype Determined by Multiplex PCR Assays and the Antibiotic Susceptibility Patterns of Staphylococcus aureus andStaphylococcus epidermidis. Antimicrob Agent Chemotherap. 2000;44:231–8. Ranjbar R, Shahreza MHS, Rahimi E, Jonaidi-Jafari N. Methicillin-resistant Staphylococcus aureus isolates from Iranian restaurant food samples: Panton-Valentine Leukocidin, SCCmec phenotypes and antimicrobial resistance. Tropic J Pharma Res. 2017;16:1939–49. Waters AE, Contente-Cuomo T, Buchhagen J, Liu CM, Watson L, Pearce K, Foster JT, Bowers J, Driebe EM, Engelthaler DM. Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin Infect Dis. 2011;52:1227–30. Alfouzan W, Udo EE, Modhaffer A. Molecular Characterization of Methicillin-Resistant Staphylococcus aureus in a Tertiary Care hospital in Kuwait. Sci Rep. 2019;9:1–8. Mahanti A, Joardar SN, Bandyopadhyay S, Banerjee J, Ghosh S, Batabyal K, Sar TK, Dutta TK, Samanta I. Characterization of methicillin-resistant and enterotoxins producing Staphylococcus aureus in bovine milk in India. J Agri Food Res. 2020;2:100017. Tables Table 4 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table4.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3928012","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":271871763,"identity":"72fc476e-2dea-45fc-9612-8f767bb811eb","order_by":0,"name":"Zohreh Mashak","email":"","orcid":"","institution":"Islamic Azad University, Karaj","correspondingAuthor":false,"prefix":"","firstName":"Zohreh","middleName":"","lastName":"Mashak","suffix":""},{"id":271871764,"identity":"fdcca44b-70c2-4af3-b407-73276bb5aa38","order_by":1,"name":"Fatemeh Khadivi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYBAC9gYGZmYGBmYeIHWAgbGBCC08B5hhWtgSSNMCYhoQqYX9/GHjghprGYPjPN8kfu6wkWNgP3x0A14tPMnMyTOOpfMYHObdJtl7Js2YgSct7QY+LfYMycyHedgO80g2826T4G07nNggwWOGVwsP/2Ogln8gLTzPJP8SpUUC6DCg4Tz8zDxs0sTZIvHY2Ji3Lx2ohc3YWrYtzZiNkF94+BMfS/N8s7Zn4z/88ObbNhs5fvbDx/BqQQYsEiCSjVjlIMD8gRTVo2AUjIJRMHIAAIkIPnGCkv3lAAAAAElFTkSuQmCC","orcid":"","institution":"Islamic Azad University of Urmia","correspondingAuthor":true,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Khadivi","suffix":""}],"badges":[],"createdAt":"2024-02-04 15:14:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3928012/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3928012/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51007572,"identity":"09dd1350-1548-45c5-ae03-216eb5b8806b","added_by":"auto","created_at":"2024-02-12 15:36:11","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":63593,"visible":true,"origin":"","legend":"\u003cp\u003eIncidence of MDR-MRSA bacteria with raw milk origin.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3928012/v1/23c340eb73ae3d7825bdc329.jpg"},{"id":51007573,"identity":"b339a74a-29ca-4cc8-8c26-0b280e9fe6d0","added_by":"auto","created_at":"2024-02-12 15:36:11","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":66713,"visible":true,"origin":"","legend":"\u003cp\u003eIncidence of MDR-MRSA bacteria with dairy origin.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3928012/v1/93136158398bb363072b795f.jpg"},{"id":51181168,"identity":"c3e4369b-ff0f-4e6f-b8d7-456972cb9323","added_by":"auto","created_at":"2024-02-15 14:53:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":621324,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3928012/v1/cdeec24f-f4ae-4c67-8863-134e00c966ff.pdf"},{"id":51007814,"identity":"da7abff6-7291-4a64-bd1b-5c5dcaa1a534","added_by":"auto","created_at":"2024-02-12 15:44:11","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18371,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.docx","url":"https://assets-eu.researchsquare.com/files/rs-3928012/v1/3601bd7a1117b59db1ce742c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Incidence of Methicillin-resistant Staphylococcus aureus in milk and dairy and assessment genotypic and phenotypic properties of antibiotic resistance","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMilk, as a healthy food, is a rich source of appropriate materials for human health [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is full of unique proteins, carbohydrates, fats, minerals, and vitamins [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Milk of animal species can processed into diverse kinds of healthy and popular dairy products including cheese, cream, butter, yogurt, kashk, and doogh [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Doogh and kashk are general traditional dairies in the Middle East. Kashk has liquid or dried types both are made from cheese-making leftover milk after well boiling [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Doogh is a pleasant yogurt-based beverage with acidic content [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Traditional dairy products are known as those produced traditionally without any industrial techniques and machines, particularly in small producing units or homes. Higher human involvement in the milking and production of traditional dairy products makes them more prone to microbial contamination [\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Milk and dairies in raw and traditional forms are mainly sale in Iran. Otherwise, farmer\u0026acute;s markets, retail, or supermarkets can sale diverse kinds of dairy products in Iran.\u003c/p\u003e \u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS. aureus\u003c/em\u003e) is a pathogenic bacterium originated from the upper respiratory tract and skin [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Additionally, the mammary glands of animals, the dairy environment (including milking hall and equipment), and milkers\u0026rsquo; hands can be important sources of \u003cem\u003eS. aureus\u003c/em\u003e. Furthermore, dairy products can become contaminated with \u003cem\u003eS. aureus\u003c/em\u003e during manufacturing and subsequent handling. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e is mostly responsible for the occurrence of food poisoning and food-borne diseases known with nausea, crmps of the abdomen, vomiting, rarely diarrhea, and toxic shock syndrome (TSS), and nosocomial infections [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCurrently, methicillin-resistant \u003cem\u003eS. aureus\u003c/em\u003e (MRSA) has become a substantial threat globally [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Moreover, several investigation reported the high MRSA prevalence in foodstuffs, particularly milk and dairy [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] which may show the importance of these kinds of food samples as MRSA source [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBoosted MRSA resistance, particularly against fluoroquinolones, cephalosporins, macrolides, lincosamides, aminoglycosides, penicillins, folate pathway inhibitors, tetracyclines, phenicols, and glycopeptides, is another substantial issue in its control and treatment [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Some specific genes are responsible for the occurrence of antibiotic resistance amongst the Staphylococcus bacteria. Incidence of the genes that encode resistance toward penicillins (\u003cem\u003eblaZ\u003c/em\u003e), cephalosporins (\u003cem\u003eblaCTX\u003c/em\u003e), aminoglycosides (\u003cem\u003eaacA\u003c/em\u003e), glycopeptides (\u003cem\u003evan\u003c/em\u003e), folate pathway inhibitors (\u003cem\u003edfrA1\u003c/em\u003e), macrolides (\u003cem\u003emef\u003c/em\u003e, \u003cem\u003emsr\u003c/em\u003e, and \u003cem\u003eerm\u003c/em\u003e), tetracyclines (\u003cem\u003etet\u003c/em\u003e), lincosamides (\u003cem\u003elinA\u003c/em\u003e), ansamycins (\u003cem\u003erpoB\u003c/em\u003e), fluoroquinolones (\u003cem\u003egyrA\u003c/em\u003e and \u003cem\u003egrlA\u003c/em\u003e) and phenicols (\u003cem\u003ecfr\u003c/em\u003e) antibiotics was abundant amongst MRSA bacteria [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDespite the high number of investigation on MRSA dynamics, additional inquiries are obligatory to ontain more MRSA epidemiological aspects. Consequently, this study was aimed to evaluate the incidence the MRSA amongst the milk and dairy samples and to apprise their genotypic and phenotypic properties of antibiotic resistance.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSampling\u003c/h2\u003e \u003cp\u003eFrom September 2021 to March 2022, a total of 380 raw milk and traditionally produced dairy samples including cow milk (n\u0026thinsp;=\u0026thinsp;50), sheep milk (n\u0026thinsp;=\u0026thinsp;40), goat milk (n\u0026thinsp;=\u0026thinsp;50), cheese (n\u0026thinsp;=\u0026thinsp;40), cream (n\u0026thinsp;=\u0026thinsp;40), butter (n\u0026thinsp;=\u0026thinsp;40), yogurt (n\u0026thinsp;=\u0026thinsp;40), doogh (n\u0026thinsp;=\u0026thinsp;40) and kashk (n\u0026thinsp;=\u0026thinsp;40) were collected from different shopping centers, Urmia, Iran. The mean \u003cem\u003eS. aureus\u003c/em\u003e prevalnce in food samples collected from previous surveys was applied to determine the sample size [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAll samples were stored at refrigerator. A total of fifty grams were collected from each raw milk and dairy samples. Cool bags were applied for samples rapid trasnferring. Samples appearance and physical properties, including color, odor, and density was normal.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eS. aureus isolation amd MRSA identification\u003c/h2\u003e \u003cp\u003eSamples (25 g each) were added to peptone water (225 mL and buffered type) and homogenized (Stomacher, Interscience, France). From an achieved solution, 5 \u0026micro;l was poured into a tube contained Trypticase Soy Broth (50 mL). Media were complemented with sodium pyruvate (1%) and NaCl (10%) and incubated at 35\u0026deg;C for 18 h. Formerly, a loopful of the TSB culture was transferred into egg yolk tellurite emulsion Baird-Parker agar. Incubation was done for 24 h at 37\u0026deg;C. Balck colonies with shiny appearance were initially recognized as \u003cem\u003eS. aureus\u003c/em\u003e and examined with supplementary tests, including Gram staining, bacitracin resistance, oxidase, urease, coagulase, hemolysis, and catalase activity, mannitol and other carbohydrates fermentation, phosphatase, nitrate reduction, and voges-proskaver (VP) test (All media were purchased from Merck, Germany) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. After S. aureus identification, MRSA was determined using cefoxitin (30 \u0026micro;g) and oxacillin (1 \u0026micro;g) susceptibility examination [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The presence of \u003cem\u003emecA\u003c/em\u003e gene was also assessed in MRSA isolates [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMRSA phenotypic resistance\u003c/h2\u003e \u003cp\u003eMRSA phenotypic antibiotic resistance was evaluated by disk diffusion regarding the Clinical and Laboratory Standard Institute (CLSI) instructions on Mueller\u0026ndash;Hinton agar (MHA, Merck, Germany) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Initially, 0.5 McFarland concentration was prepared from MRSA isolates and then bacterial were cultured superficially on the mha media. Dissimilar antibiotic disks, including clindamycin (2 \u0026micro;g/disk), ciprofloxacin, rifampin, vancomycin, and levofloxacin (5 \u0026micro;g/disk), gentamicin and penicillin (10 \u0026micro;g/disk), erythromycin and azithromycin (15 \u0026micro;g/disk), trimethoprim-sulfamethoxazole (25 \u0026micro;g/disk), amikacin, doxycycline, cefotaxime, tetracycline, ceftriaxone, and chloramphenicol (30 \u0026micro;g/disk) (Oxoid, UK) were placed with significant distance from eachothers on the MHA media contained the MRSA. Media contained MRSA and disks were incubated (37\u0026deg;C for 24 h) and the diameter of the growth inhibition zone surround each disk was measred, comopared with CLSI guidelines [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and resistant isolates were determined. Multidrug resistant (MDR)-MRSA prevalence was also determined rendering the percent of bacteria resist to more than three antibiotic agent. Methicillin-resistant \u003cem\u003eS. aureus\u003c/em\u003e ATCC 43300 was used as a positive control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMRSA genotypic resistance\u003c/h2\u003e \u003cp\u003eMRSA isolates sub-cultured one-night period on TSB was applied for DNA extraction using kit (Thermo Fisher Scientific, Germany) regarding the guidlines. Extracted DNA\u0026rsquo;s purity (A260/A280) was evaluated using NanoDrop (NanoDrop, Thermo Scientific, USA). PCR programs and thermal cycles for antibiotic resistance encoding genes were revealed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e [\u003cspan additionalcitationids=\"CR30 CR31 CR32 CR33 CR34 CR35\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Thermocycler device with determined program (Eppendorf Mastercycler 5330, Germany) was applied. Visualization was done by electrophoresis (120 V/208 mA) in agarose gel (2.5%) contained 0.4 \u0026micro;g/ml ethidium bromide. Presence or absence of significant bands in obtained gels were screened by the UVIDoc (Jencons PLC, UK). MRSA (ATCC 43300 and ATCC 33591) strains were applied as positive and PCR-grade water was applied as negative controls. All reagents and materials were purchased from Thermo Fisher Scientific, Germany.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR programs [\u003cspan additionalcitationids=\"CR29 CR30 CR31 CR32 CR33 CR34 CR35\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePCR product (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrograms\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVolume (50\u0026micro;L)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eaacA-D\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TAATCCAAGAGCAATAAGGGC\u003c/p\u003e \u003cp\u003eR: GCCACACTATCATAACCACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e227\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 5 min.\u003c/p\u003e \u003cp\u003e25 cycles:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e55\u0026deg;C, 70 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eermA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AAGCGGTAAACCCCTCTGA\u003c/p\u003e \u003cp\u003eR: TTCGCAAATCCCTTCTCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e190\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etetK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTAGCGACAATAGGTAATAGT\u003c/p\u003e \u003cp\u003eR: GTAGTGACAATAAACCTCCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eermB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCGTTTACGAAATTGGAACAGGTAAAGGGC\u003c/p\u003e \u003cp\u003eR: GAATCGAGACTTGAGTGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e359\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003emefA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTATCATTAATCACTAGTGC\u003c/p\u003e \u003cp\u003eR: TTCTTCTGGTACTAAAAGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e346\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egrlA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTTGAAGATGTTTTAGGTGAT\u003c/p\u003e \u003cp\u003eR: TTAGGAAATCTTGATGGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e618\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etetM\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGTGGAGCGATTACAGAA\u003c/p\u003e \u003cp\u003eR: CATATGTCCTGGCGTGTCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e158\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 6 min.\u003c/p\u003e \u003cp\u003e34 cycles:\u003c/p\u003e \u003cp\u003e95\u0026deg;C, 50 s\u003c/p\u003e \u003cp\u003e55\u0026deg;C, 70 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 8 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egyrA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGTACATCGTCGTATACTATATGG\u003c/p\u003e \u003cp\u003eR: ATCACGTAACAGTTCAAGTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e280\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003emsrA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCACAATAAGAGTGTTTAAAGG\u003c/p\u003e \u003cp\u003eR: AAGTTATATCATGAATAGATTGTCCTGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 6 min.\u003c/p\u003e \u003cp\u003e34 cycles:\u003c/p\u003e \u003cp\u003e95\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e50\u0026deg;C, 70 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 70 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 8 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003emsrB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TATGATATCCATAATAATTATCCAATC\u003c/p\u003e \u003cp\u003eR: AAGTTATATCATGAATAGATTGTCCTGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e595\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003edfrA1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTCACGATAAACAAAGAGTCA\u003c/p\u003e \u003cp\u003eR: CAATCATTGCTTCGTATAACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e201\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elinA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGGCTGGGGGGTAGATGTATTAACTGG\u003c/p\u003e \u003cp\u003eR: GCTTCTTTTGAAATACATGGTATTTTTCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e323\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 6 min.\u003c/p\u003e \u003cp\u003e30 cycles:\u003c/p\u003e \u003cp\u003e95\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e57\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eblaZ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGAACCGTATGTTAGTGC\u003c/p\u003e \u003cp\u003eR: GTCGTGTTAGCGTTGATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e681\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 6 min.\u003c/p\u003e \u003cp\u003e30 cycles:\u003c/p\u003e \u003cp\u003e95\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e59\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecfr\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGAAGTATAAAGCAGGTTGGGAGTCA\u003c/p\u003e \u003cp\u003eR: ACCATATAATTGACCACAAGCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e746\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 1 min.\u003c/p\u003e \u003cp\u003e34 cycles:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 2 min\u003c/p\u003e \u003cp\u003e48\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 3 min\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erpoB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACCGTCGTTTACGTTCTGTA\u003c/p\u003e \u003cp\u003eR: TCAGTGATAGCATGTGTATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e460\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 5 min.\u003c/p\u003e \u003cp\u003e40 cycles:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 40 s\u003c/p\u003e \u003cp\u003e45.5\u0026deg;C, 40 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 90 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 8 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eblaCTX-M\u003c/em\u003e\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGTGCAGYACCAGTAARGT\u003c/p\u003e \u003cp\u003eR: TGGGTRAARTARGTSACCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e593\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 7 min.\u003c/p\u003e \u003cp\u003e35 cycles:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 50 s\u003c/p\u003e \u003cp\u003e50\u0026deg;C, 40 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 5 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evanA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGAATAGAATAAAAGTTGC\u003c/p\u003e \u003cp\u003eR: TCACCCCTTTAACGCTAATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1032\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e98\u0026deg;C, 2 min.\u003c/p\u003e \u003cp\u003e35 cycles:\u003c/p\u003e \u003cp\u003e98\u0026deg;C, 10 s\u003c/p\u003e \u003cp\u003e50\u0026deg;C, 60 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 90 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evanB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTGACAAACCGGAGGCGAGGA\u003c/p\u003e \u003cp\u003eR: CCGCCATCCTCCTGCAAAAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e430\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 10 min.\u003c/p\u003e \u003cp\u003e30 cycles:\u003c/p\u003e \u003cp\u003e94\u0026deg;C, 30 s\u003c/p\u003e \u003cp\u003e50\u0026deg;C, 45 s\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 30 s\u003c/p\u003e \u003cp\u003e1 cycle:\u003c/p\u003e \u003cp\u003e72\u0026deg;C, 10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10X PCR buffer: 5 \u0026micro;L\u003c/p\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e: 1.5 mM\u003c/p\u003e \u003cp\u003edNTP: 200 \u0026micro;M\u003c/p\u003e \u003cp\u003ePrimers F \u0026amp; R: 0.5 \u0026micro;M each\u003c/p\u003e \u003cp\u003eDNA polymerase (Taq): 1.25 U\u003c/p\u003e \u003cp\u003eDNA: 2.5 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003ea\u003c/sup\u003eR is G or A; Y is T or C; S is C or G.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eSPSS 21.0 software (SPSS, USA) was applied. Two tests, including Chi-square test and Fisher\u0026rsquo;s exact were applied to measure any significant association between the collected data. \u003cem\u003eP\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered as significant level.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eS. aureus and MRSA incidence\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e characterizes the \u003cem\u003eS. aureus\u003c/em\u003e and MRSA incidence. \u003cem\u003eS. aureus\u003c/em\u003e total contamination rate was 15.78% (60 of 380 samples). \u003cem\u003eS. aureus\u003c/em\u003e raw milk and traditional dairy contamination rates was were 12.85% and 17.50%, respectively. Raw cow milk (18.00%) and traditional cheese (32.50%) samples had the maximum \u003cem\u003eS. aureus\u003c/em\u003e contamination rates. Thirty-eight out of 60 (63.33%) \u003cem\u003eS. aureus\u003c/em\u003e isolates harbored simultaneous resistance toward cefoxitin and oxacillin and were determined as MRSA. Additionally, all of the MRSA isolates harbored the \u003cem\u003emecA\u003c/em\u003e gene. Total incidence of MRSA amongst the \u003cem\u003eS. aureus\u003c/em\u003e bacteria isolated from raw milk and dairy samples were 55.55% and 66.66%, respectively. Raw goat milk (66.66%) and traditional doogh (75.00%) samples had the highest contamination rates with the MRSA. Data anlysis revealed significant difference between sample types and \u003cem\u003eS. aureus\u003c/em\u003e incidence and similarly for the MRSA (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cem\u003eS. aureus\u003c/em\u003e and MRSA incidence.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTypes of samples\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN\u003csup\u003e*\u003c/sup\u003e. collected samples\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eN. samples positive for \u003cem\u003eS. aureus\u003c/em\u003e (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN. isolates determined as MRSA (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eRaw milk\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9 (18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5 (55.55)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSheep\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6 (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGoat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e140\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e18 (12.85)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e10 (55.55)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e \u003cp\u003eTraditional dairy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCheese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13 (32.50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9 (69.23)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCream\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9 (22.50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6 (66.66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eButter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10 (25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6 (60)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYogurt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (7.50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDoogh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4 (10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 (75)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKashk\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (7.50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e240\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e42 (17.50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e28 (66.66)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e380\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e60 (15.78)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e38 (63.33)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e*\u003c/sup\u003eNumber\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMRSA phenotypic resistance\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e characterizes the MRSA phenotypic antibiotic resistance. Methicillin-resistant \u003cem\u003eS. aureus\u003c/em\u003e bacteria presented the maximum resistance rate against cefotaxime (100%), ceftriaxone (100%), penicillin (100%), erythromycin (85.78%), tetracycline (84.21%) and gentamicin (73.68%) antibiotic agents. However, MRSA strains revealed the minimum rate of resistance against chloramphenicol (18.42%), rifampin (36.84%), vancomycin (39.47%), azithromycin (47.36%), and doxycycline (52.63%) antibiotic agents. Data anlysis revealed significant difference between MRSA phenotypic resistance and sample types (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMRSA phenotypic resistance.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"18\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eType of samples (N. MRSA)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"16\" nameend=\"c18\" namest=\"c3\"\u003e \u003cp\u003eN\u003csup\u003e*\u003c/sup\u003e (%) isolates resistant to each antibiotic\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePenicillins\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eAminoglycosides\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eTetracyclines\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eMacrolides\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003eCephalosporins\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eFolate inhibitors\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eLincosamides\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eAnsamycins\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003ePhenicols\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c17\" namest=\"c16\"\u003e \u003cp\u003eFluoroquinolones\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eGlycopeptides\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP10\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGen\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmk\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTet\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDox\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eAzi\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEry\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCft\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eCfr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eTr-sul\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eCln\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eRif\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003eC30\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c16\"\u003e \u003cp\u003eCip\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c17\"\u003e \u003cp\u003eLev\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eVan\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cb\u003eRaw milk\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCow (5)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 (60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4 (80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3 (60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2 (40)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e3 (60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e5 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e5 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e3 (60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e2 (40)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1 (20)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1 (20)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e3 (60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e2 (40)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e2 (40)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eSheep (3)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGoat (2)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTotal (10)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e10 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5 (50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e4 (40)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e6 (60)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e5 (50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e3 (30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e5 (50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e10 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e10 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e5 (50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e3 (30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e2 (20)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e1 (10)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e5 (50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e4 (40)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e3 (30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e \u003cp\u003e\u003cb\u003eTraditional dairy\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCheese (9)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7 (77.77)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8 (88.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5 (55.55)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e7 (77.77)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e9 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e9 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e7 (77.77)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e6 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e4 (44.44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e2 (22.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e4 (44.44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e3 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e4 (44.44)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCream (6)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (83.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5 (83.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e2 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eButter (6)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (83.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5 (83.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e6 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e3 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1 (16.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e4 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e2 (33.33)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eYogurt (2)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eDoogh (3)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e3 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e2 (66.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e1 (33.33)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eKashk (2)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e2 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e1 (50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTotal (28)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e28 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e23 (82.14)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e17 (60.71)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e26 (92.85)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e15 (53.57)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e15 (53.57)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e20 (71.42)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e28 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e28 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e19 (67.85)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e17 (60.71)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e12 (42.85)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e6 (21.42)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e16 (57.14)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e15 (53.57)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e12 (42.85)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal (38)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e38 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e28 (73.68)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e21 (55.26)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e32 (84.21)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e20 (52.63)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e18 (47.36)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e25 (85.78)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e38 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e38 (100)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e24 (63.15)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e20 (52.63)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e14 (36.84)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e7 (18.42)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cb\u003e21 (55.26)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cb\u003e19 (50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u003cb\u003e15 (39.47)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"18\"\u003e\u003csup\u003e*\u003c/sup\u003eNumber; \u003csup\u003e**\u003c/sup\u003eP10: penicillin (10 \u0026micro;g/disk), Gen: gentamicin (10 \u0026micro;g/disk), Amk: amikacin (30 \u0026micro;g/disk), Tet: tetracycline (30 \u0026micro;g/disk), Dox: doxycycline (30 \u0026micro;g/disk), Azi: azithromycin (15 \u0026micro;g/disk), Ery: erythromycin (15 \u0026micro;g/disk), Cft: cefotaxime (30 \u0026micro;g/disk), Cfr: ceftriaxone (30 \u0026micro;g/disk), Tri-Sul: trimethoprim-sulfamethoxazole (25 \u0026micro;g/disk), Cln: clindamycin (2 \u0026micro;g/disk), Rif: rifampin (5 \u0026micro;g/disk), C30: chloramphenicol (30 \u0026micro;g/disk), Cip: ciprofloxacin (5 \u0026micro;g/disk), Lev: levofloxacin (5 \u0026micro;g/disk), and Van: vancomycin (5 \u0026micro;g/disk).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMDR\u003cem\u003e-MRSA incidnece\u003c/em\u003e\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e represents the MDR-MRSA incidence among raw milk samples. All MRSA bacteria with raw milk origin harbored resistance to at least one of the studied antibiotic disks. Resistance rate against 5 antibiotic agents was 40%. Rate of MDR resistance against more than 7 antibiotic agents was 20%. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e represents the MDR-MRSA incidence among dairy samples. All MRSA bacteria with dairy origin harbored resistance to at least one of the studied antibiotic disks. Resistance rate against 5 antibiotic agents was 64.28%. Rate of MDR resistance against more than 7 antibiotic agents was 32.14%.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMRSA genotypic antibiotic resistance\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e represents the MRSA genotypic antibiotic resistance. The most commonly detected genes encode antibiotic resistance was \u003cem\u003eblaZ\u003c/em\u003e (100%), \u003cem\u003eblaCTX-M\u003c/em\u003e (100%), \u003cem\u003etetK\u003c/em\u003e (55.26%), \u003cem\u003emsrA\u003c/em\u003e (50%), \u003cem\u003eaacA-D\u003c/em\u003e (47.36%), \u003cem\u003eermA\u003c/em\u003e (44.73%), \u003cem\u003emefA\u003c/em\u003e (44.73%) and \u003cem\u003egyrA\u003c/em\u003e (42.10%). Incidence of \u003cem\u003emsrB\u003c/em\u003e (15.78%), \u003cem\u003ecfr\u003c/em\u003e (18.42%), \u003cem\u003evanB\u003c/em\u003e (18.42%), \u003cem\u003eermB\u003c/em\u003e (21.05%), \u003cem\u003erpoB\u003c/em\u003e (21.05%), and \u003cem\u003egrlA\u003c/em\u003e (23.68%) was lower than other genes. MRSA bacteria with dairy origin harbored the highest distribution of genes encode antibiotic resistance (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Data anlysis revealed significant difference between MRSA genotypic resistance and sample types (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Moreover, significant difference was originated between the \u003cem\u003etetK\u003c/em\u003e and \u003cem\u003etetM\u003c/em\u003e, \u003cem\u003egyrA\u003c/em\u003e and \u003cem\u003egrlA\u003c/em\u003e, \u003cem\u003evanA\u003c/em\u003e and \u003cem\u003evanB\u003c/em\u003e, \u003cem\u003eermA\u003c/em\u003e and \u003cem\u003eermB\u003c/em\u003e, and finally \u003cem\u003emsrA\u003c/em\u003e and \u003cem\u003emsrB\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) distribution.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eResistant-bacteria and the genes encoding resistance toward microorganisms can trasnfere from food animals, particularly milk and meat, to humans. An imperative pathogen, MRSA, is presently endemic in many health care centers and also various foodstuffs, predominantly those have animal origins [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFindings of the present examination disclosed that the raw milk and traditional dairy contamination rate with MRSA was 10% (38/380) which was entirely higher than those reported from Germany (2.30%) [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], United Kingdom (2.30%) [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], China (2.10%) [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], Bangladesh (5.55%) [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], Singapore (2.20%) [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and United States (4.00%) [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], while was lower than the incidence described from Turkey (17%) [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], Italy (20%) [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], Uganda (56.10%) [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], Brazil (23.30%) [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], Egypt (50.00%) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], and Pakistan (34.00%) [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Surveys carried out in American, Asiana, African and European countries reported high incidence of MRSA amongst food and dairy samples [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Milk and dairy contamination rate with MRSA vary in dissimilar surveys. Differences in findings reported in various studies recommend that variations in time, season, sample types, sampling method and place, and even applied techniques may affect the surveys outcomes. Furthermore, differences in the milking halls and dairy producing units hygienic levels may cause changesin the bacterial incidence among dissimilar surveys [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe probable reasons for the high frequency or MRSA in milk and dairy in Iran is maybe the high prescription rate of antibiotic agents [\u003cspan additionalcitationids=\"CR54\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] and also low hygienic conditions of milking halls and traditional units of dairy production [\u003cspan additionalcitationids=\"CR54\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFindings of the present survey showed that MRSA bacteria had the higher incidence rate in traditionally produced dairy product than raw milk samples of animal species. Raw milk of animal species is probably contaminated due to the fact that some dairy animals are MRSA main sources. Additionally, some examined animals may harbored sub-clinical mastitis and shed the MRSA into their milk. Furthermore, the risk of MRSA transmission from infected staffs to milk and dairy should be considered [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan additionalcitationids=\"CR57\" citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnimals nutrition and habbits should also affect the MRSA distribution. In dairy samples, type of method of processing, may affect the MRSA incidence. In this regard, cooking or boiling time and temperature and also acidic level of dairy may affect the survival of MRSA and other bacteria. Kashak is mainly produce through boiling and doogh is mainly has acidic pH [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. As a result, they they harbored the minimum MRSA contamination rate. Cheese contamination rate with MRSA was 22.50%. It is because of cheese production need low cooking time and temperature compared to other dairy products which facilitates the survival and growth of \u003cem\u003eS. aureus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eMRSA boosted resistance against cefotaxime, ceftriaxone, penicillin, tetracycline, erythromycin, and gentamicin was supported by the boosted incidence of \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaZ\u003c/em\u003e, \u003cem\u003emsrA\u003c/em\u003e, \u003cem\u003etetK\u003c/em\u003e, \u003cem\u003eermA\u003c/em\u003e and \u003cem\u003emefA\u003c/em\u003e, and \u003cem\u003eaacA-D\u003c/em\u003e antibiotic resistance-encoding genes, respectively. Genotypic and phenotypic antibiotic resistance was assisted with the boosted distribution of MDR-MRSA. Uneven and unauthorize prescription of antibiotic agents are the probable reasons for boosted incidence of resistance in the present research [\u003cspan additionalcitationids=\"CR60 CR61 CR62\" citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Regarding the boosted rate of resistance, the above-mentioned antibiotics should be prescribed with caution for mastitis and also cases of food poisoning caused by MRSA in Iran.\u003c/p\u003e \u003cp\u003eSimilar MRSA rate of resistance against cefotaxime, ceftriaxone, penicillin, tetracycline, erythromycin, and gentamicin was reported from South Africa [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e], Malaysia [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e], Indonesia [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], Iran [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e], Jordan [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], and Egypt [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. Comparable \u003cem\u003eS. aureus\u003c/em\u003e phenotypic resistance has been described against fluoroquinolones [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], aminoglycosides [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], macrolides [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], tetracyclines [\u003cspan additionalcitationids=\"CR70 CR71 CR72\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], cephems [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], folate inhibitors [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], penicillins [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], phenicols [\u003cspan additionalcitationids=\"CR70 CR71 CR72\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], lincosamides [\u003cspan additionalcitationids=\"CR70 CR71 CR72 CR73 CR74\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], and ansamycins [\u003cspan additionalcitationids=\"CR70 CR71 CR72\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], antibiotic groups. Similar MDR distribution was also reported previously [\u003cspan additionalcitationids=\"CR77\" citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. Likewise, a survey on hospital foods [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e] described that the MRSA resistance against gentamicin (81.08%), ceftaroline (100%), azithromycin (59.45%), ciprofloxacin (48.64%), trimethoprim-sulfamethoxazole (83.78%), rifampin (35.13%), penicillin (100%), erythromycin (86.47%), and tetracycline (100%) was combined with the boosted distribution of \u003cem\u003eaacA-D\u003c/em\u003e (62.16%), \u003cem\u003emsrA\u003c/em\u003e (64.86%), \u003cem\u003etetK\u003c/em\u003e (72.97%), \u003cem\u003evatA\u003c/em\u003e (45.94%), \u003cem\u003eermA\u003c/em\u003e (72.97%), and \u003cem\u003elinA\u003c/em\u003e (43.24%) encoding genes. Correspondingly, Rahi et al. (2020) [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e] stated that the MRSA resistance against doxycycline (71.42%), amikacin (17.85%), clindamycin (42.85%), erythromycin (82.14%), gentamicin (78.57%), trimethoprim-sulfamethoxazole (78.57%), ciprofloxacin (35.71%), tetracycline (100%), azithromycin (32.14%), penicillin (100%), levofloxacin (32.14%), rifampin (14.28%), and chloramphenicol (28.57%) was assisted with the boosted distribution of \u003cem\u003eermA\u003c/em\u003e (50%), \u003cem\u003eblaZ\u003c/em\u003e (100%), \u003cem\u003emsrA\u003c/em\u003e (35.71%), \u003cem\u003eermB\u003c/em\u003e (25%), \u003cem\u003egyrA\u003c/em\u003e (50%), \u003cem\u003eaacA-D\u003c/em\u003e (67.85%), \u003cem\u003elinA\u003c/em\u003e (28.57%), \u003cem\u003etetK\u003c/em\u003e (85.71%), \u003cem\u003emefA\u003c/em\u003e (35.71%), \u003cem\u003erpoB\u003c/em\u003e (10.71%) \u003cem\u003egrlA\u003c/em\u003e (42.85%), \u003cem\u003etetM\u003c/em\u003e (35.71%), \u003cem\u003edfrA1\u003c/em\u003e (71.42%), \u003cem\u003ecfr\u003c/em\u003e (25%), and \u003cem\u003emsrB\u003c/em\u003e (10.71%) resistance encoding genes.\u003c/p\u003e \u003cp\u003ePrevious epidemiological surveys were also reported that MRSA phenotypic resistance was mainly confirmed by the presence of specific antibiotic resistance-encoding genes [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan additionalcitationids=\"CR80\" citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]. Huang et al. (2023) [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e] described that \u003cem\u003eS. aureus\u003c/em\u003e bacteria isolated from raw milk in China harbored the boosted rate of resistance against erythromycin (21.60%), sulfamethoxazole (65.00%), and ampicillin (96.70%) with considerable distribution of \u003cem\u003etet\u003c/em\u003e (9.27%), \u003cem\u003efex\u003c/em\u003e (6.83%), and \u003cem\u003eerm\u003c/em\u003e (4.39%) resistance-encoding genes. Similarly, Liu et al. (2022) [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e] described that the \u003cem\u003eS. aureus\u003c/em\u003e strains with raw cow milk revealed the maximum rate of resistance toward penicillin (50.00%), ampicillin (33.30%), cefoxitin (22.20%), oxacillin (16.70%), eyrthromicin (25.00%), clindamycin (2.80%), trimethoprim-sulfamethoxazole (8.30%), tetracycline (41.70%), kanamycin (19.40%), gentamicin (36.10%), streptomycin (22.20%), and chloramphenicol (16.70%). They also supported that the resistance-encoding genes, particularly \u003cem\u003eblaZ\u003c/em\u003e (69.20%), \u003cem\u003emecA\u003c/em\u003e (23.10%), \u003cem\u003ecfxA\u003c/em\u003e (23.10%), \u003cem\u003eaacaph\u003c/em\u003e (50.00%), \u003cem\u003efexA\u003c/em\u003e (7.70%), \u003cem\u003etetM\u003c/em\u003e (38.50%), \u003cem\u003etetK\u003c/em\u003e (7.70%), \u003cem\u003eermB\u003c/em\u003e (11.50%), and \u003cem\u003emsrB\u003c/em\u003e (15.40%), were predominant amongst the \u003cem\u003eS. aureus\u003c/em\u003e isolates.\u003c/p\u003e \u003cp\u003eAs several mechanisms of antibiotic resistance other than the presence of the genes encode resistance existed in bacterial cells, it is not surprising that the examined MRSA bacteria had the higher phenotypically resistance toward antibiotic agents than genotypical. This conclusion was in agreement with those reported from previous investigations [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]. Akanbi et al. (2017) [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e] described the boosted distribution of \u003cem\u003etet\u003c/em\u003e, \u003cem\u003eerm\u003c/em\u003e, and \u003cem\u003emec\u003c/em\u003e resistance encode genes. Surveys conducted in Egypt [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e], Germany [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e], Iran [\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e], and Switzerland [\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e] also revealed the bossted incidence of \u003cem\u003etet\u003c/em\u003e, \u003cem\u003emec\u003c/em\u003e, \u003cem\u003evat\u003c/em\u003e, \u003cem\u003eerm\u003c/em\u003e, and \u003cem\u003emsr\u003c/em\u003e resistance encoding genes amongst the \u003cem\u003eS. aureus\u003c/em\u003e of food origins. Kabiri and Mashak (2022) [\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e] also reported the boosted \u003cem\u003edfrA1\u003c/em\u003e (44.44%), \u003cem\u003eblaZ\u003c/em\u003e (100%), \u003cem\u003etetK\u003c/em\u003e (51.85%). \u003cem\u003eaacA-D\u003c/em\u003e (62.96%), and \u003cem\u003ecat1\u003c/em\u003e (48.14%) incidence amongst the raw milk-borne MRSA in Iran. Similar to our findings, Hizlisoy et al. (2018) [\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e] described similar genotypic profile of resistance (\u003cem\u003eblaZ\u003c/em\u003e, \u003cem\u003etet\u003c/em\u003e, \u003cem\u003eaacA\u003c/em\u003e, \u003cem\u003eerm\u003c/em\u003e, \u003cem\u003emec\u003c/em\u003e, \u003cem\u003evat\u003c/em\u003e, and \u003cem\u003evan\u003c/em\u003e) of \u003cem\u003eS. aureus\u003c/em\u003e in animal foods in Turkey.\u003c/p\u003e \u003cp\u003eHigher distribution of \u003cem\u003eermA\u003c/em\u003e than \u003cem\u003eermB\u003c/em\u003e, \u003cem\u003evatA\u003c/em\u003e than \u003cem\u003evatB\u003c/em\u003e, \u003cem\u003etetK\u003c/em\u003e than \u003cem\u003etetM\u003c/em\u003e, \u003cem\u003emsrA\u003c/em\u003e than \u003cem\u003emsrB\u003c/em\u003e, \u003cem\u003egyrA\u003c/em\u003e than \u003cem\u003egrlA\u003c/em\u003e, and \u003cem\u003evanA\u003c/em\u003e than \u003cem\u003evanB\u003c/em\u003e resistance encoding genes was described in the current study, which was entirely supported by the previous investigations [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e, \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e]. MDR-MRSA was reported in 40% of milk-borne and 64.28% of dairy-borne isolates. Studies conducted on China [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], Bangladesh [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], Iran [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e], United States [\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e], Kuwait [\u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e], India [\u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e], and Africa [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e] also described the high incidence of MDR-\u003cem\u003eS. aureus\u003c/em\u003e in food samples.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eMRSA presence of in milk and dairy beside the boosted incidence of MDR and also dissimilar resistance-encoding genes were reported in the present survey. Traditional dairy product samples had the higher potential to transmission of MDR-MRSA. High incidence of resistance of MRSA against cefotaxime, ceftriaxone, penicillin, erythromycin, tetracycline and gentamicin which was supported by the presence of \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaZ\u003c/em\u003e, \u003cem\u003emsrA\u003c/em\u003e, \u003cem\u003eermA\u003c/em\u003e, \u003cem\u003eaacA-D\u003c/em\u003e, \u003cem\u003emefA\u003c/em\u003e, \u003cem\u003etetK\u003c/em\u003e, and \u003cem\u003egyrA\u003c/em\u003e antibiotic encoding genes may recommend a substantial threat about the raw or unpasteurized milk and traditionally produced dairy product role in MDR-MRSA transmission into the community. It seems that cefotaxime, ceftriaxone, tetracycline, erythromycin, penicillin, and gentamicin antibiotic agents are not operative healing options in the cases of MRSA food-borne diseases in Iran. Appropriate raw milk boiling, pasteurization employment, cross-contamination deterrence, and disk diffusion-based antibiotic administration can moderate the MDR-MRSA transmission risk.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eS. aureus\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMRSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMethicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePolymerase Chain Reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSPSS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eStatistical Package for the Social Sciences\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAs the project didn\u0026rsquo;t performed any human or animal-based examination, ethical approval was not applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no consent for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed throughout this research are included in this published article.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMaryam M, Manzoor A. A comparative evaluation of five milk-producing mammals: Benefits and safety. Archives Veterinary Sci. 2023;28(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalvo MV, Fontecha J, P\u0026eacute;rez-G\u0026aacute;lvez A, Rodr\u0026iacute;guez-Alcal\u0026aacute; LM. Milk lipids and their nutritional importance. InBioactive Lipids 2023 (pp. 269\u0026ndash;95). Academic.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eALKaisy QH, Al-Saadi JS, Al‐Rikabi AK, Altemimi AB, Hesarinejad MA, Abedelmaksoud TG. Exploring the health benefits and functional properties of goat milk proteins. Food Sci Nutr. 2023;11(10):5641\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePratelli G, Tamburini B, Badami GD, Lo Pizzo M, De Blasio A, Carlisi D, Di Liberto D. Cow\u0026rsquo;s Milk: A Benefit for Human Health? Omics Tools and Precision Nutrition for Lactose Intolerance Management. Nutrients. 2024;16(2):320.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafarpoor Dehkordi F, Yazdani F, Mozafari J, Valizadeh Y. Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products. BMC Res Notes. 2014;7:217.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahrajabian MH, Sun W. Kashk and Doogh: The Yogurt-based National Persian Products. Curr Nutr Food Sci. 2023;19(9):922\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakhdoumi P, Hossini H, Mohammadi R, Limoee M. The prevalence of aflatoxin M1 (AFM1) in conventional and industrial dairy products (yogurt, cheese, kashk and dough) of Iran: a systematic review and meta-analysis. Rev Environ Health. 2022;37(1):123\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgwaro BA, Gibson H, Hill DJ, O\u0026rsquo;Gara EA. Microbiological Quality of Typical Traditional Fermented Milk from Northern Uganda and Western Kenya. Dairy. 2023 J;4(3):445\u0026thinsp;\u0026ndash;\u0026thinsp;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRanjbar R, Farsani FY, Dehkordi FS. Phenotypic analysis of antibiotic resistance and genotypic study of the vacA, cagA, iceA, oipA and babA genotypes of the Helicobacter pylori strains isolated from raw milk. Antimicrob Resist Infect Control. 2018;7:115.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhali-Mohammed I, Odetokun IA, Raufu IA, Adetunji VO. Handling practices and contamination of raw milk sold for consumption in markets of Kwara State, Nigeria. Sokoto J Veterinary Sci. 2022;20(1):50\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNormatova SA, Botirov MT, Ruzmatova KK, ugli Mamarasulov JO. Hygienic basis for contamination of food products and production of dairy products until 2030. Int J Health Med Sci. 2021;4(1):123\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng J, Liu L, Chen G, Xu W, Huang Y, Lei G, Huang W, Lv H, Yang X. Molecular Characteristics of Staphylococcus aureus Isolates form Food-Poisoning Outbreaks (2011\u0026ndash;2022) in Sichuan, China. Foodborne Pathogens and Disease; 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdolmaleki Z, Mashak Z, Dehkordi FS. Phenotypic and genotypic characterization of antibiotic resistance in the methicillin-resistant Staphylococcus aureus strains isolated from hospital cockroaches. Antimicrob Resist Infect Control. 2019;8:54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdolmaleki Z, Mashak Z, Safarpoor Dehkordi F. Molecular and Virulence Characteristics of Methicillin-Resistant Staphylococcus aureus Bacteria Recovered From Hospital Cockroaches. Jundishapur J Microbiol. 2019;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKansaen R, Boueroy P, Hatrongjit R, Kamjumphol W, Kerdsin A, Chopjitt P. The Occurrence and Characteristics of Methicillin-Resistant Staphylococcal Isolates from Foods and Containers. Antibiotics. 2023;12(8):1287.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTitouche Y, Hakem A, Houali K, Meheut T, Vingadassalon N, Ruiz-Ripa L, Salmi D, Chergui A, Chenouf N, Hennekinne J. Emergence of methicillin-resistant Staphylococcus aureus (MRSA) ST8 in raw milk and traditional dairy products in the Tizi Ouzou area of Algeria. J Dairy Sci. 2019;102:6876\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeyvan E, Yurdakul O, Demirtas A, Yalcin H, Bilgen N. Identification of Methicillin-Resistant Staphylococcus aureus in Bulk Tank Milk. Food Sci Techno. 2020;40:150\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva AT, Gon\u0026ccedil;alves JL, Dantas ST, Rall VL, de Oliveira PR, Dos Santos MV, Peixoto RD, Mota RA. Genetic and phenotypic characterization of subclinical mastitis-causing multidrug-resistant Staphylococcus aureus. Antibiotics. 2023;12(9):1353.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtes A, Tastan C, Ermertcan S. Precision Genome Editing Unveils a Breakthrough in Reversing Antibiotic Resistance: CRISPR/Cas9 Targeting of Multi-Drug Resistance Genes in Methicillin-Resistant Staphylococcus aureus. bioRxiv. 2024:2023\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtarigho B, Falade MO. Analysis of antibiotics resistant genes in different strains of Staphylococcus aureus. Bioinformation. 2018;14:113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHunduma D, Amenu K, Desta H, Grace D, Agga GE, Kerro Dego O. Prevalence and antimicrobial resistance of Escherichia coli O157: H7 and Salmonella, and the prevalence of Staphylococcus aureus in dairy cattle and camels under pastoral production system. Antibiotics. 2023;13(1):26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Lin X, Jiang T, Peng Z, Xu J, Yi L, Li F, Fanning S, Baloch Z. Prevalence and characterization of Staphylococcus aureus cultured from raw milk taken from dairy cows with mastitis in Beijing, China. Front Microbiol. 2018;9:1123.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGajewska J, Zakrzewski A, Chajęcka-Wierzchowska W, Zadernowska A. Meta-analysis of the global occurrence of S. aureus in raw cattle milk and artisanal cheeses. Food Control. 2023:109603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaymenov BM, Bulashev AK, Chuzhebayeva GD, Aliyeva GK, Beishova IS, Kokanov SK, Raketsky VA. Phenotypic and genotypic resistance to antibiotics in Staphylococcus aureus strains isolated from cattle milk in Northern Kazakhstan. Veterinary World. 2023;16(9):1815.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonjean M, Hodille E, Dumitrescu O, Dupieux C, Nkoud Mongo C, Allam C, Beghin M, Paris M, Borrel O, Chardon H, Laurent F. Disk diffusion testing for detection of methicillin-resistant Staphylococci: Does Moxalactam improve upon Cefoxitin? J Clin Microbiol. 2016;54(12):2905\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadhavan A, Sachu A, Balakrishnan A, Vasudevan A, Balakrishnan S, Vasudevapanicker J. Comparison of PCR and phenotypic methods for the detection of methicillin resistant Staphylococcus aureus. Iran J Microbiol. 2021;13(1):31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCLSI. Performance Standards for Antimicrobial Susceptibility Testing; 17th Informational Supplement. CLSI document M100-S17. 2007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement. CLSI document M100-S25. 2015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLina G, Quaglia A, Reverdy M-E, Leclercq R, Vandenesch F, Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob Agent Chemotherap. 1999;43:1062\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrommenger B, Kettlitz C, Werner G, Witte W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J Clin Microbiol. 2003;41:4089\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAboshkiwa M, Rowland G, Coleman G. Nucleotide sequence of the Staphylococcus aureus RNA polymerase rpoB gene and comparison of its predicted amino acid sequence with those of other bacteria. Biochim Biophys Acta. 1995;1262:73\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmitz F-J, Jones ME, Hofmann B, Hansen B, Scheuring S, L\u0026uuml;ckefahr M, Fluit A, Verhoef J, Hadding U, Heinz H-P. Characterization of grlA, grlB, gyrA, and gyrB mutations in 116 unrelated isolates of Staphylococcus aureus and effects of mutations on ciprofloxacin MIC. Antimicrob Agent Chem. 1998;42:1249\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob Agent Chem. 1999;43:2823\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang J, Zhang R, Chen J, Zhao Y, Tang C, Yue H, Li J, Wang Q, Shi H. Incidence and characterization of Staphylococcus aureus strains isolated from food markets. Ann Microbiol. 2015;65:279\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKehrenberg C, Schwarz S. Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates. Antimicrob Agent Chem. 2006;50:1156\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagani L, Dell'Amico E, Migliavacca R, D'Andrea MM, Giacobone E, Amicosante G, Romero E, Rossolini GM. Multiple CTX-M-type extended-spectrum β-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J Clin Microbiol. 2003;41:4264\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClark N, Cooksey R, Hill B, Swenson J, Tenover F. Characterization of glycopeptide-resistant enterococci from US hospitals. Antimicrob Agent Chem. 1993;37:2311\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKluytmans J. Methicillin-resistant Staphylococcus aureus in food products: cause for concern or case for complacency? Clin Microbiol Infect. 2010;16:11\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKreausukon K, Fetsch A, Kraushaar B, Alt K, M\u0026uuml;ller K, Kr\u0026ouml;mker V, Zessin K-H, K\u0026auml;sbohrer A, Tenhagen B-A. Prevalence, antimicrobial resistance, and molecular characterization of methicillin-resistant Staphylococcus aureus from bulk tank milk of dairy herds. J Dairy Sci. 2012;95:4382\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT\u0026uuml;rkyılmaz S, Tekbıyık S, Oryasin E, Bozdogan B. Molecular epidemiology and antimicrobial resistance mechanisms of methicillin-resistant Staphylococcus aureus isolated from bovine milk. Zoonos Pub Health. 2010;57:197\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu S, Huang J, Zhang F, Wu Q, Zhang J, Pang R, Zeng H, Yang X, Chen M, Wang J. Prevalence and characterization of food-related methicillin-resistant Staphylococcus aureus (MRSA) in China. Front Microbiol. 2019;10:304.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam MA, Parveen S, Rahman M, Huq M, Nabi A, Khan ZUM, Ahmed N, Wagenaar JA. Occurrence and characterization of methicillin resistant Staphylococcus aureus in processed raw foods and ready-to-eat foods in an urban setting of a developing country. Front Microbiol. 2019;10:503.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAung KT, Hsu LY, Koh TH, Hapuarachchi HC, Chau ML, Guti\u0026eacute;rrez RA, Ng LC. Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in retail food in Singapore. Antimicrob Resist Infect Control. 2017;6:94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaran K, Godden SM, Boxrud D, Jawahir S, Bender JB, Sreevatsan S. Prevalence and characterization of Staphylococcus aureus, including methicillin-resistant Staphylococcus aureus, isolated from bulk tank milk from Minnesota dairy farms. J Clin Microbiol. 2012;50:688\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRiva A, Borghi E, Cirasola D, Colmegna S, Borgo F, Amato E, Pontello MM, Morace G. Methicillin-resistant Staphylococcus aureus in raw milk: Prevalence, SCC mec typing, enterotoxin characterization, and antimicrobial resistance patterns. J Food Protect. 2015;78:1142\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsiimwe BB, Baldan R, Trovato A, Cirillo DM. Prevalence and molecular characteristics of Staphylococcus aureus, including methicillin resistant strains, isolated from bulk can milk and raw milk products in pastoral communities of South-West Uganda. BMC Infect Dis. 2017;17:422.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuimar\u0026atilde;es F, Manzi M, Joaquim S, Richini-Pereira V, Langoni H. Outbreak of methicillin-resistant Staphylococcus aureus (MRSA)-associated mastitis in a closed dairy herd. J Dairy Sci. 2017;100:726\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwad A, Ramadan H, Nasr S, Ateya A, Atwa S. Genetic characterization, antimicrobial resistance patterns and virulence determinants of Staphylococcus aureus isolated form bovine mastitis. Pak J Biol Sci. 2017;20:298\u0026ndash;305.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAqib AI, Ijaz M, Anjum AA, Malik MAR, Mehmood K, Farooqi SH, Hussain K. Antibiotic susceptibilities and prevalence of Methicillin resistant Staphylococcus aureus (MRSA) isolated from bovine milk in Pakistan. Acta Tropic. 2017;176:168\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSergelidis D, Angelidis A. Methicillin-resistant Staphylococcus aureus: a controversial food‐borne pathogen. Letter App Microbiol. 2017;64:409\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFowoyo P, Ogunbanwo S. Antimicrobial resistance in coagulase-negative staphylococci from Nigerian traditional fermented foods. Ann Clin Microbiol Antimicrob. 2017;16:4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaghbaderani ZT, Shakerian A, Rahimi E. Phenotypic and Genotypic Assessment of Antibiotic Resistance of Staphylococcus aureus Bacteria Isolated from Retail Meat. Infect Drug Resist. 2020;13:1339.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZangoei-Fard S, Rahimi E, Shakerian A. Incidence and Phenotypic Pattern of Antibiotic Resistance of Vibrio Species Isolated from Seafood Samples Caught from the Persian Gulf. Egypt J Vet Sci. 2020;51:337\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbbasian H, Hajimolaali M, Yektadoost A, Zartab S. Antibiotic utilization in Iran 2000\u0026ndash;2016: Pattern analysis and benchmarking with organization for economic co-operation and development Countries. J Res Pharma Pract. 2019;8:162.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMousavi S, Dehkordi FS. Virulence factors and antibiotic resistance of Helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran. J Venom Anim Toxin including Tropic Dis. 2014;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhabbour R, Awad A, Younis G. Genetic Characterization and Antimicrobial-Resistant Profiles of Staphylococcus aureus Isolated from Different Food Sources. Biocontrol Sci. 2022;27(2):87\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatel K, Godden SM, Royster EE, Crooker BA, Johnson TJ, Smith EA, Sreevatsan S. Prevalence, antibiotic resistance, virulence and genetic diversity of Staphylococcus aureus isolated from bulk tank milk samples of US dairy herds. BMC Genomics. 2021;22(1):367.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruce SA, Smith JT, Mydosh JL, Ball J, Needle DB, Gibson R, Andam CP. Shared antibiotic resistance and virulence genes in Staphylococcus aureus from diverse animal hosts. Sci Rep. 2022;12(1):4413.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassani S, Moosavy MH, Gharajalar SN, Khatibi SA, Hajibemani A, Barabadi Z. High prevalence of antibiotic resistance in pathogenic foodborne bacteria isolated from bovine milk. Sci Rep. 2022;12(1):3878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurray CJ, Ikuta KS, Sharara F, Swetschinski L, Aguilar GR, Gray A, Han C, Bisignano C, Rao P, Wool E, Johnson SC. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 2022;399(10325):629\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam MW, Shahjahan M, Azad AK, Hossain MJ. Factors contributing to antibiotic misuse among parents of school-going children in Dhaka City, Bangladesh. Sci Rep. 2024;14(1):2318.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalsh TR, Gales AC, Laxminarayan R, Dodd PC. Antimicrobial resistance: addressing a global threat to humanity. PLoS Med. 2023;20(7):e1004264.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadgir CA, Biswas DA, Nadgir C, Biswas D. Antibiotic Resistance and Its Impact on Disease Management. Cureus. 2023;15(4):e38251.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePekana A, Green E. Antimicrobial Resistance Profiles of Staphylococcus aureus Isolated from Meat Carcasses and Bovine Milk in Abattoirs and Dairy Farms of the Eastern Cape, South Africa. Int J Env Res Pub Health. 2018;15:2223.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasidharan S, Prema B, Latha LY. Antimicrobial drug resistance of Staphylococcus aureus in dairy products. Asian Pac J Trop Biomed. 2011;1:130\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTyasningsih W, Effendi MH, Budiarto B, Syahputra IR. Antibiotic Resistance to Staphylococcus aureus and Methicillin Resistant Staphylococcus aureus (MRSA) Isolated from Dairy Farms in Surabaya, Indonesia. Indian Vet J. 2019;96:27\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzizkhani M, Tooryan F. Methicillin resistant Staphylococcus aureus (MRSA) in pastry cream products sold in Amol (Iran). Iran J Vet Med. 2018;12:167\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmail ZB. Molecular characteristics, antibiogram and prevalence of multi-drug resistant Staphylococcus aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis. Asian Pac J Tropic Biomed. 2017;7:694\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElmonir W, Aglan H, Elmahallawy E, El-Tras W. Antimicrobial phenotypes of geographically matched \u003cem\u003estaphylococcus aureus\u003c/em\u003e isolated from buffalo\u0026rsquo;s milk and clinical human cases in egypt: potential zoonotic risks. Slovenian Vet Res. 2019;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafarpoor Dehkordi F, Gandomi H, Akhondzadeh Basti A, Misaghi A, Rahimi E. Phenotypic and genotypic characterization of antibiotic resistance of methicillin-resistant Staphylococcus aureus isolated from hospital food. Antimicrob Resist Infect Control. 2017;6:104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMbindyo CM, Gitao GC, Plummer PJ, Kulohoma BW, Mulei CM, Bett R. Antimicrobial resistance profiles and genes of Staphylococci isolated from mastitic cow\u0026rsquo;s milk in Kenya. Antibiotics. 2021;10(7):772.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShariatifar M, Salavati-Hamedani M, Rezaeian-Doloei R, Rezaeigolestani M, Mohsenzadeh M. Antibiotic resistance and enterotoxin gene profiles of Staphylococcus aureus isolated from raw milk in Iran. J Hellenic Veterinary Med Soc. 2023;74(1):5433\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuncay RM, Sancak YC. Antimicrobial Resistance Properties, Biofilm, and mecA Gene Presence in Staphylococcus Aureus Isolated from Raw Milk Sold in Van, T\u0026uuml;rkiye. Turkish J Agriculture-Food Sci Technol. 2023;11(2):355\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNing K, Zhou R, Li M. Antimicrobial resistance and molecular typing of Staphylococcus aureus isolates from raw milk in Hunan Province. PeerJ. 2023;11:e15847.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSri Prabakusuma A, Zhu J, Shi Y, Ma Q, Zhao Q, Yang Z, Xu Y, Huang A. Prevalence and antimicrobial resistance profiling of Staphylococcus aureus isolated from traditional cheese in Yunnan, China. 3 Biotech. 2022;12:1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuwita S, Indrawati A, Damajanti R, Safika S, Mayasari NL. Multiple antibiotic resistance and virulence factors of Staphylococcus aureus strains isolated from dairy farms in South Sulawesi, Indonesia. Biodiversitas J Biol Divers. 2022;23(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Chen Y, Li X, Wang X, Li H. Detection of antibiotic resistance, virulence gene, and drug resistance gene of Staphylococcus aureus isolates from bovine Mastitis. Microbiol Spectr. 2022;10(4):e00471\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarell J, Petzl W, Gangl A, Huber-Schlenstedt R, Sorge US. Changes in antimicrobial resistance of Staphylococcus aureus in bovine quarter milk samples from Southern Germany between 2012 and 2022. J Dairy Sci. 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahi A, Kazemeini H, Jafariaskari S, Seif A, Hosseini S, Dehkordi FS. Genotypic and Phenotypic-Based Assessment of Antibiotic Resistance and Profile of Staphylococcal Cassette Chromosome mec in the Methicillin-Resistant Staphylococcus aureus Recovered from Raw Milk. Infect Drug Resist. 2020;13:273.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S-M, Zhou Y-F, Li L, Fang L-X, Duan J-H, Liu F-R, Liang H-Q, Wu Y-T, Gu W-Q, Liao X-P. Characterization of the Multi-Drug Resistance Gene cfr in Methicillin-Resistant Staphylococcus aureus (MRSA) Strains Isolated From Animals and Humans in China. Front Microbiol. 2018;9:2925.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y-T, Lin Y-T, Wan T-W, Wang D-Y, Lin H-Y, Lin C-Y, Chen Y-C, Teng L-J. Distribution of antibiotic resistance genes among Staphylococcus species isolated from ready-to-eat foods. J Food Drug Analys. 2019;27(4):841\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Zhang W, Sun B, Jiang Q, Cao Y, Shang J, Zhang Y, Gu X, Lv C, Guo C, Li M. Genetic diversity, antibiotic resistance, and virulence characteristics of Staphylococcus aureus from raw milk over 10 years in Shanghai. Int J Food Microbiol. 2023:110273.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Dong L, Zhao Y, Meng L, Wang J, Wang C, Zheng N. Antimicrobial susceptibility, and molecular characterization of staphylococcus aureus isolated from different raw milk samples in China. Front Microbiol. 2022;13:840670.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkanbi OE, Njom HA, Fri J, Otigbu AC, Clarke AM. Antimicrobial Susceptibility of Staphylococcus aureus Isolated from Recreational Waters and Beach Sand in Eastern Cape Province of South Africa. Int J Env Res Pub Health. 2017;14:1001.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsman K, Badr J, Al-Maary KS, Moussa IM, Hessain AM, Girah Z, Amin M, Abo-shama UH, Orabi A, Saad A. Prevalence of the antibiotic resistance genes in coagulase-positive-and negative-Staphylococcus in chicken meat retailed to consumers. Front Microbiol. 2016;7:1846.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohler S, Layer F, Stephan R. Comparison of virulence and antibiotic resistance genes of food poisoning outbreak isolates of Staphylococcus aureus with isolates obtained from bovine mastitis milk and pig carcasses. J Food Protect. 2011;74:1852\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahimi H, Saei HD, Ahmadi M. Nasal carriage of Staphylococcus aureus: Frequency and antibiotic resistance in healthy ruminants. Jundishapur J Microbiol. 2015;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMerz A, Stephan R, Johler S. Staphylococcus aureus isolates from goat and sheep milk seem to be closely related and differ from isolates detected from bovine milk. Front Microbiol. 2016;7:319.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabiri E, Mashak Z. Antimicrobial resistance properties and enterotoxigenic gene profile of methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolates from raw milk. J Posit School Psychol. 2022;6(8):1244\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHizlisoy H, ONMAZ NE, Karadal F, Serhat A, Yildirim Y, Gonulalan Z, Kilic H. Antibiotic Resistance Gene Profiles of Staphylococcus aureus Isolated From Foods of Animal Origin. Kafkas \u0026Uuml;ni Vet Fak\u0026uuml;lt Derg. 2018;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartineau F, Picard FJ, Lansac N, M\u0026eacute;nard C, Roy PH, Ouellette M, Bergeron MG. Correlation between the Resistance Genotype Determined by Multiplex PCR Assays and the Antibiotic Susceptibility Patterns of Staphylococcus aureus andStaphylococcus epidermidis. Antimicrob Agent Chemotherap. 2000;44:231\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRanjbar R, Shahreza MHS, Rahimi E, Jonaidi-Jafari N. Methicillin-resistant Staphylococcus aureus isolates from Iranian restaurant food samples: Panton-Valentine Leukocidin, SCCmec phenotypes and antimicrobial resistance. Tropic J Pharma Res. 2017;16:1939\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaters AE, Contente-Cuomo T, Buchhagen J, Liu CM, Watson L, Pearce K, Foster JT, Bowers J, Driebe EM, Engelthaler DM. Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin Infect Dis. 2011;52:1227\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlfouzan W, Udo EE, Modhaffer A. Molecular Characterization of Methicillin-Resistant Staphylococcus aureus in a Tertiary Care hospital in Kuwait. Sci Rep. 2019;9:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahanti A, Joardar SN, Bandyopadhyay S, Banerjee J, Ghosh S, Batabyal K, Sar TK, Dutta TK, Samanta I. Characterization of methicillin-resistant and enterotoxins producing Staphylococcus aureus in bovine milk in India. J Agri Food Res. 2020;2:100017.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 4 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Incidence, Methicillin-resistant Staphylococcus aureus, Traditional dairy, Raw milk, Antibiotic resistance","lastPublishedDoi":"10.21203/rs.3.rs-3928012/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3928012/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMethicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e bacteria are considered an emerging food-borne pathogens. This study aimed to evaluate the MRSA incidence and its genotypic and phenotypic properties of antibiotic resistance in raw milk and dairy.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThree hundred and eighty raw milk and traditional dairy samples were collected. \u003cem\u003eS. aureus\u003c/em\u003e was examined by culture method. MRSA was identified as simultaneous resistance against cefoxitin and oxacillin. MRSA genotypic and phenotypic antibiotic resistance was evaluated by PCR and disk diffusion, respectively.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003e \u003cem\u003eS. aureus\u003c/em\u003e contamination rate in milk and dairy samples was 15.78% (70 of 380 samples). Thirty-eight out of 60 (63.33%) \u003cem\u003eS. aureus\u003c/em\u003e isolates were identified as MRSA. MRSA distribution among isolates with sources of raw milk and dairy was 55.55% and 66.66%, respectively. MRSA isolates revealed the maximum resistance rate toward cefotaxime (100%), ceftriaxone (100%), penicillin (100%), erythromycin (85.78%), tetracycline (84.21%) and gentamicin (73.68%). Resistance of raw milk and dairy MRSA isolates against more than 7 antibiotic agents was 20% and 32.14%, respectively. The \u003cem\u003eblaZ\u003c/em\u003e (100%), \u003cem\u003eblaCTX-M\u003c/em\u003e (100%), \u003cem\u003etetK\u003c/em\u003e (55.26%), \u003cem\u003emsrA\u003c/em\u003e (50%), \u003cem\u003eaacA-D\u003c/em\u003e (47.36%), \u003cem\u003eermA\u003c/em\u003e (44.73%), \u003cem\u003emefA\u003c/em\u003e (44.73%) and \u003cem\u003egyrA\u003c/em\u003e (42.10%) were the most predominant genes encode resistance.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eDairy and milk in traditional and raw formats may be MDR-MRSA sources with boosted hygienic threats to consumers.\u003c/p\u003e","manuscriptTitle":"Incidence of Methicillin-resistant Staphylococcus aureus in milk and dairy and assessment genotypic and phenotypic properties of antibiotic resistance","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-12 15:36:06","doi":"10.21203/rs.3.rs-3928012/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dd1870ff-f554-44b5-91f2-bc5f7c8126d8","owner":[],"postedDate":"February 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-16T07:29:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-12 15:36:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3928012","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3928012","identity":"rs-3928012","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}