Mitochondrial uncoupler BAM15 attenuates cell proliferation and tumor growth in non-small cell lung cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mitochondrial uncoupler BAM15 attenuates cell proliferation and tumor growth in non-small cell lung cancer Mei-Yin Zhang, Nuo-Qing Weng, Yu-Feng Zhou, Yue-Ning Wang, Shi-Juan Mai, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8556496/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Lung cancer remains the leading cause of cancer-related mortality worldwide, with non-small cell lung cancer (NSCLC) accounting for 80–85% of all cases, highlighting the urgent need for novel therapeutic strategies. BAM15, a mitochondria-targeted uncoupler, has demonstrated therapeutic potential in metabolic disorders and several cancer types; however, its role in NSCLC progression remains poorly understood. This study aimed to evaluate the antitumor effects of BAM15 in human NSCLC cells (A549, H1299) and elucidate the underlying mechanisms, with in vivo validation. The results showed that BAM15 treatment dose-dependently inhibited the viability of NSCLC cells (IC50: 4.013 µM for A549, 7.897 µM for H1299) and suppressed their colony formation, migration and invasion. Furthermore, BAM15 not only induced G1/G0 phase arrest but also apoptosis in NSCLC cells. RNA sequencing identified 2,270 differentially expressed genes (DEGs) in response to BAM15 treatment. Pathway analysis showed that BAM15 downregulated cell signaling pathways involved in DNA replication and cell cycle, and upregulated those associated with inflammatory response (e.g., TNF, IL-17, NF-κB signaling) and MAPK/PI3K-Akt signaling. Western blot confirmed that BAM15 downregulated key cell cycle regulators, including CDK2, CDK6, and PCNA. In vivo experiment, BAM15 administration significantly reduced xenograft tumor weight and volume and decreased the number of PCNA-positive tumor cells. In conclusion, BAM15 exerts potent antitumor effects against NSCLC both in vitro and in vivo by disrupting DNA replication and cell cycle progression, likely through modulation of cell cycle regulators and downstream signaling pathways. These findings suggest BAM15 as a promising candidate for targeted NSCLC therapy. non-small lung cancer cell BAM15 cell cycle migration invasion vitro experiment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Lung cancer is the leading cause of cancer-related deaths worldwide, with 1.8 million annual deaths ( 1 , 2 ). Among these cases, non-small cell lung cancer (NSCLC) accounts for 80–85% of all lung cancer diagnoses ( 3 ); however, approximately 70% of patients are diagnosed at an advanced stage, resulting in an overall 5-year survival rate of only 18% ( 4 ). Conventional treatment modalities for NSCLC include surgery, radiotherapy, and chemotherapy ( 5 ). For early-stage disease (stage I or II), radical surgery remains the cornerstone, typically followed by adjuvant therapy. In contrast, advanced-stage disease (stage III or IV) is primarily managed with chemotherapy or radiotherapy ( 6 ). Approximately 30–40% of NSCLC patients are diagnosed with distant metastasis, and the resulting organ dysfunction due to widespread tumor spread often precludes them from undergoing curative surgery ( 7 ). For this population, precision therapies such as targeted therapy, immunotherapy, antibody-drug conjugates (ADCs), and bispecific antibodies are being increasingly integrated into first-line treatment regimens ( 8 ). However, clinical practice continues to show that some patients face challenges such as therapeutic bottlenecks or treatment intolerance ( 9 ). Thus, the current treatment dilemma underscores the urgent need to develop new antitumor drugs ( 10 ). Mitochondria, as the primary energy-producing organelles and critical signaling regulators in eukaryotic cells, play a central role in maintaining cellular bioenergetics, including ATP generation through oxidative phosphorylation (OXPHOS), and participate in essential metabolic pathways such as the tricarboxylic acid (TCA) cycle and fatty acid oxidation ( 11 , 12 ). However, mitochondrial dysfunction has been increasingly recognized as a hallmark of tumorigenesis and cancer progression ( 13 ). Emerging evidence indicates that tumor cells undergo profound metabolic reprogramming to sustain uncontrolled proliferation, a process often characterized by suppressed OXPHOS, accumulation of TCA cycle intermediates, and impaired electron transport chain (ETC) activity ( 14 ). This metabolic shift, known as the "Warburg effect", not only sustains the supply of energy and biosynthetic precursors but also drives key oncogenic processes, including cellular transformation, evasion of apoptosis, and enhanced proliferative potential ( 13 ). Notably, ETC dysfunction disrupts mitochondrial membrane potential, leading to excessive production of reactive oxygen species (ROS) ( 14 ). The resultant oxidative stress further exacerbates genomic instability, activates pro-survival signaling pathways, and promotes epithelial-mesenchymal transition (EMT), collectively driving tumor malignancy ( 15 ). The intricate link between mitochondrial dysfunction, ROS imbalance, and tumor progression underscores its potential as a therapeutic target, offering promising avenues for precision oncology interventions ( 5 , 15 ). Mitochondrial uncouplers are a class of targeted drugs that disrupt the proton gradient across the inner mitochondrial membrane, block ADP phosphorylation, and cause energy to be released as heat instead of producing ATP ( 16 ). Traditional mitochondrial uncouplers such as carbonyl cyanide m-chlorophenyl hydrazone (CCCP), carbonyl cyanide p-trifluoromethoxyphenyl hydrazone (FCCP), and 2,4-dinitrophenol (DNP) can inhibit tumor growth by disrupting mitochondrial membrane potential (ΔΨm), but their effects vary ( 17 – 20 ). The novel mitochondrial uncoupler BAM15 (N5,N6-bis(2-Fluorophenyl)[1,2,5]oxidiazolo[3,4-b]pyrazine-5,6-diamine) is a well-tolerated and bioavailable protonophore that restores lipid metabolism and improves glycemic control in preclinical models of obesity( 21 , 22 ). Beyond its metabolic effects, BAM15 exhibits significant anticancer properties( 23 , 24 ). It may suppress the proliferation of aggressive breast cancer cells by increasing proton leak and reducing mitochondrial membrane potential ( 23 ). In acute myeloid leukemia (AML), BAM15 significantly inhibited proliferation and induced apoptosis while demonstrating lower cytotoxicity toward normal cells ( 24 ). Additionally, it synergizes with targeted drugs in melanoma, markedly enhancing apoptosis and inhibiting colony formation ( 25 ). However, the role of BAM15 in lung cancer remains unexplored. In this study, we investigate its effects on lung cancer cell proliferation, migration, and invasion through in vitro and in vivo experiments. Materials and methods Experimental animals A total of 16 male BALB/c-nu nude mice (specific pathogen-free [SPF]-grade), aged 6 weeks and weighing 21–27 g, were obtained from the Guangdong Provincial Laboratory Animal Center (Animal Production License No. SCXK (Yue) 2022-0002). All mice were housed in a specific pathogen-free (SPF) facility at the Experimental Animal Facility of Sun Yat-sen University Cancer Center. The environment was maintained under controlled conditions with a relative humidity of 50% and a temperature range of 22–25°C. Mice had ad libitum access to food and water and were subjected to a 12-hour light-dark cycle regulated by an automated light control system. Animal care and experimental procedures were conducted in strict accordance with the 3R principles (Replacement, Reduction, Refinement). Humane endpoints are established to intervene before animals experience unnecessary pain or distress, and death is never used as an endpoint in the experiment. Specific humane endpoints include tumor volume exceeding 10% of initial body weight, tumor ulceration or infection, and weight loss ≥15%. Subcutaneous tumors were measured every 3 days using a vernier caliper to record length and width, with volume calculated using the formula V = length × width² × 0.5. Body weight was also monitored every 2 days throughout the study. At the experimental endpoint, euthanasia was performed using a gradual CO₂ inhalation method in a 10 L euthanasia chamber. CO₂ gas was infused at a constant flow rate of 5.8 L/min for 3 minutes, achieving a total displacement rate of 174% of the chamber volume. Subsequently, animal death was confirmed by observing the absence of vital signs, including respiration, heartbeat, and neural reflexes (e.g., corneal reflex), for a minimum of 5 minutes. This study was approved by the Experimental Animal Ethics Committee of Sun Yat-sen University Cancer Center (Ethics Approval No. L102012020120J). All animal experiments were performed in compliance with guidelines established by the International Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC) and the National Research Council’s Guide for the Care and Use of Laboratory Animals. Cell cultures and reagents Human lung cancer cell lines A549 and H1299 were obtained from the State Key Laboratory of Oncology in South China. A549 cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.), while H1299 cells were cultured DMEM medium (Gibco, Thermo Fisher Scientific, Inc.). Both media were supplemented with 10% fetal bovine serum (FBS, ExCell Bio, China.) and 1% penicillin/streptomycin (KeyGen Biotech, China). The cells were maintained at 37°C in a humidified incubator with 5% CO 2 (Thermo Fisher Scientific, Inc.). When cells reached 80-90% confluency, they were detached using 0.25% EDTA-trypsin (Gibco, Thermo Fisher Scientific, Inc.) or gently pipetted off. Half-Maximal Inhibitory Concentration (IC50) Assay A549 and H1299 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 1×10³ cells/well and incubated overnight at 37°C in a 5% CO₂ atmosphere. After cell adherence, the medium was replaced with fresh 10% FBS medium containing BAM15 (Selleck, China; at concentrations ranging from 0.0195 to 40 μM (2-fold serial dilution). Blank (medium only) and control (cells + medium) groups were included. After 48 h of incubation, the medium was removed, and 100 μL of 10% Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan) in fresh medium was added to each well. The plates were then incubated in the dark for 2 hours. Absorbance (OD value) was measured at 450 nm using a Synergy HTX multi-mode microplate reader (BioTek, USA). The cell viability inhibition rate was calculated as: Inhibition rate (%) = [(Control OD – Experimental OD) / (Control OD – Blank OD)] × 100%. The IC₅₀ value of BAM15 was determined by fitting the dose-response curve using GraphPad Prism 9.0. Cell Proliferation Assay A549 and H1299 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 1×10³ cells/well and cultured overnight. For A549 cells: low, medium, and high doses of BAM15 (2, 4, 6 μM) were added in 10% FBS medium, while H1299 cells were treated with 4, 6, or 8 μM BAM15. Blank (medium only) and control (cells + medium) groups were included, with three replicate wells per group. At 24, 48, and 72 h post-treatment, the medium was replaced with 100 μL of fresh medium containing 10% CCK-8, followed by incubation in the dark for 2 h. Cell viability was assessed by measuring the absorbance at 450 nm. EdU Incorporation Assay A549 and H1299 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 1×10⁵ cells/well and cultured for 24 hours. After adherence, cells were gently washed with PBS. The experimental group was treated with medium containing 5 μM BAM15 (control: equal volume DMSO) until cells reached ~70% confluence. For EdU labeling, cells were incubated with 10 μM EdU in fresh medium for 2 h in the dark. Following PBS washes, cells were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.3% Triton X-100 for 15 min. The Click reaction was carried out following the manufacturer’s protocol of the EdU kit (Beyotime Biotechnolog, China), with a 30-min incubation in the dark. After washing, nuclei were counterstained with Hoechst 33342 for 10 min. Five random fields per well were imaged using an inverted fluorescence microscope. EdU-positive cells were quantified, and experiments were performed in triplicate. Colony-formation Assay A549 and H1299 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 500 cells/well and cultured overnight. Grouping and treatment were performed identically to the Cell Proliferation Assay, with a control group (medium containing an equivalent volume of DMSO) included in parallel. The cells were continuously cultured for 14 days. After incubation, the medium was aspirated, and the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 10 min, and stained with 0.1% crystal violet solution at room temperature for 30 min. Following gentle rinsing with running water, the plates were air-dried, and the number of cell colonies was counted. Cell Cycle Analysis by Flow Cytometry A549 and H1299 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 2×10⁵ cells/well and cultured for 24 hours. After adherence, the cells were gently washed with PBS and treated with fresh medium containing 5 μM BAM15 (control: DMSO vehicle) for 48 hours. The cells were then trypsinized, washed with PBS, and fixed overnight at 4°C in 500 μL of 70% ethanol. Following centrifugation, the cells were washed with PBS, incubated with 100 μL RNaseA at 37°C for 30 min, and stained with 400 μL PI (KeyGen Biotech, China). Cell cycle distribution was analyzed using a CytoFLEX flow cytometer (Beckman Coulter, Germany) and FlowJo software. Cell Apoptosis assays A549 and H1299 cells in logarithmic growth phase were seeded in 6-well plates at 2×10⁵ cells/well and cultured overnight. Grouping and treatment were performed identically to the Cell Proliferation Assay, with a control group (medium containing an equivalent volume of DMSO) included in parallel. After 48 h of further incubation, cells were harvested using 0.25% trypsin without EDTA (KeyGen Biotech, China), washed twice with pre-cooled PBS, and resuspended in Binding Buffer. For staining, 5 μL Annexin V-FITC and 5 μL propidium iodide (PI) solution (KeyGen Biotech, China) were added to the cell suspension, followed by gentle mixing and incubation in the dark at room temperature for 15 min. Stained cells were analyzed immediately using a CytoFlex flow cytometer (Beckman Coulter, Germany), with data processed within 1 hour of sample processing. FlowJo software (v10.8) was used for data analysis. Scratch Assay A549 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 2×10⁵ cells/well and cultured to form a confluent monolayer (>90% adherence). A sterile 200 μL pipette tip was used to create parallel scratches (three replicates per group, width: 800±50 μm). After discarding the medium and gently washing with PBS, the experimental group was treated with serum-free medium containing 5 μM BAM15, while the control group received serum-free medium with an equivalent volume of DMSO. Cell migration was monitored by capturing images at 0, 24, and 48 hours using an inverted microscope (Nikon, Japan). The migration distance was measured using ImageJ software, and the percentage of wound closure was calculated to quantify cell migration. Cell Migration Assay (Transwell Chamber) A549 cells in the logarithmic growth phase were resuspended in serum-free medium at a density of 1×10⁵ cells/mL. For the experimental group, 200 μL of the cell suspension was seeded into the upper chamber of a Transwell (8 μm pore size, Corning, USA) insert, while the lower chamber received 600 μL of complete medium supplemented with 10% FBS and 5 μM BAM15. The control group was treated identically but with complete medium lacking BAM15. After 24 hours of incubation, non-migrated cells were removed from the upper chamber surface using a cotton swab. Migrated cells on the lower membrane surface were fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet for 20 min, gently rinsed with PBS, and quantified by counting cells in six random non-overlapping fields using ImageJ software. Matrigel Coating and Invasion Assay The Matrigel matrix (Corning, USA) was diluted 1:5 with pre-cooled serum-free medium on ice, and 80 μL of the diluted solution was evenly coated onto the upper surface of the Transwell chamber (8 μm pore size, Corning, USA). After polymerization at 37°C with 5% CO₂ for 5 hours, the chambers were washed with PBS to remove unpolymerized liquid, followed by equilibration with 100 μL serum-free medium (37°C, 30 min). A549 cells in the logarithmic growth phase were resuspended at 2×10⁵ cells/mL. For the experimental group, 200 μL cell suspension was added to the upper chamber, while the lower chamber contained 600 μL of complete medium supplemented with 10% FBS and 5 μM BAM15. The control group received complete medium without BAM15. After 24 hours of incubation, non-invaded cells and Matrigel were removed with a cotton swab. Invaded cells were fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet for 20 min, rinsed with PBS, and counted in six random fields per membrane using ImageJ. RNA sequencing (RNA-seq) A549 cells in the logarithmic growth phase were cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin (100 U/mL) for 24 hours. After adherence, the medium was aspirated, and cells were gently washed with PBS. Fresh medium containing 5 μM BAM15 (control: DMSO vehicle) was added, with three biological replicates per group. After 48 h of treatment, control and BAM15-treated A549 cells were collected for transcriptome sequencing. The sequencing experiment was conducted on an Illumina NovaSeq 6000 platform by Suzhou Panomike Biomedical Technology Co., Ltd. Bioinformatics Analysis Differentially expressed genes (DEGs) between the two groups were identified with DESeq2 (v1.38.3), with the threshold set at adjusted P 1. Functional enrichment analysis of DEGs, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, was conducted using R package clusterProfiler to investigate the biological processes and signaling pathways affected by BAM15 treatment. Additionally, further enrichment analysis and Gene Set Enrichment Analysis (GSEA) of DEGs were performed through the bioinformatics platform (https://www.bioinformatics.com.cn). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) Total RNA was extracted using TRIzol reagent (Invitrogen, USA). Approximately 1.5×10⁶ cells were lysed in 1 mL TRIzol and kept on ice. After adding 200 μL chloroform, the mixture was vortexed for 10 s and incubated at room temperature for 15 min. Following centrifugation at 12,000 × g for 10 min at 4°C, the aqueous phase was transferred to a new tube. An equal volume of isopropanol was added, gently mixed, and incubated at room temperature for 10 min. After another centrifugation (12,000 × g, 10 min, 4°C), the RNA pellet was washed twice with 75% ethanol, air-dried for 5 min, and resuspended in 20 μL DEPC-treated water. RNA concentration and purity (A260/280 ratio) were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA). For cDNA synthesis, 1 μg of total RNA was reverse-transcribed using the Evo M-MLV RT kit (Cat. No. AG11701, Accura Biotechnology, China). The SYBR Green reagent used was the SYBR Green Premix Pro Taq HS qPCR kit (Cat. No. AG11706, Accura Biotechnology, China). qRT-PCR was performed using 100 ng cDNA, 10 μL 2× SYBR Green mix, 0.4 μL each of forward and reverse primers, and RNase-free water to a final volume of 20 μL. Amplification conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and 70°C for 10 s. GAPDH served as the internal reference, and relative gene expression was calculated using the 2 -ΔΔCT method. The primer sequences are shown in Table 1. Table 1. Sequences of primers used for qRT-PCR Gene name Primer sequence (5'-3') GAPDH F: GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG CDK2 F: CCAGGAGTTACTTCTATGCCTGA R: TTCATCCAGGGGAGGTACAAC CDK4 F: ATGGCTACCTCTCGATATGAGC R: CATTGGGGACTCTCACACTCT CDK6 F: CCAGATGGCTCTAACCTCAGT R: AACTTCCACGAAAAAGAGGC PCNA F: ACACTAAGGGCCGAAGATAACG R: ACAGCATCTCCAATATGGCTGA F, forward; R, reverse. Western blot (WB) Total cellular proteins were extracted using RIPA lysis buffer (Beyotime Biotechnology, China) supplemented with PMSF protease inhibitor. Protein concentrations were determined using a BCA assay kit (Beyotime Biotechnology, China). Equal amounts of protein were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk at room temperature for 2 h. After washing, membranes were incubated overnight at 4°C with primary antibodies against CDK2 (1:1000, Abcam, ab205718), CDK6 (1:1000, CST, #30483), PCNA (1:1000, Affinity, #AF0239), and GAPDH (1:5000, Abcam, ab181602). Following incubation with HRP-conjugated secondary antibodies (goat anti-mouse or anti-rabbit, 1:5000, Proteintech) for 2 h at room temperature, protein bands were visualized using ECL reagent and captured by a gel imaging system. Band intensities were quantified using ImageJ software, with GAPDH as the loading control to normalize relative protein expression levels. Xenograft tumor experiment Sixteen 6-week-old male BALB/c-nu nude mice (SPF-grade) were housed in an SPF environment at the Experimental Animal Facility of Sun Yat-sen University Cancer Center and managed in accordance with the 3R principles. After a 1-week acclimation period, A549 cells in the logarithmic growth phase were resuspended in sterile saline (2 × 10⁷ cells/mL) and subcutaneously inoculated into the right axilla of each mouse (4 × 10⁶ viable cells/0.1 mL). When tumors reached ~100 mm³ in volume, mice were randomly assigned to two groups (n=8 per group): the control group received 0.2 mL vehicle (0.4% CMC-Na + 0.2% Tween-80), while the BAM15 group was administered 5 mg/kg BAM15 in the same vehicle volume. Mice were orally administered the treatment every 2 days for 4 weeks. Tumor volume (V = length × width² × 0.5) and body weight were measured periodically. After sacrifice, tumors were excised and weighed. Immunohistochemistry (IHC) Nude mouse tumor tissues were fixed in 4% paraformaldehyde, paraffin-embedded, and sectioned into 4 μm slices. After deparaffinization in xylene and rehydration through graded ethanol, antigen retrieval was performed using EDTA buffer (pH 8.0) with heat treatment. Sections were blocked with 3% BSA at room temperature for 30 min, followed by overnight incubation at 4°C with a PCNA primary antibody (1:1000). After three PBS washes, HRP-labeled secondary antibody was applied for 1 hour at 37°C. DAB staining and hematoxylin counterstaining were then performed. Positive expression was identified as brown-yellow staining under microscopy (×400). Staining intensity was scored as follows: 0 (no color), 1 (light-yellow), 2 (brown-yellow), 3 (brown). The percentage of positive cells was scored as: 0 (0%), 1 (1-25%), 2 (26-50%), 3 (51-75%) or 4 (76-100%). A total score (range: 0-12) was calculated by multiplying the intensity and percentage scores. Statistical analysis . GraphPad Prism 9.0 was used to generate BAM15 dose-response curves and calculate IC 50 values. Statistical analyses were performed using SPSS software (version 30.0, IBM Corp., Armonk, NY, USA). Normally distributed continuous data were presented as the mean ± standard deviation ( x̅ ± s ). Intergroup comparisons were analyzed using independent Student’s t-tests, while one-way analysis of variance (ANOVA) was employed for comparisons among multiple groups, with P <0.05 considered statistically significant. All experiments were conducted in triplicate. Results BAM15 inhibits NSCLC cell viability in a dose-dependent manner. A549 and H1299 cell lines were treated with varying concentrations of BAM15 for 48 hours, and cell viability was assessed using the CCK-8 assay. The results demonstrated that BAM15 exerted a weak inhibitory effect on A549 and H1299 cells at low concentrations. However, as the drug concentration increased, cell viability gradually decreased in a dose-dependent manner. The IC₅₀ values of BAM15 were calculated as 4.013 µM for A549 and 7.897 µM for H1299 cells (Fig. 1 A). To further evaluate the impact of BAM15 on lung cancer cell proliferation, we performed CCK-8 and colony formation assays. The CCK-8 assay revealed that BAM15 significantly inhibited the proliferation of A549 cells at low (2 µM), medium (4 µM), and high (6 µM) concentrations compared to the DMSO control ( P < 0.001). Similarly, H1299 cell proliferation was suppressed at low (4 µM), medium (6 µM), and high (8 µM) concentrations ( P < 0.001). The inhibitory effect of BAM15 was positively correlated with both concentration and treatment duration (Fig. 1 B). BAM15 suppresses NSCLC cell proliferation. To further validate the antiproliferation activity of BAM15, EdU incorporation assays were conducted to assess DNA synthesis. In A549 cells, the EdU-positive rate was significantly reduced in the BAM15-treated group compared to the control ( P = 0.013). Similarly, H1299 cells exhibited a significant reduction in both the EdU-positive rate and average fluorescence intensity following BAM15 treatment ( P = 0.002) (Fig. 1 C). Collectively, these results demonstrate that BAM15 consistently suppresses DNA synthesis in both A549 and H1299 NSCLC cells, confirming its antiproliferative effect. BAM15 impairs NSCLC cell clonogenic potential. Subsequently, colony formation assays were performed to investigate the long-term proliferative capacity of NSCLC cells. Consistent with the CCK-8 and EdU results, BAM15 treatment significantly inhibited the clonogenic ability of both A549 and H1299 cells in a dose-dependent manner. Specifically, the CCK-8 assay revealed that BAM15 significantly inhibited the proliferation of A549 cells at low (2 µM), medium (4 µM), and high (6 µM) concentrations compared to the DMSO control ( P < 0.001). Similarly, H1299 cell proliferation was suppressed at low (4 µM), medium (6 µM), and high (8 µM) concentrations ( P < 0.001), with the inhibitory effect positively correlated with both concentration and treatment duration (Fig. 1 D). Correspondingly, the colony formation assay showed that as the concentration of BAM15 increased, the clonogenic capacity of both cell lines declined significantly. BAM15 induces G1 phase arrest and suppresses cell cycle progression in NSCLC Cells To further elucidate the antiproliferative effects of BAM15, we first evaluated its impact on cell cycle distribution. A549 and H1299 cells were treated with 5 µM BAM15 for 48 h and analyzed by flow cytometry. In A549 cells, BAM15 treatment significantly increased the proportion of cells in the G1/G0 phase, while concurrently decreasing the populations in the S and G2/M phase. A similar trend was observed in H1299 cells, with a marked increase in the G1/G0 phase and reductions in the S and G2/M phases (Fig. 2 A). Collectively, these results demonstrate that BAM15 induces G1 phase arrest and impairs the G1/S transition in both NSCLC cell lines. BAM15 induces apoptosis in NSCLC cells in a dose-dependent manner Apoptosis has been widely recognized as a crucial cellular mechanism that plays a pivotal role in inhibiting cancer cell proliferation and maintaining tissue homeostasis. To systematically investigate this phenomenon, we employed a well-established flow cytometric assay utilizing Annexin V-FITC and PI double-staining to accurately quantify apoptotic cells in NSCLC models. Quantitative data revealed that BAM15 treatment robustly induced apoptosis in both A549 and H1299 cell lines in a dose-dependent manner (Fig. 2 B). These compelling findings not only validate our initial hypothesis but also provide strong evidence to confirm that BAM15 exerts its potent anti-proliferative effects through the induction of apoptosis in NSCLC cells. BAM15 inhibits the migration and invasion of A549 Cell migration and invasion are key steps in cancer metastasis, allowing tumor cells to spread to distant organs, which worsens treatment outcomes in lung cancer. To test BAM15’s effort on A549 cell migration, we first performed the scratch assay. At 24 hours, BAM15 slightly slowed wound healing, but the difference was not significant ( P > 0.05). However, by 48 hours, BAM15 significantly reduced the wound closure ( P < 0.05, Fig. 3 A). We also performed a Transwell migration assay, which confirmed that BAM15 significantly reduced the number of migrating A549 cells ( P < 0.05). Additionally, a Transwell invasion assay (with Matrigel) showed that BAM15 significantly decreased invasive cell numbers ( P < 0.05, Fig. 3B). These results indicated that BAM15 significantly suppresses both the migratory and invasive abilities of A549 cells. RNA-seq-based screening and identification of differentially expressed genes in A549 To elucidate the molecular mechanisms underlying BAM15-mediated inhibition of A549 cell growth, cells were starved for 48 hours and treated with either 5 µM BAM15 or DMSO (control) for 48 hours. RNA-seq analysis identified 16,880 and 17,146 genes in the control and the BAM15 groups, respectively, with 16,302 genes common to both. Using thresholds of |log2 Fold Change|>1 and P < 0.05, we identified 2,270 DEGs, including 1,439 upregulated and 831 downregulated genes (Fig. 4 A-B). Heatmaps of the top 50 up- and down-regulated DEGs clearly distinguished the two groups, demonstrating BAM15’s profound impact on the A549 transcriptome (Fig. 4 C). Functional enrichment analysis of DEGs and reveals BAM15 inhibits A549 cell growth via differential gene expression Functional annotation of DEGs via GO, KEGG, and GSEA revealed distinct biological patterns. GO analysis revealed the enrichment of DEGs in three functional categories: biological processes were primarily involved in anatomical structure development, regulation of localization, and multicellular organism development; cellular components were enriched in cell projections, plasma membrane-coated cell projections, and extracellular regions; molecular functions focused on signal receptor binding, signal receptor activity, and receptor regulator activity (Fig. 4 D). Additionally, GO chord diagram analysis further highlighted IL1A as a key shared gene across these functional categories (Fig. 4 E). KEGG pathway analysis identified distinct patterns of pathway regulation (Fig. 4 F). The upregulated pathways included inflammation-related signaling cascades (TNF signaling, IL-17 signaling, NF-κB signaling, and JAK-STAT signaling), as well as the MAPK and PI3K-Akt pathways, which directly or indirectly modulate the balance between glycolysis and oxidative phosphorylation. Metabolic pathways for glycine, serine, and threonine metabolism were also activated, potentially to support energy demand. In contrast, the downregulated pathways encompassed DNA replication, cell cycle regulation, cytochrome P450 metabolism, retinol metabolism, and glycosylation processes. These findings suggest that BAM15 drives inflammatory responses and metabolic reprogramming in the tumor microenvironment by activating inflammation-immune and metabolic pathways while suppressing cell cycle progression and drug metabolism pathways, potentially influencing tumor progression through metabolic-immune crosstalk. GSEA with thresholds of |NES|>1.5 and FDR < 0.05 further validated these observations. Specifically, co-activated pro-inflammatory pathways included cytokine-cytokine receptor interaction (NES = 1.88, FDR = 1.39E-07) and IL-17 signaling (NES = 2.09, FDR = 1.39E-07), while significantly suppressed proliferation pathways comprised DNA replication (NES=-2.58, FDR = 4.34E-09) and cell cycle regulation (NES=-1.69, FDR = 6.49E-05) (Fig. 4 G). Collectively, this pattern indicates that BAM15 exerts its biological effects through a dual mechanism of "inflammatory activation-proliferation suppression". The CDK2/CDK6-PCNA Pathway Serves as a Critical Target for BAM15-Mediated Inhibition of Cell Cycle Progression To elucidate the key genes and underlying molecular mechanisms regulating the cell cycle, we constructed a clustering heatmap to visualize the expression patterns of cell cycle-related genes. As supported by our previous GO, KEGG, and GSEA analyses (which highlighted significant enrichment of the cell cycle pathway), the heatmap revealed distinct clustering of BAM15-treated and control groups based on the dysregulation of cell cycle-related transcripts (Fig. 5 A). Specifically, RNA-Seq results indicated that multiple cell cycle-related genes were aberrantly expressed in BAM15-treated cells, with a prominent downregulation of CDK2, CDK6, and PCNA transcripts. Subsequent validation via qPCR and Western blot analysis confirmed the expression patterns of these key cell cycle regulators. Consistent with RNA-Seq data, qPCR demonstrated significant reductions in CDK2, CDK6, and PCNA mRNA levels (all P 0.05) (Fig. 5 B). Western blot analysis further verified decreased protein levels of CDK2, CDK6, and PCNA in BAM15-treated cells (all P < 0.05) (Fig. 5 C). Collectively, these findings indicate that BAM15 specifically targets the CDK2/CDK6-PCNA signaling pathway by regulating cell cycle-critical genes, thereby inducing G1/S phase arrest and suppressing cell cycle progression. BAM15 treatment inhibited tumor growth in the xenograft mouse model To further validate the biological relevance of these in vitro findings in vivo, we conducted animal experiments to assess the effect of BAM15 on tumor growth and proliferation. Following the animal experiment, subcutaneous tumor volume and mass were measured in both groups of nude mice, and the number of PCNA-positive cells was further analyzed. The results showed no significant difference in body weight between the control and BAM15 groups during the experiment ( P > 0.05, Fig. 6 A), indicating that BAM15 did not cause significant systemic toxicity at the effective dose. Tumor masses were significantly larger in the control group than in the BAM15-treated group ( P < 0.05, Fig. 6 B-C). Similarly, tumor volumes were significantly reduced in the BAM15 group compared to the control group ( P < 0.05, Fig. 6 D-E). Quantitative IHC analysis revealed a significantly lower PCNA-positive cell score in the BAM15-treated group than in the control group ( P < 0.05, Fig. 6 F-G). These findings collectively demonstrate that BAM15 treatment significantly inhibited subcutaneous tumor growth in nude mice, consistent with its in vitro role in suppressing proliferation pathways. Discussion In this study, we demonstrated that BAM15 significantly inhibited the proliferation of NSCLC cells in a dose-dependent manner, as evidenced by CCK-8 assays and colony formation experiments. Additionally, migration and invasion assays revealed that BAM15 effectively weakened the migratory and invasive capabilities of lung cancer cells. Flow cytometry analysis further indicated that BAM15 could induce apoptosis in these cells. In vivo experiments using a mouse xenograft model confirmed that BAM15 significantly suppressed tumor growth. At the molecular level, BAM15 induced cell cycle arrest at the G1 phase, thereby blocking the G1/S transition and inhibiting DNA replication. Moreover, it might activate pro-inflammatory pathways, forming a synergistic effect. As a novel mitochondria-targeting agent, BAM15 enhances mitochondrial respiratory efficiency, promotes fatty acid oxidation, and optimizes energy allocation, thereby achieving dual effects of reducing adipose tissue and improving metabolic function in obesity treatment ( 21 ). It also significantly enhances insulin sensitivity and effectively reverses insulin resistance in db/db mice and diet-induced obesity models ( 22 ). In cancer therapy, BAM15 inhibits tumor progression by regulating mitochondrial metabolic reprogramming. For instance, it effectively suppresses cell proliferation and promotes apoptosis in breast cancer and acute myeloid leukemia (AML) ( 23 , 24 ). In melanoma, BAM15 exhibits synergistic effects when combined with targeted MAPK pathway drugs, significantly enhancing apoptosis and inhibiting colony formation ( 25 ). Furthermore, low-dose BAM15 remodels the tumor metabolic microenvironment, augmenting the tumor-killing function of CD8 + T cells ( 26 ). In vivo studies have further demonstrated that BAM15 effectively inhibits AML progression and prolongs survival in mice, with its anticancer activity significantly enhanced when combined with cytarabine ( 23 , 24 ). These findings suggest that BAM15 holds potential as an anti-tumor agent. Notably, whether BAM15's anti-tumor effects are cancer-type dependent remains unclear. This study focused on lung cancer, revealing that BAM15 treatment led to dose-dependent reductions in cell viability, diminished colony formation, increased apoptosis, and inhibited migration and invasion in NSCLC cells compared to controls. These results indicate that BAM15 exerts its anti-tumor effects by inhibiting proliferation, promoting apoptosis, and reducing metastatic potential, consistent with existing research. Lung cancer development is orchestrated by intricate signaling crosstalk. While the full scope of BAM15's regulatory mechanisms remains under investigation, studies suggest that BAM15 uncouples oxidative phosphorylation, inhibiting ATP synthesis and leading to cellular energy deficiency. Additionally, it increases proton leakage across the mitochondrial inner membrane, disrupting the proton gradient and reducing mitochondrial membrane potential (ΔΨm). These effects further impair the electron transport chain, resulting in reactive oxygen species (ROS) accumulation and cytochrome c release, ultimately inducing apoptosis in MDA-MB-231 and EO771 cells ( 23 ). BAM15 not only regulates ROS generation and restores dynamic balance but also significantly inhibits AML cell proliferation and induces apoptosis with low toxicity to normal cells ( 24 ). Low-dose BAM15 remodeled the tumor metabolic microenvironment, activating the AMPK/AKT signaling pathway and promoting futile energy consumption in the tricarboxylic acid (TCA) cycle, thereby increasing CD8 + T cell numbers and granzyme B levels and enhancing anti-tumor immune responses ( 26 ). Given biological differences among tumor cell lines, this study employed RNA-seq to systematically identify differentially expressed genes and conducted cross-validation using GO, KEGG, and GSEA analyses to elucidate the molecular basis of BAM15's biological effects. The results revealed that BAM15 regulates the tumor microenvironment through an inflammation-metabolism axis, exerting dual regulatory effects. On one hand, BAM15 activates pro-inflammatory pathways (e.g., TNF, IL-17, NF-κB, and JAK-STAT), MAPK, and PI3K-Akt pathways, as well as metabolic pathways (e.g., glycine metabolism), directly or indirectly driving glycolysis and oxidative phosphorylation and promoting inflammation and metabolic reprogramming. On the other hand, BAM15 inhibits DNA replication, cell cycle progression, and related metabolic pathways (e.g., cytochrome P450). BAM15 functions as a mitochondrial uncoupler with potency equivalent to conventional uncouplers such as FCCP and DNP, while displaying reduced cytotoxicity (26, 32). Importantly, it specifically depolarizes mitochondria without impacting plasma membrane potential, effectively mitigating off-target effects associated with plasma membrane depolarization (33). These advantages endow BAM15 with promising potential for application in lung cancer treatment. While this study preliminarily confirmed BAM15's anti-tumor effects in lung cancer, we also observed significant changes in the IL1A gene in lung cancer cells following BAM15 treatment. IL1A is a nuclear alarmin released by dying cells, capable of weakening the immunosuppressive capacity of tumor-associated myeloid cells and promoting the recruitment and effector function of CD8 + T cells ( 27 – 29 ). Additionally, patients with low IL1A expression typically exhibit better clinical outcomes ( 26 ). Based on these findings, we speculate that IL1A may be a key gene mediating BAM15's pro-inflammatory effects and potential resistance. Future research will investigate BAM15’s pro-inflammatory and immune modulatory mechanisms, as well as its therapeutic potential in combination with chemotherapeutic drugs to overcome drug resistance. Additionally, this study focused solely on A549 and H1299 lung cancer cell lines. Given the heterogeneity of lung cancer cell lines, future research should extend these findings to additional models to uncover broader therapeutic targets. Conclusion In the present study, BAM15 exerts in vitro and in vivo anti-tumor effects by inhibiting proliferation, inducing cell cycle arrest and apoptosis in lung cancer cells. Moreover, BAM15 also inhibited migration and invasion in A549 cells. These findings provide important insights for the clinical application of BAM15, suggesting its potential as a promising therapeutic agent for lung cancer. Declarations Acknowledgements Not applicable. Author contributions MYZ and NQW conceived and designed the experiments; MYZ and YFZ performed the experiments; MYZ and YNW analyzed the data and interpreted the data; HYW and SJM contributed to the provision of reagents, materials, and analysis tools; MYZ wrote original draft; and MYZ, SJM and HYW reviewed and edited the manuscript draft. All authors checked and confirmed the authenticity of all the raw data. All authors read and approved the final version of the manuscript. Funding The present study was supported by the National Nature Science Foundation of China (grant no. 82273051). Data availability The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics & Bioinformatics 2025) in National Genomics Data Center (Nucleic Acids Res 2025), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: HRA015662) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa. All other data generated in the present study may be requested from the corresponding author. Competing interests The authors declare that they have no competing interests. Consent for publication All authors agree to the publication of the article. Ethics approval and consent to participate The present study was approved (approval no. L102012020120J) by the animal Ethics Committee of Sun Yat-sen University Cancer Center (Guangzhou, China). References Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-63. Thai AA, Solomon BJ, Sequist LV, Gainor JF, Heist RS. Lung cancer. Lancet. 2021;398(10299):535-54. Jha SK, De Rubis G, Devkota SR, Zhang Y, Adhikari R, Jha LA, et al. Cellular senescence in lung cancer: Molecular mechanisms and therapeutic interventions. Ageing Res Rev. 2024;97:102315. Sun CY, Cao D, Ren QN, Zhang SS, Zhou NN, Mai SJ, et al. Combination Treatment With Inhibitors of ERK and Autophagy Enhances Antitumor Activity of Betulinic Acid in Non-small-Cell Lung Cancer In Vivo and In Vitro. Front Pharmacol. 2021;12:684243. Abdul Satar N, Ismail MN, Yahaya BH. Synergistic Roles of Curcumin in Sensitising the Cisplatin Effect on a Cancer Stem Cell-Like Population Derived from Non-Small Cell Lung Cancer Cell Lines. Molecules. 2021;26(4). Li Y, Yan B, He S. Advances and challenges in the treatment of lung cancer. Biomed Pharmacother. 2023;169:115891. Xue M, Ma L, Zhang P, Yang H, Wang Z. New insights into non-small cell lung cancer bone metastasis: mechanisms and therapies. Int J Biol Sci. 2024;20(14):5747-63. Su PL, Furuya N, Asrar A, Rolfo C, Li Z, Carbone DP, et al. Recent advances in therapeutic strategies for non-small cell lung cancer. J Hematol Oncol. 2025;18(1):35. Wang M, Herbst RS, Boshoff C. Toward personalized treatment approaches for non-small-cell lung cancer. Nat Med. 2021;27(8):1345-56. Zhu Y, Dai Z. HSP90: A promising target for NSCLC treatments. Eur J Pharmacol. 2024;967:176387. Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. Nat Rev Cancer. 2011;11(2):85-95. DeBerardinis RJ, Chandel NS. Fundamentals of cancer metabolism. Sci Adv. 2016;2(5):e1600200. Zong Y, Li H, Liao P, Chen L, Pan Y, Zheng Y, et al. Mitochondrial dysfunction: mechanisms and advances in therapy. Signal Transduct Target Ther. 2024;9(1):124. Greene J, Segaran A, Lord S. Targeting OXPHOS and the electron transport chain in cancer; Molecular and therapeutic implications. Semin Cancer Biol. 2022;86(Pt 2):851-9. Du H, Xu T, Yu S, Wu S, Zhang J. Mitochondrial metabolism and cancer therapeutic innovation. Signal Transduct Target Ther. 2025;10(1):245. Childress ES, Alexopoulos SJ, Hoehn KL, Santos WL. Small Molecule Mitochondrial Uncouplers and Their Therapeutic Potential. J Med Chem. 2018;61(11):4641-55. Jiang H, Zhang XW, Liao QL, Wu WT, Liu YL, Huang WH. Electrochemical Monitoring of Paclitaxel-Induced ROS Release from Mitochondria inside Single Cells. Small. 2019;15(48):e1901787. Alasadi A, Cao B, Guo J, Tao H, Collantes J, Tan V, et al. Mitochondrial uncoupler MB1-47 is efficacious in treating hepatic metastasis of pancreatic cancer in murine tumor transplantation models. Oncogene. 2021;40(12):2285-95. Alasadi A, Chen M, Swapna GVT, Tao H, Guo J, Collantes J, et al. Effect of mitochondrial uncouplers niclosamide ethanolamine (NEN) and oxyclozanide on hepatic metastasis of colon cancer. Cell Death Dis. 2018;9(2):215. Shrestha R, Johnson E, Byrne FL. Exploring the therapeutic potential of mitochondrial uncouplers in cancer. Mol Metab. 2021;51:101222. Axelrod CL, King WT, Davuluri G, Noland RC, Hall J, Hull M, et al. BAM15-mediated mitochondrial uncoupling protects against obesity and improves glycemic control. EMBO Mol Med. 2020;12(7):e12088. Alexopoulos SJ, Chen SY, Brandon AE, Salamoun JM, Byrne FL, Garcia CJ, et al. Mitochondrial uncoupler BAM15 reverses diet-induced obesity and insulin resistance in mice. Nat Commun. 2020;11(1):2397. Zunica ERM, Axelrod CL, Cho E, Spielmann G, Davuluri G, Alexopoulos SJ, et al. Breast cancer growth and proliferation is suppressed by the mitochondrial targeted furazano[3,4-b]pyrazine BAM15. Cancer Metab. 2021;9(1):36. Gao ZX, Cui ZL, Zhou MR, Fu Y, Liu F, Zhang L, et al. The new mitochondrial uncoupler BAM15 induces ROS production for treatment of acute myeloid leukemia. Biochem Pharmacol. 2022;198:114948. Serasinghe MN, Gelles JD, Li K, Zhao L, Abbate F, Syku M, et al. Dual suppression of inner and outer mitochondrial membrane functions augments apoptotic responses to oncogenic MAPK inhibition. Cell Death Dis. 2018;9(2):29. Jiang X, Fan Z, Zhang Z, Zeng F, Sun T, Li Y, et al. Tumor metabolome remolded by low dose mitochondrial uncoupler elicites robust CD8(+) T cell response. Cell Death Discov. 2025;11(1):291. Liu M, Zhu B, Li QJ. IL-1 signaling in aging and cancer: An inflammaging feedback loop unveiled. Cancer Cell. 2024;42(11):1820-2. Park MD, Le Berichel J, Hamon P, Wilk CM, Belabed M, Yatim N, et al. Hematopoietic aging promotes cancer by fueling IL-1⍺-driven emergency myelopoiesis. Science. 2024;386(6720):eadn0327. Hanggi K, Li J, Gangadharan A, Liu X, Celias DP, Osunmakinde O, et al. Interleukin-1alpha release during necrotic-like cell death generates myeloid-driven immunosuppression that restricts anti-tumor immunity. Cancer Cell. 2024;42(12):2015-31 e11. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 21 Apr, 2026 Reviews received at journal 17 Apr, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviewers agreed at journal 08 Apr, 2026 Reviews received at journal 08 Apr, 2026 Reviewers agreed at journal 07 Apr, 2026 Reviewers invited by journal 26 Mar, 2026 Editor assigned by journal 09 Jan, 2026 Submission checks completed at journal 09 Jan, 2026 First submitted to journal 08 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8556496","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":613164300,"identity":"9affba3a-a42a-4a60-adba-b0d3a27f1d87","order_by":0,"name":"Mei-Yin Zhang","email":"","orcid":"","institution":"State Key Laboratory of Oncology in South China, Guangdong Provincial Clinical Research Center for Cancer, Sun Yat-sen University Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Mei-Yin","middleName":"","lastName":"Zhang","suffix":""},{"id":613164301,"identity":"d0becd52-f57d-42f5-8da0-04a8bc2af8ca","order_by":1,"name":"Nuo-Qing Weng","email":"","orcid":"","institution":"State Key Laboratory of Oncology in South China, Guangdong Provincial Clinical Research Center for Cancer, Sun Yat-sen University Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Nuo-Qing","middleName":"","lastName":"Weng","suffix":""},{"id":613164302,"identity":"a1583bbc-8ce1-4c41-a81f-51d11b2fd98d","order_by":2,"name":"Yu-Feng Zhou","email":"","orcid":"","institution":"State Key Laboratory of Oncology in South China, Guangdong Provincial Clinical Research Center for Cancer, Sun Yat-sen University Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Yu-Feng","middleName":"","lastName":"Zhou","suffix":""},{"id":613164303,"identity":"5dc8b035-478b-4060-bde0-47e572f968c3","order_by":3,"name":"Yue-Ning Wang","email":"","orcid":"","institution":"State Key Laboratory of Oncology in South China, Guangdong Provincial Clinical Research Center for Cancer, Sun Yat-sen University Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Yue-Ning","middleName":"","lastName":"Wang","suffix":""},{"id":613164305,"identity":"738b197b-14bc-497c-9a25-8f0cdb23a6ca","order_by":4,"name":"Shi-Juan Mai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYFACxgZmBh4b0rWkkWgPMwPDYRKU67Yfbv5cIHPe3uD8GcMPPxhs8uUdmJ89wKfF7Exim/QMntuJG27kGEv2MKRZbjzAZm6AV8uBxDZmHp7bCQY3eMxALjQwbOBhk8Cr5fzD5s88POdADiNWy43EBmkengOMGw7kQLTIMxDU8rANqCU5ceaNtGLJHoM0AwNmNjMCDkt//Jm3x86e7/zhjR9+VNgYyLc3P8OrBQwYexgYFA6AWMCgMiAujn4wMMg3QNlwxigYBaNgFIwCKAAAl6lD0/fY7bUAAAAASUVORK5CYII=","orcid":"","institution":"State Key Laboratory of Oncology in South China, Guangdong Provincial Clinical Research Center for Cancer, Sun Yat-sen University Cancer Center","correspondingAuthor":true,"prefix":"","firstName":"Shi-Juan","middleName":"","lastName":"Mai","suffix":""},{"id":613164308,"identity":"1e63ed12-19f5-4d88-b66b-d8f8958bcf27","order_by":5,"name":"Hui-Yun Wang","email":"","orcid":"","institution":"State Key Laboratory of Oncology in South China, Guangdong Provincial Clinical Research Center for Cancer, Sun Yat-sen University Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Hui-Yun","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-01-09 03:53:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8556496/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8556496/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105787969,"identity":"1b2f80fc-7531-40ef-801f-db443143316a","added_by":"auto","created_at":"2026-03-31 06:57:52","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5274555,"visible":true,"origin":"","legend":"\u003cp\u003eBAM15 inhibits proliferation of A549 and H1299 cells in a dose- and time-dependent manner. (A) IC₅₀ values of BAM15 in A549 and H1299 cells after 48 h treatment. (B) Cell viability at 24, 48, and 72 h following BAM15 exposure. (C) EdU incorporation assays showed decreased DNA synthesis in A549 and H1299 cells following 48 h of BAM15 treatment. (D) Colony formation assay showing dose-dependent inhibition of clonogenic growth. Data are presented as mean ± SD (n ≥ 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001. IC₅₀, half-maximal inhibitory concentration.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/765dcac9f71b6b6d0dabd009.jpg"},{"id":105787944,"identity":"a1237d65-a6a5-4f5a-bee5-ffd527fdb067","added_by":"auto","created_at":"2026-03-31 06:57:46","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5103352,"visible":true,"origin":"","legend":"\u003cp\u003eBAM15 treatment inhibited cell proliferation and induced apoptosis in A549 and H1299 cells. (A) Effect of BAM15 on the cell cycle. (B) The dose-dependent effect of different concentrations of BAM15 on cell apoptosis. A549 and H1299 cell lines were treated with BAM15 at various concentrations for 48 hours. Apoptotic cells were quantified using Annexin V-FITC/PI double staining followed by flow cytometry analysis. Three independent experiments were conducted. Data are presented mean ± SD; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/3f04f1be02ef933ec598fa5a.jpg"},{"id":105787970,"identity":"c0ce169a-dc05-4165-911c-1dece80faa1f","added_by":"auto","created_at":"2026-03-31 06:57:52","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5206844,"visible":true,"origin":"","legend":"\u003cp\u003eBAM15 inhibits A549 cell migration and invasion. (A) Wound healing assay (×4 magnification) showing BAM15-induced inhibition of A549 cell migration. (B) Transwell assays demonstrating the suppressive effect of BAM15 on A549 cell migration (without Matrigel) and invasion (with Matrigel). Three independent experiments were conducted. Data are presented mean ± SD; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/e5dce8c30c398537ea5f80b4.jpg"},{"id":105787946,"identity":"8bc13af7-b696-4475-aef2-22993723a8a1","added_by":"auto","created_at":"2026-03-31 06:57:47","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6389492,"visible":true,"origin":"","legend":"\u003cp\u003eComprehensive analysis of differentially expressed genes after BAM15 treatment. (A) The Venn diagram illustrates the overlap of DEGs between BAM15-treated and vehicle control groups. (B) The volcano plot depicts DEGs between BAM15 and vehicle control groups. Gray dots represent genes with no significant expression changes (|log2FC|\u0026lt;1, \u003cem\u003eP\u003c/em\u003e\u0026gt;0.05), while colored dots indicate significant DEGs (red: up-regulated; blue: down-regulated). (C) The heatmap visualizes the expression patterns of DEGs between BAM15 and vehicle control groups, with hierarchical clustering based on expression similarity. (D) GO enrichment analysis revealed that these DEGs were significantly enriched in tumor-related pathways. (E) The chord diagram demonstrates the relationships between significantly enriched GO terms and their associated DEGs, highlighting key biological processes. (F) KEGG enrichment analysis showed that these DEGs were significantly enriched in tumor-related pathways. The right panel displays enriched pathways, while the left panel lists DEGs within each pathway sorted by log2FC values. (G) GSEA identified tumor-related pathways as significantly enriched in BAM15-treated samples, with NES and \u003cem\u003eP\u003c/em\u003e-values indicated.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/fdaaf7e4dbe8f50f3e80454e.jpg"},{"id":105787922,"identity":"3dc021f2-4f22-4d8a-ba43-36befa01854a","added_by":"auto","created_at":"2026-03-31 06:57:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3423310,"visible":true,"origin":"","legend":"\u003cp\u003eBAM15 inhibits cell proliferation in A549 cell. (A) Heatmap showing transcriptional alterations in key cell cycle regulators after BAM15 treatment in A549 cell. (B) qRT-PCR analysis demonstrated that BAM15 significantly downregulated the mRNA expression levels of CDK2, CDK6 and PCNA in A549 cell. (C) Western blot analysis showed that BAM15 significantly reduced the total protein expression levels of CDK2, CDK6 and PCNA in A549 cell. Data are presented as mean ± SD; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/0a82e2f5d593c6ab2d8c0ed5.png"},{"id":105787920,"identity":"d09f9164-0288-46ca-97ae-9a492b745791","added_by":"auto","created_at":"2026-03-31 06:57:41","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":7649738,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo effects of BAM15 on tumor growth, mouse body weight, and PCNA expression in A549 subcutaneous xenografts. (A) A549 cells were subcutaneously injected into the right flank of mice. Mice were intragastrically administrated with vehicle or BAM15 (30 μM/kg) for three weeks. Body weight changes in mice were monitored over the entire treatment period. (B) Representative images of xenotransplanted tumors in each treatment group. (C) Growth curves of subcutaneous xenograft tumor volume during the treatment period. (D) Final tumor weight of mice in each group at the end of the treatment period. (E) Summary of PCNA expression levels from IHC analysis. (F) Representative IHC staining of PCNA (scale bar:100 μm). Datas are presented as the mean ± SD; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/ca62525926568ebed1495926.jpg"},{"id":105788073,"identity":"e8ab6075-8284-49b6-8968-ee5d6ea63ec9","added_by":"auto","created_at":"2026-03-31 06:58:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":34218418,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8556496/v1/b757c074-6214-43c8-82b7-5a49b56da512.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mitochondrial uncoupler BAM15 attenuates cell proliferation and tumor growth in non-small cell lung cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLung cancer is the leading cause of cancer-related deaths worldwide, with 1.8\u0026nbsp;million annual deaths (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Among these cases, non-small cell lung cancer (NSCLC) accounts for 80\u0026ndash;85% of all lung cancer diagnoses (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e); however, approximately 70% of patients are diagnosed at an advanced stage, resulting in an overall 5-year survival rate of only 18% (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Conventional treatment modalities for NSCLC include surgery, radiotherapy, and chemotherapy (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). For early-stage disease (stage I or II), radical surgery remains the cornerstone, typically followed by adjuvant therapy. In contrast, advanced-stage disease (stage III or IV) is primarily managed with chemotherapy or radiotherapy (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Approximately 30\u0026ndash;40% of NSCLC patients are diagnosed with distant metastasis, and the resulting organ dysfunction due to widespread tumor spread often precludes them from undergoing curative surgery (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). For this population, precision therapies such as targeted therapy, immunotherapy, antibody-drug conjugates (ADCs), and bispecific antibodies are being increasingly integrated into first-line treatment regimens (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). However, clinical practice continues to show that some patients face challenges such as therapeutic bottlenecks or treatment intolerance (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Thus, the current treatment dilemma underscores the urgent need to develop new antitumor drugs (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMitochondria, as the primary energy-producing organelles and critical signaling regulators in eukaryotic cells, play a central role in maintaining cellular bioenergetics, including ATP generation through oxidative phosphorylation (OXPHOS), and participate in essential metabolic pathways such as the tricarboxylic acid (TCA) cycle and fatty acid oxidation (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). However, mitochondrial dysfunction has been increasingly recognized as a hallmark of tumorigenesis and cancer progression (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Emerging evidence indicates that tumor cells undergo profound metabolic reprogramming to sustain uncontrolled proliferation, a process often characterized by suppressed OXPHOS, accumulation of TCA cycle intermediates, and impaired electron transport chain (ETC) activity (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). This metabolic shift, known as the \"Warburg effect\", not only sustains the supply of energy and biosynthetic precursors but also drives key oncogenic processes, including cellular transformation, evasion of apoptosis, and enhanced proliferative potential (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Notably, ETC dysfunction disrupts mitochondrial membrane potential, leading to excessive production of reactive oxygen species (ROS) (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The resultant oxidative stress further exacerbates genomic instability, activates pro-survival signaling pathways, and promotes epithelial-mesenchymal transition (EMT), collectively driving tumor malignancy (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). The intricate link between mitochondrial dysfunction, ROS imbalance, and tumor progression underscores its potential as a therapeutic target, offering promising avenues for precision oncology interventions (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMitochondrial uncouplers are a class of targeted drugs that disrupt the proton gradient across the inner mitochondrial membrane, block ADP phosphorylation, and cause energy to be released as heat instead of producing ATP (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Traditional mitochondrial uncouplers such as carbonyl cyanide m-chlorophenyl hydrazone (CCCP), carbonyl cyanide p-trifluoromethoxyphenyl hydrazone (FCCP), and 2,4-dinitrophenol (DNP) can inhibit tumor growth by disrupting mitochondrial membrane potential (ΔΨm), but their effects vary (\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The novel mitochondrial uncoupler BAM15 (N5,N6-bis(2-Fluorophenyl)[1,2,5]oxidiazolo[3,4-b]pyrazine-5,6-diamine) is a well-tolerated and bioavailable protonophore that restores lipid metabolism and improves glycemic control in preclinical models of obesity(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). Beyond its metabolic effects, BAM15 exhibits significant anticancer properties(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). It may suppress the proliferation of aggressive breast cancer cells by increasing proton leak and reducing mitochondrial membrane potential (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). In acute myeloid leukemia (AML), BAM15 significantly inhibited proliferation and induced apoptosis while demonstrating lower cytotoxicity toward normal cells (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Additionally, it synergizes with targeted drugs in melanoma, markedly enhancing apoptosis and inhibiting colony formation (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). However, the role of BAM15 in lung cancer remains unexplored. In this study, we investigate its effects on lung cancer cell proliferation, migration, and invasion through in vitro and in vivo experiments.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eExperimental animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 16 male BALB/c-nu nude mice (specific pathogen-free [SPF]-grade), aged 6 weeks and weighing 21\u0026ndash;27 g, were obtained from the Guangdong Provincial Laboratory Animal Center (Animal Production License No. SCXK (Yue) 2022-0002). All mice were housed in a specific pathogen-free (SPF) facility at the Experimental Animal Facility of Sun Yat-sen University Cancer Center. The environment was maintained under controlled conditions with a relative humidity of 50% and a temperature range of 22\u0026ndash;25\u0026deg;C. Mice had ad libitum access to food and water and were subjected to a 12-hour light-dark cycle regulated by an automated light control system. Animal care and experimental procedures were conducted in strict accordance with the 3R principles (Replacement, Reduction, Refinement). Humane endpoints are established to intervene before animals experience unnecessary pain or distress, and death is never used as an endpoint in the experiment. Specific humane endpoints include tumor volume exceeding 10% of initial body weight, tumor ulceration or infection, and weight loss \u0026ge;15%. Subcutaneous tumors were measured every 3 days using a vernier caliper to record length and width, with volume calculated using the formula V = length \u0026times; width\u0026sup2; \u0026times; 0.5. Body weight was also monitored every 2 days throughout the study. At the experimental endpoint, euthanasia was performed using a \u0026zwnj;gradual CO₂ inhalation method\u0026zwnj; in a 10 L euthanasia chamber. CO₂ gas was infused at a constant flow rate of 5.8 L/min for 3 minutes, achieving a total displacement rate of 174% of the chamber volume. Subsequently, animal death was confirmed by observing the absence of vital signs, including respiration, heartbeat, and neural reflexes (e.g., corneal reflex), for a minimum of 5 minutes. This study was approved by the Experimental Animal Ethics Committee of Sun Yat-sen University Cancer Center (Ethics Approval No. L102012020120J). All animal experiments were performed in compliance with guidelines established by the International Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC) and the National Research Council\u0026rsquo;s Guide for the Care and Use of Laboratory Animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell cultures and reagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman lung cancer cell lines A549 and H1299 were obtained from the State Key Laboratory of Oncology in South China. A549 cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.), while H1299 cells were cultured DMEM medium (Gibco, Thermo Fisher Scientific, Inc.). Both media were supplemented with 10% fetal bovine serum (FBS, ExCell Bio, China.) and 1% penicillin/streptomycin (KeyGen Biotech, China). The cells were maintained at 37\u0026deg;C in a humidified incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e (Thermo Fisher Scientific, Inc.). When cells reached 80-90% confluency, they were detached using 0.25% EDTA-trypsin (Gibco, Thermo Fisher Scientific, Inc.) or gently pipetted off.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHalf-Maximal Inhibitory Concentration (IC50) Assay\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eA549 and H1299 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 1\u0026times;10\u0026sup3; cells/well and incubated overnight at 37\u0026deg;C in a 5% CO₂ atmosphere. After cell adherence, the medium was replaced with fresh 10% FBS medium containing BAM15 (Selleck, China; at concentrations ranging from 0.0195 to 40 \u0026mu;M (2-fold serial dilution). Blank (medium only) and control (cells + medium) groups were included. After 48 h of incubation, the medium was removed, and 100 \u0026mu;L of 10% Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan) in fresh medium was added to each well. The plates were then incubated in the dark for 2 hours. Absorbance (OD value) was measured at 450 nm using a Synergy HTX multi-mode microplate reader (BioTek, USA). The cell viability inhibition rate was calculated as: Inhibition rate (%) = [(Control OD \u0026ndash; Experimental OD) / (Control OD \u0026ndash; Blank OD)] \u0026times; 100%. The IC₅₀ value of BAM15 was determined by fitting the dose-response curve using GraphPad Prism 9.0.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Proliferation Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 and H1299 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 1\u0026times;10\u0026sup3; cells/well and cultured overnight. For A549 cells: low, medium, and high doses of BAM15 (2, 4, 6 \u0026mu;M) were added in 10% FBS medium, while H1299 cells were treated with 4, 6, or 8 \u0026mu;M BAM15. Blank (medium only) and control (cells + medium) groups were included, with three replicate wells per group. At 24, 48, and 72 h post-treatment, the medium was replaced with 100 \u0026mu;L of fresh medium containing 10% CCK-8, followed by incubation in the dark for 2 h. Cell viability was assessed by measuring the absorbance at 450 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEdU Incorporation Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 and H1299 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 1\u0026times;10⁵ cells/well and cultured for 24 hours. After adherence, cells were gently washed with PBS. The experimental group was treated with medium containing 5 \u0026mu;M BAM15 (control: equal volume DMSO) until cells reached ~70% confluence. For EdU labeling, cells were incubated with 10 \u0026mu;M EdU in fresh medium for 2 h in the dark. Following PBS washes, cells were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.3% Triton X-100 for 15 min. The Click reaction was carried out following the manufacturer\u0026rsquo;s protocol of the EdU kit (Beyotime Biotechnolog, China), with a 30-min incubation in the dark. After washing, nuclei were counterstained with Hoechst 33342 for 10 min. Five random fields per well were imaged using an inverted fluorescence microscope. EdU-positive cells were quantified, and experiments were performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony-formation Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 and H1299 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 500 cells/well and cultured overnight. Grouping and treatment were performed identically to the Cell Proliferation Assay, with a control group (medium containing an equivalent volume of DMSO) included in parallel. The cells were continuously cultured for 14 days. After incubation, the medium was aspirated, and the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 10 min, and stained with 0.1% crystal violet solution at room temperature for 30 min. Following gentle rinsing with running water, the plates were air-dried, and the number of cell colonies was counted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Cycle Analysis by Flow Cytometry\u003c/strong\u003e\u003cstrong\u003e\u0026zwnj;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 and H1299 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 2\u0026times;10⁵ cells/well and cultured for 24 hours. After adherence, the cells were gently washed with PBS and treated with fresh medium containing 5 \u0026mu;M BAM15 (control: DMSO vehicle) for 48 hours. The cells were then trypsinized, washed with PBS, and fixed overnight at 4\u0026deg;C in 500 \u0026mu;L of 70% ethanol. Following centrifugation, the cells were washed with PBS, incubated with 100 \u0026mu;L RNaseA at 37\u0026deg;C for 30 min, and stained with 400 \u0026mu;L PI (KeyGen Biotech, China). Cell cycle distribution was analyzed using a CytoFLEX flow cytometer (Beckman Coulter, Germany) and FlowJo software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Apoptosis assays\u003c/strong\u003e\u003cstrong\u003e\u0026zwnj;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 and H1299 cells in logarithmic growth phase were seeded in 6-well plates at 2\u0026times;10⁵ cells/well and cultured overnight. Grouping and treatment were performed identically to the Cell Proliferation Assay, with a control group (medium containing an equivalent volume of DMSO) included in parallel. After 48 h of further incubation, cells were harvested using 0.25% trypsin without EDTA (KeyGen Biotech, China), washed twice with pre-cooled PBS, and resuspended in Binding Buffer. For staining, 5 \u0026mu;L Annexin V-FITC and 5 \u0026mu;L propidium iodide (PI) solution (KeyGen Biotech, China) were added to the cell suspension, followed by gentle mixing and incubation in the dark at room temperature for 15 min. \u0026nbsp;Stained cells were analyzed immediately using a CytoFlex flow cytometer (Beckman Coulter, Germany), with data processed within 1 hour of sample processing. FlowJo software (v10.8) was used for data analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScratch Assay\u003c/strong\u003e\u003cstrong\u003e\u0026zwnj;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 2\u0026times;10⁵ cells/well and cultured to form a confluent monolayer (\u0026gt;90% adherence). A sterile 200 \u0026mu;L pipette tip was used to create parallel scratches (three replicates per group, width: 800\u0026plusmn;50 \u0026mu;m). After discarding the medium and gently washing with PBS, the experimental group was treated with serum-free medium containing 5 \u0026mu;M BAM15, while the control group received serum-free medium with an equivalent volume of DMSO. Cell migration was monitored by capturing images at 0, 24, and 48 hours using an inverted microscope (Nikon, Japan). The migration distance was measured using ImageJ software, and the percentage of wound closure was calculated to quantify cell migration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Migration Assay (Transwell Chamber)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 cells in the logarithmic growth phase were resuspended in serum-free medium at a density of 1\u0026times;10⁵ cells/mL. For the experimental group, 200 \u0026mu;L of the cell suspension was seeded into the upper chamber of a Transwell (8 \u0026mu;m pore size, Corning, USA) insert, while the lower chamber received 600 \u0026mu;L of complete medium supplemented with 10% FBS and 5 \u0026mu;M BAM15. The control group was treated identically but with complete medium lacking BAM15. After 24 hours of incubation, non-migrated cells were removed from the upper chamber surface using a cotton swab. Migrated cells on the lower membrane surface were fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet for 20 min, gently rinsed with PBS, and quantified by counting cells in six random non-overlapping fields using ImageJ software.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026zwnj;\u003cstrong\u003eMatrigel Coating and Invasion Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Matrigel matrix (Corning, USA) was diluted 1:5 with pre-cooled serum-free medium on ice, and 80 \u0026mu;L of the diluted solution was evenly coated onto the upper surface of the Transwell chamber (8 \u0026mu;m pore size, Corning, USA). After polymerization at 37\u0026deg;C with 5% CO₂ for 5 hours, the chambers were washed with PBS to remove unpolymerized liquid, followed by equilibration with 100 \u0026mu;L serum-free medium (37\u0026deg;C, 30 min). A549 cells in the logarithmic growth phase were resuspended at 2\u0026times;10⁵ cells/mL. For the experimental group, 200 \u0026mu;L cell suspension was added to the upper chamber, while the lower chamber contained 600 \u0026mu;L of complete medium supplemented with 10% FBS and 5 \u0026mu;M BAM15. The control group received complete medium without BAM15. After 24 hours of incubation, non-invaded cells and Matrigel were removed with a cotton swab. Invaded cells were fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet for 20 min, rinsed with PBS, and counted in six random fields per membrane using ImageJ.\u003c/p\u003e\n\u003cp\u003e\u0026zwnj;\u003cstrong\u003eRNA sequencing (RNA-seq)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 cells in the logarithmic growth phase were cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin (100 U/mL) for 24 hours. After adherence, the medium was aspirated, and cells were gently washed with PBS. Fresh medium containing 5 \u0026mu;M BAM15 (control: DMSO vehicle) was added, with three biological replicates per group. After 48 h of treatment, control and BAM15-treated A549 cells were collected for transcriptome sequencing. The sequencing experiment was conducted on an Illumina NovaSeq 6000 platform by Suzhou Panomike Biomedical Technology Co., Ltd.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatics Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferentially expressed genes (DEGs) between the two groups were identified with DESeq2 (v1.38.3), with the threshold set at adjusted \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 and |log\u003csub\u003e2\u003c/sub\u003e Fold Change|\u0026gt;1. Functional enrichment analysis of DEGs, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, was conducted using R package clusterProfiler to investigate the biological processes and signaling pathways affected by BAM15 treatment.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAdditionally, further enrichment analysis and Gene Set Enrichment Analysis (GSEA) of DEGs were performed through the bioinformatics platform (https://www.bioinformatics.com.cn).\u003c/p\u003e\n\u003cp\u003e\u0026zwnj;\u003cstrong\u003eQuantitative reverse transcription polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted using TRIzol reagent (Invitrogen, USA). Approximately 1.5\u0026times;10⁶ cells were lysed in 1 mL TRIzol and kept on ice. After adding 200 \u0026mu;L chloroform, the mixture was vortexed for 10 s and incubated at room temperature for 15 min. Following centrifugation at 12,000 \u0026times; g for 10 min at 4\u0026deg;C, the aqueous phase was transferred to a new tube. An equal volume of isopropanol was added, gently mixed, and incubated at room temperature for 10 min. After another centrifugation (12,000 \u0026times; g, 10 min, 4\u0026deg;C), the RNA pellet was washed twice with 75% ethanol, air-dried for 5 min, and resuspended in 20 \u0026mu;L DEPC-treated water. RNA concentration and purity (A260/280 ratio) were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA). For cDNA synthesis, 1 \u0026mu;g of total RNA was reverse-transcribed using the Evo M-MLV RT kit (Cat. No. AG11701, Accura Biotechnology, China). The SYBR Green reagent used was the SYBR Green Premix Pro Taq HS qPCR kit (Cat. No. AG11706, Accura Biotechnology, China). qRT-PCR was performed using 100 ng cDNA, 10 \u0026mu;L 2\u0026times; SYBR Green mix, 0.4 \u0026mu;L each of forward and reverse primers, and RNase-free water to a final volume of 20 \u0026mu;L. Amplification conditions were as follows: 95\u0026deg;C for 30 s, followed by 40 cycles of 95\u0026deg;C for 5 s, 60\u0026deg;C for 30 s, and 70\u0026deg;C for 10 s. GAPDH served as the internal reference, and relative gene expression was calculated using the 2\u003csup\u003e-\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method. The primer sequences are shown in Table 1.\u003c/p\u003e\n\u003cp\u003eTable 1. Sequences of primers used for qRT-PCR\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eGene name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003ePrimer sequence (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eF: GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eR: GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCDK2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eF: CCAGGAGTTACTTCTATGCCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eR: TTCATCCAGGGGAGGTACAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCDK4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eF: ATGGCTACCTCTCGATATGAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eR: CATTGGGGACTCTCACACTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCDK6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eF: CCAGATGGCTCTAACCTCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eR: AACTTCCACGAAAAAGAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003ePCNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eF:\u0026nbsp;ACACTAAGGGCCGAAGATAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 412px;\"\u003e\n \u003cp\u003eR:\u0026nbsp;ACAGCATCTCCAATATGGCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eF, forward; R, reverse.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot (WB)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal cellular proteins were extracted using RIPA lysis buffer (Beyotime Biotechnology, China) supplemented with PMSF protease inhibitor. Protein concentrations were determined using a BCA assay kit (Beyotime Biotechnology, China). Equal amounts of protein were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk at room temperature for 2 h. After washing, membranes were incubated overnight at 4\u0026deg;C with primary antibodies against CDK2 (1:1000, Abcam, ab205718), CDK6 (1:1000, CST, #30483), PCNA (1:1000, Affinity, #AF0239), and GAPDH (1:5000, Abcam, ab181602). Following incubation with HRP-conjugated secondary antibodies (goat anti-mouse or anti-rabbit, 1:5000, Proteintech) for 2 h at room temperature, protein bands were visualized using ECL reagent and captured by a gel imaging system. Band intensities were quantified using ImageJ software, with GAPDH as the loading control to normalize relative protein expression levels.\u003c/p\u003e\n\u003cp\u003e\u0026zwnj;\u003cstrong\u003eXenograft tumor experiment\u003c/strong\u003e\u003cstrong\u003e\u0026zwnj;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSixteen 6-week-old male BALB/c-nu nude mice (SPF-grade) were housed in an SPF environment at the Experimental Animal Facility of Sun Yat-sen University Cancer Center and managed in accordance with the 3R principles. After a 1-week acclimation period, A549 cells in the logarithmic growth phase were resuspended in sterile saline (2 \u0026times; 10⁷ cells/mL) and subcutaneously inoculated into the right axilla of each mouse (4 \u0026times; 10⁶ viable cells/0.1 mL). When tumors reached ~100 mm\u0026sup3; in volume, mice were randomly assigned to two groups (n=8 per group): \u0026zwnj;the control group\u0026zwnj; received 0.2 mL vehicle (0.4% CMC-Na + 0.2% Tween-80), while the \u0026zwnj;BAM15 group\u0026zwnj; was administered 5 mg/kg BAM15 in the same vehicle volume. Mice were orally administered the treatment every 2 days for 4 weeks. Tumor volume (V = length \u0026times; width\u0026sup2; \u0026times; 0.5) and body weight were measured periodically. After sacrifice, tumors were excised and weighed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry (IHC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNude mouse tumor tissues were fixed in 4% paraformaldehyde, paraffin-embedded, and sectioned into 4 \u0026mu;m slices. After deparaffinization in xylene and rehydration through graded ethanol, antigen retrieval was performed using EDTA buffer (pH 8.0) with heat treatment. Sections were blocked with 3% BSA at room temperature for 30 min, followed by overnight incubation at 4\u0026deg;C with a PCNA primary antibody (1:1000). After three PBS washes, HRP-labeled secondary antibody was applied for 1 hour at 37\u0026deg;C. DAB staining and hematoxylin counterstaining were then performed. Positive expression was identified as brown-yellow staining under microscopy (\u0026times;400). Staining intensity was scored as follows: 0 (no color), 1 (light-yellow), 2 (brown-yellow), 3 (brown). The percentage of positive cells was scored as: 0 (0%), 1 (1-25%), 2 (26-50%), 3 (51-75%) or 4 (76-100%). A total score (range: 0-12) was calculated by multiplying the intensity and percentage scores.\u003c/p\u003e\n\u003cp\u003e\u0026zwnj;\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003cstrong\u003e\u0026zwnj;\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGraphPad Prism 9.0 was used to generate BAM15 dose-response curves and calculate IC\u003csub\u003e50\u003c/sub\u003e values. Statistical analyses were performed using SPSS software (version 30.0, IBM Corp., Armonk, NY, USA). Normally distributed continuous data were presented as the mean \u0026plusmn; standard deviation (\u003cem\u003ex̅\u003c/em\u003e\u0026plusmn;\u003cem\u003es\u003c/em\u003e). Intergroup comparisons were analyzed using independent Student\u0026rsquo;s t-tests, while one-way analysis of variance (ANOVA) was employed for comparisons among multiple groups, with \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 considered statistically significant. All experiments were conducted in triplicate.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eBAM15 inhibits NSCLC cell viability in a dose-dependent manner.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA549 and H1299 cell lines were treated with varying concentrations of BAM15 for 48 hours, and cell viability was assessed using the CCK-8 assay. The results demonstrated that BAM15 exerted a weak inhibitory effect on A549 and H1299 cells at low concentrations. However, as the drug concentration increased, cell viability gradually decreased in a dose-dependent manner. The IC₅₀ values of BAM15 were calculated as 4.013 \u0026micro;M for A549 and 7.897 \u0026micro;M for H1299 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To further evaluate the impact of BAM15 on lung cancer cell proliferation, we performed CCK-8 and colony formation assays. The CCK-8 assay revealed that BAM15 significantly inhibited the proliferation of A549 cells at low (2 \u0026micro;M), medium (4 \u0026micro;M), and high (6 \u0026micro;M) concentrations compared to the DMSO control (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similarly, H1299 cell proliferation was suppressed at low (4 \u0026micro;M), medium (6 \u0026micro;M), and high (8 \u0026micro;M) concentrations (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The inhibitory effect of BAM15 was positively correlated with both concentration and treatment duration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBAM15 suppresses NSCLC cell proliferation.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further validate the antiproliferation activity of BAM15, EdU incorporation assays were conducted to assess DNA synthesis. In A549 cells, the EdU-positive rate was significantly reduced in the BAM15-treated group compared to the control (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.013). Similarly, H1299 cells exhibited a significant reduction in both the EdU-positive rate and average fluorescence intensity following BAM15 treatment (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Collectively, these results demonstrate that BAM15 consistently suppresses DNA synthesis in both A549 and H1299 NSCLC cells, confirming its antiproliferative effect.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBAM15 impairs NSCLC cell clonogenic potential.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSubsequently, colony formation assays were performed to investigate the long-term proliferative capacity of NSCLC cells. Consistent with the CCK-8 and EdU results, BAM15 treatment significantly inhibited the clonogenic ability of both A549 and H1299 cells in a dose-dependent manner. Specifically, the CCK-8 assay revealed that BAM15 significantly inhibited the proliferation of A549 cells at low (2 \u0026micro;M), medium (4 \u0026micro;M), and high (6 \u0026micro;M) concentrations compared to the DMSO control (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similarly, H1299 cell proliferation was suppressed at low (4 \u0026micro;M), medium (6 \u0026micro;M), and high (8 \u0026micro;M) concentrations (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with the inhibitory effect positively correlated with both concentration and treatment duration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Correspondingly, the colony formation assay showed that as the concentration of BAM15 increased, the clonogenic capacity of both cell lines declined significantly.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eBAM15 induces G1 phase arrest and suppresses cell cycle progression in NSCLC Cells\u003c/h2\u003e \u003cp\u003eTo further elucidate the antiproliferative effects of BAM15, we first evaluated its impact on cell cycle distribution. A549 and H1299 cells were treated with 5 \u0026micro;M BAM15 for 48 h and analyzed by flow cytometry. In A549 cells, BAM15 treatment significantly increased the proportion of cells in the G1/G0 phase, while concurrently decreasing the populations in the S and G2/M phase. A similar trend was observed in H1299 cells, with a marked increase in the G1/G0 phase and reductions in the S and G2/M phases (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Collectively, these results demonstrate that BAM15 induces G1 phase arrest and impairs the G1/S transition in both NSCLC cell lines.\u0026zwnj;\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eBAM15 induces apoptosis in NSCLC cells in a dose-dependent manner\u003c/h2\u003e \u003cp\u003eApoptosis has been widely recognized as a crucial cellular mechanism that plays a pivotal role in inhibiting cancer cell proliferation and maintaining tissue homeostasis. To systematically investigate this phenomenon, we employed a well-established flow cytometric assay utilizing Annexin V-FITC and PI double-staining to accurately quantify apoptotic cells in NSCLC models. Quantitative data revealed that BAM15 treatment robustly induced apoptosis in both A549 and H1299 cell lines in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These compelling findings not only validate our initial hypothesis but also provide strong evidence to confirm that BAM15 exerts its potent anti-proliferative effects through the induction of apoptosis in NSCLC cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e\u0026zwnj;\u003cb\u003eBAM15 inhibits the migration and invasion of A549\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCell migration and invasion are key steps in cancer metastasis, allowing tumor cells to spread to distant organs, which worsens treatment outcomes in lung cancer. To test BAM15\u0026rsquo;s effort on A549 cell migration, we first performed the scratch assay. At 24 hours, BAM15 slightly slowed wound healing, but the difference was not significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, by 48 hours, BAM15 significantly reduced the wound closure (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We also performed a Transwell migration assay, which confirmed that BAM15 significantly reduced the number of migrating A549 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, a Transwell invasion assay (with Matrigel) showed that BAM15 significantly decreased invasive cell numbers (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u003cb\u003e\u0026zwnj;\u003c/b\u003eFig. 3B\u0026zwnj;). These results indicated that BAM15 significantly suppresses both the migratory and invasive abilities of A549 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eRNA-seq-based screening and identification of differentially expressed genes in A549\u003c/h2\u003e \u003cp\u003eTo elucidate the molecular mechanisms underlying BAM15-mediated inhibition of A549 cell growth, cells were starved for 48 hours and treated with either 5 \u0026micro;M BAM15 or DMSO (control) for 48 hours. RNA-seq analysis identified 16,880 and 17,146 genes in the control and the BAM15 groups, respectively, with 16,302 genes common to both. Using thresholds of |log2 Fold Change|\u0026gt;1 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, we identified 2,270 DEGs, including 1,439 upregulated and 831 downregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Heatmaps of the top 50 up- and down-regulated DEGs clearly distinguished the two groups, demonstrating BAM15\u0026rsquo;s profound impact on the A549 transcriptome (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFunctional enrichment analysis of DEGs and reveals BAM15 inhibits A549 cell growth via differential gene expression\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFunctional annotation of DEGs via GO, KEGG, and GSEA revealed distinct biological patterns. GO analysis revealed the enrichment of DEGs in three functional categories: biological processes were primarily involved in anatomical structure development, regulation of localization, and multicellular organism development; cellular components were enriched in cell projections, plasma membrane-coated cell projections, and extracellular regions; molecular functions focused on signal receptor binding, signal receptor activity, and receptor regulator activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Additionally, GO chord diagram analysis further highlighted IL1A as a key shared gene across these functional categories (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). KEGG pathway analysis identified distinct patterns of pathway regulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). The upregulated pathways included inflammation-related signaling cascades (TNF signaling, IL-17 signaling, NF-κB signaling, and JAK-STAT signaling), as well as the MAPK and PI3K-Akt pathways, which directly or indirectly modulate the balance between glycolysis and oxidative phosphorylation. Metabolic pathways for glycine, serine, and threonine metabolism were also activated, potentially to support energy demand. In contrast, the downregulated pathways encompassed DNA replication, cell cycle regulation, cytochrome P450 metabolism, retinol metabolism, and glycosylation processes. These findings suggest that BAM15 drives inflammatory responses and metabolic reprogramming in the tumor microenvironment by activating inflammation-immune and metabolic pathways while suppressing cell cycle progression and drug metabolism pathways, potentially influencing tumor progression through metabolic-immune crosstalk. GSEA with thresholds of |NES|\u0026gt;1.5 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05 further validated these observations. Specifically, co-activated pro-inflammatory pathways included cytokine-cytokine receptor interaction (NES\u0026thinsp;=\u0026thinsp;1.88, FDR\u0026thinsp;=\u0026thinsp;1.39E-07) and IL-17 signaling (NES\u0026thinsp;=\u0026thinsp;2.09, FDR\u0026thinsp;=\u0026thinsp;1.39E-07), while significantly suppressed proliferation pathways comprised DNA replication (NES=-2.58, FDR\u0026thinsp;=\u0026thinsp;4.34E-09) and cell cycle regulation (NES=-1.69, FDR\u0026thinsp;=\u0026thinsp;6.49E-05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Collectively, this pattern indicates that BAM15 exerts its biological effects through a dual mechanism of \"inflammatory activation-proliferation suppression\".\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003e\u0026zwnj;\u003c/h2\u003e \u003cp\u003e \u003cb\u003eThe CDK2/CDK6-PCNA Pathway Serves as a Critical Target for BAM15-Mediated Inhibition of Cell Cycle Progression\u003c/b\u003e To elucidate the key genes and underlying molecular mechanisms regulating the cell cycle, we constructed a clustering heatmap to visualize the expression patterns of cell cycle-related genes. As supported by our previous GO, KEGG, and GSEA analyses (which highlighted significant enrichment of the cell cycle pathway), the heatmap revealed distinct clustering of BAM15-treated and control groups based on the dysregulation of cell cycle-related transcripts (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Specifically, RNA-Seq results indicated that multiple cell cycle-related genes were aberrantly expressed in BAM15-treated cells, with a prominent downregulation of CDK2, CDK6, and PCNA transcripts. Subsequent validation via qPCR and Western blot analysis confirmed the expression patterns of these key cell cycle regulators. Consistent with RNA-Seq data, qPCR demonstrated significant reductions in CDK2, CDK6, and PCNA mRNA levels (all \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas CDK4 expression remained unaffected (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Western blot analysis further verified decreased protein levels of CDK2, CDK6, and PCNA in BAM15-treated cells (all \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Collectively, these findings indicate that BAM15 specifically targets the CDK2/CDK6-PCNA signaling pathway by regulating cell cycle-critical genes, thereby inducing G1/S phase arrest and suppressing cell cycle progression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eBAM15 treatment inhibited tumor growth in the xenograft mouse model\u003c/h2\u003e \u003cp\u003eTo further validate the biological relevance of these in vitro findings in vivo, we conducted animal experiments to assess the effect of BAM15 on tumor growth and proliferation. Following the animal experiment, subcutaneous tumor volume and mass were measured in both groups of nude mice, and the number of PCNA-positive cells was further analyzed. The results showed no significant difference in body weight between the control and BAM15 groups during the experiment (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA), indicating that BAM15 did not cause significant systemic toxicity at the effective dose. Tumor masses were significantly larger in the control group than in the BAM15-treated group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-C). Similarly, tumor volumes were significantly reduced in the BAM15 group compared to the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E). Quantitative IHC analysis revealed a significantly lower PCNA-positive cell score in the BAM15-treated group than in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF-G). These findings collectively demonstrate that BAM15 treatment significantly inhibited subcutaneous tumor growth in nude mice, consistent with its in vitro role in suppressing proliferation pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we demonstrated that BAM15 significantly inhibited the proliferation of NSCLC cells in a dose-dependent manner, as evidenced by CCK-8 assays and colony formation experiments. Additionally, migration and invasion assays revealed that BAM15 effectively weakened the migratory and invasive capabilities of lung cancer cells. Flow cytometry analysis further indicated that BAM15 could induce apoptosis in these cells. In vivo experiments using a mouse xenograft model confirmed that BAM15 significantly suppressed tumor growth. At the molecular level, BAM15 induced cell cycle arrest at the G1 phase, thereby blocking the G1/S transition and inhibiting DNA replication. Moreover, it might activate pro-inflammatory pathways, forming a synergistic effect.\u003c/p\u003e \u003cp\u003eAs a novel mitochondria-targeting agent, BAM15 enhances mitochondrial respiratory efficiency, promotes fatty acid oxidation, and optimizes energy allocation, thereby achieving dual effects of reducing adipose tissue and improving metabolic function in obesity treatment (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). It also significantly enhances insulin sensitivity and effectively reverses insulin resistance in db/db mice and diet-induced obesity models (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). In cancer therapy, BAM15 inhibits tumor progression by regulating mitochondrial metabolic reprogramming. For instance, it effectively suppresses cell proliferation and promotes apoptosis in breast cancer and acute myeloid leukemia (AML) (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). In melanoma, BAM15 exhibits synergistic effects when combined with targeted MAPK pathway drugs, significantly enhancing apoptosis and inhibiting colony formation (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Furthermore, low-dose BAM15 remodels the tumor metabolic microenvironment, augmenting the tumor-killing function of CD8\u0026thinsp;+\u0026thinsp;T cells (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In vivo studies have further demonstrated that BAM15 effectively inhibits AML progression and prolongs survival in mice, with its anticancer activity significantly enhanced when combined with cytarabine (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). These findings suggest that BAM15 holds potential as an anti-tumor agent. Notably, whether BAM15's anti-tumor effects are cancer-type dependent remains unclear. This study focused on lung cancer, revealing that BAM15 treatment led to dose-dependent reductions in cell viability, diminished colony formation, increased apoptosis, and inhibited migration and invasion in NSCLC cells compared to controls. These results indicate that BAM15 exerts its anti-tumor effects by inhibiting proliferation, promoting apoptosis, and reducing metastatic potential, consistent with existing research.\u003c/p\u003e \u003cp\u003eLung cancer development is orchestrated by intricate signaling crosstalk. While the full scope of BAM15's regulatory mechanisms remains under investigation, studies suggest that BAM15 uncouples oxidative phosphorylation, inhibiting ATP synthesis and leading to cellular energy deficiency. Additionally, it increases proton leakage across the mitochondrial inner membrane, disrupting the proton gradient and reducing mitochondrial membrane potential (ΔΨm). These effects further impair the electron transport chain, resulting in reactive oxygen species (ROS) accumulation and cytochrome c release, ultimately inducing apoptosis in MDA-MB-231 and EO771 cells (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). BAM15 not only regulates ROS generation and restores dynamic balance but also significantly inhibits AML cell proliferation and induces apoptosis with low toxicity to normal cells (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Low-dose BAM15 remodeled the tumor metabolic microenvironment, activating the AMPK/AKT signaling pathway and promoting futile energy consumption in the tricarboxylic acid (TCA) cycle, thereby increasing CD8\u0026thinsp;+\u0026thinsp;T cell numbers and granzyme B levels and enhancing anti-tumor immune responses (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Given biological differences among tumor cell lines, this study employed RNA-seq to systematically identify differentially expressed genes and conducted cross-validation using GO, KEGG, and GSEA analyses to elucidate the molecular basis of BAM15's biological effects. The results revealed that BAM15 regulates the tumor microenvironment through an inflammation-metabolism axis, exerting dual regulatory effects. On one hand, BAM15 activates pro-inflammatory pathways (e.g., TNF, IL-17, NF-κB, and JAK-STAT), MAPK, and PI3K-Akt pathways, as well as metabolic pathways (e.g., glycine metabolism), directly or indirectly driving glycolysis and oxidative phosphorylation and promoting inflammation and metabolic reprogramming. On the other hand, BAM15 inhibits DNA replication, cell cycle progression, and related metabolic pathways (e.g., cytochrome P450).\u003c/p\u003e \u003cp\u003eBAM15 functions as a mitochondrial uncoupler with potency equivalent to conventional uncouplers such as FCCP and DNP, while displaying reduced cytotoxicity (26, 32). Importantly, it specifically depolarizes mitochondria without impacting plasma membrane potential, effectively mitigating off-target effects associated with plasma membrane depolarization (33). These advantages endow BAM15 with promising potential for application in lung cancer treatment.\u003c/p\u003e \u003cp\u003eWhile this study preliminarily confirmed BAM15's anti-tumor effects in lung cancer, we also observed significant changes in the IL1A gene in lung cancer cells following BAM15 treatment. IL1A is a nuclear alarmin released by dying cells, capable of weakening the immunosuppressive capacity of tumor-associated myeloid cells and promoting the recruitment and effector function of CD8\u0026thinsp;+\u0026thinsp;T cells (\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Additionally, patients with low IL1A expression typically exhibit better clinical outcomes (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Based on these findings, we speculate that IL1A may be a key gene mediating BAM15's pro-inflammatory effects and potential resistance. Future research will investigate BAM15\u0026rsquo;s pro-inflammatory and immune modulatory mechanisms, as well as its therapeutic potential in combination with chemotherapeutic drugs to overcome drug resistance. Additionally, this study focused solely on A549 and H1299 lung cancer cell lines. Given the heterogeneity of lung cancer cell lines, future research should extend these findings to additional models to uncover broader therapeutic targets.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn the present study, BAM15 exerts \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e anti-tumor effects by inhibiting proliferation, inducing cell cycle arrest and apoptosis in lung cancer cells. Moreover, BAM15 also inhibited migration and invasion in A549 cells. These findings provide important insights for the clinical application of BAM15, suggesting its potential as a promising therapeutic agent for lung cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003eMYZ and NQW conceived and designed the experiments; MYZ and YFZ performed the experiments; MYZ and YNW analyzed the data and interpreted the data; HYW and SJM contributed to the provision of reagents, materials, and analysis tools; MYZ wrote original draft; and MYZ, SJM and HYW reviewed and edited the manuscript draft. All authors checked and confirmed the authenticity of all the raw data. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThe present study was supported by the National Nature Science Foundation of China (grant no. 82273051).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eThe raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics \u0026amp; Bioinformatics 2025) in National Genomics Data Center (Nucleic Acids Res 2025), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: HRA015662) that are publicly accessible at \u003cem\u003ehttps://ngdc.cncb.ac.cn/gsa.\u003c/em\u003e All other data generated in the present study may be requested from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003eAll authors agree to the publication of the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003eThe present study was approved (approval no. L102012020120J) by the animal Ethics Committee of Sun Yat-sen University Cancer Center (Guangzhou, China).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-63.\u003c/li\u003e\n \u003cli\u003eThai AA, Solomon BJ, Sequist LV, Gainor JF, Heist RS. Lung cancer. Lancet. 2021;398(10299):535-54.\u003c/li\u003e\n \u003cli\u003eJha SK, De Rubis G, Devkota SR, Zhang Y, Adhikari R, Jha LA, et al. Cellular senescence in lung cancer: Molecular mechanisms and therapeutic interventions. Ageing Res Rev. 2024;97:102315.\u003c/li\u003e\n \u003cli\u003eSun CY, Cao D, Ren QN, Zhang SS, Zhou NN, Mai SJ, et al. Combination Treatment With Inhibitors of ERK and Autophagy Enhances Antitumor Activity of Betulinic Acid in Non-small-Cell Lung Cancer In Vivo and In Vitro. Front Pharmacol. 2021;12:684243.\u003c/li\u003e\n \u003cli\u003eAbdul Satar N, Ismail MN, Yahaya BH. Synergistic Roles of Curcumin in Sensitising the Cisplatin Effect on a Cancer Stem Cell-Like Population Derived from Non-Small Cell Lung Cancer Cell Lines. Molecules. 2021;26(4).\u003c/li\u003e\n \u003cli\u003eLi Y, Yan B, He S. Advances and challenges in the treatment of lung cancer. Biomed Pharmacother. 2023;169:115891.\u003c/li\u003e\n \u003cli\u003eXue M, Ma L, Zhang P, Yang H, Wang Z. New insights into non-small cell lung cancer bone metastasis: mechanisms and therapies. Int J Biol Sci. 2024;20(14):5747-63.\u003c/li\u003e\n \u003cli\u003eSu PL, Furuya N, Asrar A, Rolfo C, Li Z, Carbone DP, et al. Recent advances in therapeutic strategies for non-small cell lung cancer. J Hematol Oncol. 2025;18(1):35.\u003c/li\u003e\n \u003cli\u003eWang M, Herbst RS, Boshoff C. Toward personalized treatment approaches for non-small-cell lung cancer. Nat Med. 2021;27(8):1345-56.\u003c/li\u003e\n \u003cli\u003eZhu Y, Dai Z. HSP90: A promising target for NSCLC treatments. Eur J Pharmacol. 2024;967:176387.\u003c/li\u003e\n \u003cli\u003eCairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. Nat Rev Cancer. 2011;11(2):85-95.\u003c/li\u003e\n \u003cli\u003eDeBerardinis RJ, Chandel NS. Fundamentals of cancer metabolism. Sci Adv. 2016;2(5):e1600200.\u003c/li\u003e\n \u003cli\u003eZong Y, Li H, Liao P, Chen L, Pan Y, Zheng Y, et al. Mitochondrial dysfunction: mechanisms and advances in therapy. Signal Transduct Target Ther. 2024;9(1):124.\u003c/li\u003e\n \u003cli\u003eGreene J, Segaran A, Lord S. Targeting OXPHOS and the electron transport chain in cancer; Molecular and therapeutic implications. Semin Cancer Biol. 2022;86(Pt 2):851-9.\u003c/li\u003e\n \u003cli\u003eDu H, Xu T, Yu S, Wu S, Zhang J. Mitochondrial metabolism and cancer therapeutic innovation. Signal Transduct Target Ther. 2025;10(1):245.\u003c/li\u003e\n \u003cli\u003eChildress ES, Alexopoulos SJ, Hoehn KL, Santos WL. Small Molecule Mitochondrial Uncouplers and Their Therapeutic Potential. J Med Chem. 2018;61(11):4641-55.\u003c/li\u003e\n \u003cli\u003eJiang H, Zhang XW, Liao QL, Wu WT, Liu YL, Huang WH. Electrochemical Monitoring of Paclitaxel-Induced ROS Release from Mitochondria inside Single Cells. Small. 2019;15(48):e1901787.\u003c/li\u003e\n \u003cli\u003eAlasadi A, Cao B, Guo J, Tao H, Collantes J, Tan V, et al. Mitochondrial uncoupler MB1-47 is efficacious in treating hepatic metastasis of pancreatic cancer in murine tumor transplantation models. Oncogene. 2021;40(12):2285-95.\u003c/li\u003e\n \u003cli\u003eAlasadi A, Chen M, Swapna GVT, Tao H, Guo J, Collantes J, et al. Effect of mitochondrial uncouplers niclosamide ethanolamine (NEN) and oxyclozanide on hepatic metastasis of colon cancer. Cell Death Dis. 2018;9(2):215.\u003c/li\u003e\n \u003cli\u003eShrestha R, Johnson E, Byrne FL. Exploring the therapeutic potential of mitochondrial uncouplers in cancer. Mol Metab. 2021;51:101222.\u003c/li\u003e\n \u003cli\u003eAxelrod CL, King WT, Davuluri G, Noland RC, Hall J, Hull M, et al. BAM15-mediated mitochondrial uncoupling protects against obesity and improves glycemic control. EMBO Mol Med. 2020;12(7):e12088.\u003c/li\u003e\n \u003cli\u003eAlexopoulos SJ, Chen SY, Brandon AE, Salamoun JM, Byrne FL, Garcia CJ, et al. Mitochondrial uncoupler BAM15 reverses diet-induced obesity and insulin resistance in mice. Nat Commun. 2020;11(1):2397.\u003c/li\u003e\n \u003cli\u003eZunica ERM, Axelrod CL, Cho E, Spielmann G, Davuluri G, Alexopoulos SJ, et al. Breast cancer growth and proliferation is suppressed by the mitochondrial targeted furazano[3,4-b]pyrazine BAM15. Cancer Metab. 2021;9(1):36.\u003c/li\u003e\n \u003cli\u003eGao ZX, Cui ZL, Zhou MR, Fu Y, Liu F, Zhang L, et al. The new mitochondrial uncoupler BAM15 induces ROS production for treatment of acute myeloid leukemia. Biochem Pharmacol. 2022;198:114948.\u003c/li\u003e\n \u003cli\u003eSerasinghe MN, Gelles JD, Li K, Zhao L, Abbate F, Syku M, et al. Dual suppression of inner and outer mitochondrial membrane functions augments apoptotic responses to oncogenic MAPK inhibition. Cell Death Dis. 2018;9(2):29.\u003c/li\u003e\n \u003cli\u003eJiang X, Fan Z, Zhang Z, Zeng F, Sun T, Li Y, et al. Tumor metabolome remolded by low dose mitochondrial uncoupler elicites robust CD8(+) T cell response. Cell Death Discov. 2025;11(1):291.\u003c/li\u003e\n \u003cli\u003eLiu M, Zhu B, Li QJ. IL-1 signaling in aging and cancer: An inflammaging feedback loop unveiled. Cancer Cell. 2024;42(11):1820-2.\u003c/li\u003e\n \u003cli\u003ePark MD, Le Berichel J, Hamon P, Wilk CM, Belabed M, Yatim N, et al. Hematopoietic aging promotes cancer by fueling IL-1⍺-driven emergency myelopoiesis. Science. 2024;386(6720):eadn0327.\u003c/li\u003e\n \u003cli\u003eHanggi K, Li J, Gangadharan A, Liu X, Celias DP, Osunmakinde O, et al. Interleukin-1alpha release during necrotic-like cell death generates myeloid-driven immunosuppression that restricts anti-tumor immunity. Cancer Cell. 2024;42(12):2015-31 e11.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"medical-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"medo","sideBox":"Learn more about [Medical Oncology](https://www.springer.com/journal/12032)","snPcode":"12032","submissionUrl":"https://submission.nature.com/new-submission/12032/3","title":"Medical Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"non-small lung cancer cell, BAM15, cell cycle, migration, invasion, vitro experiment ","lastPublishedDoi":"10.21203/rs.3.rs-8556496/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8556496/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLung cancer remains the leading cause of cancer-related mortality worldwide, with non-small cell lung cancer (NSCLC) accounting for 80\u0026ndash;85% of all cases, highlighting the urgent need for novel therapeutic strategies. BAM15, a mitochondria-targeted uncoupler, has demonstrated therapeutic potential in metabolic disorders and several cancer types; however, its role in NSCLC progression remains poorly understood. This study aimed to evaluate the antitumor effects of BAM15 in human NSCLC cells (A549, H1299) and elucidate the underlying mechanisms, with in vivo validation. The results showed that BAM15 treatment dose-dependently inhibited the viability of NSCLC cells (IC50: 4.013 \u0026micro;M for A549, 7.897 \u0026micro;M for H1299) and suppressed their colony formation, migration and invasion. Furthermore, BAM15 not only induced G1/G0 phase arrest but also apoptosis in NSCLC cells. RNA sequencing identified 2,270 differentially expressed genes (DEGs) in response to BAM15 treatment. Pathway analysis showed that BAM15 downregulated cell signaling pathways involved in DNA replication and cell cycle, and upregulated those associated with inflammatory response (e.g., TNF, IL-17, NF-κB signaling) and MAPK/PI3K-Akt signaling. Western blot confirmed that BAM15 downregulated key cell cycle regulators, including CDK2, CDK6, and PCNA. In vivo experiment, BAM15 administration significantly reduced xenograft tumor weight and volume and decreased the number of PCNA-positive tumor cells. In conclusion, BAM15 exerts potent antitumor effects against NSCLC both in vitro and in vivo by disrupting DNA replication and cell cycle progression, likely through modulation of cell cycle regulators and downstream signaling pathways. These findings suggest BAM15 as a promising candidate for targeted NSCLC therapy.\u003c/p\u003e","manuscriptTitle":"Mitochondrial uncoupler BAM15 attenuates cell proliferation and tumor growth in non-small cell lung cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-31 06:55:44","doi":"10.21203/rs.3.rs-8556496/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-04-21T05:48:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-17T13:55:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"307532778653107827290496832362457526359","date":"2026-04-10T14:48:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"86604387918102524870164774521113881360","date":"2026-04-08T23:54:27+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-08T04:39:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"215344452724226506766253825559193663367","date":"2026-04-07T05:14:51+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-27T03:31:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-09T05:37:28+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-09T05:35:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Medical Oncology","date":"2026-01-09T03:38:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"medical-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"medo","sideBox":"Learn more about [Medical Oncology](https://www.springer.com/journal/12032)","snPcode":"12032","submissionUrl":"https://submission.nature.com/new-submission/12032/3","title":"Medical Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"7e37fa6e-faa6-4340-b635-07147d390c5a","owner":[],"postedDate":"March 31st, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-31T06:55:45+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-31 06:55:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8556496","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8556496","identity":"rs-8556496","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.