Mechanism of recognition and binding of Ultrabithorax

Mechanism of recognition and binding of Ultrabithorax | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanism of recognition and binding of Ultrabithorax SAVITA SINGH This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5172078/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Hox genes are highly conserved throughout metazoan evolution and code for homeodomain containing transcription factors that control specific developmental pathways. Ultrabithorax (Ubx) exerts its function mainly through activation or repression of downstream genes. Only a few direct target genes of Ubx have been identified and studied in detail therefore mechanism of Ubx mediated control of its target gene is far from complete. Understanding the mechanisms by which Ubx regulates its targets requires the knowledge of target genes and of sequence motifs that serve as recognition and binding elements for Ubx. By employing chip-on-chip and bioinformatics approach, our lab identified a large number of downstream targets of Ubx. The sequence analyses of these genes have suggested few potential Ubx-binding and/or recognition motifs. Here we report the results of cell-based luciferase assays to confirm if these motifs are indeed Ubx-response elements and understand the mechanism of activation and repression. Developmental Biology Hox genes Ultrabithorax Ubx-binding and/or recognition motifs activity regulation Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Ultrabithorax (Ubx) consists of a highly conserved 60-amino-acid DNA binding motif, the Homeodomain. Ubx functions as a transcription factor by directly binding to Ubx responsive elements. Various approaches have been used to identify the Ubx responsive elements. Biochemical approach identified a total of 7 heptamer Ubx –binding motifs T-T-A-A-T-T/G-A/G (Ekker et. al; 1991). Ubx have low DNA binding specifity in vitro but are highly specific in in-vivo. Despite the knowledge of Ubx responsive elements, the mechanism of action of Ubx protein as activator and repressor remains elusive. Various co-factors like Extradenticle (Exd) and Homothorax (Hth) are required by Hox protein to show its activity. However, Exd/Hth is not required by Ubx in development of haltere. Further Collaboration of many contexts' specific transcription factors with recruitment of specific co-repressor and/or activators is one of the mechanisms by which Hox proteins determines the transcriptional output. Unfortunately, a few examples for this kind of collaboration are known (Hueber and Lohmann, 2008). Genome wide approach to identify targets of Ubx using ChIP assay identified some motif frequently present in Data Set using bioinformatics approach (Agrawal et al., 2011). TRANSFAC analysis of suggested small sequences codes for other transcription factors. Our aim in this direction was to validate putative motifs and to further examine functionality of them along with Ubx. Here we report the functionality of few Ubx responsive other transcription factor binding motifs using Schneider (S2) cell reporter assay. 2. Materials And Methods 2.1 Bacterial culture Bacteria were streaked out and grown on Luria Broth (LB)-agar plates containing respective antibody for selection of transformants or in liquid culture. Transformed bacterial culture were maintained as glycerol stock, followed by freezing them in liquid nitrogen and subsequently stored at -700C. 2.2 Preparation of Ultracompetent cells Ultracompetent cells were prepared using the Inoue method for preparation and transformation of E coli (Sambrook et al. 1987). 2.3 Plasmid Constructions Ubx expression plasmid Our lab had cloned the full length cDNA of Drosophila Melanogaster Ubx into pET 14b vector for protein expression. This fragment of Ubx having stop codon was PCR amplified from pET14b vector with PCR primers containing Kpn1 and BamH1 sites and was then sub-cloned into Kpn1 and BamH1 sites of a Drosophila expression vector, pRmHa-3GFP containing metallothionein promoter. Both the above constructs were sequence verified. Forward primer: CCGGGTACCAGCGCAATGAACTCGTACTTTGA Reverse primer: CGGGGATCCCTACTGATCTAAGTGTCCACCTTG Reporter Plasmids Addition of new motifs and control oligos into pDE5–37tkluc vector. Both sense and antisense oligos containing Kpn1 and Nhe1 were synthesized. Equal amounts of both sense and antisense oligos were heated for 10min at 99 0C and slowly allowed to cool. After that both oligo and Vector was digested with Kpn1 and Nhe1 restriction enzymes and was ligated with Promega fast DNA ligase. To identify positive clone of interest, Colony PCR was done using sense oligo as forward primer and RV primer1, RV primer3, RV primer 4 as reverse primer. Then they were sequence verified using GL primer 2 as forward primer. Primer Used are: RVprimer1 5’-CGACTCGAAATCCACATATCAAAT-3, RVprimer3 5´-CTAGCAAAATAGGCTGTCCC-3´ RVprimer4 5´-GACGATAGTCATGCCCCGCG-3´ For sequencing forward primer GLprimer2 5´-CTTTATGTTTTTGGCGTCTTCCA-3´ 2.4 Polymerase chain reaction (PCR) After ligation and transformation positive colonies containing construct were identified using colony PCR. A master mix for PCR reaction was prepared on ice and randomly 5-10 clones were picked up from transformed master plate. The picked single colony was simultaneously being marked and maintained on other culture plate. Then same tips were kept inside PCR tubes. PCR reaction was set up using the specific primers along with a positive and a negative control. Then selected positive colony from colony PCR was further sequence verified. 2.5 Cell Culture Drosophila S2 cells were maintained with standard methods. S2 cells were grown in Schneider’s media (invitrogen) supplemented with 10% fetal bovine serum, without any antibiotics. For transient transfection, 1.5 X 106cells per well in 6-well plates and 8-4.8X 108in 24 Well plates were seeded for experiments. 2.6 Extraction of plasmid DNA Construct containing pDE5–37tkluc added oligos and pDE5–37tkluc as control were prepared using Sigma midi prep while other plasmids were prepared using maxiprep method (Sambrook et al. 1987) and were used for transfection. 2.7 Transient transfection and dual luciferase assay S2 cells were grown in’s media (invitrogen) supplemented with 10% fetal bovine serum, without any antibiotics. Transient transfections into Drosophila S2 cells were carried out by effectene transfection reagent (Qiagen) as described by company. Total of 150ng of DNA was used for transfection in 12 well plates. Expression of Ubx protein in pRmHa3-Ubx transfected S2 cells were induced by 0.5mM copper sulphate after 18-20 h of transfection, cells were lysed after 24 hrs for extraction of protein and expression of proteins in cells were detected by immunofluoresence with N-terminal anti-Ubx antibodies as described below and by western blot analysis. For all reporter assay Co-transfections into Drosophila S2 cells were carried out by effectene transfection reagent (Qiagen). Expression vector to reporter was 1:5 or 1:1. Expression of Ubx protein in pRmHa3-Ubx transfected S2 cells were induced by 0.5mM copper sulphate after 18-20 h of transfection, cells were lysed after 24 hrs of induction. The luciferase reporter activity was determined with the dual luciferase reporter assay system (Promega). 2.8 Antibody Staining for S2 cells Preparation of Cover slip: Before growing cells on cover slip they were soaked in 1N HCl for overnight at 600C in oven. Then were washed thoroughly with autoclaved water and were stored in pure ethanol. After that cover slips were dried in a large plastic Petri dish without filter paper in Tissue culture hood. They were kept such that they do not touch each other. 0.5 mg/ml solution of ConA filter sterilized (Sigma) in water was added with pipette and was kept for 30min-1hr. ConA on cover slip was washed with PBS and was air dried. For detecting protein of interest cells were cultured on glass cover slips coated with conA. Then expression plasmids were transformed. For staining cell culture media was removed and cells were fixed with 3.5% paraformaldehyde and 0.05% glutraldehyde in PHEM buffer saline (60mM PIPES, 25mM HEPES, 10mM EGTA, 2mM MgCl2, 6H2O) for 10 min. Cells were washed 3 times with PHEM buffer saline and were permeabilized with 0.1% Triton X 100 in PHEM for 10 min. Cells were blocked with 5% heat inactivated goat serum in PHEM buffer for one hour. The cells were incubated with primary polyclonal Nterminal anti-Ubx (1:1000) overnight at 4 °C. After that 4 washes for 10 min with PHEM buffer was given and fluorescein secondary antibodies (1:1000) were applied for one hour at room temperature in dark. Final 3 washes for 10 min were performed. Cover slip with antifade reagent with DAP1 was placed gently on slide to visualize the protein by fluorescence microscopy. 2.9 Western blot analysis Cultured suspension S2 cells were centrifuged at 450Xg for 5min to pellet cells and media was removed. Cells were given wash with PBS and were further centrifuged to remove PBS. RIPA lysis buffer or passive lysis buffer was added and was mixed by vortexing. Kept on ice for 15 min and further votexed briefly to re-suspend cells and lyse residual cells. Whole adult and larvae samples were frozen in liquid nitrogen after that were crushed and lysed in RIPA lysis buffer. Samples were quickly frozen in liquid nitrogen and stored at -700C for future use. Then stored samples were centrifuged to remove cell debris and supernatant was treated for loading on gels. Protein harvested from cell was further boiled for 5min in Laemmli’s buffer and separated on 10% SDS-PAGE (Sambrook et al. 1987). The resolved gel was blotted on PVDF membrane and was stained with Ponceau S to check the protein. The membrane was blocked with 5% skimmed milk for 1X TBST Membrane was given three wash for 10min at RT with 1X TBST. The transblot was probed with antibodies against polyclonal N-terminal Ubx antibody (Agrawal et al., 2011) diluted to 1:5000 and followed by secondary horseradish peroxidase-conjugated antibodies for 1h at RT or overnight at 4°C. 3. Results 3.1 Expression of Ubx in S2 cells To design an assay system for Ubx responsive elements, we first checked the expression of Ubx in S2 cells using western blot analysis. N-terminal specific antibody was used to confirm expression Ubx.Ubx was found to be absent in S2 cells. Next, we expressed full length Ubx in S2 cells using transient transfection and detected it using antibody staining and western blot analysis. S2 cells expressing Ubx were stained with Polyclonal N-Terminal Ubx antibody and Ubx was observed to accumulate in the nucleus. Immunoblot analysis showed various Ubx expressing band and can be because of post translational modification by Phosphorylation of Ubx in S2 cells (Gavis and Hogness et al 1991) (Fig. A.1). 3.2 Ubx is responsive to Dorsal and Twist binding elements and response is not because of any cryptic Ubx responsive element present on vector Bio-informatics data analysis of pulled down sequences revealed presence of multiple transcription factor binding sites. Many potential targets of Ubx like CG 17838, CG30413, CG30417, Khc-73, ttv were found to have pair of Dorsal and Twist transcription factor binding sites within 200 bp pulled down sequences. Consistent with previous finding we detected response of Ubx in a vector sequence carrying Dorsal and Twist factor responsive elements present in 5 copies (DE5). Increase in reporter activity was observed on induction of Ubx. Next we asked whether the increase in reporter activity observed is because of Dorsal and Twist interaction with Ubx or cryptic Ubx responsive elements present on vector. In this direction we induced Ubx in parental Vector lacking Dorsal and Twist binding element. Increase in reporter activity was not observed. Therefore, Induction of Ubx causes enhancement of Dorsal and Twist mediated reporter activity (Fig A.2 A). Further, we used Ubx responsive DE5 vector in S2 cells to test the functionality of putative Ubx responsive elements in S2 cells. In this direction some the Known Ubx responsive elements tested positive for Ubx binding using in-vitro assay like EMSA and other potential responsive elements obtained by Genome wide assay were cloned upstream to DE5 sequence (Fig. A.2 B, Listed in table A.1). 3.3 Assay for some of the known Ubx responsive elements and Putative responsive/binding elements Spalt (sal) gene is repressed by Ubx in haltere (Galant et al., 2002). Multiple monomer Ubx-binding sites are required to completely repress the cis-element in the haltere, and that the individual Ubx-binding sites are sufficient to mediate its partial repression. Consistent with previous finding, some of the Ubx responsive elements of Sal tested using in-vitro EMSA assay were added upstream to DE5. Ubx activates CG13222 gene in haltere (Hersh et al., 2007). Ubx Responsive CG13222 cis-regulatory oligos already tested by EMSA were also added to DE5-37tkluc vector. There are two Ubx binding sites present in the cis-regulatory region of the gene. However, Increase and decrease in activity was not consistently observed on EMSA tested oligos in S2 cells and a random sequence was used as control. Further small Ubx binding Heptamer elements in 3 copies were added upstream to DE5 sequence and were subjected to assay. No response towards the three copies of Ubx containing Heptamer was observed. Therefore, internal Dorsal and Twist containing factor have no role in facilitating the binding of Ubx to its response elements and further we can speculate here that increased response may be a result of protein-protein interaction. Further we checked the Ubx responsive elements obtained by Genome wide experiments (Agrawal et al., 2011). They were cloned in 3copies upstream to DE5 sequence. Among all the tested motifs N1, N4 and N7 showed change in reporter activity. We next looked response of added oligos to the internal factors present inside the cells. DE5-37tkluc vector containing oligo was transfected with GFP expressing vector. N1 and N7 oligos showed increase in reporter activity. Table 6.1 Oligos and Their sequences tested in S2 cell assay. Oligo Sequence Random 3XATCTAGATCTAG C3 3XCGCAGATAAATTACACTGGCCGCCCGCGAGATTAC CATCGAG H3 3XTTAATAT N1 3XAGAGAGAGAGAG N2 3XTGTTGTTGTTGC N4 3XAGATACAGATAC N6 3XGGCGACGGCGGC N7 3XGCTCCAGCTGCT A.3.4 Differential response by Ubx responsive N1, N4 and N7 motifs TRANSFAC analysis has shown N1 as GAGA factor binding element, N4 as TEIL binding element and N7 as Adf1 binding element. Next to analyse whether the increased Ubx reporter activity observed is because of Ubx or internal factor we compared there response by Ubx and internal factors. N1 oligos were responsive to internal GAGA associated factor (GAF) present in cells tested by western blot. Further on induction of Ubx decrease in reporter activity was observed. Therefore, Ubx along with GAF causes decrease in reporter activity (Fig. A.4 A, B). Second motif N4 /TEIL factor binding elements were not responsive to any internal factors present inside the cells. Interestingly induction of Ubx showed increase in reporter activity and can be because of either direct binding of Ubx or by interaction of Ubx with TEIL factor (Fig. A.4 C). N7 similar to Adf1 binding motif were responsive to internal factors and showed increase in reporter activity. Addition of Ubx further to N7DE5tkluc vector showed further increase in activity. But almost additive effect of Ubx responsive DE5 and N7 to internal factors was observed (Fig. A.4 D). 4. Discussion This TRANSFAC analyses of pulled down sequences has shown presence of several clusters of potential binding sites for various transcription region like Ubx/GAGA, Ubx/Twi, Ubx/dl, Ubx/dl/GAGA factor, CEBP/dl/GAGAfactor and many other combinations of transcription factor (Agrawal et al., 2011). Interestingly, not all pulled down sequences revealed presence of Ubx binding sequence. Here Using S2 cell assay we have attempted to understand the functionality of some of these binding elements along with their interaction with Ubx. Addition of Ubx binding sites upstream to DE5 as small Heptamer in tandem or tested positive Ubx responsive elements with Ubx binding region along with its few base pair flanking sequence induced no change in reporter activity. In contrast to this Ubx was responsive to other transcription factor binding sequences. Indicating that collaboration with other transcription factor is indeed one of the important steps required by Ubx to perform activity. We here show that presence of Ubx can modulate the transcriptional activity of some of these transcription factors. We have identified possible ways by which Ubx can modulate the activity; one by enhancing the Dorsal/Twist mediated activation of reporter activity. Second Ubx can modulate the binding or activity of GAGA factor leading to decrease in transcriptional activity. Third some of the already present transcription factors like TEIL element binding factors along with Ubx are required for activity. Adf1 showed increase in activity with Ubx in S2 Cells. Therefore, many transcription factors are required by Ubx to modulate its functionality. Although we have tested only few combinations of transcription factors indicating existence of other possible ways by which Ubx can modulate the activity of other transcription leading to change in transcriptional activity. This assay system can further be used as a system to understand how Ubx interacts with other existing combinations of transcription factors as cofactors or collaborators to identify its target and to function as activator or repressor. section should highlight the importance and novelty of the work and discuss the implications of the findings in the context of the existing understanding in the field. Refrain from providing more background information or repeating the results here. The limitations of the study should also be objectively discussed. If a Conclusions section is not included separately, please also include a dedicated paragraph to discuss the broader and/or real world implications of the results and future work. Declarations Acknowledgments : Thank you to IISER, Pune, India. Funding : Council for Scientific and Industrial Research, CSIR, India. References Agrawal P, Habib F, Yelagandula R et al (2011) Genome-level identification of targets of Hox protein Ultrabithorax in Drosophila: novel mechanisms for target selection. Sci Rep 1:205 Bradley M, Hersh CE, Nelson, Samantha J, Stoll JE, Norton TJ, Albert SB (2007) Carroll,The UBX-regulated network in the haltere imaginal disc of D. melanogaster, Developmental Biology, 302, Issue 2 Ekker S, Young K, Kessler D, Beachy P (1991) Optimal DNA sequence recognition by the Ultrabithorax homeodomain of Drosophila. EMBO J 10:1179–1186. 10.1002/j.1460-2075.1991.tb08058 Gavis ER, Hogness DS (1991) Phosphorylation, expression and function of the Ultrabithorax protein family in Drosophila melanogaster. Development 112(4):1077–1093 Hueber SD, Lohmann I (2008) Shaping segments: Hox gene function in the genomic age. BioEssays, 30 Molecular cloning (1987) a laboratory manualby Sambrook, Joseph Galant R, Walsh CM (2002) S.B. Carroll Hox repression of a target gene: extradenticle-independent, additive action through multiple monomer binding sites, Development, 129 pp. 3115–3126 (Galant 2002) Shen WF, Krishnan K, Lawrence HJ, Largman C (2001) The HOX homeodomain proteins block CBP histone acetyltransferase activity. Mol Cell Biol 21:7509–7522 Thomas M, William ME, Williams R, Kuickb D, Misekb (2005) Kevin McDonaghc Samir Hanashb, Jeffrey W. Innis. Candidate downstream regulated genes of HOX group 13 transcription factors with and without monomeric DNA binding capability. Dev Biol 279:462–480 Additional Declarations The authors declare no competing interests. Supplementary Files hoxgenemotifsup.docx Mechanism of recognition and binding of Ultrabithorax Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5172078","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":360133621,"identity":"214d43c5-4509-4015-90f3-8405a91ed9d0","order_by":0,"name":"SAVITA SINGH","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIie2PsQqCUBSGDwi35ULrHSJfwRAiqDdpKQSne/YGiSCwLVe3XsGp+YTkZPvdBYcmQWiMNKHRdAu63/Cf5f845wBoND8KNcOopxh1UxqHrWqF91nDrXd+bZuHdBIXHizNUJZ35c04DOJr1KZYqbSIEsBI4Xkuk+ow7rqqVQF3RcQqReDZlqxSBJ+2KmaQV8oT8BTK3JbPDgooh+jiA+6UNDL0OyiWyohuR4FRmk8NPArOvv1iBut9sXks8HRwslI+tuPhIE7aD2sQdbAmO9Q/GEWftkaj0fwPL62QTOhtDbKLAAAAAElFTkSuQmCC","orcid":"","institution":"Kellogg School of Management, Northwestern University","correspondingAuthor":true,"prefix":"","firstName":"SAVITA","middleName":"","lastName":"SINGH","suffix":""}],"badges":[],"createdAt":"2024-09-28 21:40:36","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-5172078/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5172078/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65695443,"identity":"a4338def-71fb-48e9-b307-af6e584f1e6e","added_by":"auto","created_at":"2024-10-01 11:09:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":53175,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure A.1 Expression of Ubx in S2 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Western blots showing absence of expression of Ubx in S2 cells. (B) Immunoblot analysis of the expression of full length Ubx proteins in the transient-transfection experiments. Ubx proteins were harvested 48 hrs after transfection and immunoblotted with antibody against the polyclonal N-terminal Ubx. Note Slight shift in the band observed after transfection can be because of modification of Ubx \u0026nbsp;(C) Ubx expression in S2 cells after transfection.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5172078/v1/61bb8f160ba66b528d4b5bba.png"},{"id":65695808,"identity":"0980ec98-d5bc-477c-8151-4e5b8f80408a","added_by":"auto","created_at":"2024-10-01 11:17:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":44329,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure A.2 Ubx responsive Vector \u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003e(A) 37TK vector is not responsive to Ubx while 37TK vector containing 5 copies of Dorsal and Twist binding element (DE5) is responsive to Ubx. \u0026nbsp;(B) Schematic representing design of assay system. All oligos/motifs need to be tested are cloned upstream to 5X DE5.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5172078/v1/225ce35d99ae319c54347dc1.png"},{"id":65695807,"identity":"8c036804-eee0-4c71-ae9b-bf6713a5125e","added_by":"auto","created_at":"2024-10-01 11:17:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":32462,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure A.3 Assay for Ubx Responsive elements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Graph showing assay for Ubx responsive elements. Firefly luciferase reporter vector with oligos to be tested is co-transfected with Ubx expressing vector and an internal control (Prl-TK) encoding renilla luciferase. Fold change in activity is measured by normalizing with control assay containing all the vectors as in test without any induction of Ubx. Therefore, bars represent the fold activity achieved by expression of Ubx. Random sequence as control, C3, H3, N2, N6 oligos are not responsive to Ubx while N1, N4, and N7 oligos are responsive to Ubx. Each bar represents SD of N number of independent experiments with three replications of each experiment. (B) Graph showing response of oligos to the internal factors present in the S2 cells. Firefly luciferase reporter vector with oligos to be tested is cotransfected with GFP expressing vector and an internal control (pRL-TK) encoding renilla luciferase. N1 and N7 oligos are responsive to the internal factor present inside the cells. Each bar represents single experiment done in three wells. Error bar represents SD.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5172078/v1/3617fdbd520f58f0103a9e97.png"},{"id":65695445,"identity":"23bf098c-5dfd-4b15-a716-6756bd634585","added_by":"auto","created_at":"2024-10-01 11:09:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":114014,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure A.4 Positive Ubx responsive oligos shows differential response\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) N1 oligo contains GAGA factor binding elements and is responsive to GAF in S2\u0026nbsp;cells represented by increase in reporter activity without any induction of Ubx.\u0026nbsp; Induction of Ubx decrease GAF mediated reporter activity.\u0026nbsp;(B) Western blot shows expression of Ubx in S2 cells and larvae, immunobloted with\u0026nbsp;antibody against the polyclonal anti-GAF.\u0026nbsp;(C) N4 element are TEIL binding motif. N4 is not responsive to internal factors and\u0026nbsp;shows more than additive response on induction of Ubx compared to Ubx mediated\u0026nbsp;activation of DE5 itself. TEIL factors present inside cells shows its activity along\u0026nbsp;with Ubx.\u0026nbsp;(D) N7 contains Adf1 binding elements and is responsive to internal Adf1 factors presented by 3\u003csup\u003erd \u003c/sup\u003ebar on induction with GFP as control. N7 oligo in DE5 shows additive response induced by Ubx on DE5 and Adf1 internal factor on N7 oligo.\u0026nbsp; Each bar represents single experiment done in three wells. Error bar represents SD.\u0026nbsp; Ubx or GFP are induced by CuSO\u003csub\u003e4\u003c/sub\u003e. P-value represented as \u0026lt;*0.05, \u0026lt;**0.01,\u0026nbsp; \u0026lt;***0.001\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5172078/v1/39bdf647b32ebf8f5bfac5c0.png"},{"id":65695809,"identity":"409383af-8d66-40b9-bc45-50ba1fb8765e","added_by":"auto","created_at":"2024-10-01 11:17:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":665026,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5172078/v1/332a337d-11b3-4284-81e7-ea60afcb847c.pdf"},{"id":65695441,"identity":"d1bed3ae-f471-427b-89a0-185592cea86c","added_by":"auto","created_at":"2024-10-01 11:09:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":476756,"visible":true,"origin":"","legend":"\u003cp\u003eMechanism of recognition and binding of Ultrabithorax\u003c/p\u003e","description":"","filename":"hoxgenemotifsup.docx","url":"https://assets-eu.researchsquare.com/files/rs-5172078/v1/702668037a3ebdd69278dba4.docx"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003eMechanism of recognition and binding of Ultrabithorax\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eUltrabithorax (Ubx) consists of a highly conserved 60-amino-acid DNA binding motif, the Homeodomain. Ubx functions as a transcription factor by directly binding to Ubx responsive elements. Various approaches have been used to identify the Ubx responsive elements. Biochemical approach identified a total of 7 heptamer Ubx \u0026ndash;binding motifs T-T-A-A-T-T/G-A/G (Ekker et. al; 1991). Ubx have low DNA binding specifity in vitro but are highly specific \u0026nbsp; in in-vivo. Despite the knowledge of Ubx responsive elements, the mechanism of action of Ubx protein as activator and repressor remains elusive. Various co-factors like Extradenticle (Exd) and Homothorax (Hth) are required by Hox protein to show its activity. However, Exd/Hth is not required by Ubx in development of haltere. Further Collaboration of many contexts\u0026apos; specific transcription factors with recruitment of specific co-repressor and/or activators is one of the mechanisms by which Hox proteins determines the transcriptional output. Unfortunately, a few examples for this kind of collaboration are known (Hueber and Lohmann, 2008). \u0026nbsp; Genome wide approach to identify targets of Ubx using ChIP assay identified some motif frequently present in Data Set using bioinformatics approach (Agrawal et al., 2011). TRANSFAC analysis of suggested small sequences codes for other transcription factors. Our aim in this direction was to validate putative motifs and to further examine functionality of them along with Ubx. \u0026nbsp;Here we report the functionality of few Ubx responsive other transcription factor binding motifs using Schneider (S2) cell reporter assay.\u0026nbsp;\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cp\u003e2.1 Bacterial culture \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBacteria were streaked out and grown on Luria Broth (LB)-agar plates containing respective antibody for selection of transformants or in liquid \u0026nbsp;culture. Transformed bacterial culture were maintained as glycerol stock, followed by freezing them in liquid nitrogen and subsequently stored at -700C. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.2 Preparation of Ultracompetent cells\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eUltracompetent cells were prepared using the Inoue method for preparation and transformation of E coli (Sambrook et al. 1987). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.3 Plasmid Constructions\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eUbx expression plasmid\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur lab had cloned the full length cDNA of Drosophila Melanogaster Ubx into pET 14b vector for protein expression. This fragment of Ubx having stop codon was PCR amplified from pET14b vector with PCR primers containing Kpn1 and BamH1 sites and was then sub-cloned into Kpn1 and BamH1 sites of a Drosophila expression vector, pRmHa-3GFP containing metallothionein promoter. Both the above constructs were sequence verified.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eForward primer: CCGGGTACCAGCGCAATGAACTCGTACTTTGA\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eReverse primer: CGGGGATCCCTACTGATCTAAGTGTCCACCTTG\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eReporter Plasmids\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAddition of new motifs and control oligos into pDE5\u0026ndash;37tkluc vector. Both sense and antisense oligos containing Kpn1 and Nhe1 were synthesized. \u0026nbsp;Equal amounts of both sense and antisense oligos were heated for 10min at 99 \u0026nbsp;0C and slowly allowed to cool. After that both oligo and Vector was digested with Kpn1 and Nhe1 restriction enzymes and was ligated with Promega fast DNA ligase. To identify positive clone of interest, Colony PCR was done using sense oligo as forward primer and RV primer1, RV primer3, RV primer 4 as reverse primer. Then they were sequence verified using GL primer 2 as forward primer.\u003c/p\u003e\n\u003cp\u003ePrimer Used are:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRVprimer1 5\u0026rsquo;-CGACTCGAAATCCACATATCAAAT-3, RVprimer3 5\u0026acute;-CTAGCAAAATAGGCTGTCCC-3\u0026acute;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRVprimer4 5\u0026acute;-GACGATAGTCATGCCCCGCG-3\u0026acute;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor sequencing forward primer\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGLprimer2 5\u0026acute;-CTTTATGTTTTTGGCGTCTTCCA-3\u0026acute;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.4 Polymerase chain reaction (PCR)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter ligation and transformation positive colonies containing construct were identified using colony PCR. A master mix for PCR reaction was prepared on ice and randomly 5-10 clones were picked up from transformed master plate. \u0026nbsp;The picked single colony was simultaneously being marked and maintained on other culture plate. Then same tips were kept inside PCR tubes. PCR reaction was set up using the specific primers along with a positive and a negative control. Then selected positive colony from colony PCR was further sequence verified.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.5 Cell Culture\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDrosophila S2 cells were maintained with standard methods. S2 cells were grown in Schneider\u0026rsquo;s media (invitrogen) supplemented with 10% fetal bovine serum, without any antibiotics. For transient transfection, 1.5 X 106cells per well in 6-well plates and 8-4.8X 108in 24 Well plates were seeded for experiments. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.6 Extraction of plasmid DNA\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConstruct containing pDE5\u0026ndash;37tkluc added oligos and pDE5\u0026ndash;37tkluc as control were prepared using Sigma midi prep while other plasmids were prepared using maxiprep method (Sambrook et al. 1987) and were used for transfection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.7 Transient transfection and dual luciferase assay\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eS2 cells were grown in\u0026rsquo;s media (invitrogen) supplemented with 10% fetal bovine serum, without any antibiotics. Transient transfections into Drosophila S2 cells were carried out by effectene transfection reagent (Qiagen) as described by company. Total of 150ng of DNA was used for transfection in 12 well plates. Expression of Ubx protein in pRmHa3-Ubx transfected S2 cells were induced by 0.5mM copper sulphate after 18-20 h of transfection, cells were lysed after 24 hrs for extraction of protein and expression of proteins in \u0026nbsp;cells were detected by immunofluoresence with N-terminal anti-Ubx \u0026nbsp;antibodies as described below and by western blot analysis. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor all reporter assay Co-transfections into Drosophila S2 cells were carried out by effectene transfection reagent (Qiagen). Expression vector to reporter was 1:5 or 1:1. Expression of Ubx protein in pRmHa3-Ubx transfected S2 cells were induced by 0.5mM copper sulphate after 18-20 h of transfection, cells were lysed after 24 hrs of induction. The luciferase reporter activity was determined with the dual luciferase reporter assay system (Promega).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.8 Antibody Staining for S2 cells\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePreparation of Cover slip: Before growing cells on cover slip they were soaked in 1N HCl for overnight at 600C in oven. Then were washed thoroughly with autoclaved water and were stored in pure ethanol.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter that cover slips were dried in a large plastic Petri dish without filter paper in Tissue culture hood. They were kept such that they do not touch each other. 0.5 mg/ml solution of ConA filter sterilized (Sigma) in water was added with pipette and was kept for 30min-1hr. ConA on cover slip was washed with PBS and was air dried.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor detecting protein of interest cells were cultured on glass cover slips coated with conA. Then expression plasmids were transformed. For staining cell culture media was removed and cells were fixed with 3.5% paraformaldehyde and 0.05% glutraldehyde in PHEM buffer saline (60mM PIPES, 25mM HEPES, 10mM EGTA, 2mM MgCl2, 6H2O) for 10 min. Cells were washed 3 times with PHEM buffer saline and were permeabilized with 0.1% Triton X\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e100 in PHEM for 10 min. Cells were blocked with 5% heat inactivated goat serum in PHEM buffer for one hour. The cells were incubated with primary polyclonal Nterminal anti-Ubx (1:1000) overnight at 4 \u0026deg;C. After that 4 washes for 10 min with PHEM buffer was given and fluorescein secondary antibodies (1:1000) were applied for one hour at room temperature in dark. Final 3 washes for 10 min were performed. Cover slip with antifade reagent with DAP1 was placed gently on slide to visualize the protein by fluorescence microscopy.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.9 Western blot analysis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCultured suspension S2 cells were centrifuged at 450Xg for 5min to pellet cells and media was removed. Cells were given wash with PBS and were further centrifuged to remove PBS. RIPA lysis buffer or passive lysis buffer was added and was mixed by vortexing. Kept on ice for 15 min and further votexed briefly to re-suspend cells and lyse residual cells. \u0026nbsp;Whole adult and larvae samples were frozen in liquid nitrogen after that were crushed and lysed in RIPA lysis buffer. Samples were quickly frozen in liquid nitrogen and stored at -700C for future use. Then stored samples were centrifuged to remove cell debris and supernatant was treated for loading on gels. Protein harvested from cell was further boiled for 5min in Laemmli\u0026rsquo;s buffer and separated on 10% SDS-PAGE (Sambrook et al. 1987). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe resolved gel was blotted on PVDF membrane and was stained with Ponceau S to check the protein. The membrane was blocked with 5% skimmed milk for 1X TBST Membrane was given three wash for 10min at RT with 1X TBST. The transblot was probed with antibodies against polyclonal N-terminal Ubx antibody (Agrawal et al., 2011) diluted to 1:5000 and followed by secondary horseradish peroxidase-conjugated antibodies for 1h at \u0026nbsp;RT or overnight at 4\u0026deg;C.\u0026nbsp;\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Expression of Ubx in S2 cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo design an assay system for Ubx responsive elements, we first checked the expression of Ubx in S2 cells using western blot analysis. N-terminal specific antibody was used to confirm expression Ubx.Ubx was found to be absent in S2 cells. Next, we expressed full length Ubx in S2 cells using transient transfection and detected it using antibody staining and western blot analysis. \u0026nbsp;S2 cells expressing Ubx were stained with Polyclonal N-Terminal Ubx antibody and Ubx was observed to accumulate in the nucleus. Immunoblot analysis showed various Ubx expressing band and can be because of post translational modification by Phosphorylation of Ubx in S2 cells (Gavis and Hogness et al 1991) (Fig. A.1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Ubx is responsive to Dorsal and Twist binding elements and response is not because of any cryptic Ubx responsive element present on vector\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBio-informatics data analysis of pulled down sequences revealed presence of\u0026nbsp;multiple transcription factor binding sites. Many potential targets of Ubx like\u0026nbsp;CG\u003cem\u003e17838, CG30413, CG30417, Khc-73, ttv\u0026nbsp;\u003c/em\u003ewere found to have pair of Dorsal and Twist transcription factor binding sites within 200 bp pulled down sequences. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConsistent with previous finding we detected response of Ubx in a vector sequence carrying Dorsal and Twist factor responsive elements present in 5 copies (DE5). Increase in reporter activity was observed on induction of Ubx. \u0026nbsp;Next we asked whether the increase in reporter activity observed is because of Dorsal and Twist interaction with Ubx or cryptic Ubx responsive elements present on vector. In this direction we induced Ubx in parental Vector lacking Dorsal and Twist binding element. Increase in reporter activity was not observed. \u0026nbsp;Therefore, Induction of Ubx causes enhancement of Dorsal and Twist mediated reporter activity (Fig A.2 A). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther, we used Ubx responsive DE5 vector in S2 cells to test the functionality of putative Ubx responsive elements in S2 cells. In this direction some the Known Ubx responsive elements tested positive for Ubx binding using in-vitro assay like EMSA and other potential responsive elements obtained by Genome wide assay were cloned upstream to DE5 sequence (Fig. A.2 B, Listed in table A.1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Assay for some of the known Ubx responsive elements and Putative responsive/binding elements \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSpalt (sal)\u0026nbsp;\u003c/em\u003egene is repressed by Ubx in haltere (Galant et al., 2002). Multiple monomer Ubx-binding sites are required to completely repress the cis-element in the haltere, and that the individual Ubx-binding sites are sufficient to mediate its partial repression. Consistent with previous finding, some of the Ubx responsive elements of Sal tested using in-vitro EMSA assay were added upstream to DE5. Ubx activates \u003cem\u003eCG13222\u0026nbsp;\u003c/em\u003egene in haltere (Hersh et al., 2007). \u0026nbsp;Ubx Responsive CG13222 cis-regulatory oligos already tested by EMSA were also added to DE5-37tkluc vector. There are two Ubx binding sites present in the cis-regulatory region of the gene. However, Increase and decrease in activity was not consistently observed on EMSA tested oligos in S2 cells and a random sequence was used as control. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther small Ubx binding Heptamer elements in 3 copies were added upstream to DE5 sequence and were subjected to assay. No response towards the three copies of Ubx containing Heptamer was observed. Therefore, internal Dorsal and Twist containing factor have no role in facilitating the binding of Ubx to its response elements and further we can speculate here that increased response may be a result of protein-protein interaction.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther we checked the Ubx responsive elements obtained by Genome wide experiments (Agrawal et al., 2011). They were cloned in 3copies upstream to DE5 sequence. Among all the tested motifs N1, N4 and N7 showed change in reporter activity. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe next looked response of added oligos to the internal factors present inside the cells. DE5-37tkluc vector containing oligo was transfected with GFP expressing vector. N1 and N7 oligos showed increase in reporter activity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 6.1 Oligos and Their sequences tested in S2 cell assay.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eOligo\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eSequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eRandom\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XATCTAGATCTAG\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eC3\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XCGCAGATAAATTACACTGGCCGCCCGCGAGATTAC CATCGAG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eH3\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XTTAATAT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eN1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XAGAGAGAGAGAG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eN2\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XTGTTGTTGTTGC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eN4\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XAGATACAGATAC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eN6\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XGGCGACGGCGGC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eN7\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3XGCTCCAGCTGCT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/br\u003e\n\u003cp\u003e\u003cstrong\u003eA.3.4 Differential response by Ubx responsive N1, N4 and N7 motifs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRANSFAC analysis has shown N1 as GAGA factor binding element, N4 as TEIL binding element and N7 as Adf1 binding element. Next to analyse whether the increased Ubx reporter activity observed is because of Ubx or internal factor we compared there response by Ubx and internal factors. N1 \u0026nbsp;oligos were responsive to internal GAGA associated factor (GAF) present in \u0026nbsp;cells tested by western blot. Further on induction of Ubx decrease in reporter activity was observed. Therefore, Ubx along with GAF causes decrease in reporter activity (Fig. A.4 A, B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSecond motif N4 /TEIL factor binding elements were not responsive to any internal factors present inside the cells. Interestingly induction of Ubx showed increase in reporter activity and can be because of either direct binding of Ubx or by interaction of Ubx with TEIL factor (Fig. \u0026nbsp;A.4 C). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eN7 similar to Adf1 binding motif were responsive to internal factors and showed increase in reporter activity. Addition of Ubx further to N7DE5tkluc vector showed further increase in activity. But almost additive effect of Ubx responsive DE5 and N7 to internal factors was observed (Fig. A.4 D).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis\u0026nbsp;TRANSFAC analyses of pulled down sequences has shown presence of several clusters of potential binding sites for various transcription region like Ubx/GAGA, Ubx/Twi, Ubx/dl, Ubx/dl/GAGA factor, CEBP/dl/GAGAfactor and many other combinations of transcription factor (Agrawal et al., 2011). Interestingly, not all pulled down sequences revealed presence of Ubx binding sequence. Here Using S2 cell assay we have attempted to understand the functionality of some of these binding elements along with their interaction with Ubx.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAddition of Ubx binding sites upstream to DE5 as small Heptamer in tandem or tested positive Ubx responsive elements with Ubx binding region along with its few base pair flanking sequence induced no change in reporter activity. In contrast to this Ubx was responsive to other transcription factor binding sequences. Indicating that collaboration with other transcription factor is indeed one of the important steps required by Ubx to perform activity. We here show that presence of Ubx can modulate the transcriptional activity of some of these transcription factors. We have identified possible ways by which Ubx can modulate the activity; one by enhancing the Dorsal/Twist mediated activation of reporter activity. Second Ubx can modulate the binding or activity of GAGA factor leading to decrease in transcriptional activity. \u0026nbsp;Third some of the already present transcription factors like TEIL element binding factors along with Ubx are required for activity. Adf1 showed increase in activity with Ubx in S2 Cells. Therefore, many transcription factors are required by Ubx to modulate its functionality.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlthough we have tested only few combinations of transcription factors indicating existence of other possible ways by which Ubx can modulate the activity of other transcription leading to change in transcriptional activity. This assay system can further be used as a system to understand how Ubx interacts with other existing combinations of transcription factors as cofactors or collaborators to identify its target and to function as activator or repressor. section should highlight the importance and novelty of the work and discuss the implications of the findings in the context of the existing understanding in the field. Refrain from providing more background information or repeating the results here. The limitations of the study should also be objectively discussed. If a Conclusions section is not included separately, please also include a dedicated paragraph to discuss the broader and/or real world implications of the results and future work.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e:\u0026nbsp;Thank you to IISER, Pune, India. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e: Council for Scientific and Industrial Research, CSIR, India.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAgrawal P, Habib F, Yelagandula R et al (2011) Genome-level identification of targets of Hox protein Ultrabithorax in Drosophila: novel mechanisms for target selection. Sci Rep 1:205\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradley M, Hersh CE, Nelson, Samantha J, Stoll JE, Norton TJ, Albert SB (2007) Carroll,The UBX-regulated network in the haltere imaginal disc of D. melanogaster, Developmental Biology, 302, Issue 2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEkker S, Young K, Kessler D, Beachy P (1991) Optimal DNA sequence recognition by the Ultrabithorax homeodomain of Drosophila. EMBO J 10:1179\u0026ndash;1186. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/j.1460-2075.1991.tb08058\u003c/span\u003e\u003cspan address=\"10.1002/j.1460-2075.1991.tb08058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGavis ER, Hogness DS (1991) Phosphorylation, expression and function of the Ultrabithorax protein family in Drosophila melanogaster. Development 112(4):1077\u0026ndash;1093\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHueber SD, Lohmann I (2008) Shaping segments: Hox gene function in the genomic age. BioEssays, 30\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolecular cloning (1987) a laboratory manualby Sambrook, Joseph\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalant R, Walsh CM (2002) S.B. Carroll Hox repression of a target gene: extradenticle-independent, additive action through multiple monomer binding sites, Development, 129 pp. 3115\u0026ndash;3126 (Galant 2002)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen WF, Krishnan K, Lawrence HJ, Largman C (2001) The HOX homeodomain proteins block CBP histone acetyltransferase activity. Mol Cell Biol 21:7509\u0026ndash;7522\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas M, William ME, Williams R, Kuickb D, Misekb (2005) Kevin McDonaghc Samir Hanashb, Jeffrey W. Innis. Candidate downstream regulated genes of HOX group 13 transcription factors with and without monomeric DNA binding capability. Dev Biol 279:462\u0026ndash;480\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hox genes, Ultrabithorax, Ubx-binding and/or recognition motifs, activity regulation","lastPublishedDoi":"10.21203/rs.3.rs-5172078/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5172078/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eHox\u003c/em\u003e genes are highly conserved throughout metazoan evolution and code for homeodomain containing transcription factors that control specific developmental pathways. Ultrabithorax (Ubx) exerts its function mainly through activation or repression of downstream genes. Only a few direct target genes of Ubx have been identified and studied in detail therefore mechanism of Ubx mediated control of its target gene is far from complete. Understanding the mechanisms by which Ubx regulates its targets requires the knowledge of target genes and of sequence motifs that serve as recognition and binding elements for Ubx. By employing chip-on-chip and bioinformatics approach, our lab identified a large number of downstream targets of Ubx. The sequence analyses of these genes have suggested few potential Ubx-binding and/or recognition motifs. Here we report the results of cell-based luciferase assays to confirm if these motifs are indeed Ubx-response elements and understand the mechanism of activation and repression.\u003c/p\u003e","manuscriptTitle":"Mechanism of recognition and binding of Ultrabithorax","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-01 11:09:39","doi":"10.21203/rs.3.rs-5172078/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ff666284-3be1-4388-bf67-36d98aacba16","owner":[],"postedDate":"October 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":38318476,"name":"Developmental Biology"}],"tags":[],"updatedAt":"2024-10-01T11:09:39+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-01 11:09:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5172078","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5172078","identity":"rs-5172078","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}