Niosomal Hesperidin Attenuates the M1/M2-Macrophage Polarization-Based Hepatotoxicity Followed Chlorpyrifos -Induced Toxicities

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-28 · read from full text ⓘ

This preprint investigates the protective effects of niosomal hesperidin against hepatotoxicity and oxidative stress induced by the pesticide chlorpyrifos in a mouse model. The researchers administered chlorpyrifos to mice for four weeks and then treated them with either standard hesperidin or niosomal hesperidin, evaluating outcomes through markers of antioxidant activity, inflammation, and macrophage polarization in liver, brain, and ovary tissues. The results indicated that niosomal hesperidin significantly improved antioxidant status, reduced apoptosis, and modulated M1/M2 macrophage polarization more effectively than non-niosomal hesperidin, although it did not substantially alter primary follicle counts in the uterus. Relevance to endometriosis: listed as one indication for GnRH antagonists, though the paper's main focus is uterine fibroids.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Purpose: The organophosphate pesticide chlorpyrifos (CPF) can cause developmental , neurological deficiencies , and mitochondria-mediated oxidative stress responses. In this study, the effect of niosomal hesperidin (Nio+Hesp) on the polarization of M1-M2 liver macrophages and the amount of inflammatory cells secretion in the brain, liver, and ovary tissues of CPF induced mice (3 mg/kg for 4 weeks; Intraperitoneally) was investigated. Methods: : Fourty C57 mice were divided into CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups and treated carried out orally for 30 days. The activity of superoxide dismutase (SOD) and malondialdehyde (MDA), tissue changes, inflammation, and apoptosis in brain, liver, and ovary tissues, the number of ovarian germ cells , and M1-M2 liver macrophage polarization were evaluated by examining the expression of CD163 and CD68 genes. Results: : Nio+Hesp prescription caused an increase in SOD and a decrease in MDA. Nio+Hesp decreased the amount of cell apoptosis in the liver, also reduced the expression of CD163 and CD68 genes. Although there was a significant difference between Hesperidin and Nio+Hesp in the increase of Graafian follicles, corpus luteum, and peri-antral follicles, no substantial difference was observed in primary follicles in the uterus. Both Nio+Hesp and Hesp alleviated CPF-induced hepatotoxicity, however, Nio+Hesp was superior to Hesp in downregulation of the CD163 and CD68 genes expression. Conclusion: The ameliorative effects of HSP and Nio+Hesp may be at least in part due to their antioxidant and anti-inflammatory properties. By attenuating, Nio+Hesp may have therapeutic applications for reversing CPF-induced toxicity as an appropriate antioxidant effects.
Full text 136,749 characters · extracted from preprint-html · click to expand
Niosomal Hesperidin Attenuates the M1/M2-Macrophage Polarization-Based Hepatotoxicity Followed Chlorpyrifos -Induced Toxicities | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Niosomal Hesperidin Attenuates the M1/M2-Macrophage Polarization-Based Hepatotoxicity Followed Chlorpyrifos -Induced Toxicities Mahsa Sharifnia, Zohre Eftekhari, Pejman Mortazavi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3123664/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose: The organophosphate pesticide chlorpyrifos (CPF) can cause developmental , neurological deficiencies , and mitochondria-mediated oxidative stress responses. In this study, the effect of niosomal hesperidin (Nio+Hesp) on the polarization of M1-M2 liver macrophages and the amount of inflammatory cells secretion in the brain, liver, and ovary tissues of CPF induced mice (3 mg/kg for 4 weeks; Intraperitoneally) was investigated. Methods: Fourty C57 mice were divided into CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups and treated carried out orally for 30 days. The activity of superoxide dismutase (SOD) and malondialdehyde (MDA), tissue changes, inflammation, and apoptosis in brain, liver, and ovary tissues, the number of ovarian germ cells , and M1-M2 liver macrophage polarization were evaluated by examining the expression of CD163 and CD68 genes. Results: Nio+Hesp prescription caused an increase in SOD and a decrease in MDA. Nio+Hesp decreased the amount of cell apoptosis in the liver, also reduced the expression of CD163 and CD68 genes. Although there was a significant difference between Hesperidin and Nio+Hesp in the increase of Graafian follicles, corpus luteum, and peri-antral follicles, no substantial difference was observed in primary follicles in the uterus. Both Nio+Hesp and Hesp alleviated CPF-induced hepatotoxicity, however, Nio+Hesp was superior to Hesp in downregulation of the CD163 and CD68 genes expression. Conclusion: The ameliorative effects of HSP and Nio+Hesp may be at least in part due to their antioxidant and anti-inflammatory properties. By attenuating, Nio+Hesp may have therapeutic applications for reversing CPF-induced toxicity as an appropriate antioxidant effects. Chlorpyrifos. Hesperidin. Niosomal Hesperidin. Antioxidant Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction The existence of high productivity in the agricultural industry can be attributed to the use of pesticides but their disadvantages to the environment and the health of non-target organisms cannot be ignored (Mdeni et al. 2022a). Pesticides are a most important class of organic compounds that resistance to biodegradation and lead to chronic and permanent health and biological problems (Mdeni et al. 2022b). Chlorpyrifos (CPF) is a known insecticide in agricultural and non-agricultural fields (Essa et al. 2019). This poison has the formula O, O-diethyl-O-(3,5,6-trichloro-2-pyridinyl)-phosphorothioate and the chemical formula C9H11Cl3NO2PS, which has low solubility in water but is soluble in oil, benzene, dimethyl sulfoxide, alcohol, and acetone dissolve (ur Rahman et al. 2021). Poisoning with this toxin is happened not only through the fruits and vegetables consumptions that are consumed as part of the normal diet but also through water, milk, and derived products (Saunders et al. 2012a). Since most organophosphates have lipophilic properties, they can easily absorbed by human and animal bodies through the skin and accumulate in animal borgans and milk (Zhang et al. 2021). The placenta cannot act as a barrier for lipophilic OPs, so the fetus is contaminated with toxin (Saunders et al. 2012b). Also it can easily cross the blood-brain barrier, due to this lipophilicity, so the nervous system is the first target of this poison. CPF disrupts neurotransmission and causes neurological disorders (Aboubakr et al. 2021a). Also, due to its lipophilic properties, this toxin binds with the phospholipid membrane of cells in various organs and causes the peroxidation of fats (Tanvir et al. 2015). Chlorpyrifos poison causes excessive production of active oxygen metabolites, which is one of the mechanisms of damage of this poison in recent studies (Aboubakr et al. 2021b; Akpa et al. 2021). Natural products show notable features such as unusual chemical variety, chemical and biological possessions with low toxicity. These properties make natural products the pioneers in discovering new drugs (Siddiqui et al. 2014). However, natural compounds are nowadays used to treat numerous main diseases, such as cancer, diabetes, cardiovascular, and infectious diseases (Dabbagh Moghaddam et al. 2021; Deka Dey et al. n.d.; D. Moghaddam et al. 2020; F. D. Moghaddam, Hamedi, and Dezfulian 2016; Patra et al. 2018b, 2018a). So natural medicines have unique benefits such as less toxicity and side effects, low price, and capable therapeutic agents (Patra et al. 2018c). However, concerns related to the biocompatibility and toxicity of natural compounds pose a more significant challenge to use as drugs. So, numerous natural compounds do not successfully authorize in clinical trials due to these problems (Patra et al. 2018c). Malondialdehyde (MDA)as an oxidative stress marker and superoxide dismutase (SOD) as an antioxidant enzyme was known (Camkurt et al. 2017a). The function of SOD is important in controlling the levels of ROS and anion radicals (Camkurt et al. 2017b). Edible polyphenols have a protective role against many toxins due to their antioxidant properties (Zhao et al. 2020). Hesperidin (C28H34O15), belongs to the group of flavonoid, is one of these polyphenol substances with antioxidant properties, often found in citrus fruits (Imperatrice et al. 2022). Hesperidin and its derivatives are in the citrus family, such as oranges, grapefruits, tangerines, limes, and lemons. After oral intake, hesperidin is hydrolyzed by intestinal microbial mainly in the large intestine and in the small intestine to form aglycone and then altered to glucuronide in the large intestine. They are later catabolized and produce phenolic acids and their corresponding metabolites (Pyrzynska 2022). Hesperidin ameliorates the neurodegenerative symptoms of Alzheimer's, Parkinson's, Huntington's, depression, Multiple sclerosis, brain ischemia-reperfusion injury, and traumatic injury in central nervous system (CNS) in animal models (Kim et al. 2019a). However, the bioavailability of these compounds is limited due to their low solubility, and this property limits their use as health agents (Wdowiak et al. 2022a). Therefore, ensuring the bioavailability of hesperidin is essential to exploit its beneficial properties entirely (Nielsen et al. 2006). Diffrent approaches, such as micronization and encapsulation of hesperidin, have been suggested to increase its bioavailability, stability, and organized releasing, especially for drug production. One of the encouraging drug carriers are Niosomes that have a bilayer assembly and are designed by self-association of nonionic surfactants and cholesterol in an aqueous phase. They have extended shelf life, display high stability, and enable the delivery of drug to the target location, so the potential of niosomes has been widely studied (Dabbagh Moghaddam et al. 2021; Moammeri et al. 2022a). The use of pesticides has helped to increase the quality of products to a great extent. Still, on the other hand, it has unknown effects on the health of vital organs, so scientists are interested in investigating and evaluating these effects. Therefore, in the present study, nanoliposomes were designed for the delivery of hesperidin to evaluate the ameliorative role and its effect against oxidative stress, lipid peroxidation, and tissue lesions in the mice received CPF. Material and Methods Reagents CPF (Cat No: 45395-100 mg, Sigma Aldrich, Darmstadt, Germany), DMSO (Cat No: D2650( Sigma Aldrich, Darmstadt, Germany), KOH (Sigma Aldrich, Darmstadt, Germany), Ketamine (Alfasan, Woerden, Netherlands), Xylazine (Alfasan, Woerden, Netherlands), Chloroform ( Sigma Aldrich, Darmstadt, Germany), Methanol (Sigma Aldrich, Darmstadt, Germany ), Ethanol (Sigma Aldrich, Darmstadt, Germany), MDA (ZellBio GmbH assay kit, Germany ), SOD( ZellBio GmbH assay kit, Germany), PBS(Sigma Aldrich, Darmstadt, Germany), Qiagen (Hilden, Germany) QIAzol reagent (Qiagen, Hilden, Germany), cDNA synthesis Kit (Qiagen, Hilden, Germany), SYBER Green (RealQ Plus 2x Master Mix Green – Amplicon, Odense, Denmark), ABI Step One (Applied Biosystems, StepOne™, Foster, USA), RNA extraction kit (CinnaGen, Tehran, Iran), Phosphoserine acid solution ( Sigma Aldrich, Darmstadt, Germany), Phosphomolybdic acid ( Sigma Aldrich, Darmstadt, Germany), Xylene 1 and 2 (Sigma Aldrich, Darmstadt, Germany), Cresyl violet acetate (Sigma Aldrich, Darmstadt, Germany), Bouin's solution (Sigma Aldrich, Darmstadt, Germany), Glacial acetic acid (Sigma Aldrich, Darmstadt, Germany). Hesperidin Extraction and Compounds Analysis The preparation of hesperidin extraction was carried out by maceration method. The dried orange rind was soaked in an alkaline solution (KOH 10%) for one night, and then the mixture was filtered through a Buchner funnel. Gas chromatography–mass spectrometry (GC-MS) (Agilent Technologies; GC-MS System: 7890 A) was used to identify the components of the hesperidin extract (injection port temperature: 260 ºC; ion source temperature: 240 ºC; carrier gas: He 99.999%; and sample volume: 0.4 µL). Preparation of Niosomal Formulation The preparation of Hesperidin-loaded niosomes was carried out by thin-layer hydration method. Briefly, surfactant and cholesterol were dissolved in 20 mL of chloroform and methanol solution (2:1; v/v). The organic solvent was evaporated by rotary evaporator (250 rpm, 60°C, 30 min). Then, the dried agent were hydrated utilizing 10 mL Hesperidin solution (PBS, pH 7.4) at 60°C for 45 minutes, 150 rpm. Finally, the gained sample was sonicated for 10 min (Hielscher up 50H ultrasonic processor, Germany) to obtain the uniform size distribution niosomal sample. The sample was stored in a refrigerator (4–8°C) for further experiments. Characterization of Niosome The characterization of the prepared niosome was done using a scanning electron microscope (SEM) and dynamic light scattering (DLS) measurements. The techniques provide information on the form, size, surface charge, and distribution of the prepared niosome. Drugs Release Kinetic Study One mL of niosome solution containing hesperidin, was dispensed into a dialysis bag and then placed in 50 mL PBS, located in a shaker incubator at 37°C and 100 rpm and sampling was performed every 10 hour until 50 hours. In each sampling, 500 µL of PBS was removed and exchanged with 500 µL of isothermal PBS. To evaluate the concentration of released hesperidin, the uptake of hesperidin at 285 nm was measured using spectroscopy. The cumulative release rate of the drug was determined in 48 hours with specified intervals. Experimental Animals Study Design Forthy female C57 mice (6–8 weeks, 25 ± 2g) were obtained from the Pasteur Institute of Iran. The animals were housed under specific conditions based on guidelines : RoomTemperature (22 ± 2°C); Room light-dark cycles 14/10 h; Relative humidity 50–55%. Mice had access to adequate water in polycarbonate bottles and were fed with commercial rodent pellets. After seven days, they were randomly divided into four categories (n = 10 per group). All mice were treated according to guidelines for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978) and kept under ethical considerations of the Institutional Animal Care and Use Committee (Ethical code: IR.IAU.SRB.REC.1401.113). Prescription of CPF, DMSO, CPF + Hesp, and CPF + Nio + Hesp was performed. Group 1: CPF (mice as a control group) received CPF; (3 mg/kg for 4 weeks ; Intraperitoneally) (Nikbin et al. 2020) Group 2: Sham (healthy mice as a control group) received DMSO; (40 mL/Kg for 4 weeks ; Intraperitoneally) Group 3: CPF (3 mg/kg for 4 weeks ; Intraperitoneally) after induction model Hesp (100 mg/kg ; for 30 days; Orally gavaged) Group 4: CPF(3 mg/kg for 4 weeks ; Intraperitoneally) + Nio + Hesp (100 mg/kg for 30 days; Orally gavaged) (Abdollahi et al. 2021) The appropriate doses of CPF and Hesp were obtained from previous studies (Kim et al. 2019b; Wdowiak et al. 2022b). At the end of the experimental period, mice were Euthenized in a CO 2 + O 2 chamber. Blood samples were taken by cardiac puncture method, and the sera were seperated by centrifugation at 4000 rpm, 10 min (Hettich-Germany), and refrigerated at -20°C. Oxidative Stress Assay The blood clot was formed at room temperature and was centrifugated at 4000 rpm for 10 min. The supernatants were collected for MDA and SOD assessment. Lipid peroxidation results from oxidative stress, a marker of oxidative stress. The lipid peroxidation was determined by the ZellBio GmbH assay kit based on the reaction of MDA with thiobarbituric acid (TBA). The SOD activity was assayed with a ZellBio GmbH assay kit based on the colorimetric (420 nm) method. Real-time Polymerase Chain Reaction (RT-PCR) Real-time PCR was performed to measure the mRNA transcript level of CD163 and CD68 in the liver tissue. The CD163 and CD68 gene expression level of the CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp groups were assessed. RNA was extracted from all samples by using QIAzol reagent according to Qiagen protocol. The RNA samples were treated with DNase I, then were reverse-transcribed into cDNA using fast cDNA synthesis, enabling sensitive real-time kit protocol and oligo (dT) primers. Each PCR reaction performed using the PCR master mix and SYBER Green, on ABI Step One, according to the manufacturer’s protocol. Forty cycles were considered for each Real-Time PCR and temperatures of each cycle were set at 94.00 ˚C for 30 secs, 58.00 ˚C for 30 secs, and 72.00 ˚C for 30 sec. Specific forward and reverse primer sequences were designed for the genes studied using NCBI as shown in Table 1 . Table 1 Primer sequences used in Real-time PCR Genes Forward primer (5'-3') Reverse primer (3'-5') CD163 CACACGGAGCCATCAAAATCATC GGACAAACCTTTTACAACCAGGAG CD68 TCCGGACCCACAACTGTCAC CTTGGACTAGGCGAGGGTGG GAPDH CAGAACATCATCCCAGCCTCC TTGGCAGGTTTCTCAAGACGG Data were analyzed based on delta-delta CT from the device, and the normalization of data was done by GAPDH as a reference gene.The primers for CD163, CD68 , and GAPDH (as housekeeping genes) were designed using a verified BLAST program in NCBI databases. Forward and reverse primer sequences for the aforementioned genes are listed in ( Table 1 ) . The qRT-PCR was performed with the sense and antisense primers using a 7500 Real-time PCR System. The 2 − ΔΔCT was calculated for the obtained data. A melting curve analysis was performed to evaluate the possibility of nonspecific amplification or primer-dimer formation. Histopathology of the Liver, Brain, and Ovary C57 mice were anesthetized with Ketamine 10% (100 mg/kg) and Xylazine 2% (10 mg/kg). 10% formalin was used to fix the tissue samples. After preparing the paraffin sections with a thickness of 4 micrometers, they were stained with hematoxylin and eosin, Masson's trichrome, and cresyl violet. Hematoxylin and Eosin Staining The brain, liver, and ovary slides were dewaxed in laboratory four machines for 20 min at 90°C. The specimens were dipped in each Xylene 1 and 2 for 15 min. The samples were hydrated in graded ethanol and distilled water and were stained based on the instruction. The neural cell population and inflammation score in mice brains were measured by this staining method. Masson’s Trichrome Staining The prepared slides were placed using descending degrees of alcohol, then in Bowen's solution for one hour in an autoclave (56 0 C). Then rinsed with distilled water, Weigert's hematoxylin was poured onto the tissues. The slides were rinsed with running water for 10 minutes, and then filtered water and re-brushed for 10–15 minutes in acid fuchsin was placed. After rinsing with distilled water, about 10–15 minutes of phosphoserine acid solution and phosphomolybdic acid were poured on the slides and immersed in aniline blue solution for 20–25 minutes. The samples were washed with distilled water and immersed in Acetic acid 1% for about 2–5 minutes. In the end, the slides were washed with distilled water, and engaged in alcohol; then, the slide was glued. Cresyl Violet Staining About 0.6 g powder of Cresyl violet acetate was dissolved in 500 mL of distilled water and 1.25 mL glacial acetic acid. Then the sample located on magnetic stirrer at 60°C and solution filtered with Whitman paper and stored. Prepared slides were immersed in Xylene twofold (5 minutes), followed by immersions in ethanol 100% (5 minutes). Then slides were dipped in 95% ethanol and 70% ethanol once for 2 minutes before being placed in a container with distilled water for 2 minutes. Then the slides were immersed in cresyl violet staining solution (15 minutes) and washed with distilled water for 2 minutes. The previous steps were repeated in reverse: dropping in ethanol 70% for 2 minutes and ethanol 90% for 2 minutes, followed by two immersions in ethanol 100% for 5 minutes each. The final two immersions were in Xylene solution for 5 minutes each then the slides were coverslipped with permanent medium and left air-dried overnight. Statistical Analysis Data were reported as mean ± SD, and the graphs were plotted using Graph Pad Prism 5.04 software. Data were statistically analyzed using analysis of variances (ANOVA) followed by a post-Tukey test, and a p-value less than 0.05 was considered a significant difference. Results Gas Chromatography-mass Spectrometry Analysis A chromatography device connected to a gas mass spectrometer was used to identify the components of the hesperidin extract. The results was shown in Table 2 . The identified chemical composition of hesperidin extract is shown in Table 2 and represented 10 compounds. The compounds of hesperidin identified based on the peak area, and retention time. The active principles with their retention time (RT) and percentage of peak area (%) are expressed in Table 2 . Table 2 Gas chromatography-mass spectrometry analysis of Hesperidin extract compounds. RT (min) Area% Component Quality 12.798 21.25 2-Furancarboxaldehyde, 5-(hydroxymethyl)- 59 14.199 17.17 2-Methoxy-4-vinylphenol 95 17.811 8.31 N1-(4-hydroxybutyl)-N3-methylguanidine acetate 43 26.118 8.65 Methyl ester of 3-(3,5-di-tert-butyl-4-hydroxyphenyl)-propionic acid 99 34.321 7.56 Oleic Acid 50 34.778 10.90 Di-(2-ethylhexyl)phthalate 90 35.867 6.03 7-Amino-1,4-dimethylpyrimido[4,5-c]pyridazine-3,5-(1H,2H)-dione 46 38.97 6.90 2,3-dimethyl-4-azaphenanthrene 46 46.307 6.91 Gibberellin A3 52 49.809 6.30 Cyclotrisiloxane, hexamethyl- 43 Characterization of Niosome According to the results reported by the SEM and DLS, the size of the niosomal nanocarrier containing the extract was determined to be 460 nm and the particle diameter range was 0.458 (Fig. 1 A). Also, the image from the scanning electron microscopy can be seen below (Fig. 1 B). Figure shows the optimal niosomal formulation that confirms uniform morphology and a smooth surface. The release pattern of niosomal hesperidin was evaluated. The obtained results showed that during 48 hours, 100% of the drug was separated from the niosome, so in the first 12 hours, 60% of the loaded drug was separated from the nanosystem, and this process slowed down after that (Fig. 1 C). Oxidative Stress Assays Followed injection the CPF, an enhancement in MDA level and decrease in SOD concentration were observed but the obtained results from oxidative stress analysis showed that the concentration of MDA in the Sham, CPF + Hesp, and CPF + Nio + Hesp groups decreased statistically significant followed treatment ( p < 0.001) (Fig. 2 A). In contrast, a significant increase was observed in the SOD activity level of the CPF + Hesp and CPF + Nio + Hesp groups compared to CPF ( p < 0.05, and p < 0.001), respectively. Also, this increase was significant in the CPF + Nio + Hesp group compared to the CPF + Hesp group ( p < 0.05) (Fig. 2 B). Brain Cresyl Violet Staining Figure 3 A shows cresyl violet-stained cross-sections of C57 mice's brain tissue in CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp groups. The number of dark brain cells was counted after cresyl violet staining. Followed CPF injection, the number of dark brain cells decreased. While, the number of dark cells in the CPF + Hesp and CPF + Nio + Hesp groups were increased in comparison to the CPF group ( p < 0.01 and p < 0.001), perspectively (Fig. 3 B). Brain Hematoxylin and Eosin Staining Figure 4 A shows the morphological analysis of cerebellum tissue using hematoxylin and eosin staining. The group exposed to CPF showed a significant increase in the inflammatory cells amount in the vicinity of cerebral cortex blood vessels. The inflammation score in the Sham and CPF + Nio + Hesp groups was lower than the CPF ( p < 0.001 and p < 0.05) (Fig. 4 B). Also, the neural cell population in the CPF + Hesp and CPF + Nio + Hesp groups was significantly increased compared to the CPF group ( p < 0.05 and p < 0.001), respectively (Fig. 4 C). Liver Hematoxylin and Eosin Staining Figure 5 A shows the liver Hematoxylin and Eosin staining of CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp groups. The sham group displayed standard hepatocyte structure, the percentage of liver cells without nuclei and with apoptotic appearance was about 5% in this group. On the other hand, the microscopic examination of the CPF-treated group showed that the percentage of vacuolated hepatocyte cells with an unclear nucleus and nuclear membrane were significantly increased compared to other studied groups. In the CPF group, dead cells were observed to be less pigmented than living cells due to the destruction of the liver tissue, and this amount of sample discoloration was around 50%. There was an accumulation of blood cells and lymphocytes in the spaces resulting from dead cells. Moreover, there were congestion and hemorrhage in the hepatic sinusoids. However, the examination of the mice treated with niosomal hesperidin revealed that hepatic cells had a normal appearance. A central vein with normal morphology was observed in the space between the lobules, the liver triad, and between each lobule. Kupffer cells were located around sinusoidal vessels. A small number of liver cells were without nuclei and with an appearance similar to apoptotic cells. The percentage of this number of cells was around 15% of the total tissue. The observation of the regular hesperidin-treated group showed that the hepatic cells had a normal appearance, and Kupffer cells were observed around sinusoidal vessels. The percentages of cells without a nucleus were 25% compared to the whole tissue. The liver inflammation score in the CPF + Nio + Hesp groups was significantly lower than the CPF group ( p < 0.05), respectively. While the group treated via CPF + Hesp did not show significant change compared to CPF (Fig. 5 B). Liver Masson's Trichrome Staining Figure 6 A shows Masson's trichrome-stained cross-sections of C57 mice's liver tissue in CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp groups. Th toxic effect of CPF was evaluated by the collagen deposition in the liver. In the investigation of the collagen deposition rate of the control and treated groups, the results showed a statistical decrease in the CPF + Hesp, and CPF + Nio + Hesp groups compared to the CPF group ( p < 0.001). In the comparison between the of CPF + Hesp, and CPF + Nio + Hesp, the collagen deposition rate in CPF + Nio + Hesp was decreased ( p < 0.05) (Fig. 6 B). Ovarian Hematoxylin and Eosin Staining Figure 7 shows hematoxylin and eosin-stained cross-sections of C57 mice's ovarian tissue in CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp groups. Based on the histopathology results, In the CPF group, a large population of follicles underwent apoptosis due to increased inflammatory cells and insufficient blood supply. In addition, the accumulation of inflammatory cells was observed in the central part of the ovary, which was transferred to the tissue by the ovarian vessels. While in the sham group, a tiny population of these inflammatory cells was seen in the tissue, and the appearance of the tissue did not show any inflammation (Fig. 7 A). An increase in the number of Graafian follicles was observed in the CPF + Hesp, and CPF + Nio + Hesp groups compared to the CPF group, which were significant p < 0.05 and p < 0.001, respectively (Fig. 7 B). Also, in the examination of the number of corpus luteum in the studied groups, a statistically significant increase was observed in the CPF + Hesp, and CPF + Nio + Hesp groups compared to CPF ( p < 0.05, and p < 0.05) (Fig. 7 C). On the other hand, the number of the preantral follicle (Fig. 7 D) and primary follicle (Fig. 7 E) also showed an increase in the CPF + Hesp, and CPF + Nio + Hesp groups compared to CPF groups ( p < 0.01, and p < 0.001), respectively Ovarian Trichrome Staining Figure 8 A shows the results of cross-sectional histopathology of the liver tissue of C57 mice treated via CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp. Figure 8 B shows the number of the atretic follicle of CPF, Sham, CPF + Hesp, and CPF + Nio + Hesp groups. The comparison between these groups showed a statistically significant decrease in the number of the atretic follicle in the CPF + Nio + Hesp compared to CPF ( p < 0.05), respectively. Liver Macrophage Gene Expression The expression level of CD163 and CD68 genes can be seen in Figs. 9 A and 9 B. CD163 gene expression in CPF + Hesp, and CPF + Nio + Hesp groups had a significant decrease compared to the CPF group ( p < 0.01, and p < 0.001) respectively (Fig. 9 A). Also, this decrease in CD68 gene expression level was observed. In this way, the groups of CPF + Hesp, and CPF + Nio + Hesp compared to CPF showed a statistically significant decrease of ( p < 0.05, and p < 0.01), respectively (Fig. 9 B). Discussion In the present study, the effects of CPF on brain, liver, and ovary in female C57 mice were investigated IP injection of CPF (3 mg/kg) during 4 weeks showed adverse consequences on mice which the toxicity effect was evaluated by collagen deposition rate in the liver, inflammation score, neural cells and dark cells in the brain, and oxidative stress assay parameters. Based on previous investigations, the effect of CPF dose and period of exposure on liver fibrosis occurrence and collagen deposition rate were confirmed in rats and NMRI mice as an animal model (Gheibi et al. 2020). Nowadays, the use of plants as a valuable sources of natural antioxidants has received considerable attention. One of these components is hesperidin known as a natural antioxidant and has significant medicinal properties, such as anti-diabetic, anti-inflammatory, wound healing, liver, heart, and nervous sysytem protection (Küçükler et al. 2021a). On the other hand, numerous studies show that delivery of drugs based on the niosomes will improve the therapeutic effects compared to natural based drugs (Dabbagh Moghaddam et al. 2021; Moammeri et al. 2022b). Niosomal drug delivery system are a helpful way to increase the body's access to the drugs with low water solubility, as well as reduce unwanted side effects. The therapeutic performance of the niosomal natural-based drug molecules can also be enhanced by delayed clearance from the blood circulation, protecting the drug from biological interactions, and controlling effects to objective cells (Küçükler et al. 2021b). Therefore, in this study, we focused on the thraputic effect of Niosomal Hespeidin on M1-/M2-macrophage functions and the amount of inflammatory cell secretion in the brain, liver, and ovary tissues by regulating the antioxidant activity in mice CPF-induced hepatotoxicity. By pathological analyses, it was found that CPF-induced mice vital organs injury are very complicated. CPF can enter the body through the respiratory and digestive systems, as well as the skin. The accumulation of CPF residues in the environment has been linked to severe adverse reactions in the animal and humans. CPF chronic toxicity stimulates many biological pathways by blocking sodium and calcium channels, including oxidative stress, inflammation, and apoptosis (Moammeri et al. 2022b). CPF is a cholinesterase inhibitor that causes oxidative stress and damages the body's proteins, DNA, and lipids (Ma et al. 2013a). Organophosphorus toxins cause an increase in the level of MDA, which is a marker of lipid peroxidation. MDA is a mutagenic and carcinogenic mammal substance that reacts with DNA bases. Measurement of SOD activity and MDA level are two potential indicators to show oxidative damage (Ma et al. 2013b). CPF injection caused considerable decreases in the SOD activity in mice with CPF exposure. SOD, a natural defense against oxidative stress, degrade superoxide to hydrogen peroxide, which is then eliminated by glutathione peroxidase or catalase. As a result, SODs inhibit the generation of highly reactive ROS like peroxynitrite or hydroxyl radical (Rahman et al. 2018a; Wang et al. 2021). The present study also confirmed the increase of MDA and the decrease of SOD in the CPF group compared to the sham. Both hesperidin and Niosomal hesperidin decreased MDA levels and increased SOD activity. There was no difference between hesperidin and Niosomal hesperidin for the regulation of MDA, while the role of niosomal hesperidin in increasing SOD was more substantial. One of the innate immune response cells in contrast to foreign pathogens and injuries are Macrophages (Saqib et al. 2018a). These cells play a critical role in the inflammatory pathway in a range of diseases such as autoimmune disseases, myocarditis, atherosclerosis, sepsis, arthritis, and diabetes (Saqib et al. 2018b). Recently, since the discovery of two subtypes of macrophages, distinguished by their distinct phenotype and gene expression pattern, more studies have attentive on the inflammatory diseases of macrophages (Saqib et al. 2018b). Among these, M1 macrophages are pro-inflammatory and responsible for inflammatory signaling, while M2 are anti-inflammatory macrophages that participate in the inflammatory process responces; M2 macrophages produce anti-inflammatory cytokines and thus contribute to tissue healing (Saqib et al. 2018b). Flavonoids extracted from cypress leaves have remarkable anti-inflammatory properties on RAW 264. Seven lipopolysaccharide-induced macrophages detected in mice, which can inhibit the secretion of IL-6, and TNF-α by inhibiting the expression of inflammation-related genes (Li-Li et al. 2019a). Feng et al. (2017) investigated the anti-inflammatory effects of 5, 7, 2', 4', and 5'-pentamethoxyflavanone, a type of flavonoid, in vivo and in vitro (Li-Li et al. 2019b). This flavonoid inhibited the expression of pro-inflammatory cytokines IL-1B, IL-6, TNFa, and iNOS, characteristic of M1 macrophage inhibition (Li-Li et al. 2019b). The decreased expression of CD11c, a marker of M1 macrophage levels, further confirmed these anti-inflammatory effects. On the other hand, this substance also increased M2 polarization by increasing anti-inflammatory factors and M2 macrophage surface markers, leading to the balance of M1 and M2 macrophages (Li-Li et al. 2019b). Both M1- and M2-macrophages cause development of hepatic lesions induced by d-galactosamine that indicating the importance of analysis of macrophage phenotypes for hepatotoxicity based on M1-/M2-polarization (Yang et al. 2022)(Rahman et al. 2018b).Commonly, in immunohistochemical or gene expression analyses, M1-macrophages are identified by the expression of CD68, whereas M2-macrophages by CD163 (Li-Li et al. 2019b). In this study, the expression levels of CD68 and CD163 genes, which are markers of M1 and M2 liver macrophages, respectively, were increased and significantly decreased with hesperidin and niosomal hesperidin compared to the group receiving poison. These findings showed that M1- and M2-macrophages contribute to the development of hepatic lesions induced by CPF. Treatment with either Hespridin (Hesp), or Niosomal Hespridin resulted in partial improvement of CPF-induced hepatotoxicity represented by significant reduction of CD68 and CD163 genes expression, significant reduction of the hepatic collagen deposition rate, and a significant decrease in sera MDA levels(Rahman et al. 2018b). The brain is most closely associated with the development of oxidative stress situations due to its high lipid content, low levels of antioxidant molecules, and increased oxygen consumption. So, exposure to toxins causes neuronal injury and behavioral disorders. Animals exposed to CPF showed marked pyknotic, degenerated, and wrinkled neurons. Severe inflammatory cell infiltration was also observed in the CPF group. A wide range of pharmacological targets, including nerve growth factors and enhanced endogenous antioxidant defenses that reduce neuroinflammatory and apoptotic signaling pathways, have been implicated in the neuroprotective potential of this flavonoid. Hesperidin can effectively protect neurons from damage caused by oxidative or nitrosation stress(Rahman et al. 2018b). In the observations made in this research, following the treatment of mice with CFP, infiltration of inflammatory cells was observed in their brains, and the number of neurons and dark cells was reduced. Treatment with niosomal reduced 50% of the inflammation in the brain, while in the hesperidin-received group, the rash was decreased by about 25%. There was a significant difference between hesperidin and niosomal hesperidin treatment for neuronal cell population recovery. CPF toxin causes histopathological lesions in the liver, and several studies have mentioned that this change in the pathological structure of the liver is due to the excessive production of ROS. CPF-treated mice's livers showed significant vein congestion, localized hepatocyte necrosis, dissociation of hepatic cords, and infiltration of inflammatory cells. Hesperidin has a hepatoprotective role in many diseases. Hesperidin decreases the oxidative stress, MDA level, and liver tissue changes caused by consuming Ethanol in the liver, increasing the antioxidant capacity and anti-inflammation properties (Celik et al. 2016). In this study, followed CPF injection, death and lack of nuclei in 50 % of the cells wasobserved while this was reduced to 25% with hesperidin and only 15% with Niosomal hesperidin. In Niosomal hesperidin consumed group hepatic parenchyma with hepatocytes and sinusoids (‘lobular’ region), which were interspersed with central venules and portal tracts were in normal view in comparison to CPF group. Portal tracts that contain a portal vein, a branch of the hepatic artery, and a bile duct were visible followed Niosomal hesperidin gavage. The hepatic cell patterns and cell infiltration were in normal condition in comparison to CPF group while treatment with hesperidin could not significantly reduce liver inflammation, while niosomal hesperidin had significant anti-inflammatory effects on the liver tissue. In the liver tissue of CPF-treated mice stained with Masson trichrome, a lot of collagenous tissue and liver fibrosis was observed. Treatment with hesperidin and niosomal hesperidin significantly reduced the amount of collagen deposition and fibrosis in the liver. CPF deposition has been seen in follicles and influence on oocyte maturation. CPF lowered the rate of oocyte maturation while increasing the proportion of oocyte mortality. These findings showed that CPF interfered with oocyte nuclear maturation (Rahman et al. 2018b). In the ovaries of mice treated with CPF, inflammatory cells accumulated in the central part of the ovary, which caused follicles to undergo apoptosis due to insufficient blood supply. The amount of inflammation decreased significantly with both hesperidin and niosomal hesperidin treatments which this reduction was more in the niosomal hesperidin group. In the groups receiving hesperidin and niosomal hesperidin, the increase in the number of follicles of different stages was without significant difference, except for graphene follicles, where niosomal hesperidin was more ameliorating. In the groups receiving hesperidin and niosomal hesperidin, the increase in the number of follicles of different stages was without significant differences, except for Graafian follicles, in which niosomal hesperidin was more ameliorating. The main difference between hesperidin and niosomal hesperidin was that hesperidin could not significantly reduce atretic follicles. In contrast, niosomal hesperidin reduced the number of these types of follicles, but there was no significant difference between them. There are two macrophage type (M1 and, alternatively, activated M2). M1 macrophages express the antigen CD68 , which shows high phagocytosis and cytotoxicity, while M2 macrophages express the antigen CD163 , which may be involved in tissue repair and reparative fibrosis. In this study, Chlorpyrifos poison significantly increased the expression of CD163 and CD68 genes , and hesperidin and niosomal hesperidin significantly decreased the expression of these genes, and there was no difference between them. Conclussion In this study, hesperidin, an antioxidant and anti-inflammatory agent, and niosomal hesperidin effect on CPF induced toxicity effects were studied for the first time. The obtained results from this study showed that niosomal hesperidin can have significant antioxidant effects in mice treated with chlorpyrifos by effects on the polarization of M1-M2 liver macrophages and the amount of secretion of inflammatory cells in the brain, liver and ovarian tissue. Therefore niosomal hesperidin could be used as a novel agent in the treatment of organs injury due to CPF toxic effects. Declarations Acknowledgment The authors would like to acknowledge the contributions of the Pasteur Institute of Iran research team and Islamic Azad University, Tehran, Iran. Ethics approval All mice were treated according to guidelines for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978) and kept under ethical considerations of the Institutional Animal Care and Use Committee (Ethical code: IR.IAU.SRB.REC.1401.113). Competing interests Competing interests The authors declare no known competing financial interests or personal relationships. Authors' contributions Mahsa Shrifnia : Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Data curation, Writing - original draft, Writing - review & editing. Zohre Eftekhari : Conceptualization, Methodology, Resources, Writing - review & editing, Supervision. Pejman Mortazavi : Conceptualization, Methodology, Formal analysis, Resources, Data curation, Writing - review & editing, Supervision, Project administration Funding No funding. Availability of data and materials Not applicable. References Abdollahi, Hamed, Mohammad Amin Edalatmanesh, Seyed Ebrahim Hosseini, and Mohsen Forouzanfar. 2021. ‘The Influence of Hesperidin on Memory, Learning and Oxidative Stress Parameters in Rat Model of Utreoplacental Insufficiency’. KAUMS Journal (FEYZ) 25(1): 704–13. Aboubakr, Mohamed et al. 2021a. ‘Antioxidant and Anti-Inflammatory Potential of Thymoquinone and Lycopene Mitigate the Chlorpyrifos-Induced Toxic Neuropathy’. Pharmaceuticals 14(9): 940. ———. 2021b. ‘Antioxidant and Anti-Inflammatory Potential of Thymoquinone and Lycopene Mitigate the Chlorpyrifos-Induced Toxic Neuropathy’. Pharmaceuticals 14(9): 940. Akpa, Amaka Rosita, Joseph Olusegun Ayo, Hudu Garba Mika’il, and Friday Ocheja Zakari. 2021. ‘Protective Effect of Fisetin against Subchronic Chlorpyrifos-Induced Toxicity on Oxidative Stress Biomarkers and Neurobehavioral Parameters in Adult Male Albino Mice’. Toxicological research 37(2): 163–71. Camkurt, Mehmet Akif et al. 2017a. ‘Evaluation of Malondialdehyde, Superoxide Dismutase and Catalase Activity in Fetal Cord Blood of Depressed Mothers’. Clinical Psychopharmacology and Neuroscience 15(1): 35. ———. 2017b. ‘Evaluation of Malondialdehyde, Superoxide Dismutase and Catalase Activity in Fetal Cord Blood of Depressed Mothers’. Clinical Psychopharmacology and Neuroscience 15(1): 35. Celik, Emrah et al. 2016. ‘Protective Effects of Hesperidin in Experimental Testicular Ischemia/Reperfusion Injury in Rats’. Archives of Medical Science 12(5): 928–34. Dabbagh Moghaddam, Farnaz et al. 2021. ‘Delivery of Melittin-Loaded Niosomes for Breast Cancer Treatment: An in Vitro and in Vivo Evaluation of Anti-Cancer Effect’. Cancer Nanotechnology 12(1): 1–35. Deka Dey, Asmita et al. ‘MiRNA‐encapsulated Abiotic Materials and Biovectors for Cutaneous and Oral Wound Healing: Biogenesis, Mechanisms, and Delivery Nanocarriers’. Bioengineering & Translational Medicine : e10343. Essa, Sara S et al. 2019. ‘Nanoparticles of Zinc Oxide Defeat Chlorpyrifos-Induced Immunotoxic Effects and Histopathological Alterations’. Veterinary World 12(3): 440. Gheibi, Parisa, Zohre Eftekhari, Delaram Doroud, and Kazem Parivar. 2020. ‘Chlorpyrifos Effects on Integrin Alpha v and Beta 3 in Implantation Window Phase’. Environmental Science and Pollution Research 27: 29530–38. Imperatrice, Maria, Iris Cuijpers, Freddy J Troost, and Mireille MJPE Sthijns. 2022. ‘Hesperidin Functions as an Ergogenic Aid by Increasing Endothelial Function and Decreasing Exercise-Induced Oxidative Stress and Inflammation, Thereby Contributing to Improved Exercise Performance’. Nutrients 14(14): 2955. Kim, Jeongtae et al. 2019a. ‘Benefits of Hesperidin in Central Nervous System Disorders: A Review’. Anatomy & cell biology 52(4): 369–77. ———. 2019b. ‘Benefits of Hesperidin in Central Nervous System Disorders: A Review’. Anatomy & cell biology 52(4): 369–77. Küçükler, Sefa et al. 2021a. ‘Hesperidin Protects against the Chlorpyrifos‐induced Chronic Hepato‐renal Toxicity in Rats Associated with Oxidative Stress, Inflammation, Apoptosis, Autophagy, and Up‐regulation of PARP‐1/VEGF’. Environmental Toxicology 36(8): 1600–1617. ———. 2021b. ‘Hesperidin Protects against the Chlorpyrifos‐induced Chronic Hepato‐renal Toxicity in Rats Associated with Oxidative Stress, Inflammation, Apoptosis, Autophagy, and Up‐regulation of PARP‐1/VEGF’. Environmental Toxicology 36(8): 1600–1617. Li-Li, FENG et al. 2019a. ‘5, 7, 2’, 4’, 5’-Pentamethoxyflavanone Regulates M1/M2 Macrophage Phenotype and Protects the Septic Mice’. Chinese journal of natural medicines 17(5): 363–71. ———. 2019b. ‘5, 7, 2’, 4’, 5’-Pentamethoxyflavanone Regulates M1/M2 Macrophage Phenotype and Protects the Septic Mice’. Chinese journal of natural medicines 17(5): 363–71. Ma, Ping et al. 2013a. ‘Oxidative Damage Induced by Chlorpyrifos in the Hepatic and Renal Tissue of Kunming Mice and the Antioxidant Role of Vitamin E’. Food and chemical toxicology 58: 177–83. ———. 2013b. ‘Oxidative Damage Induced by Chlorpyrifos in the Hepatic and Renal Tissue of Kunming Mice and the Antioxidant Role of Vitamin E’. Food and chemical toxicology 58: 177–83. Mdeni, Nonkululeko Landy, Abiodun Olagoke Adeniji, Anthony Ifeanyi Okoh, and Omobola Oluranti Okoh. 2022a. ‘Analytical Evaluation of Carbamate and Organophosphate Pesticides in Human and Environmental Matrices: A Review’. Molecules 27(3): 618. ———. 2022b. ‘Analytical Evaluation of Carbamate and Organophosphate Pesticides in Human and Environmental Matrices: A Review’. Molecules 27(3): 618. Moammeri, Ali et al. 2022a. ‘PH-Responsive, Adorned Nanoniosomes for Codelivery of Cisplatin and Epirubicin: Synergistic Treatment of Breast Cancer’. ACS applied bio materials 5(2): 675–90. ———. 2022b. ‘PH-Responsive, Adorned Nanoniosomes for Codelivery of Cisplatin and Epirubicin: Synergistic Treatment of Breast Cancer’. ACS applied bio materials 5(2): 675–90. Moghaddam, Dabbagh et al. 2020. ‘Evaluation of the Effect of Melittin on Liver and Renal Biochemical Markers and KI67 Expression in Mice with Experimentally-Induced Breast Cancer’. Journal of Comparative Pathobiology 17(1): 3045–58. Moghaddam, Farnaz Dabbagh, Somayeh Hamedi, and Mehrouz Dezfulian. 2016. ‘Anti-Tumor Effect of C-Phycocyanin from Anabaena Sp. ISC55 in Inbred BALB/c Mice Injected with 4T1 Breast Cancer Cell’. Comparative Clinical Pathology 25(5): 947–52. Nielsen, Inge Lise F et al. 2006. ‘Bioavailability Is Improved by Enzymatic Modification of the Citrus Flavonoid Hesperidin in Humans: A Randomized, Double-Blind, Crossover Trial’. The Journal of nutrition 136(2): 404–8. Nikbin, Sina et al. 2020. ‘Investigating the Protective Effect of Aerobic Exercise on Oxidative Stress and Histological Damages of Testicular Tissue Associated with Chlorpyrifos in Male Rats’. Andrologia 52(2): e13468. Patra, Jayanta Kumar et al. 2018a. ‘Apoptotic Effects of Melittin on 4T1 Breast Cancer Cell Line Is Associated with up Regulation of Mfn1’. Journal of nanobiotechnology 16(1): 1–33. ———. 2018b. ‘Nano Based Drug Delivery Systems: Recent Developments and Future Prospects’. Journal of nanobiotechnology 16(1): 1–33. ———. 2018c. ‘Nano Based Drug Delivery Systems: Recent Developments and Future Prospects’. Journal of nanobiotechnology 16(1): 1–33. Pyrzynska, Krystyna. 2022. ‘Hesperidin: A Review on Extraction Methods, Stability and Biological Activities’. Nutrients 14(12): 2387. Rahman, Nahid et al. 2018a. ‘M1/M2-Macrophage Polarization-Based Hepatotoxicity in d-Galactosamine-Induced Acute Liver Injury in Rats’. Toxicologic pathology 46(7): 764–76. ———. 2018b. ‘M1/M2-Macrophage Polarization-Based Hepatotoxicity in d-Galactosamine-Induced Acute Liver Injury in Rats’. Toxicologic pathology 46(7): 764–76. Saqib, Uzma et al. 2018a. ‘Phytochemicals as Modulators of M1-M2 Macrophages in Inflammation’. Oncotarget 9(25): 17937. ———. 2018b. ‘Phytochemicals as Modulators of M1-M2 Macrophages in Inflammation’. Oncotarget 9(25): 17937. Saunders, Margaret et al. 2012a. ‘Chlorpyrifos and Neurodevelopmental Effects: A Literature Review and Expert Elicitation on Research and Policy’. Environmental Health 11(1): 1–11. ———. 2012b. ‘Chlorpyrifos and Neurodevelopmental Effects: A Literature Review and Expert Elicitation on Research and Policy’. Environmental Health 11(1): 1–11. Siddiqui, Anees A, Farah Iram, Seemi Siddiqui, and Kapendra Sahu. 2014. ‘Role of Natural Products in Drug Discovery Process’. International journal of drug development and research 6(2): 0. Tanvir, E M et al. 2015. ‘Honey Has a Protective Effect against Chlorpyrifos-Induced Toxicity on Lipid Peroxidation, Diagnostic Markers and Hepatic Histoarchitecture’. European Journal of Integrative Medicine 7(5): 525–33. ur Rahman, Hafiz Ubaid et al. 2021. ‘A Comprehensive Review on Chlorpyrifos Toxicity with Special Reference to Endocrine Disruption: Evidence of Mechanisms, Exposures and Mitigation Strategies’. Science of The Total Environment 755: 142649. Wang, Cheng et al. 2021. ‘Macrophage Polarization and Its Role in Liver Disease’. Frontiers in Immunology : 5381. Wdowiak, Kamil et al. 2022a. ‘Bioavailability of Hesperidin and Its Aglycone Hesperetin—Compounds Found in Citrus Fruits as a Parameter Conditioning the Pro-Health Potential (Neuroprotective and Antidiabetic Activity)—Mini-Review’. Nutrients 14(13): 2647. ———. 2022b. ‘Bioavailability of Hesperidin and Its Aglycone Hesperetin—Compounds Found in Citrus Fruits as a Parameter Conditioning the Pro-Health Potential (Neuroprotective and Antidiabetic Activity)—Mini-Review’. Nutrients 14(13): 2647. Yang, Wenchang et al. 2022. ‘Maresin 1 Protects against Lipopolysaccharide/d-Galactosamine-Induced Acute Liver Injury by Inhibiting Macrophage Pyroptosis and Inflammatory Response’. Biochemical Pharmacology 195: 114863. Zhang, Yecui et al. 2021. ‘Effects of Chlorpyrifos Exposure on Liver Inflammation and Intestinal Flora Structure in Mice’. Toxicology Research 10(1): 141–49. Zhao, Yue et al. 2020. ‘Walnut Polyphenol Extract Protects against Malathion-and Chlorpyrifos-Induced Immunotoxicity by Modulating TLRx-NOX-ROS’. Nutrients 12(3): 616. Additional Declarations No competing interests reported. Supplementary Files GAPARIA.pptx Highlights.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3123664","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":215087889,"identity":"8c16665f-d997-4608-86b5-1c2901872082","order_by":0,"name":"Mahsa Sharifnia","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mahsa","middleName":"","lastName":"Sharifnia","suffix":""},{"id":215087890,"identity":"2b1cbb56-c769-4057-bc4c-16a7587b4d03","order_by":1,"name":"Zohre Eftekhari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIie3RMUvEMBTA8RcCccmR9R0W7ivU6RbhvsoFIS6nHNxSsJQnhbqIc0XQr6DfoKXQKTgLt7SLk8OJIC4eFnSoYIpuDvltCfx54QXA8/6pDcB8DsBOm/6tHChYXnwmadid8C8JCOwnThPiZbqJzLG6qrKTZZwkCo8aeIshmJJjBAlNhV2s8F5n67yucJwfhuy8BhkUPycc5LQps0iTZdlaigLDBwMwIpCuJwpQz1RuI33TJSu5TXDWJex9IJEgGZW00LddwkcZxxAN8KEpCGKPbG30nWXp7uVFNc7tI1RBjc6k21hLUXygr+1O+7J8TZQ6M6x9ivdnznVPmv4uvhS/+Z/vied5ntf3AROoVeBMO2tsAAAAAElFTkSuQmCC","orcid":"","institution":"Pasteur Institute of Iran","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Zohre","middleName":"","lastName":"Eftekhari","suffix":""},{"id":215087891,"identity":"e45e0b88-0de5-46d1-94c1-577dd90bd695","order_by":2,"name":"Pejman Mortazavi","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pejman","middleName":"","lastName":"Mortazavi","suffix":""}],"badges":[],"createdAt":"2023-06-29 08:29:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3123664/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3123664/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":39696617,"identity":"71640d92-dd85-4380-8001-e0608ad76069","added_by":"auto","created_at":"2023-07-07 13:40:28","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":274156,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of particle size distribution of niosomal Hesperidin structure via dynamic light scattering test \u003cstrong\u003e(A)\u003c/strong\u003e; Nanoparticles specifications: Temperature: 25°C, Z-Avarage (r.nm): 230.4, Dispersion Medium Viscosity: 0.8872 cP, Conductivity: 0.212 mS/cm, Electrode Voltage: 151 V, Zeta Potential: -24.5mV . Morphological characterization of optimized niosomes by SEM \u003cstrong\u003e(B)\u003c/strong\u003e; and Cumulative release of Nanoparticle \u003cstrong\u003e(C)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/cde29be4b82bd95412155f30.jpeg"},{"id":39695295,"identity":"4727dfad-4bdd-4147-ba0d-896d9b812b9d","added_by":"auto","created_at":"2023-07-07 13:32:28","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":122622,"visible":true,"origin":"","legend":"\u003cp\u003eMalondialdehyde (MDA) concentration \u003cstrong\u003e(A)\u003c/strong\u003e and superoxide dismutase (SOD) activity \u003cstrong\u003e(B)\u003c/strong\u003ein CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups. Data are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/2951bebc0cf68ab97bc0046b.jpeg"},{"id":39695296,"identity":"831c9356-0252-401f-a786-997f9af5d6c9","added_by":"auto","created_at":"2023-07-07 13:32:28","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":578971,"visible":true,"origin":"","legend":"\u003cp\u003eLight microscopy images of brain tissues, cresyl violet staining of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp study groups \u003cstrong\u003e(A)\u003c/strong\u003e. The number of dark cells of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups \u003cstrong\u003e(B)\u003c/strong\u003e. Data are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***). Scale bars represent 200, 100, and 20 µm.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/1857b22207743b71706db7e4.jpeg"},{"id":39695299,"identity":"1fadfb44-68e0-4f4a-9bb0-ae00a9b2505c","added_by":"auto","created_at":"2023-07-07 13:32:28","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":746370,"visible":true,"origin":"","legend":"\u003cp\u003eLight microscopy images of brain tissues, hematoxylin, and eosinstaining of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp study groups \u003cstrong\u003e(A)\u003c/strong\u003e. The inflammation score \u003cstrong\u003e(B)\u003c/strong\u003e and neural cell population rate \u003cstrong\u003e(C)\u003c/strong\u003e of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups. Data are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***). Scale bars represent 200, 100, and 20 µm.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/14952cfdf718cbd748816365.jpeg"},{"id":39698409,"identity":"28ca7b79-7456-4d9b-a439-98ca018437f8","added_by":"auto","created_at":"2023-07-07 13:48:28","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":862672,"visible":true,"origin":"","legend":"\u003cp\u003eLight microscopy images of liver tissues, hematoxylin and eosinstaining of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp study groups \u003cstrong\u003e(A)\u003c/strong\u003e. The inflammation score of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups \u003cstrong\u003e(B)\u003c/strong\u003e. Data are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***). Scale bars represent 200, 100, and 20 µm.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/c2bfbae409cc66115a2da6ca.jpeg"},{"id":39695301,"identity":"c3342a24-7d24-4fbf-9f00-5ac707efbd74","added_by":"auto","created_at":"2023-07-07 13:32:28","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":808134,"visible":true,"origin":"","legend":"\u003cp\u003eLight microscopy images of liver tissues, Masson's trichrome staining of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp study groups \u003cstrong\u003e(A)\u003c/strong\u003e. The collagen deposition rate of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups \u003cstrong\u003e(B)\u003c/strong\u003e. Data are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***). Scale bars represent 200, 100, and 20 µm.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/82ad1fffc4563ddc10d6e160.jpeg"},{"id":39695304,"identity":"ff062f7b-42c4-4d08-8760-d8f79bc3bc8b","added_by":"auto","created_at":"2023-07-07 13:32:28","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":550902,"visible":true,"origin":"","legend":"\u003cp\u003eLight microscopy images of ovarian tissues, hematoxylin, and eosin staining of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp study groups (\u003cstrong\u003eA\u003c/strong\u003e). The number of Graafian follicles (\u003cstrong\u003eB\u003c/strong\u003e), corpus luteum (\u003cstrong\u003eC\u003c/strong\u003e), the number of preantral follicles (\u003cstrong\u003eD\u003c/strong\u003e), and the number of the primary follicle (\u003cstrong\u003eE\u003c/strong\u003e) of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups.\u003cstrong\u003e \u003c/strong\u003eData are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***). Scale bars represent 200, 100, and 20 µm.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/851315c898f113f59cf80fd4.jpeg"},{"id":39696618,"identity":"e4065395-f631-4ef0-8ebb-524fc651e058","added_by":"auto","created_at":"2023-07-07 13:40:28","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":472461,"visible":true,"origin":"","legend":"\u003cp\u003eLight microscopy images of ovarian tissues, trichrome staining of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp study groups (\u003cstrong\u003eA\u003c/strong\u003e). The number of the atretic follicle of CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups (\u003cstrong\u003eB\u003c/strong\u003e).\u003cstrong\u003e \u003c/strong\u003eData are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***). Scale bars represent 200, 100, and 20 µm.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/c4047a2e707cd30cf1ad2b99.jpeg"},{"id":39696619,"identity":"9fe54917-5253-4df0-906c-6558bb5033e2","added_by":"auto","created_at":"2023-07-07 13:40:28","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":145926,"visible":true,"origin":"","legend":"\u003cp\u003eThe \u003cem\u003eCD163\u003c/em\u003e (\u003cstrong\u003eA\u003c/strong\u003e) and \u003cem\u003eCD68\u003c/em\u003e (\u003cstrong\u003eB\u003c/strong\u003e) liver macrophage gene expression gene levels in the CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups. Data are shown as mean ± SD (\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05 *; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 **; \u003cem\u003ep\u0026lt;\u003c/em\u003e0.001 ***).\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/df05265d7d904439b057261f.jpeg"},{"id":41852046,"identity":"1bb86035-c08e-44f5-aabb-d3e19c70a078","added_by":"auto","created_at":"2023-08-21 07:52:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1952988,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/1f90c9a2-7cdb-4e68-a1d3-2ff864c0ab25.pdf"},{"id":39695305,"identity":"7d49f412-6204-4cd8-8f36-b3c66c3560ed","added_by":"auto","created_at":"2023-07-07 13:32:29","extension":"pptx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2761235,"visible":true,"origin":"","legend":"","description":"","filename":"GAPARIA.pptx","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/9933b5f529e0f059c09ae922.pptx"},{"id":39695298,"identity":"b57dae28-8d3c-4afa-b075-9ebae94f021c","added_by":"auto","created_at":"2023-07-07 13:32:28","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":14071,"visible":true,"origin":"","legend":"","description":"","filename":"Highlights.docx","url":"https://assets-eu.researchsquare.com/files/rs-3123664/v1/56b410e905db7ef18ad4993d.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Niosomal Hesperidin Attenuates the M1/M2-Macrophage Polarization-Based Hepatotoxicity Followed Chlorpyrifos -Induced Toxicities","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe existence of high productivity in the agricultural industry can be attributed to the use of pesticides but their disadvantages to the environment and the health of non-target organisms cannot be ignored (Mdeni et al. 2022a). Pesticides are a most important class of organic compounds that resistance to biodegradation and lead to chronic and permanent health and biological problems (Mdeni et al. 2022b).\u003c/p\u003e \u003cp\u003eChlorpyrifos (CPF) is a known insecticide in agricultural and non-agricultural fields (Essa et al. 2019). This poison has the formula O, O-diethyl-O-(3,5,6-trichloro-2-pyridinyl)-phosphorothioate and the chemical formula C9H11Cl3NO2PS, which has low solubility in water but is soluble in oil, benzene, dimethyl sulfoxide, alcohol, and acetone dissolve (ur Rahman et al. 2021). Poisoning with this toxin is happened not only through the fruits and vegetables consumptions that are consumed as part of the normal diet but also through water, milk, and derived products (Saunders et al. 2012a).\u003c/p\u003e \u003cp\u003eSince most organophosphates have lipophilic properties, they can easily absorbed by human and animal bodies through the skin and accumulate in animal borgans and milk (Zhang et al. 2021). The placenta cannot act as a barrier for lipophilic OPs, so the fetus is contaminated with toxin (Saunders et al. 2012b). Also it can easily cross the blood-brain barrier, due to this lipophilicity, so the nervous system is the first target of this poison. CPF disrupts neurotransmission and causes neurological disorders (Aboubakr et al. 2021a). Also, due to its lipophilic properties, this toxin binds with the phospholipid membrane of cells in various organs and causes the peroxidation of fats (Tanvir et al. 2015). Chlorpyrifos poison causes excessive production of active oxygen metabolites, which is one of the mechanisms of damage of this poison in recent studies (Aboubakr et al. 2021b; Akpa et al. 2021).\u003c/p\u003e \u003cp\u003eNatural products show notable features such as unusual chemical variety, chemical and biological possessions with low toxicity. These properties make natural products the pioneers in discovering new drugs (Siddiqui et al. 2014). However, natural compounds are nowadays used to treat numerous main diseases, such as cancer, diabetes, cardiovascular, and infectious diseases (Dabbagh Moghaddam et al. 2021; Deka Dey et al. n.d.; D. Moghaddam et al. 2020; F. D. Moghaddam, Hamedi, and Dezfulian 2016; Patra et al. 2018b, 2018a). So natural medicines have unique benefits such as less toxicity and side effects, low price, and capable therapeutic agents (Patra et al. 2018c). However, concerns related to the biocompatibility and toxicity of natural compounds pose a more significant challenge to use as drugs. So, numerous natural compounds do not successfully authorize in clinical trials due to these problems (Patra et al. 2018c).\u003c/p\u003e \u003cp\u003eMalondialdehyde (MDA)as an oxidative stress marker and superoxide dismutase (SOD) as an antioxidant enzyme was known (Camkurt et al. 2017a). The function of SOD is important in controlling the levels of ROS and anion radicals (Camkurt et al. 2017b).\u003c/p\u003e \u003cp\u003eEdible polyphenols have a protective role against many toxins due to their antioxidant properties (Zhao et al. 2020). Hesperidin (C28H34O15), belongs to the group of flavonoid, is one of these polyphenol substances with antioxidant properties, often found in citrus fruits (Imperatrice et al. 2022). Hesperidin and its derivatives are in the citrus family, such as oranges, grapefruits, tangerines, limes, and lemons. After oral intake, hesperidin is hydrolyzed by intestinal microbial mainly in the large intestine and in the small intestine to form aglycone and then altered to glucuronide in the large intestine. They are later catabolized and produce phenolic acids and their corresponding metabolites (Pyrzynska 2022).\u003c/p\u003e \u003cp\u003eHesperidin ameliorates the neurodegenerative symptoms of Alzheimer's, Parkinson's, Huntington's, depression, Multiple sclerosis, brain ischemia-reperfusion injury, and traumatic injury in central nervous system (CNS) in animal models (Kim et al. 2019a). However, the bioavailability of these compounds is limited due to their low solubility, and this property limits their use as health agents (Wdowiak et al. 2022a). Therefore, ensuring the bioavailability of hesperidin is essential to exploit its beneficial properties entirely (Nielsen et al. 2006).\u003c/p\u003e \u003cp\u003eDiffrent approaches, such as micronization and encapsulation of hesperidin, have been suggested to increase its bioavailability, stability, and organized releasing, especially for drug production. One of the encouraging drug carriers are Niosomes that have a bilayer assembly and are designed by self-association of nonionic surfactants and cholesterol in an aqueous phase. They have extended shelf life, display high stability, and enable the delivery of drug to the target location, so the potential of niosomes has been widely studied (Dabbagh Moghaddam et al. 2021; Moammeri et al. 2022a).\u003c/p\u003e \u003cp\u003eThe use of pesticides has helped to increase the quality of products to a great extent. Still, on the other hand, it has unknown effects on the health of vital organs, so scientists are interested in investigating and evaluating these effects. Therefore, in the present study, nanoliposomes were designed for the delivery of hesperidin to evaluate the ameliorative role and its effect against oxidative stress, lipid peroxidation, and tissue lesions in the mice received CPF.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eCPF (Cat No: 45395-100 mg, Sigma Aldrich, Darmstadt, Germany), DMSO (Cat No: D2650( Sigma Aldrich, Darmstadt, Germany), KOH (Sigma Aldrich, Darmstadt, Germany), Ketamine (Alfasan, Woerden, Netherlands), Xylazine (Alfasan, Woerden, Netherlands), Chloroform ( Sigma Aldrich, Darmstadt, Germany), Methanol (Sigma Aldrich, Darmstadt, Germany ), Ethanol (Sigma Aldrich, Darmstadt, Germany), MDA (ZellBio GmbH assay kit, Germany ), SOD( ZellBio GmbH assay kit, Germany), PBS(Sigma Aldrich, Darmstadt, Germany), Qiagen (Hilden, Germany) QIAzol reagent (Qiagen, Hilden, Germany), cDNA synthesis Kit (Qiagen, Hilden, Germany), SYBER Green (RealQ Plus 2x Master Mix Green \u0026ndash; Amplicon, Odense, Denmark), ABI Step One (Applied Biosystems, StepOne\u0026trade;, Foster, USA), RNA extraction kit (CinnaGen, Tehran, Iran), Phosphoserine acid solution ( Sigma Aldrich, Darmstadt, Germany), Phosphomolybdic acid ( Sigma Aldrich, Darmstadt, Germany), Xylene 1 and 2 (Sigma Aldrich, Darmstadt, Germany), Cresyl violet acetate (Sigma Aldrich, Darmstadt, Germany), Bouin's solution (Sigma Aldrich, Darmstadt, Germany), Glacial acetic acid (Sigma Aldrich, Darmstadt, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eHesperidin Extraction and Compounds Analysis\u003c/h2\u003e \u003cp\u003eThe preparation of hesperidin extraction was carried out by maceration method. The dried orange rind was soaked in an alkaline solution (KOH 10%) for one night, and then the mixture was filtered through a Buchner funnel. Gas chromatography\u0026ndash;mass spectrometry (GC-MS) (Agilent Technologies; GC-MS System: 7890 A) was used to identify the components of the hesperidin extract (injection port temperature: 260 \u0026ordm;C; ion source temperature: 240 \u0026ordm;C; carrier gas: He 99.999%; and sample volume: 0.4 \u0026micro;L).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of Niosomal Formulation\u003c/h2\u003e \u003cp\u003eThe preparation of Hesperidin-loaded niosomes was carried out by thin-layer hydration method. Briefly, surfactant and cholesterol were dissolved in 20 mL of chloroform and methanol solution (2:1; v/v). The organic solvent was evaporated by rotary evaporator (250 rpm, 60\u0026deg;C, 30 min). Then, the dried agent were hydrated utilizing 10 mL Hesperidin solution (PBS, pH 7.4) at 60\u0026deg;C for 45 minutes, 150 rpm.\u003c/p\u003e \u003cp\u003eFinally, the gained sample was sonicated for 10 min (Hielscher up 50H ultrasonic processor, Germany) to obtain the uniform size distribution niosomal sample. The sample was stored in a refrigerator (4\u0026ndash;8\u0026deg;C) for further experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of Niosome\u003c/h2\u003e \u003cp\u003eThe characterization of the prepared niosome was done using a scanning electron microscope (SEM) and dynamic light scattering (DLS) measurements. The techniques provide information on the form, size, surface charge, and distribution of the prepared niosome.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDrugs Release Kinetic Study\u003c/h2\u003e \u003cp\u003eOne mL of niosome solution containing hesperidin, was dispensed into a dialysis bag and then placed in 50 mL PBS, located in a shaker incubator at 37\u0026deg;C and 100 rpm and sampling was performed every 10 hour until 50 hours. In each sampling, 500 \u0026micro;L of PBS was removed and exchanged with 500 \u0026micro;L of isothermal PBS. To evaluate the concentration of released hesperidin, the uptake of hesperidin at 285 nm was measured using spectroscopy. The cumulative release rate of the drug was determined in 48 hours with specified intervals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eExperimental Animals Study Design\u003c/h2\u003e \u003cp\u003eForthy female C57 mice (6\u0026ndash;8 weeks, 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2g) were obtained from the Pasteur Institute of Iran. The animals were housed under specific conditions based on guidelines : RoomTemperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C); Room light-dark cycles 14/10 h; Relative humidity 50\u0026ndash;55%. Mice had access to adequate water in polycarbonate bottles and were fed with commercial rodent pellets. After seven days, they were randomly divided into four categories (n\u0026thinsp;=\u0026thinsp;10 per group). All mice were treated according to guidelines for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978) and kept under ethical considerations of the Institutional Animal Care and Use Committee (Ethical code: IR.IAU.SRB.REC.1401.113).\u003c/p\u003e \u003cp\u003ePrescription of CPF, DMSO, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp was performed.\u003c/p\u003e \u003cp\u003eGroup 1: CPF (mice as a control group) received CPF; (3 mg/kg for 4 weeks ; Intraperitoneally) (Nikbin et al. 2020)\u003c/p\u003e \u003cp\u003eGroup 2: Sham (healthy mice as a control group) received DMSO; (40 mL/Kg for 4 weeks ; Intraperitoneally)\u003c/p\u003e \u003cp\u003eGroup 3: CPF (3 mg/kg for 4 weeks ; Intraperitoneally) after induction model Hesp (100 mg/kg ; for 30 days; Orally gavaged)\u003c/p\u003e \u003cp\u003eGroup 4: CPF(3 mg/kg for 4 weeks ; Intraperitoneally)\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp (100 mg/kg for 30 days; Orally gavaged) (Abdollahi et al. 2021)\u003c/p\u003e \u003cp\u003eThe appropriate doses of CPF and Hesp were obtained from previous studies (Kim et al. 2019b; Wdowiak et al. 2022b). At the end of the experimental period, mice were Euthenized in a CO\u003csub\u003e2\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;O\u003csub\u003e2\u003c/sub\u003e chamber. Blood samples were taken by cardiac puncture method, and the sera were seperated by centrifugation at 4000 rpm, 10 min (Hettich-Germany), and refrigerated at -20\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eOxidative Stress Assay\u003c/h2\u003e \u003cp\u003eThe blood clot was formed at room temperature and was centrifugated at 4000 rpm for 10 min. The supernatants were collected for MDA and SOD assessment. Lipid peroxidation results from oxidative stress, a marker of oxidative stress. The lipid peroxidation was determined by the ZellBio GmbH assay kit based on the reaction of MDA with thiobarbituric acid (TBA). The SOD activity was assayed with a ZellBio GmbH assay kit based on the colorimetric (420 nm) method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eReal-time Polymerase Chain Reaction (RT-PCR)\u003c/h2\u003e \u003cp\u003eReal-time PCR was performed to measure the mRNA transcript level of \u003cem\u003eCD163\u003c/em\u003e and \u003cem\u003eCD68\u003c/em\u003e in the liver tissue. The \u003cem\u003eCD163\u003c/em\u003e and \u003cem\u003eCD68\u003c/em\u003e gene expression level of the CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups were assessed. RNA was extracted from all samples by using QIAzol reagent according to Qiagen protocol. The RNA samples were treated with DNase I, then were reverse-transcribed into cDNA using fast cDNA synthesis, enabling sensitive real-time kit protocol and oligo (dT) primers. Each PCR reaction performed using the PCR master mix and SYBER Green, on ABI Step One, according to the manufacturer\u0026rsquo;s protocol. Forty cycles were considered for each Real-Time PCR and temperatures of each cycle were set at 94.00 ˚C for 30 secs, 58.00 ˚C for 30 secs, and 72.00 ˚C for 30 sec. Specific forward and reverse primer sequences were designed for the genes studied using NCBI as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in Real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward primer (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse primer (3'-5')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCD163\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCACACGGAGCCATCAAAATCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGACAAACCTTTTACAACCAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCD68\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCGGACCCACAACTGTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTGGACTAGGCGAGGGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGAACATCATCCCAGCCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTGGCAGGTTTCTCAAGACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eData were analyzed based on delta-delta CT from the device, and the normalization of data was done by GAPDH as a reference gene.The primers for \u003cem\u003eCD163, CD68\u003c/em\u003e, and \u003cem\u003eGAPDH\u003c/em\u003e (as housekeeping genes) were designed using a verified BLAST program in NCBI databases. Forward and reverse primer sequences for the aforementioned genes are listed in \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. The qRT-PCR was performed with the sense and antisense primers using a 7500 Real-time PCR System. The 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCT was calculated for the obtained data. A melting curve analysis was performed to evaluate the possibility of nonspecific amplification or primer-dimer formation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHistopathology of the Liver, Brain, and Ovary\u003c/h2\u003e \u003cp\u003eC57 mice were anesthetized with Ketamine 10% (100 mg/kg) and Xylazine 2% (10 mg/kg). 10% formalin was used to fix the tissue samples. After preparing the paraffin sections with a thickness of 4 micrometers, they were stained with hematoxylin and eosin, Masson's trichrome, and cresyl violet.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and Eosin Staining\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe brain, liver, and ovary slides were dewaxed in laboratory four machines for 20 min at 90\u0026deg;C. The specimens were dipped in each Xylene 1 and 2 for 15 min. The samples were hydrated in graded ethanol and distilled water and were stained based on the instruction. The neural cell population and inflammation score in mice brains were measured by this staining method.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMasson\u0026rsquo;s Trichrome Staining\u003c/h2\u003e \u003cp\u003eThe prepared slides were placed using descending degrees of alcohol, then in Bowen's solution for one hour in an autoclave (56 \u003csup\u003e0\u003c/sup\u003eC). Then rinsed with distilled water, Weigert's hematoxylin was poured onto the tissues. The slides were rinsed with running water for 10 minutes, and then filtered water and re-brushed for 10\u0026ndash;15 minutes in acid fuchsin was placed. After rinsing with distilled water, about 10\u0026ndash;15 minutes of phosphoserine acid solution and phosphomolybdic acid were poured on the slides and immersed in aniline blue solution for 20\u0026ndash;25 minutes. The samples were washed with distilled water and immersed in Acetic acid 1% for about 2\u0026ndash;5 minutes. In the end, the slides were washed with distilled water, and engaged in alcohol; then, the slide was glued.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCresyl Violet Staining\u003c/h2\u003e \u003cp\u003eAbout 0.6 g powder of Cresyl violet acetate was dissolved in 500 mL of distilled water and 1.25 mL glacial acetic acid. Then the sample located on magnetic stirrer at 60\u0026deg;C and solution filtered with Whitman paper and stored. Prepared slides were immersed in Xylene twofold (5 minutes), followed by immersions in ethanol 100% (5 minutes). Then slides were dipped in 95% ethanol and 70% ethanol once for 2 minutes before being placed in a container with distilled water for 2 minutes. Then the slides were immersed in cresyl violet staining solution (15 minutes) and washed with distilled water for 2 minutes. The previous steps were repeated in reverse: dropping in ethanol 70% for 2 minutes and ethanol 90% for 2 minutes, followed by two immersions in ethanol 100% for 5 minutes each. The final two immersions were in Xylene solution for 5 minutes each then the slides were coverslipped with permanent medium and left air-dried overnight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData were reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, and the graphs were plotted using Graph Pad Prism 5.04 software. Data were statistically analyzed using analysis of variances (ANOVA) followed by a post-Tukey test, and a p-value less than 0.05 was considered a significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGas Chromatography-mass Spectrometry Analysis\u003c/h2\u003e \u003cp\u003eA chromatography device connected to a gas mass spectrometer was used to identify the components of the hesperidin extract. The results was shown in Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The identified chemical composition of hesperidin extract is shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and represented 10 compounds. The compounds of hesperidin identified based on the peak area, and retention time. The active principles with their retention time (RT) and percentage of peak area (%) are expressed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGas chromatography-mass spectrometry analysis of Hesperidin extract compounds.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT (min)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eArea%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eComponent\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eQuality\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12.798\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2-Furancarboxaldehyde, 5-(hydroxymethyl)-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14.199\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2-Methoxy-4-vinylphenol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17.811\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN1-(4-hydroxybutyl)-N3-methylguanidine acetate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e26.118\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMethyl ester of 3-(3,5-di-tert-butyl-4-hydroxyphenyl)-propionic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e34.321\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOleic Acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e34.778\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDi-(2-ethylhexyl)phthalate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e35.867\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7-Amino-1,4-dimethylpyrimido[4,5-c]pyridazine-3,5-(1H,2H)-dione\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e38.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2,3-dimethyl-4-azaphenanthrene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e46.307\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGibberellin A3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e49.809\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclotrisiloxane, hexamethyl-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of Niosome\u003c/h2\u003e \u003cp\u003eAccording to the results reported by the SEM and DLS, the size of the niosomal nanocarrier containing the extract was determined to be 460 nm and the particle diameter range was 0.458 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Also, the image from the scanning electron microscopy can be seen below (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Figure shows the optimal niosomal formulation that confirms uniform morphology and a smooth surface. The release pattern of niosomal hesperidin was evaluated. The obtained results showed that during 48 hours, 100% of the drug was separated from the niosome, so in the first 12 hours, 60% of the loaded drug was separated from the nanosystem, and this process slowed down after that (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eOxidative Stress Assays\u003c/h2\u003e \u003cp\u003eFollowed injection the CPF, an enhancement in MDA level and decrease in SOD concentration were observed but the obtained results from oxidative stress analysis showed that the concentration of MDA in the Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups decreased statistically significant followed treatment (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In contrast, a significant increase was observed in the SOD activity level of the CPF\u0026thinsp;+\u0026thinsp;Hesp and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups compared to CPF (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05, and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001), respectively. Also, this increase was significant in the CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp group compared to the CPF\u0026thinsp;+\u0026thinsp;Hesp group (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eBrain Cresyl Violet Staining\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA shows cresyl violet-stained cross-sections of C57 mice's brain tissue in CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups. The number of dark brain cells was counted after cresyl violet staining. Followed CPF injection, the number of dark brain cells decreased. While, the number of dark cells in the CPF\u0026thinsp;+\u0026thinsp;Hesp and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups were increased in comparison to the CPF group ( \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01 and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001), perspectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eBrain Hematoxylin and Eosin Staining\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA shows the morphological analysis of cerebellum tissue using hematoxylin and eosin staining. The group exposed to CPF showed a significant increase in the inflammatory cells amount in the vicinity of cerebral cortex blood vessels. The inflammation score in the Sham and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups was lower than the CPF (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001 and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Also, the neural cell population in the CPF\u0026thinsp;+\u0026thinsp;Hesp and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups was significantly increased compared to the CPF group ( \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05 and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eLiver Hematoxylin and Eosin Staining\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA shows the liver Hematoxylin and Eosin staining of CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups. The sham group displayed standard hepatocyte structure, the percentage of liver cells without nuclei and with apoptotic appearance was about 5% in this group. On the other hand, the microscopic examination of the CPF-treated group showed that the percentage of vacuolated hepatocyte cells with an unclear nucleus and nuclear membrane were significantly increased compared to other studied groups. In the CPF group, dead cells were observed to be less pigmented than living cells due to the destruction of the liver tissue, and this amount of sample discoloration was around 50%. There was an accumulation of blood cells and lymphocytes in the spaces resulting from dead cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMoreover, there were congestion and hemorrhage in the hepatic sinusoids. However, the examination of the mice treated with niosomal hesperidin revealed that hepatic cells had a normal appearance. A central vein with normal morphology was observed in the space between the lobules, the liver triad, and between each lobule. Kupffer cells were located around sinusoidal vessels. A small number of liver cells were without nuclei and with an appearance similar to apoptotic cells. The percentage of this number of cells was around 15% of the total tissue. The observation of the regular hesperidin-treated group showed that the hepatic cells had a normal appearance, and Kupffer cells were observed around sinusoidal vessels. The percentages of cells without a nucleus were 25% compared to the whole tissue.\u003c/p\u003e \u003cp\u003eThe liver inflammation score in the CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups was significantly lower than the CPF group (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), respectively. While the group treated via CPF\u0026thinsp;+\u0026thinsp;Hesp did not show significant change compared to CPF (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003e\u003cb\u003eLiver Masson's Trichrome Staining\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA shows Masson's trichrome-stained cross-sections of C57 mice's liver tissue in CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups. Th toxic effect of CPF was evaluated by the collagen deposition in the liver. In the investigation of the collagen deposition rate of the control and treated groups, the results showed a statistical decrease in the CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups compared to the CPF group (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001). In the comparison between the of CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp, the collagen deposition rate in CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp was decreased (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eOvarian Hematoxylin and Eosin Staining\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e shows hematoxylin and eosin-stained cross-sections of C57 mice's ovarian tissue in CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups. Based on the histopathology results, In the CPF group, a large population of follicles underwent apoptosis due to increased inflammatory cells and insufficient blood supply. In addition, the accumulation of inflammatory cells was observed in the central part of the ovary, which was transferred to the tissue by the ovarian vessels. While in the sham group, a tiny population of these inflammatory cells was seen in the tissue, and the appearance of the tissue did not show any inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAn increase in the number of Graafian follicles was observed in the CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups compared to the CPF group, which were significant \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05 and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Also, in the examination of the number of corpus luteum in the studied groups, a statistically significant increase was observed in the CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups compared to CPF (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05, and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). On the other hand, the number of the preantral follicle (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD) and primary follicle (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE) also showed an increase in the CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups compared to CPF groups (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01, and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001), respectively\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eOvarian Trichrome Staining\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA shows the results of cross-sectional histopathology of the liver tissue of C57 mice treated via CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp. Figure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB shows the number of the atretic follicle of CPF, Sham, CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups. The comparison between these groups showed a statistically significant decrease in the number of the atretic follicle in the CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp compared to CPF (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eLiver Macrophage Gene Expression\u003c/h2\u003e \u003cp\u003eThe expression level of \u003cem\u003eCD163\u003c/em\u003e and \u003cem\u003eCD68\u003c/em\u003e genes can be seen in Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB. \u003cem\u003eCD163\u003c/em\u003e gene expression in CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp groups had a significant decrease compared to the CPF group (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01, and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001) respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). Also, this decrease in \u003cem\u003eCD68\u003c/em\u003e gene expression level was observed. In this way, the groups of CPF\u0026thinsp;+\u0026thinsp;Hesp, and CPF\u0026thinsp;+\u0026thinsp;Nio\u0026thinsp;+\u0026thinsp;Hesp compared to CPF showed a statistically significant decrease of (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05, and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, the effects of CPF on brain, liver, and ovary in female C57 mice were investigated IP injection of CPF (3 mg/kg) during 4 weeks showed adverse consequences on mice which the toxicity effect was evaluated by collagen deposition rate in the liver, inflammation score, neural cells and dark cells in the brain, and oxidative stress assay parameters. Based on previous investigations, the effect of CPF dose and period of exposure on liver fibrosis occurrence and collagen deposition rate were confirmed in rats and NMRI mice as an animal model (Gheibi et al. 2020).\u003c/p\u003e \u003cp\u003eNowadays, the use of plants as a valuable sources of natural antioxidants has received considerable attention. One of these components is hesperidin known as a natural antioxidant and has significant medicinal properties, such as anti-diabetic, anti-inflammatory, wound healing, liver, heart, and nervous sysytem protection (K\u0026uuml;\u0026ccedil;\u0026uuml;kler et al. 2021a).\u003c/p\u003e \u003cp\u003eOn the other hand, numerous studies show that delivery of drugs based on the niosomes will improve the therapeutic effects compared to natural based drugs (Dabbagh Moghaddam et al. 2021; Moammeri et al. 2022b). Niosomal drug delivery system are a helpful way to increase the body's access to the drugs with low water solubility, as well as reduce unwanted side effects. The therapeutic performance of the niosomal natural-based drug molecules can also be enhanced by delayed clearance from the blood circulation, protecting the drug from biological interactions, and controlling effects to objective cells (K\u0026uuml;\u0026ccedil;\u0026uuml;kler et al. 2021b). Therefore, in this study, we focused on the thraputic effect of Niosomal Hespeidin on M1-/M2-macrophage functions and the amount of inflammatory cell secretion in the brain, liver, and ovary tissues by regulating the antioxidant activity in mice CPF-induced hepatotoxicity. By pathological analyses, it was found that CPF-induced mice vital organs injury are very complicated.\u003c/p\u003e \u003cp\u003eCPF can enter the body through the respiratory and digestive systems, as well as the skin. The accumulation of CPF residues in the environment has been linked to severe adverse reactions in the animal and humans. CPF chronic toxicity stimulates many biological pathways by blocking sodium and calcium channels, including oxidative stress, inflammation, and apoptosis (Moammeri et al. 2022b). CPF is a cholinesterase inhibitor that causes oxidative stress and damages the body's proteins, DNA, and lipids (Ma et al. 2013a). Organophosphorus toxins cause an increase in the level of MDA, which is a marker of lipid peroxidation. MDA is a mutagenic and carcinogenic mammal substance that reacts with DNA bases. Measurement of SOD activity and MDA level are two potential indicators to show oxidative damage (Ma et al. 2013b).\u003c/p\u003e \u003cp\u003eCPF injection caused considerable decreases in the SOD activity in mice with CPF exposure. SOD, a natural defense against oxidative stress, degrade superoxide to hydrogen peroxide, which is then eliminated by glutathione peroxidase or catalase. As a result, SODs inhibit the generation of highly reactive ROS like peroxynitrite or hydroxyl radical (Rahman et al. 2018a; Wang et al. 2021). The present study also confirmed the increase of MDA and the decrease of SOD in the CPF group compared to the sham. Both hesperidin and Niosomal hesperidin decreased MDA levels and increased SOD activity. There was no difference between hesperidin and Niosomal hesperidin for the regulation of MDA, while the role of niosomal hesperidin in increasing SOD was more substantial.\u003c/p\u003e \u003cp\u003eOne of the innate immune response cells in contrast to foreign pathogens and injuries are Macrophages (Saqib et al. 2018a). These cells play a critical role in the inflammatory pathway in a range of diseases such as autoimmune disseases, myocarditis, atherosclerosis, sepsis, arthritis, and diabetes (Saqib et al. 2018b). Recently, since the discovery of two subtypes of macrophages, distinguished by their distinct phenotype and gene expression pattern, more studies have attentive on the inflammatory diseases of macrophages (Saqib et al. 2018b). Among these, M1 macrophages are pro-inflammatory and responsible for inflammatory signaling, while M2 are anti-inflammatory macrophages that participate in the inflammatory process responces; M2 macrophages produce anti-inflammatory cytokines and thus contribute to tissue healing (Saqib et al. 2018b).\u003c/p\u003e \u003cp\u003eFlavonoids extracted from cypress leaves have remarkable anti-inflammatory properties on RAW 264. Seven lipopolysaccharide-induced macrophages detected in mice, which can inhibit the secretion of IL-6, and TNF-α by inhibiting the expression of inflammation-related genes (Li-Li et al. 2019a). Feng et al. (2017) investigated the anti-inflammatory effects of 5, 7, 2', 4', and 5'-pentamethoxyflavanone, a type of flavonoid, in vivo and in vitro (Li-Li et al. 2019b). This flavonoid inhibited the expression of pro-inflammatory cytokines IL-1B, IL-6, TNFa, and iNOS, characteristic of M1 macrophage inhibition (Li-Li et al. 2019b). The decreased expression of CD11c, a marker of M1 macrophage levels, further confirmed these anti-inflammatory effects. On the other hand, this substance also increased M2 polarization by increasing anti-inflammatory factors and M2 macrophage surface markers, leading to the balance of M1 and M2 macrophages (Li-Li et al. 2019b). Both M1- and M2-macrophages cause development of hepatic lesions induced by d-galactosamine that indicating the importance of analysis of macrophage phenotypes for hepatotoxicity based on M1-/M2-polarization (Yang et al. 2022)(Rahman et al. 2018b).Commonly, in immunohistochemical or gene expression analyses, M1-macrophages are identified by the expression of CD68, whereas M2-macrophages by \u003cem\u003eCD163\u003c/em\u003e (Li-Li et al. 2019b). In this study, the expression levels of \u003cem\u003eCD68\u003c/em\u003e and \u003cem\u003eCD163\u003c/em\u003e genes, which are markers of M1 and M2 liver macrophages, respectively, were increased and significantly decreased with hesperidin and niosomal hesperidin compared to the group receiving poison. These findings showed that M1- and M2-macrophages contribute to the development of hepatic lesions induced by CPF. Treatment with either Hespridin (Hesp), or Niosomal Hespridin resulted in partial improvement of CPF-induced hepatotoxicity represented by significant reduction of \u003cem\u003eCD68\u003c/em\u003e and \u003cem\u003eCD163\u003c/em\u003e genes expression, significant reduction of the hepatic collagen deposition rate, and a significant decrease in sera MDA levels(Rahman et al. 2018b).\u003c/p\u003e \u003cp\u003eThe brain is most closely associated with the development of oxidative stress situations due to its high lipid content, low levels of antioxidant molecules, and increased oxygen consumption. So, exposure to toxins causes neuronal injury and behavioral disorders. Animals exposed to CPF showed marked pyknotic, degenerated, and wrinkled neurons. Severe inflammatory cell infiltration was also observed in the CPF group. A wide range of pharmacological targets, including nerve growth factors and enhanced endogenous antioxidant defenses that reduce neuroinflammatory and apoptotic signaling pathways, have been implicated in the neuroprotective potential of this flavonoid. Hesperidin can effectively protect neurons from damage caused by oxidative or nitrosation stress(Rahman et al. 2018b). In the observations made in this research, following the treatment of mice with CFP, infiltration of inflammatory cells was observed in their brains, and the number of neurons and dark cells was reduced. Treatment with niosomal reduced 50% of the inflammation in the brain, while in the hesperidin-received group, the rash was decreased by about 25%. There was a significant difference between hesperidin and niosomal hesperidin treatment for neuronal cell population recovery.\u003c/p\u003e \u003cp\u003eCPF toxin causes histopathological lesions in the liver, and several studies have mentioned that this change in the pathological structure of the liver is due to the excessive production of ROS. CPF-treated mice's livers showed significant vein congestion, localized hepatocyte necrosis, dissociation of hepatic cords, and infiltration of inflammatory cells. Hesperidin has a hepatoprotective role in many diseases. Hesperidin decreases the oxidative stress, MDA level, and liver tissue changes caused by consuming Ethanol in the liver, increasing the antioxidant capacity and anti-inflammation properties (Celik et al. 2016). In this study, followed CPF injection, death and lack of nuclei in 50 % of the cells wasobserved while this was reduced to 25% with hesperidin and only 15% with Niosomal hesperidin. In Niosomal hesperidin consumed group hepatic parenchyma with hepatocytes and sinusoids (\u0026lsquo;lobular\u0026rsquo; region), which were interspersed with central venules and portal tracts were in normal view in comparison to CPF group. Portal tracts that contain a portal vein, a branch of the hepatic artery, and a bile duct were visible followed Niosomal hesperidin gavage. The hepatic cell patterns and cell infiltration were in normal condition in comparison to CPF group while treatment with hesperidin could not significantly reduce liver inflammation, while niosomal hesperidin had significant anti-inflammatory effects on the liver tissue. In the liver tissue of CPF-treated mice stained with Masson trichrome, a lot of collagenous tissue and liver fibrosis was observed. Treatment with hesperidin and niosomal hesperidin significantly reduced the amount of collagen deposition and fibrosis in the liver.\u003c/p\u003e \u003cp\u003eCPF deposition has been seen in follicles and influence on oocyte maturation. CPF lowered the rate of oocyte maturation while increasing the proportion of oocyte mortality. These findings showed that CPF interfered with oocyte nuclear maturation (Rahman et al. 2018b). In the ovaries of mice treated with CPF, inflammatory cells accumulated in the central part of the ovary, which caused follicles to undergo apoptosis due to insufficient blood supply. The amount of inflammation decreased significantly with both hesperidin and niosomal hesperidin treatments which this reduction was more in the niosomal hesperidin group. In the groups receiving hesperidin and niosomal hesperidin, the increase in the number of follicles of different stages was without significant difference, except for graphene follicles, where niosomal hesperidin was more ameliorating. In the groups receiving hesperidin and niosomal hesperidin, the increase in the number of follicles of different stages was without significant differences, except for Graafian follicles, in which niosomal hesperidin was more ameliorating. The main difference between hesperidin and niosomal hesperidin was that hesperidin could not significantly reduce atretic follicles. In contrast, niosomal hesperidin reduced the number of these types of follicles, but there was no significant difference between them.\u003c/p\u003e \u003cp\u003eThere are two macrophage type (M1 and, alternatively, activated M2). M1 macrophages express the antigen \u003cem\u003eCD68\u003c/em\u003e, which shows high phagocytosis and cytotoxicity, while M2 macrophages express the antigen \u003cem\u003eCD163\u003c/em\u003e, which may be involved in tissue repair and reparative fibrosis. In this study, Chlorpyrifos poison significantly increased the expression of \u003cem\u003eCD163\u003c/em\u003e and \u003cem\u003eCD68 genes\u003c/em\u003e, and hesperidin and niosomal hesperidin significantly decreased the expression of these genes, and there was no difference between them.\u003c/p\u003e"},{"header":"Conclussion","content":"\u003cp\u003eIn this study, hesperidin, an antioxidant and anti-inflammatory agent, and niosomal hesperidin effect on CPF induced toxicity effects were studied for the first time. The obtained results from this study showed that niosomal hesperidin can have significant antioxidant effects in mice treated with chlorpyrifos by effects on the polarization of M1-M2 liver macrophages and the amount of secretion of inflammatory cells in the brain, liver and ovarian tissue. Therefore niosomal hesperidin could be used as a novel agent in the treatment of organs injury due to CPF toxic effects.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment \u003c/strong\u003eThe authors would like to acknowledge the contributions of the Pasteur Institute of Iran research team and Islamic Azad University, Tehran, Iran.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e All mice were treated according to guidelines for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978) and kept under ethical considerations of the Institutional Animal Care and Use Committee (Ethical code: IR.IAU.SRB.REC.1401.113).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u003c/strong\u003eThe authors declare no known competing financial interests or personal relationships.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMahsa Shrifnia\u003c/strong\u003e: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Data curation, Writing - original draft, Writing - review \u0026amp; editing. \u003cstrong\u003eZohre Eftekhari\u003c/strong\u003e: Conceptualization, Methodology, Resources, Writing - review \u0026amp; editing, Supervision. \u003cstrong\u003ePejman\u003c/strong\u003e \u003cstrong\u003eMortazavi\u003c/strong\u003e: Conceptualization, Methodology, Formal analysis, Resources, Data curation, Writing - review \u0026amp; editing, Supervision, Project administration\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003eNo funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials \u003c/strong\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdollahi, Hamed, Mohammad Amin Edalatmanesh, Seyed Ebrahim Hosseini, and Mohsen Forouzanfar. 2021. \u0026lsquo;The Influence of Hesperidin on Memory, Learning and Oxidative Stress Parameters in Rat Model of Utreoplacental Insufficiency\u0026rsquo;. \u003cem\u003eKAUMS Journal (FEYZ)\u003c/em\u003e 25(1): 704\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eAboubakr, Mohamed et al. 2021a. \u0026lsquo;Antioxidant and Anti-Inflammatory Potential of Thymoquinone and Lycopene Mitigate the Chlorpyrifos-Induced Toxic Neuropathy\u0026rsquo;. \u003cem\u003ePharmaceuticals\u003c/em\u003e 14(9): 940.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2021b. \u0026lsquo;Antioxidant and Anti-Inflammatory Potential of Thymoquinone and Lycopene Mitigate the Chlorpyrifos-Induced Toxic Neuropathy\u0026rsquo;. \u003cem\u003ePharmaceuticals\u003c/em\u003e 14(9): 940.\u003c/li\u003e\n\u003cli\u003eAkpa, Amaka Rosita, Joseph Olusegun Ayo, Hudu Garba Mika\u0026rsquo;il, and Friday Ocheja Zakari. 2021. \u0026lsquo;Protective Effect of Fisetin against Subchronic Chlorpyrifos-Induced Toxicity on Oxidative Stress Biomarkers and Neurobehavioral Parameters in Adult Male Albino Mice\u0026rsquo;. \u003cem\u003eToxicological research\u003c/em\u003e 37(2): 163\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003eCamkurt, Mehmet Akif et al. 2017a. \u0026lsquo;Evaluation of Malondialdehyde, Superoxide Dismutase and Catalase Activity in Fetal Cord Blood of Depressed Mothers\u0026rsquo;. \u003cem\u003eClinical Psychopharmacology and Neuroscience\u003c/em\u003e 15(1): 35.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2017b. \u0026lsquo;Evaluation of Malondialdehyde, Superoxide Dismutase and Catalase Activity in Fetal Cord Blood of Depressed Mothers\u0026rsquo;. \u003cem\u003eClinical Psychopharmacology and Neuroscience\u003c/em\u003e 15(1): 35.\u003c/li\u003e\n\u003cli\u003eCelik, Emrah et al. 2016. \u0026lsquo;Protective Effects of Hesperidin in Experimental Testicular Ischemia/Reperfusion Injury in Rats\u0026rsquo;. \u003cem\u003eArchives of Medical Science\u003c/em\u003e 12(5): 928\u0026ndash;34.\u003c/li\u003e\n\u003cli\u003eDabbagh Moghaddam, Farnaz et al. 2021. \u0026lsquo;Delivery of Melittin-Loaded Niosomes for Breast Cancer Treatment: An in Vitro and in Vivo Evaluation of Anti-Cancer Effect\u0026rsquo;. \u003cem\u003eCancer Nanotechnology\u003c/em\u003e 12(1): 1\u0026ndash;35.\u003c/li\u003e\n\u003cli\u003eDeka Dey, Asmita et al. \u0026lsquo;MiRNA‐encapsulated Abiotic Materials and Biovectors for Cutaneous and Oral Wound Healing: Biogenesis, Mechanisms, and Delivery Nanocarriers\u0026rsquo;. \u003cem\u003eBioengineering \u0026amp; Translational Medicine\u003c/em\u003e: e10343.\u003c/li\u003e\n\u003cli\u003eEssa, Sara S et al. 2019. \u0026lsquo;Nanoparticles of Zinc Oxide Defeat Chlorpyrifos-Induced Immunotoxic Effects and Histopathological Alterations\u0026rsquo;. \u003cem\u003eVeterinary World\u003c/em\u003e 12(3): 440.\u003c/li\u003e\n\u003cli\u003eGheibi, Parisa, Zohre Eftekhari, Delaram Doroud, and Kazem Parivar. 2020. \u0026lsquo;Chlorpyrifos Effects on Integrin Alpha v and Beta 3 in Implantation Window Phase\u0026rsquo;. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e 27: 29530\u0026ndash;38.\u003c/li\u003e\n\u003cli\u003eImperatrice, Maria, Iris Cuijpers, Freddy J Troost, and Mireille MJPE Sthijns. 2022. \u0026lsquo;Hesperidin Functions as an Ergogenic Aid by Increasing Endothelial Function and Decreasing Exercise-Induced Oxidative Stress and Inflammation, Thereby Contributing to Improved Exercise Performance\u0026rsquo;. \u003cem\u003eNutrients\u003c/em\u003e 14(14): 2955.\u003c/li\u003e\n\u003cli\u003eKim, Jeongtae et al. 2019a. \u0026lsquo;Benefits of Hesperidin in Central Nervous System Disorders: A Review\u0026rsquo;. \u003cem\u003eAnatomy \u0026amp; cell biology\u003c/em\u003e 52(4): 369\u0026ndash;77.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2019b. \u0026lsquo;Benefits of Hesperidin in Central Nervous System Disorders: A Review\u0026rsquo;. \u003cem\u003eAnatomy \u0026amp; cell biology\u003c/em\u003e 52(4): 369\u0026ndash;77.\u003c/li\u003e\n\u003cli\u003eK\u0026uuml;\u0026ccedil;\u0026uuml;kler, Sefa et al. 2021a. \u0026lsquo;Hesperidin Protects against the Chlorpyrifos‐induced Chronic Hepato‐renal Toxicity in Rats Associated with Oxidative Stress, Inflammation, Apoptosis, Autophagy, and Up‐regulation of PARP‐1/VEGF\u0026rsquo;. \u003cem\u003eEnvironmental Toxicology\u003c/em\u003e 36(8): 1600\u0026ndash;1617.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2021b. \u0026lsquo;Hesperidin Protects against the Chlorpyrifos‐induced Chronic Hepato‐renal Toxicity in Rats Associated with Oxidative Stress, Inflammation, Apoptosis, Autophagy, and Up‐regulation of PARP‐1/VEGF\u0026rsquo;. \u003cem\u003eEnvironmental Toxicology\u003c/em\u003e 36(8): 1600\u0026ndash;1617.\u003c/li\u003e\n\u003cli\u003eLi-Li, FENG et al. 2019a. \u0026lsquo;5, 7, 2\u0026rsquo;, 4\u0026rsquo;, 5\u0026rsquo;-Pentamethoxyflavanone Regulates M1/M2 Macrophage Phenotype and Protects the Septic Mice\u0026rsquo;. \u003cem\u003eChinese journal of natural medicines\u003c/em\u003e 17(5): 363\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2019b. \u0026lsquo;5, 7, 2\u0026rsquo;, 4\u0026rsquo;, 5\u0026rsquo;-Pentamethoxyflavanone Regulates M1/M2 Macrophage Phenotype and Protects the Septic Mice\u0026rsquo;. \u003cem\u003eChinese journal of natural medicines\u003c/em\u003e 17(5): 363\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003eMa, Ping et al. 2013a. \u0026lsquo;Oxidative Damage Induced by Chlorpyrifos in the Hepatic and Renal Tissue of Kunming Mice and the Antioxidant Role of Vitamin E\u0026rsquo;. \u003cem\u003eFood and chemical toxicology\u003c/em\u003e 58: 177\u0026ndash;83.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2013b. \u0026lsquo;Oxidative Damage Induced by Chlorpyrifos in the Hepatic and Renal Tissue of Kunming Mice and the Antioxidant Role of Vitamin E\u0026rsquo;. \u003cem\u003eFood and chemical toxicology\u003c/em\u003e 58: 177\u0026ndash;83.\u003c/li\u003e\n\u003cli\u003eMdeni, Nonkululeko Landy, Abiodun Olagoke Adeniji, Anthony Ifeanyi Okoh, and Omobola Oluranti Okoh. 2022a. \u0026lsquo;Analytical Evaluation of Carbamate and Organophosphate Pesticides in Human and Environmental Matrices: A Review\u0026rsquo;. \u003cem\u003eMolecules\u003c/em\u003e 27(3): 618.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2022b. \u0026lsquo;Analytical Evaluation of Carbamate and Organophosphate Pesticides in Human and Environmental Matrices: A Review\u0026rsquo;. \u003cem\u003eMolecules\u003c/em\u003e 27(3): 618.\u003c/li\u003e\n\u003cli\u003eMoammeri, Ali et al. 2022a. \u0026lsquo;PH-Responsive, Adorned Nanoniosomes for Codelivery of Cisplatin and Epirubicin: Synergistic Treatment of Breast Cancer\u0026rsquo;. \u003cem\u003eACS applied bio materials\u003c/em\u003e 5(2): 675\u0026ndash;90.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2022b. \u0026lsquo;PH-Responsive, Adorned Nanoniosomes for Codelivery of Cisplatin and Epirubicin: Synergistic Treatment of Breast Cancer\u0026rsquo;. \u003cem\u003eACS applied bio materials\u003c/em\u003e 5(2): 675\u0026ndash;90.\u003c/li\u003e\n\u003cli\u003eMoghaddam, Dabbagh et al. 2020. \u0026lsquo;Evaluation of the Effect of Melittin on Liver and Renal Biochemical Markers and KI67 Expression in Mice with Experimentally-Induced Breast Cancer\u0026rsquo;. \u003cem\u003eJournal of Comparative Pathobiology\u003c/em\u003e 17(1): 3045\u0026ndash;58.\u003c/li\u003e\n\u003cli\u003eMoghaddam, Farnaz Dabbagh, Somayeh Hamedi, and Mehrouz Dezfulian. 2016. \u0026lsquo;Anti-Tumor Effect of C-Phycocyanin from Anabaena Sp. ISC55 in Inbred BALB/c Mice Injected with 4T1 Breast Cancer Cell\u0026rsquo;. \u003cem\u003eComparative Clinical Pathology\u003c/em\u003e 25(5): 947\u0026ndash;52.\u003c/li\u003e\n\u003cli\u003eNielsen, Inge Lise F et al. 2006. \u0026lsquo;Bioavailability Is Improved by Enzymatic Modification of the Citrus Flavonoid Hesperidin in Humans: A Randomized, Double-Blind, Crossover Trial\u0026rsquo;. \u003cem\u003eThe Journal of nutrition\u003c/em\u003e 136(2): 404\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eNikbin, Sina et al. 2020. \u0026lsquo;Investigating the Protective Effect of Aerobic Exercise on Oxidative Stress and Histological Damages of Testicular Tissue Associated with Chlorpyrifos in Male Rats\u0026rsquo;. \u003cem\u003eAndrologia\u003c/em\u003e 52(2): e13468.\u003c/li\u003e\n\u003cli\u003ePatra, Jayanta Kumar et al. 2018a. \u0026lsquo;Apoptotic Effects of Melittin on 4T1 Breast Cancer Cell Line Is Associated with up Regulation of Mfn1\u0026rsquo;. \u003cem\u003eJournal of nanobiotechnology\u003c/em\u003e 16(1): 1\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2018b. \u0026lsquo;Nano Based Drug Delivery Systems: Recent Developments and Future Prospects\u0026rsquo;. \u003cem\u003eJournal of nanobiotechnology\u003c/em\u003e 16(1): 1\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2018c. \u0026lsquo;Nano Based Drug Delivery Systems: Recent Developments and Future Prospects\u0026rsquo;. \u003cem\u003eJournal of nanobiotechnology\u003c/em\u003e 16(1): 1\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003ePyrzynska, Krystyna. 2022. \u0026lsquo;Hesperidin: A Review on Extraction Methods, Stability and Biological Activities\u0026rsquo;. \u003cem\u003eNutrients\u003c/em\u003e 14(12): 2387.\u003c/li\u003e\n\u003cli\u003eRahman, Nahid et al. 2018a. \u0026lsquo;M1/M2-Macrophage Polarization-Based Hepatotoxicity in d-Galactosamine-Induced Acute Liver Injury in Rats\u0026rsquo;. \u003cem\u003eToxicologic pathology\u003c/em\u003e 46(7): 764\u0026ndash;76.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2018b. \u0026lsquo;M1/M2-Macrophage Polarization-Based Hepatotoxicity in d-Galactosamine-Induced Acute Liver Injury in Rats\u0026rsquo;. \u003cem\u003eToxicologic pathology\u003c/em\u003e 46(7): 764\u0026ndash;76.\u003c/li\u003e\n\u003cli\u003eSaqib, Uzma et al. 2018a. \u0026lsquo;Phytochemicals as Modulators of M1-M2 Macrophages in Inflammation\u0026rsquo;. \u003cem\u003eOncotarget\u003c/em\u003e 9(25): 17937.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2018b. \u0026lsquo;Phytochemicals as Modulators of M1-M2 Macrophages in Inflammation\u0026rsquo;. \u003cem\u003eOncotarget\u003c/em\u003e 9(25): 17937.\u003c/li\u003e\n\u003cli\u003eSaunders, Margaret et al. 2012a. \u0026lsquo;Chlorpyrifos and Neurodevelopmental Effects: A Literature Review and Expert Elicitation on Research and Policy\u0026rsquo;. \u003cem\u003eEnvironmental Health\u003c/em\u003e 11(1): 1\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2012b. \u0026lsquo;Chlorpyrifos and Neurodevelopmental Effects: A Literature Review and Expert Elicitation on Research and Policy\u0026rsquo;. \u003cem\u003eEnvironmental Health\u003c/em\u003e 11(1): 1\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eSiddiqui, Anees A, Farah Iram, Seemi Siddiqui, and Kapendra Sahu. 2014. \u0026lsquo;Role of Natural Products in Drug Discovery Process\u0026rsquo;. \u003cem\u003eInternational journal of drug development and research\u003c/em\u003e 6(2): 0.\u003c/li\u003e\n\u003cli\u003eTanvir, E M et al. 2015. \u0026lsquo;Honey Has a Protective Effect against Chlorpyrifos-Induced Toxicity on Lipid Peroxidation, Diagnostic Markers and Hepatic Histoarchitecture\u0026rsquo;. \u003cem\u003eEuropean Journal of Integrative Medicine\u003c/em\u003e 7(5): 525\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eur Rahman, Hafiz Ubaid et al. 2021. \u0026lsquo;A Comprehensive Review on Chlorpyrifos Toxicity with Special Reference to Endocrine Disruption: Evidence of Mechanisms, Exposures and Mitigation Strategies\u0026rsquo;. \u003cem\u003eScience of The Total Environment\u003c/em\u003e 755: 142649.\u003c/li\u003e\n\u003cli\u003eWang, Cheng et al. 2021. \u0026lsquo;Macrophage Polarization and Its Role in Liver Disease\u0026rsquo;. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e: 5381.\u003c/li\u003e\n\u003cli\u003eWdowiak, Kamil et al. 2022a. \u0026lsquo;Bioavailability of Hesperidin and Its Aglycone Hesperetin\u0026mdash;Compounds Found in Citrus Fruits as a Parameter Conditioning the Pro-Health Potential (Neuroprotective and Antidiabetic Activity)\u0026mdash;Mini-Review\u0026rsquo;. \u003cem\u003eNutrients\u003c/em\u003e 14(13): 2647.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2022b. \u0026lsquo;Bioavailability of Hesperidin and Its Aglycone Hesperetin\u0026mdash;Compounds Found in Citrus Fruits as a Parameter Conditioning the Pro-Health Potential (Neuroprotective and Antidiabetic Activity)\u0026mdash;Mini-Review\u0026rsquo;. \u003cem\u003eNutrients\u003c/em\u003e 14(13): 2647.\u003c/li\u003e\n\u003cli\u003eYang, Wenchang et al. 2022. \u0026lsquo;Maresin 1 Protects against Lipopolysaccharide/d-Galactosamine-Induced Acute Liver Injury by Inhibiting Macrophage Pyroptosis and Inflammatory Response\u0026rsquo;. \u003cem\u003eBiochemical Pharmacology\u003c/em\u003e 195: 114863.\u003c/li\u003e\n\u003cli\u003eZhang, Yecui et al. 2021. \u0026lsquo;Effects of Chlorpyrifos Exposure on Liver Inflammation and Intestinal Flora Structure in Mice\u0026rsquo;. \u003cem\u003eToxicology Research\u003c/em\u003e 10(1): 141\u0026ndash;49.\u003c/li\u003e\n\u003cli\u003eZhao, Yue et al. 2020. \u0026lsquo;Walnut Polyphenol Extract Protects against Malathion-and Chlorpyrifos-Induced Immunotoxicity by Modulating TLRx-NOX-ROS\u0026rsquo;. \u003cem\u003eNutrients\u003c/em\u003e 12(3): 616.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chlorpyrifos. Hesperidin. Niosomal Hesperidin. Antioxidant","lastPublishedDoi":"10.21203/rs.3.rs-3123664/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3123664/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose:\u003c/strong\u003e The organophosphate pesticide chlorpyrifos (CPF) can cause developmental , neurological deficiencies , and mitochondria-mediated oxidative stress responses. In this study, the effect of niosomal hesperidin (Nio+Hesp) on the polarization of M1-M2 liver macrophages and the amount of inflammatory cells secretion in the brain, liver, and ovary tissues of CPF induced mice (3 mg/kg for 4 weeks; Intraperitoneally) was investigated.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e Fourty C57 mice were divided into CPF, Sham, CPF+Hesp, and CPF+Nio+Hesp groups and treated carried out orally for 30 days. The activity of superoxide dismutase (SOD) and malondialdehyde (MDA), tissue changes, inflammation, and apoptosis in brain, liver, and ovary tissues, the number of ovarian germ cells , and M1-M2 liver macrophage polarization were evaluated by examining the expression of \u003cem\u003eCD163\u003c/em\u003eand \u003cem\u003eCD68\u003c/em\u003e genes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Nio+Hesp prescription caused an increase in SOD and a decrease in MDA. Nio+Hesp decreased the amount of cell apoptosis in the liver, also reduced the expression of \u003cem\u003eCD163\u003c/em\u003e and \u003cem\u003eCD68\u003c/em\u003egenes. Although there was a significant difference between Hesperidin and Nio+Hesp in the increase of Graafian follicles, corpus luteum, and peri-antral follicles, no substantial difference was observed in primary follicles in the uterus. Both Nio+Hesp and Hesp alleviated CPF-induced hepatotoxicity, however, Nio+Hesp was superior to Hesp in downregulation of the \u003cem\u003eCD163\u003c/em\u003e and \u003cem\u003eCD68\u003c/em\u003egenes expression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e The ameliorative effects of HSP and Nio+Hesp may be at least in part due to their antioxidant and anti-inflammatory properties. By attenuating, Nio+Hesp may have therapeutic applications for reversing CPF-induced toxicity as an appropriate antioxidant effects.\u003c/p\u003e","manuscriptTitle":"Niosomal Hesperidin Attenuates the M1/M2-Macrophage Polarization-Based Hepatotoxicity Followed Chlorpyrifos -Induced Toxicities","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-07-07 13:32:23","doi":"10.21203/rs.3.rs-3123664/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c79e8727-aa13-46b0-b03d-b0ca8aac1224","owner":[],"postedDate":"July 7th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-08-21T07:44:29+00:00","versionOfRecord":[],"versionCreatedAt":"2023-07-07 13:32:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3123664","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3123664","identity":"rs-3123664","version":["v1"]},"buildId":"re_ckhLnmML6MCF96OHNJ","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-20T11:00:21.680559+00:00
License: CC-BY-4.0