Novel Biosynthesis and Evaluation Cytotoxic Effect of Tellurium Nano-Particle on Breast Cancer Using Co-Culture of Spirulina and Lentinula Edodes

Novel Biosynthesis and Evaluation Cytotoxic Effect of Tellurium Nano-Particle on Breast Cancer Using Co-Culture of Spirulina and Lentinula Edodes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Novel Biosynthesis and Evaluation Cytotoxic Effect of Tellurium Nano-Particle on Breast Cancer Using Co-Culture of Spirulina and Lentinula Edodes Mahdieh Ameri Shah Reza, Alireza Rasouli, Tahereh Komeili Movahhed This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4476610/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Aug, 2024 Read the published version in BioNanoScience → Version 1 posted 15 You are reading this latest preprint version Abstract Introduction Bio-based nanoparticle production has been an alternative method for preparing nanoparticles for pharmaceutical and biomedical applications. This study aims to evaluate the production of tellurium nanoparticles (TeNPs) using the co-culture of algae and fungi and finally to investigate the cytotoxicity of nanoparticles on cancer cell lines MDA-MB-468 and healthy cell line HFF. Methods The production of TeNPs was done using the co-culture of algae and fungi. Using the Tyndall effect, FTIR, and FESEM, nanoparticles were evaluated. Finally, using the MTT assay, the toxicity of the nanoparticles produced on MDA-MB-468 and HFF was investigated. Results Data showed that it is possible to produce TeNPs using the co-cultivation of algae and fungi. Also, the produced nanoparticles had a size between 20 and 30 nm. Examining the cytotoxicity effects of the created nanoparticle showed that this nanoparticle has an inhibitory effect on cancer cells, while it does not affect healthy cells. Conclusion In this study, biosynthesis of TeNPs using co-culture was performed for the first time. The data showed that it is possible to use the co-culture of algae and fungi to produce TeNPs that can inhibit the growth of human breast cancer cells. Biosynthesis Tellurium Nano-Particle Co-Culture Spirulina Lentinula Edodes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Nanoparticles are synthesized by various physical and chemical methods. The chemicals used in the synthesis process of nanoparticles are dangerous for nature and cause various environmental problems. Also, the use of synthetic methods, especially the physical method, requires a large amount of energy, which creates a large cost economically [ 1 , 2 ]. Unlike the physical and chemical methods of nanoparticle synthesis, biological synthesis is a cost-effective, environmentally friendly, and beneficial alternative that does not require any toxic chemicals, or energy sources, and can be used for biomedical applications, especially in clinical fields. Several plants and microorganisms have been used for this synthesis. Bacteria, fungi, yeasts, and algae are usually involved in the synthesis of various metal nanostructures [ 3 ]. Biogenic methods such as using enzymatic processes to produce metal nanoparticles are far superior to the chemical synthesis of nanoparticles. Microorganisms live in diverse environmental conditions. Particles produced by this process show higher catalytic reactions, improved contact between enzyme and metal salt, and higher specific surface area [ 4 ]. Algae are the main category of marine ecosystems. Algae produce a significant number of industrially useful secondary metabolites that play an important role in pharmaceuticals. The capacity to accumulate heavy metals is a secondary advantage in algae due to being eukaryotic and autotrophic. Low concentrations of metals are used by microalgae to perform metabolic functions and act as a reducer in algal cells [ 5 , 6 ]. The mechanism of synthesis of nanomaterials in algae includes preparation of extract and metal precursor solution, and incubation of both solutions for synthesis of nanomaterials. The concentration of extract and metal solution, pH, temperature, and time are among the controlling factors in the synthesis process [ 7 ]. The fungal mycelium network is preferred to other microbial syntheses due to its greater resistance to flow movement and stirring in bioreactors [ 4 ]. Fungal systems have emerged as an efficient and sustainable system for the synthesis of nanoparticles because fungi have distinct functional characteristics including high wall binding capacity, easy growth and cultivation requirements, and simpler biomass transport [ 8 ]. Fungi have the potential to produce intracellular and extracellular nanoparticles [ 9 , 10 ]. Tellurium exists in nature as a soluble oxyanion in four oxidation states and is a metalloid. This substance can be toxic in low concentrations (1 µg/ml − 1 ) [ 11 ]. In recent years, the conversion of tellurite to tellurium has attracted the attention of researchers due to its diverse applications [ 12 ]. Tellurium nanoparticles (TeNPs) have attracted research and industry attention due to their high biocompatibility [ 13 ], antioxidant, anticancer, and antimicrobial activity [ 14 , 15 ], and their ability to reduce cholesterol and triglyceride levels [ 16 ]. The efficiency of microorganisms in converting metalloid oxyanions into less toxic elemental forms leads to reduced toxicity and increased bioavailability of tellurium [ 17 ]. Tellurium has other uses, including anti-biofilm properties, bioremediation, bioremediation, etc [ 18 ]. The purpose of this research is to investigate the production and synthesis of TeNPs by Co-Culture of spirulina algae and shiitake mushroom, to characterize the produced nanoparticles, and to evaluate the toxicity effects of the produced nanoparticles against cancer cells and molecular identification of mushroom. 2. Material and Method 2.1 Microorganism and media Shiitake mushrooms were purchased from the food market in Tehran (Iran). The stock culture was maintained on malt extract agar (MEA) at 4°C and was sub-cultured monthly. The cultures were inoculated with mycelia and incubated at 25°C for 14 days. To confirm the characteristics of the used fungal strain, molecular identification was performed. Spirulina sample were purchased from Bio-Green Co, (Tehran-Iran). 20 ml of the purchased algae sample was inoculated in a 500 ml flask containing 200 ml of Zeruk culture medium at pH 8. The flasks were kept in a culture room at 30°C under continuous illumination at 12:12 h light/dark (5000 lux) for 14 days. 2.2 Biosynthesis of TeNPs The liquid culture supernatant of algae and fungi was separated using a centrifuge (4500 rpm for 10 min), and 100 ml of each was added to a 500 ml flask, then 100 ml of the prepared 1 mM potassium tellurium (K 2 TeO 3 , 3 H 2 O, Sigma Aldrich, USA) solution was added and it was incubated for 5 days at 28°C with pH 9. Finally, the precipitate containing TeNPs was separated by centrifugation (15000 rpm for 15 min). To increase the purity of the experimental sediment, TeNPs were washed three times with deionized distilled water. The TeNPs were dried at 40°C and carefully stored in vials for further analysis [ 19 ]. Macroscopic determination of the formation of TeNPs was observed by the color change of the solution and the Tyndall effect [ 19 ]. 2.3 Determining the characteristics of tellurium nanoparticles To confirm the extracellular biosynthesis of tellurium nanoparticles, first, the supernatant free from the biomass of the co-culture of algae and fungi was passed through 0.25-micron syringe filters. Then, to deposit tellurium nanoparticles, a centrifuge (15000 rpm for 45 min) was used, and FTIR and FESEM analyses were performed to determine the state of the formed nanocrystals and check the shape, size, and stability of the synthesized nanoparticles. 2.4 MTT Assay Human breast cancer cell lines (MDA-MB-468) and healthy cell line (HFF) were obtained from Iran's National Center for Genetic and Biological Resources (IBRC) and used in this study. These cells were cultured respectively in Dulbecco's Modified Eagle's Medium (DMEM) - Ham's F12 and DMEM high glucose containing 10% fetal bovine serum, penicillin (100 units/ml) and streptomycin (100 mg/ml). Then they were placed in an incubator containing 5% CO2, 95% humidity, and 37°C temperature. Flasks were examined daily by an inverted microscope in terms of cell growth and density, morphology, and contamination control. Changing the complete culture medium containing 10% FBS was done at the required time. Investigating the effect of TeNPs cytotoxicity by colorimetric method, using color 5-dimethylthiazol-2-y1]-2-5diphenyltetrazolium bromide (MTT), (3-[4 tetrazolium bromide water-soluble salt) was performed. This method is based on the activity of the enzyme succinate dehydrogenase present in the mitochondria of living cells and purple insoluble formazan crystals. This compound is soluble in DMSO. Since the dead cells are not able to convert MTT to formazan, the level of formazan is proportional to the number of MDA-MB-468 cells 5000 cells were planted in each well of a 96-well plate. 48 hours after the cells were planted, the old culture medium was removed from the wells, and cells with different concentrations (8, 32, 64, 128, 256 µg/ml) Nanoparticles and chemotherapy drug tamoxifen (1.25, 2.5, 5, 10, 20, 40 µg/ml) were treated. 4 wells were considered for each treatment and 4 wells for each time of the experiment. The complete culture was assigned as a control. The plates were incubated in an incubator containing 5% CO 2 , 95% humidity, and a temperature of 37°C. After the incubation time, the supernatant was carefully removed from each well It was replaced with the complete culture medium containing MTT solution and placed in the incubator for 4 hours, then the supernatant of each well was drained and 200 microliters of DMSO solution was replaced with the previous solution to dissolve the formazan crystals. After 15 minutes, the optical density was read using an ELISA device (USA, Bio Tek, Synergy/HTX) at a wavelength of 570 nm. The amount of absorption is directly proportional to the number of living cells. The results are calculated in terms of the percentage of live cells compared to the control from the following equation: 100 x (average absorption of control cells/average absorption of treated cells) = percentage of living cells 2.5 Molecular Identification Molecular identification of the fungal strain was done based on the 18s rRNA. DNA was extracted using the DNA extraction kit of the Denazist Company (Iran). The extracted genetic material was measured in 260 nm optical absorption (Nanodrop) and observed in agarose gel. PCR was performed using primers 5'TCCGTAGGTGAACCTGCGG3' and 'TCCTCCGCTTATTGATATGC3' for ITS1 and ITS4, respectively. Both primers amplify fragments containing about 600 bp. The PCR product was purified using the Takapouzist (Iran) PCR purification kit [ 20 ]. The obtained product was sequenced at Microscience (Switzerland) by the Sanger/Capillary method and both strands were studied to ensure reliability. Sequences were cleaned and aligned using Bioedit software (version 7.2.5). The sequences were BLAST and Phylogenetic trees were performed using MEGA X software. Finally, the identified strain was registered on the NCBI. 2.6 Statistical Analysis The data were analyzed by Excel and GraphPad Prism 8.2.1 software. The drug concentration required to inhibit cell growth by 50% (IC 50 ) was calculated and plotted by PRISM software and by non-linear regression analysis, using dose-response curves. became 3. Results Macroscopic observations show the change in color of the solutions from light to dark, the images are given in Fig. 1 . The FTIR spectra (Fig. 2 ) generated from the concentration of TeNPs Synthesis by Co-Culture of fungi and algae showed that the nanoparticles have absorption peaks around 617, 1031, 1633, 1363, 1421, 1633, 2918, and 3428 cm − 1 at the wavelength of 500–4000 cm − 1 . The peaks 3428 and 1633 cm − 1 were assigned to O-H and C-C stretching, respectively. The peak at 2918 cm − 1 was related to the C-H stretching of protein methylene groups. In addition, the peak at 1421 cm − 1 corresponds to the N-H bending of primary amides due to carbonyl stretching in proteins. In addition, the peak at 1031 cm − 1 could correspond to the C-N stretching vibration of amine, indicates the size reduction and formation of nanoparticles. FESEM Analysis (Fig. 3 ) shows the formation of nanoparticles resulting from the Co-Culture. Also, the average size of nanoparticles created is between 20 and 30 nm. Statistical analysis of the size of nanoparticles is given in Fig. 4 . MTT Assay The cytotoxic effect of TeNPs on the proliferation of MDA-MB-468 and HFF cells was evaluated using the MTT method. These cells were treated with five different concentrations of TeNPs (8, 32, 64, 128, 256 µg/ml) for 24, 48 and 72 hours. As shown in Fig. 5 , TeNPs inhibit the growth of MDA-MB-468 cells in a concentration-dependent and time-dependent manner. By examining the results of the MTT test, it was observed that with the increase in the nanoparticle concentration and with the increase in the treatment time, the survival percentage of cancer cells decreased significantly compared to the control. IC 50 values ​​calculated from dose-response curves in the MDA-MB-468 cell line for TeNPs are shown in Fig. 5 . IC 50 in 24, 48 and 72 hours was 126.4, 95.38, and 27.24 µg/ml, respectively. Figures (6) shows the toxicity of different concentrations of TeNPs on the HFF cell line. By examining the results of the MTT test, it was observed that the effect of TeNPs on normal HFF cells is much lower than on cancer cells. The IC 50 of TeNPs in the case of normal HFF cells was calculated as 423.2, 302.9, and 160.4 µg/ml in 24, 48, and 72 hours, respectively, using GraphPad Prism 8.0.2 software. In the study conducted, HFF cells were less sensitive to TeNPs (Fig. 7 ). For example, comparing the value of IC 50 at 48 hours, the amount of IC50 in HFF cells was approximately 3.17 times higher than that of MDA-MB-468 breast cancer cell lines. In addition, in this research, to compare with nanoparticles, the effect of chemotherapy drug tamoxifen was investigated. IC 50 for tamoxifen was determined as 13.1 µg/ml and 23.84 µg/ml after 48 hours of treatment in MDA-MB-468 and HFF cells, respectively (Fig. 8 ). Molecular Identification The results of 18s rRNA sequencing showed more than 99% similarity with Lentinula edodes . The strain Lentinula edodes voucher (accession number: MN622792.1) is found in the gene bank, indicating the close relationship between both strains. Lentinula edodes strain is registered in NCBI under the accession number PP502150.1 The result of drawing the phylogeny tree is shown in Fig. 9 . 4. Conclusion The Evaluation of the use of fungi and algae for the biological production of TeNPs showed that it is possible to use co-culture and this method does not prevent the production of nanoparticles. FTIR and FESEM showed that the size reduction of metal particles was created and the average size of nanoparticles is between 20 and 30 nm. Biosynthesis of nanoparticles using green technology is emerging as an environmentally friendly, cost-effective, and risk-free strategy. In recent years, TeNPs have attracted increasing attention due to their unique properties in biomedicine [ 21 ]. Sayadi et al. (2018) produced nanoparticles using spirulina algae extract [ 22 ]. Shalabi et al. (2021) produced metal nanoparticles using spirulina algae [ 23 ]. Takada et al. (2022) formed biogenic tellurium nanorods using unicellular green algae [ 24 ]. Inaba et al. (2023) produced tellurium nanorods in unicellular algae [ 18 ]. Elsakhawy et al. (2022) investigated the ability of green synthesis of nanoparticles by fungi [ 25 ]. Amin et al. (2023) produced metal nanoparticles using the secondary metabolites of Lentinula edodes [ 26 ]. In many studies, the ability of algae and fungi to produce nanoparticles has been shown, and in the present study, the ability to produce TeNPs using the co-culture of algae and fungi was shown for the first time. The result showed that TeNPs had significant cytotoxic effects in most tested concentrations in human breast cancer cells (MDA-MB-468) and inhibited the growth of cancer cells. Normal human fibroblasts (HFF) showed more resistance to TeNPs than human breast cancer cells. As a result, TeNPs can find many biomedical applications with therapeutic importance in dealing with breast cancer. Vahidi et al. (2021) investigated the effect of tellurium nanoparticles against cancer cells and it was found that nanoparticles have the highest effect against breast cancer cells and have no effect on healthy cells [ 15 ]. cantharidin-tellurium nanoparticles have been found to have an inhibitory effect against cancer cells [ 27 ]. Sathiyaseelan et al. (2024) showed that the biosynthesis of TeNPs has an acceptable toxicity effect on breast cancer cells and has no effect on healthy cells [ 28 ]. Tellurium quantum dots have a dose-dependent toxic effect against breast cancer cells [ 29 ]. TeNPs showed Cytotoxic effect against cancer cells during 48 hours at concentrations up to 50 µg/ml and did not show any significant cytotoxic effect on normal cells under the same conditions [ 14 ]. Sathiyaseelan et al. (2024) showed that tellurium nanoparticles synthesized by chitosan have a significant cytotoxic effect against cancer cells and have no effect on healthy cells [ 30 ]. The anti-cancer effects of nanoparticles have been proven in many studies, in this research, the anti-cancer effects of TeNPs on breast cancer cells were determined and these nanoparticles can be used for therapeutic applications. Declarations Ethical Approval Human and animal samples were not used in this research. Funding This work was funded by a grant (grant no: IR.MUQ.REC.1400.107) from the Vice for Research and Technology of Qom University of Medical Sciences, Qom, Iran. Author Contribution Dr. Ameri is responsible for designing, conducting, and writing the article.Mr. Rasouli is responsible for writing and reviewing the article.Dr. Kamili is responsible for analyzing the effect of nanoparticles on cancer cells. Acknowledgement The authors would like to thank all staff in the Labs where the investigations were done. Indeed, the authors’ special gratitude goes to the laboratory staff at the Department of Biotechnology and Medicinal Chemistry especially all staff in the Fermentation Lab at Shahid Beheshti University of Medical Sciences Tehran, and Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, Iran, Iran, for their immense technical assistance and support during this study. References Wageh, S., et al. (2015). Synthesis and characterization of mercaptoacetic acid capped cadmium sulphide quantum dots. Journal of Nanoscience and Nanotechnology , 15 (12), 9861–9867. Iravani, S., et al. (2014). Synthesis of silver nanoparticles: chemical, physical and biological methods. Research in pharmaceutical sciences , 9 (6), 385–406. Saxena, A., et al. (2012). Green synthesis of silver nanoparticles using aqueous solution of Ficus benghalensis leaf extract and characterization of their antibacterial activity. Materials letters , 67 (1), 91–94. Saravanan, A., et al. (2021). A review on biosynthesis of metal nanoparticles and its environmental applications. Chemosphere , 264 , 128580. Jacob, J. M., et al. (2021). Microalgae: A prospective low cost green alternative for nanoparticle synthesis. Current opinion in environmental science & health , 20 , 100163. Michalak, I., & Chojnacka, K. (2015). Algae as production systems of bioactive compounds. Engineering in Life Sciences , 15 (2), 160–176. Aboelfetoh, E. F., El-Shenody, R. A., & Ghobara, M. M. (2017). Eco-friendly synthesis of silver nanoparticles using green algae (Caulerpa serrulata): reaction optimization, catalytic and antibacterial activities. Environmental Monitoring and Assessment , 189 , 1–15. Yadav, A., et al. (2015). Fungi as an efficient mycosystem for the synthesis of metal nanoparticles: progress and key aspects of research. Biotechnology letters , 37 , 2099–2120. Gholami-Shabani, M., et al. (2013). Evaluation of the antibacterial properties of silver nanoparticles synthesized with Fusarium oxysporum and Escherichia coli. Int J Lifesc Bt Pharm Res , 2 , 342–348. Li, G., et al. (2011). Fungus-mediated green synthesis of silver nanoparticles using Aspergillus terreus. International journal of molecular sciences , 13 (1), 466–476. Vaigankar, D. C., et al. (2018). Tellurite biotransformation and detoxification by Shewanella baltica with simultaneous synthesis of tellurium nanorods exhibiting photo-catalytic and anti-biofilm activity. Ecotoxicology and environmental safety , 165 , 516–526. Huang, W., et al. (2016). Facile One-Pot Synthesis of Tellurium Nanorods as Antioxidant and Anticancer Agents. Chemistry–An Asian Journal , 11 (16), 2301–2311. Medina Cruz, D., Mi, G., & Webster, T. J. (2018). Synthesis and characterization of biogenic selenium nanoparticles with antimicrobial properties made by Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA), Escherichia coli, and Pseudomonas aeruginosa. Journal of Biomedical Materials Research Part A , 106 (5), 1400–1412. Cruz, D. M., et al. (2019). Citric juice-mediated synthesis of tellurium nanoparticles with antimicrobial and anticancer properties. Green chemistry , 21 (8), 1982–1998. Vahidi, H., et al. (2021). Green nanotechnology-based tellurium nanoparticles: Exploration of their antioxidant, antibacterial, antifungal and cytotoxic potentials against cancerous and normal cells compared to potassium tellurite. Inorganic Chemistry Communications , 124 , 108385. Mirjani, R., et al. (2015). Biosynthesis of tellurium nanoparticles by Lactobacillus plantarum and the effect of nanoparticle-enriched probiotics on the lipid profiles of mice. IET nanobiotechnology , 9 (5), 300–305. Espinosa-Ortiz, E. J., et al. (2017). Biomineralization of tellurium and selenium-tellurium nanoparticles by the white-rot fungus Phanerochaete chrysosporium. International Biodeterioration & Biodegradation , 124 , 258–266. Zambonino, M. C., et al. (2021). Green synthesis of selenium and tellurium nanoparticles: current trends, biological properties and biomedical applications. International journal of molecular sciences , 22 (3), 989. Barabadi, H., Kobarfard, F., & Vahidi, H. (2018). Biosynthesis and characterization of biogenic tellurium nanoparticles by using Penicillium chrysogenum PTCC 5031: A novel approach in gold biotechnology. Iranian journal of pharmaceutical research: IJPR , 17 (Suppl2), 87. Sha, T., et al. (2008). Genetic diversity of the endemic gourmet mushroom Thelephora ganbajun from south-western China. Microbiology , 154 (11), 3460–3468. Abd El-Ghany, M. N., et al. (2023). Biosynthesis of novel tellurium nanorods by Gayadomonas sp. TNPM15 isolated from mangrove sediments and assessment of their impact on spore germination and ultrastructure of phytopathogenic fungi. Microorganisms , 11 (3), 558. Sayadi, M. H., et al. (2018). Bio-synthesis of palladium nanoparticle using Spirulina platensis alga extract and its application as adsorbent. Surfaces and Interfaces , 10 , 136–143. Shalaby, S. M., et al. (2021). Green synthesis of recyclable iron oxide nanoparticles using Spirulina platensis microalgae for adsorptive removal of cationic and anionic dyes. Environmental Science and Pollution Research , 28 , 65549–65572. Takada, S., et al. (2022). Formation of biogenic tellurium nanorods in unicellular green alga Chlamydomonas reinhardtii. Metallomics , 14 (11), mfac089. Elsakhawy, T., et al. (2022). Green Synthesis of Nanoparticles by Mushrooms: A Crucial Dimension for Sustainable Soil Management. Sustainability , 14 (7), 4328. Amin, Z. S., et al. (2023). Synthesis, characterization and biological activities of zinc oxide nanoparticles derived from secondary metabolites of Lentinula edodes. Molecules , 28 (8), 3532. Guo, Z., et al. (2020). Versatile biomimetic cantharidin-tellurium nanoparticles enhance photothermal therapy by inhibiting the heat shock response for combined tumor therapy. Acta Biomaterialia , 110 , 208–220. Sathiyaseelan, A., Zhang, X., & Wang, M. H. (2024). Biosynthesis of gallic acid fabricated tellurium nanoparticles (GA-Te NPs) for enhanced antibacterial, antioxidant, and cytotoxicity applications. Environmental Research , 240 , 117461. Naderi, S., et al. (2018). Cadmium telluride quantum dots induce apoptosis in human breast cancer cell lines. Toxicology and industrial health , 34 (5), 339–352. Sathiyaseelan, A., et al. (2024). In situ, synthesis of chitosan fabricated tellurium nanoparticles for improved antimicrobial and anticancer applications. International Journal of Biological Macromolecules , 258 , 128778. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 12 Aug, 2024 Read the published version in BioNanoScience → Version 1 posted Editorial decision: Revision requested 15 Jul, 2024 Reviews received at journal 14 Jul, 2024 Reviews received at journal 13 Jul, 2024 Reviews received at journal 11 Jul, 2024 Reviewers agreed at journal 08 Jul, 2024 Reviewers agreed at journal 08 Jul, 2024 Reviews received at journal 08 Jul, 2024 Reviewers agreed at journal 02 Jul, 2024 Reviewers agreed at journal 30 Jun, 2024 Reviewers agreed at journal 30 Jun, 2024 Reviewers agreed at journal 04 Jun, 2024 Reviewers invited by journal 04 Jun, 2024 Editor assigned by journal 04 Jun, 2024 Submission checks completed at journal 04 Jun, 2024 First submitted to journal 25 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4476610","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":313744301,"identity":"ac2362c2-f024-4fac-ba87-dcde19cec953","order_by":0,"name":"Mahdieh Ameri Shah Reza","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsklEQVRIiWNgGAWjYNACAxsYS4JoLWkka2E4TLRKBgbd9tOJjysKzkcbHE9g/PCDwSKfoBazM7mbDc8Y3M7dcOYBs2QPg4RlA0EtB3K3STaAtNxIYJAG+sWAsC3n327/2WBwDqSF+TdxWm7kbmNsMDgA0sJGpC033m4GOiw5d+aZh22WPQZEOSx348eGP3a5fceTD9/4UVFHWAsSSGwAxikpGhgYEkhTPgpGwSgYBSMHAADFwz0brv7JuQAAAABJRU5ErkJggg==","orcid":"","institution":"Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, Iran","correspondingAuthor":true,"prefix":"","firstName":"Mahdieh","middleName":"Ameri Shah","lastName":"Reza","suffix":""},{"id":313744302,"identity":"79a9cd16-c87e-4df2-8d9c-51a678d388b1","order_by":1,"name":"Alireza Rasouli","email":"","orcid":"","institution":"Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, Iran","correspondingAuthor":false,"prefix":"","firstName":"Alireza","middleName":"","lastName":"Rasouli","suffix":""},{"id":313744304,"identity":"0579ffd2-ccfd-4736-a2db-863bbc4cd5b0","order_by":2,"name":"Tahereh Komeili Movahhed","email":"","orcid":"","institution":"Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, Iran","correspondingAuthor":false,"prefix":"","firstName":"Tahereh","middleName":"Komeili","lastName":"Movahhed","suffix":""}],"badges":[],"createdAt":"2024-05-25 11:38:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4476610/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4476610/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12668-024-01592-w","type":"published","date":"2024-08-13T00:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58567472,"identity":"04d69847-4a42-4763-987c-e10642e6a1c8","added_by":"auto","created_at":"2024-06-18 10:18:03","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":118634,"visible":true,"origin":"","legend":"\u003cp\u003eMacroscopic analysis of the color change caused by the Synthesis of nanoparticles, (A) fungi, and algae combination, (B) Synthesis of nanoparticles, (C) Tyndall effect with visible laser beam path\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/35121fdcfec6646963179c5b.jpg"},{"id":58567465,"identity":"188af1b8-626c-4619-8cf4-99c34d3f7078","added_by":"auto","created_at":"2024-06-18 10:18:02","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":21034,"visible":true,"origin":"","legend":"\u003cp\u003eFTIR spectra of Synthesis TeNPs\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/dd9a3afaa8479301b9e3e109.jpg"},{"id":58567466,"identity":"b663ef7d-1970-4750-911b-f0e866bbbe1d","added_by":"auto","created_at":"2024-06-18 10:18:02","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":73997,"visible":true,"origin":"","legend":"\u003cp\u003eFESEM Analysis of TeNPs Show Synthesis and the size of Particle\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/2c246125b6ff7cc1a088a520.jpg"},{"id":58567464,"identity":"f9e5d83d-e2fe-4f3b-bbac-b4646820bb3d","added_by":"auto","created_at":"2024-06-18 10:18:02","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":27826,"visible":true,"origin":"","legend":"\u003cp\u003eStatistical analysis of TeNPs\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/5540e9d6ced55e7b830be41b.jpg"},{"id":58568111,"identity":"aec9d9a6-f89e-4343-b881-5b6121625f5b","added_by":"auto","created_at":"2024-06-18 10:26:02","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":132584,"visible":true,"origin":"","legend":"\u003cp\u003eThe cytotoxic effect of TeNPs at different concentrations and times of 24, 48 and 72 hours on MDA-MB-468\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/7eb64b5a657aa3737a8348a0.jpg"},{"id":58568110,"identity":"1c3cb8f9-f789-4e9b-b48f-8a3c31145e45","added_by":"auto","created_at":"2024-06-18 10:26:02","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":125692,"visible":true,"origin":"","legend":"\u003cp\u003eThe cytotoxic effect of TeNPs at different concentrations and times of 24, 48 and 72 hours on HFF cells\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/675ded11c9892260ab9a6853.jpg"},{"id":58567469,"identity":"a72c5e8a-2762-45d7-ac86-f8b3e6d761fc","added_by":"auto","created_at":"2024-06-18 10:18:02","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":104942,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the cytotoxic effect of TeNPs in different concentrations in 48 hours on MDA-MB-468 and HFF cells.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/e367931938bd876194688f6a.jpg"},{"id":58567470,"identity":"2241ad25-d6f9-4b95-9da4-2aed2b7a8ab3","added_by":"auto","created_at":"2024-06-18 10:18:02","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":35872,"visible":true,"origin":"","legend":"\u003cp\u003eCytotoxic effect of tamoxifen in different concentrations and 48 hours on HFF and MDA-MB-468 cells.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/600f26457d9921d6b4631767.jpg"},{"id":58567471,"identity":"ad8b21b8-875f-48b8-9038-4b61dc251130","added_by":"auto","created_at":"2024-06-18 10:18:03","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":171361,"visible":true,"origin":"","legend":"\u003cp\u003eThe result of drawing a phylogenetic tree with Mega X software based on neighbor-joining Analysis\u003c/p\u003e","description":"","filename":"Picture9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/e38a2aca4d300ba342bd0d4e.jpg"},{"id":62889008,"identity":"a3c4f911-e199-4d10-8ad3-ec85b027736e","added_by":"auto","created_at":"2024-08-20 16:49:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1218043,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4476610/v1/b48a0b40-2126-4214-a390-d7db64db0562.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Novel Biosynthesis and Evaluation Cytotoxic Effect of Tellurium Nano-Particle on Breast Cancer Using Co-Culture of Spirulina and Lentinula Edodes","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eNanoparticles are synthesized by various physical and chemical methods. The chemicals used in the synthesis process of nanoparticles are dangerous for nature and cause various environmental problems. Also, the use of synthetic methods, especially the physical method, requires a large amount of energy, which creates a large cost economically [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Unlike the physical and chemical methods of nanoparticle synthesis, biological synthesis is a cost-effective, environmentally friendly, and beneficial alternative that does not require any toxic chemicals, or energy sources, and can be used for biomedical applications, especially in clinical fields. Several plants and microorganisms have been used for this synthesis. Bacteria, fungi, yeasts, and algae are usually involved in the synthesis of various metal nanostructures [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Biogenic methods such as using enzymatic processes to produce metal nanoparticles are far superior to the chemical synthesis of nanoparticles. Microorganisms live in diverse environmental conditions. Particles produced by this process show higher catalytic reactions, improved contact between enzyme and metal salt, and higher specific surface area [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Algae are the main category of marine ecosystems. Algae produce a significant number of industrially useful secondary metabolites that play an important role in pharmaceuticals. The capacity to accumulate heavy metals is a secondary advantage in algae due to being eukaryotic and autotrophic. Low concentrations of metals are used by microalgae to perform metabolic functions and act as a reducer in algal cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The mechanism of synthesis of nanomaterials in algae includes preparation of extract and metal precursor solution, and incubation of both solutions for synthesis of nanomaterials. The concentration of extract and metal solution, pH, temperature, and time are among the controlling factors in the synthesis process [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The fungal mycelium network is preferred to other microbial syntheses due to its greater resistance to flow movement and stirring in bioreactors [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Fungal systems have emerged as an efficient and sustainable system for the synthesis of nanoparticles because fungi have distinct functional characteristics including high wall binding capacity, easy growth and cultivation requirements, and simpler biomass transport [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Fungi have the potential to produce intracellular and extracellular nanoparticles [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Tellurium exists in nature as a soluble oxyanion in four oxidation states and is a metalloid. This substance can be toxic in low concentrations (1 \u0026micro;g/ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In recent years, the conversion of tellurite to tellurium has attracted the attention of researchers due to its diverse applications [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Tellurium nanoparticles (TeNPs) have attracted research and industry attention due to their high biocompatibility [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], antioxidant, anticancer, and antimicrobial activity [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and their ability to reduce cholesterol and triglyceride levels [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The efficiency of microorganisms in converting metalloid oxyanions into less toxic elemental forms leads to reduced toxicity and increased bioavailability of tellurium [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Tellurium has other uses, including anti-biofilm properties, bioremediation, bioremediation, etc [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe purpose of this research is to investigate the production and synthesis of TeNPs by Co-Culture of spirulina algae and shiitake mushroom, to characterize the produced nanoparticles, and to evaluate the toxicity effects of the produced nanoparticles against cancer cells and molecular identification of mushroom.\u003c/p\u003e"},{"header":"2. Material and Method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Microorganism and media\u003c/h2\u003e \u003cp\u003eShiitake mushrooms were purchased from the food market in Tehran (Iran). The stock culture was maintained on malt extract agar (MEA) at 4\u0026deg;C and was sub-cultured monthly. The cultures were inoculated with mycelia and incubated at 25\u0026deg;C for 14 days. To confirm the characteristics of the used fungal strain, molecular identification was performed.\u003c/p\u003e \u003cp\u003eSpirulina sample were purchased from Bio-Green Co, (Tehran-Iran). 20 ml of the purchased algae sample was inoculated in a 500 ml flask containing 200 ml of Zeruk culture medium at pH 8. The flasks were kept in a culture room at 30\u0026deg;C under continuous illumination at 12:12 h light/dark (5000 lux) for 14 days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Biosynthesis of TeNPs\u003c/h2\u003e \u003cp\u003eThe liquid culture supernatant of algae and fungi was separated using a centrifuge (4500 rpm for 10 min), and 100 ml of each was added to a 500 ml flask, then 100 ml of the prepared 1 mM potassium tellurium (K\u003csub\u003e2\u003c/sub\u003e TeO\u003csub\u003e3\u003c/sub\u003e, \u003csub\u003e3\u003c/sub\u003eH\u003csub\u003e2\u003c/sub\u003eO, Sigma Aldrich, USA) solution was added and it was incubated for 5 days at 28\u0026deg;C with pH 9. Finally, the precipitate containing TeNPs was separated by centrifugation (15000 rpm for 15 min). To increase the purity of the experimental sediment, TeNPs were washed three times with deionized distilled water. The TeNPs were dried at 40\u0026deg;C and carefully stored in vials for further analysis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Macroscopic determination of the formation of TeNPs was observed by the color change of the solution and the Tyndall effect [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Determining the characteristics of tellurium nanoparticles\u003c/h2\u003e \u003cp\u003eTo confirm the extracellular biosynthesis of tellurium nanoparticles, first, the supernatant free from the biomass of the co-culture of algae and fungi was passed through 0.25-micron syringe filters. Then, to deposit tellurium nanoparticles, a centrifuge (15000 rpm for 45 min) was used, and FTIR and FESEM analyses were performed to determine the state of the formed nanocrystals and check the shape, size, and stability of the synthesized nanoparticles.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 MTT Assay\u003c/h2\u003e \u003cp\u003eHuman breast cancer cell lines (MDA-MB-468) and healthy cell line (HFF) were obtained from Iran's National Center for Genetic and Biological Resources (IBRC) and used in this study. These cells were cultured respectively in Dulbecco's Modified Eagle's Medium (DMEM) - Ham's F12 and DMEM high glucose containing 10% fetal bovine serum, penicillin (100 units/ml) and streptomycin (100 mg/ml). Then they were placed in an incubator containing 5% CO2, 95% humidity, and 37\u0026deg;C temperature. Flasks were examined daily by an inverted microscope in terms of cell growth and density, morphology, and contamination control. Changing the complete culture medium containing 10% FBS was done at the required time.\u003c/p\u003e \u003cp\u003eInvestigating the effect of TeNPs cytotoxicity by colorimetric method, using color 5-dimethylthiazol-2-y1]-2-5diphenyltetrazolium bromide (MTT), (3-[4 tetrazolium bromide water-soluble salt) was performed. This method is based on the activity of the enzyme succinate dehydrogenase present in the mitochondria of living cells and purple insoluble formazan crystals. This compound is soluble in DMSO. Since the dead cells are not able to convert MTT to formazan, the level of formazan is proportional to the number of MDA-MB-468 cells 5000 cells were planted in each well of a 96-well plate. 48 hours after the cells were planted, the old culture medium was removed from the wells, and cells with different concentrations (8, 32, 64, 128, 256 \u0026micro;g/ml) Nanoparticles and chemotherapy drug tamoxifen (1.25, 2.5, 5, 10, 20, 40 \u0026micro;g/ml) were treated. 4 wells were considered for each treatment and 4 wells for each time of the experiment. The complete culture was assigned as a control. The plates were incubated in an incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e, 95% humidity, and a temperature of 37\u0026deg;C. After the incubation time, the supernatant was carefully removed from each well It was replaced with the complete culture medium containing MTT solution and placed in the incubator for 4 hours, then the supernatant of each well was drained and 200 microliters of DMSO solution was replaced with the previous solution to dissolve the formazan crystals. After 15 minutes, the optical density was read using an ELISA device (USA, Bio Tek, Synergy/HTX) at a wavelength of 570 nm. The amount of absorption is directly proportional to the number of living cells. The results are calculated in terms of the percentage of live cells compared to the control from the following equation:\u003c/p\u003e \u003c/div\u003e\n\u003cp\u003e100 x (average absorption of control cells/average absorption of treated cells) = percentage of living cells\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Molecular Identification\u003c/h2\u003e \u003cp\u003eMolecular identification of the fungal strain was done based on the 18s rRNA. DNA was extracted using the DNA extraction kit of the Denazist Company (Iran). The extracted genetic material was measured in 260 nm optical absorption (Nanodrop) and observed in agarose gel. PCR was performed using primers 5'TCCGTAGGTGAACCTGCGG3' and 'TCCTCCGCTTATTGATATGC3' for ITS1 and ITS4, respectively. Both primers amplify fragments containing about 600 bp. The PCR product was purified using the Takapouzist (Iran) PCR purification kit [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The obtained product was sequenced at Microscience (Switzerland) by the Sanger/Capillary method and both strands were studied to ensure reliability. Sequences were cleaned and aligned using Bioedit software (version 7.2.5). The sequences were BLAST and Phylogenetic trees were performed using MEGA X software. Finally, the identified strain was registered on the NCBI.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Statistical Analysis\u003c/h2\u003e \u003cp\u003eThe data were analyzed by Excel and GraphPad Prism 8.2.1 software. The drug concentration required to inhibit cell growth by 50% (IC\u003csub\u003e50\u003c/sub\u003e) was calculated and plotted by PRISM software and by non-linear regression analysis, using dose-response curves. became\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003eMacroscopic observations show the change in color of the solutions from light to dark, the images are given in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe FTIR spectra (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) generated from the concentration of TeNPs Synthesis by Co-Culture of fungi and algae showed that the nanoparticles have absorption peaks around 617, 1031, 1633, 1363, 1421, 1633, 2918, and 3428 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at the wavelength of 500\u0026ndash;4000 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The peaks 3428 and 1633 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e were assigned to O-H and C-C stretching, respectively. The peak at 2918 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was related to the C-H stretching of protein methylene groups. In addition, the peak at 1421 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e corresponds to the N-H bending of primary amides due to carbonyl stretching in proteins. In addition, the peak at 1031 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e could correspond to the C-N stretching vibration of amine, indicates the size reduction and formation of nanoparticles.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFESEM Analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) shows the formation of nanoparticles resulting from the Co-Culture. Also, the average size of nanoparticles created is between 20 and 30 nm. Statistical analysis of the size of nanoparticles is given in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMTT Assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe cytotoxic effect of TeNPs on the proliferation of MDA-MB-468 and HFF cells was evaluated using the MTT method. These cells were treated with five different concentrations of TeNPs (8, 32, 64, 128, 256 \u0026micro;g/ml) for 24, 48 and 72 hours. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, TeNPs inhibit the growth of MDA-MB-468 cells in a concentration-dependent and time-dependent manner. By examining the results of the MTT test, it was observed that with the increase in the nanoparticle concentration and with the increase in the treatment time, the survival percentage of cancer cells decreased significantly compared to the control. IC\u003csub\u003e50\u003c/sub\u003e values ​​calculated from dose-response curves in the MDA-MB-468 cell line for TeNPs are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. IC\u003csub\u003e50\u003c/sub\u003e in 24, 48 and 72 hours was 126.4, 95.38, and 27.24 \u0026micro;g/ml, respectively. Figures\u0026nbsp;(6) shows the toxicity of different concentrations of TeNPs on the HFF cell line. By examining the results of the MTT test, it was observed that the effect of TeNPs on normal HFF cells is much lower than on cancer cells. The IC\u003csub\u003e50\u003c/sub\u003e of TeNPs in the case of normal HFF cells was calculated as 423.2, 302.9, and 160.4 \u0026micro;g/ml in 24, 48, and 72 hours, respectively, using GraphPad Prism 8.0.2 software.\u003c/p\u003e \u003cp\u003eIn the study conducted, HFF cells were less sensitive to TeNPs (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). For example, comparing the value of IC\u003csub\u003e50\u003c/sub\u003e at 48 hours, the amount of IC50 in HFF cells was approximately 3.17 times higher than that of MDA-MB-468 breast cancer cell lines.\u003c/p\u003e \u003cp\u003eIn addition, in this research, to compare with nanoparticles, the effect of chemotherapy drug tamoxifen was investigated. IC\u003csub\u003e50\u003c/sub\u003e for tamoxifen was determined as 13.1 \u0026micro;g/ml and 23.84 \u0026micro;g/ml after 48 hours of treatment in MDA-MB-468 and HFF cells, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular Identification\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe results of 18s rRNA sequencing showed more than 99% similarity with \u003cem\u003eLentinula edodes\u003c/em\u003e. The strain \u003cem\u003eLentinula edodes\u003c/em\u003e voucher (accession number: MN622792.1) is found in the gene bank, indicating the close relationship between both strains. \u003cem\u003eLentinula edodes\u003c/em\u003e strain is registered in NCBI under the accession number PP502150.1 The result of drawing the phylogeny tree is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eThe Evaluation of the use of fungi and algae for the biological production of TeNPs showed that it is possible to use co-culture and this method does not prevent the production of nanoparticles. FTIR and FESEM showed that the size reduction of metal particles was created and the average size of nanoparticles is between 20 and 30 nm.\u003c/p\u003e \u003cp\u003eBiosynthesis of nanoparticles using green technology is emerging as an environmentally friendly, cost-effective, and risk-free strategy. In recent years, TeNPs have attracted increasing attention due to their unique properties in biomedicine [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Sayadi et al. (2018) produced nanoparticles using spirulina algae extract [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Shalabi et al. (2021) produced metal nanoparticles using spirulina algae [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Takada et al. (2022) formed biogenic tellurium nanorods using unicellular green algae [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Inaba et al. (2023) produced tellurium nanorods in unicellular algae [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Elsakhawy et al. (2022) investigated the ability of green synthesis of nanoparticles by fungi [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Amin et al. (2023) produced metal nanoparticles using the secondary metabolites of \u003cem\u003eLentinula edodes\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In many studies, the ability of algae and fungi to produce nanoparticles has been shown, and in the present study, the ability to produce TeNPs using the co-culture of algae and fungi was shown for the first time.\u003c/p\u003e \u003cp\u003eThe result showed that TeNPs had significant cytotoxic effects in most tested concentrations in human breast cancer cells (MDA-MB-468) and inhibited the growth of cancer cells. Normal human fibroblasts (HFF) showed more resistance to TeNPs than human breast cancer cells. As a result, TeNPs can find many biomedical applications with therapeutic importance in dealing with breast cancer. Vahidi et al. (2021) investigated the effect of tellurium nanoparticles against cancer cells and it was found that nanoparticles have the highest effect against breast cancer cells and have no effect on healthy cells [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. cantharidin-tellurium nanoparticles have been found to have an inhibitory effect against cancer cells [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Sathiyaseelan et al. (2024) showed that the biosynthesis of TeNPs has an acceptable toxicity effect on breast cancer cells and has no effect on healthy cells [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Tellurium quantum dots have a dose-dependent toxic effect against breast cancer cells [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. TeNPs showed Cytotoxic effect against cancer cells during 48 hours at concentrations up to 50 \u0026micro;g/ml and did not show any significant cytotoxic effect on normal cells under the same conditions [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Sathiyaseelan et al. (2024) showed that tellurium nanoparticles synthesized by chitosan have a significant cytotoxic effect against cancer cells and have no effect on healthy cells [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The anti-cancer effects of nanoparticles have been proven in many studies, in this research, the anti-cancer effects of TeNPs on breast cancer cells were determined and these nanoparticles can be used for therapeutic applications.\u003c/p\u003e"},{"header":"Declarations","content":" \u003ch2\u003e Ethical Approval\u003cp\u003eHuman and animal samples were not used in this research.\u003c/h2\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was funded by a grant (grant no: IR.MUQ.REC.1400.107) from the Vice for Research and Technology of Qom University of Medical Sciences, Qom, Iran.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eDr. Ameri is responsible for designing, conducting, and writing the article.Mr. Rasouli is responsible for writing and reviewing the article.Dr. Kamili is responsible for analyzing the effect of nanoparticles on cancer cells.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank all staff in the Labs where the investigations were done. Indeed, the authors\u0026rsquo; special gratitude goes to the laboratory staff at the Department of Biotechnology and Medicinal Chemistry especially all staff in the Fermentation Lab at Shahid Beheshti University of Medical Sciences Tehran, and Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, Iran, Iran, for their immense technical assistance and support during this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWageh, S., et al. (2015). Synthesis and characterization of mercaptoacetic acid capped cadmium sulphide quantum dots. \u003cem\u003eJournal of Nanoscience and Nanotechnology\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(12), 9861\u0026ndash;9867.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIravani, S., et al. (2014). Synthesis of silver nanoparticles: chemical, physical and biological methods. \u003cem\u003eResearch in pharmaceutical sciences\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(6), 385\u0026ndash;406.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaxena, A., et al. (2012). Green synthesis of silver nanoparticles using aqueous solution of Ficus benghalensis leaf extract and characterization of their antibacterial activity. \u003cem\u003eMaterials letters\u003c/em\u003e, \u003cem\u003e67\u003c/em\u003e(1), 91\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaravanan, A., et al. (2021). A review on biosynthesis of metal nanoparticles and its environmental applications. \u003cem\u003eChemosphere\u003c/em\u003e, \u003cem\u003e264\u003c/em\u003e, 128580.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacob, J. M., et al. (2021). Microalgae: A prospective low cost green alternative for nanoparticle synthesis. \u003cem\u003eCurrent opinion in environmental science \u0026amp; health\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e, 100163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichalak, I., \u0026amp; Chojnacka, K. (2015). Algae as production systems of bioactive compounds. \u003cem\u003eEngineering in Life Sciences\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(2), 160\u0026ndash;176.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAboelfetoh, E. F., El-Shenody, R. A., \u0026amp; Ghobara, M. M. (2017). Eco-friendly synthesis of silver nanoparticles using green algae (Caulerpa serrulata): reaction optimization, catalytic and antibacterial activities. \u003cem\u003eEnvironmental Monitoring and Assessment\u003c/em\u003e, \u003cem\u003e189\u003c/em\u003e, 1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadav, A., et al. (2015). Fungi as an efficient mycosystem for the synthesis of metal nanoparticles: progress and key aspects of research. \u003cem\u003eBiotechnology letters\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e, 2099\u0026ndash;2120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGholami-Shabani, M., et al. (2013). Evaluation of the antibacterial properties of silver nanoparticles synthesized with Fusarium oxysporum and Escherichia coli. \u003cem\u003eInt J Lifesc Bt Pharm Res\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e, 342\u0026ndash;348.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, G., et al. (2011). Fungus-mediated green synthesis of silver nanoparticles using Aspergillus terreus. \u003cem\u003eInternational journal of molecular sciences\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(1), 466\u0026ndash;476.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaigankar, D. C., et al. (2018). Tellurite biotransformation and detoxification by Shewanella baltica with simultaneous synthesis of tellurium nanorods exhibiting photo-catalytic and anti-biofilm activity. \u003cem\u003eEcotoxicology and environmental safety\u003c/em\u003e, \u003cem\u003e165\u003c/em\u003e, 516\u0026ndash;526.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, W., et al. (2016). Facile One-Pot Synthesis of Tellurium Nanorods as Antioxidant and Anticancer Agents. \u003cem\u003eChemistry\u0026ndash;An Asian Journal\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(16), 2301\u0026ndash;2311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMedina Cruz, D., Mi, G., \u0026amp; Webster, T. J. (2018). Synthesis and characterization of biogenic selenium nanoparticles with antimicrobial properties made by Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA), Escherichia coli, and Pseudomonas aeruginosa. \u003cem\u003eJournal of Biomedical Materials Research Part A\u003c/em\u003e, \u003cem\u003e106\u003c/em\u003e(5), 1400\u0026ndash;1412.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCruz, D. M., et al. (2019). Citric juice-mediated synthesis of tellurium nanoparticles with antimicrobial and anticancer properties. \u003cem\u003eGreen chemistry\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(8), 1982\u0026ndash;1998.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVahidi, H., et al. (2021). Green nanotechnology-based tellurium nanoparticles: Exploration of their antioxidant, antibacterial, antifungal and cytotoxic potentials against cancerous and normal cells compared to potassium tellurite. \u003cem\u003eInorganic Chemistry Communications\u003c/em\u003e, \u003cem\u003e124\u003c/em\u003e, 108385.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMirjani, R., et al. (2015). Biosynthesis of tellurium nanoparticles by Lactobacillus plantarum and the effect of nanoparticle-enriched probiotics on the lipid profiles of mice. \u003cem\u003eIET nanobiotechnology\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(5), 300\u0026ndash;305.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEspinosa-Ortiz, E. J., et al. (2017). Biomineralization of tellurium and selenium-tellurium nanoparticles by the white-rot fungus Phanerochaete chrysosporium. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u003c/em\u003e, \u003cem\u003e124\u003c/em\u003e, 258\u0026ndash;266.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZambonino, M. C., et al. (2021). Green synthesis of selenium and tellurium nanoparticles: current trends, biological properties and biomedical applications. \u003cem\u003eInternational journal of molecular sciences\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(3), 989.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarabadi, H., Kobarfard, F., \u0026amp; Vahidi, H. (2018). Biosynthesis and characterization of biogenic tellurium nanoparticles by using Penicillium chrysogenum PTCC 5031: A novel approach in gold biotechnology. \u003cem\u003eIranian journal of pharmaceutical research: IJPR\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(Suppl2), 87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSha, T., et al. (2008). Genetic diversity of the endemic gourmet mushroom Thelephora ganbajun from south-western China. \u003cem\u003eMicrobiology\u003c/em\u003e, \u003cem\u003e154\u003c/em\u003e(11), 3460\u0026ndash;3468.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbd El-Ghany, M. N., et al. (2023). Biosynthesis of novel tellurium nanorods by Gayadomonas sp. TNPM15 isolated from mangrove sediments and assessment of their impact on spore germination and ultrastructure of phytopathogenic fungi. \u003cem\u003eMicroorganisms\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(3), 558.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayadi, M. H., et al. (2018). Bio-synthesis of palladium nanoparticle using Spirulina platensis alga extract and its application as adsorbent. \u003cem\u003eSurfaces and Interfaces\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 136\u0026ndash;143.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShalaby, S. M., et al. (2021). Green synthesis of recyclable iron oxide nanoparticles using Spirulina platensis microalgae for adsorptive removal of cationic and anionic dyes. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e, 65549\u0026ndash;65572.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakada, S., et al. (2022). Formation of biogenic tellurium nanorods in unicellular green alga Chlamydomonas reinhardtii. \u003cem\u003eMetallomics\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(11), mfac089.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElsakhawy, T., et al. (2022). Green Synthesis of Nanoparticles by Mushrooms: A Crucial Dimension for Sustainable Soil Management. \u003cem\u003eSustainability\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(7), 4328.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmin, Z. S., et al. (2023). Synthesis, characterization and biological activities of zinc oxide nanoparticles derived from secondary metabolites of Lentinula edodes. \u003cem\u003eMolecules\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e(8), 3532.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, Z., et al. (2020). Versatile biomimetic cantharidin-tellurium nanoparticles enhance photothermal therapy by inhibiting the heat shock response for combined tumor therapy. \u003cem\u003eActa Biomaterialia\u003c/em\u003e, \u003cem\u003e110\u003c/em\u003e, 208\u0026ndash;220.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSathiyaseelan, A., Zhang, X., \u0026amp; Wang, M. H. (2024). Biosynthesis of gallic acid fabricated tellurium nanoparticles (GA-Te NPs) for enhanced antibacterial, antioxidant, and cytotoxicity applications. \u003cem\u003eEnvironmental Research\u003c/em\u003e, \u003cem\u003e240\u003c/em\u003e, 117461.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaderi, S., et al. (2018). Cadmium telluride quantum dots induce apoptosis in human breast cancer cell lines. \u003cem\u003eToxicology and industrial health\u003c/em\u003e, \u003cem\u003e34\u003c/em\u003e(5), 339\u0026ndash;352.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSathiyaseelan, A., et al. (2024). In situ, synthesis of chitosan fabricated tellurium nanoparticles for improved antimicrobial and anticancer applications. \u003cem\u003eInternational Journal of Biological Macromolecules\u003c/em\u003e, \u003cem\u003e258\u003c/em\u003e, 128778.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bionanoscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bnsc","sideBox":"Learn more about [BioNanoScience](http://link.springer.com/journal/12668)","snPcode":"12668","submissionUrl":"https://submission.nature.com/new-submission/12668/3","title":"BioNanoScience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Biosynthesis, Tellurium, Nano-Particle, Co-Culture, Spirulina, Lentinula Edodes","lastPublishedDoi":"10.21203/rs.3.rs-4476610/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4476610/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eIntroduction\u003c/h2\u003e \u003cp\u003eBio-based nanoparticle production has been an alternative method for preparing nanoparticles for pharmaceutical and biomedical applications. This study aims to evaluate the production of tellurium nanoparticles (TeNPs) using the co-culture of algae and fungi and finally to investigate the cytotoxicity of nanoparticles on cancer cell lines MDA-MB-468 and healthy cell line HFF.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe production of TeNPs was done using the co-culture of algae and fungi. Using the Tyndall effect, FTIR, and FESEM, nanoparticles were evaluated. Finally, using the MTT assay, the toxicity of the nanoparticles produced on MDA-MB-468 and HFF was investigated.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eData showed that it is possible to produce TeNPs using the co-cultivation of algae and fungi. Also, the produced nanoparticles had a size between 20 and 30 nm. Examining the cytotoxicity effects of the created nanoparticle showed that this nanoparticle has an inhibitory effect on cancer cells, while it does not affect healthy cells.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eIn this study, biosynthesis of TeNPs using co-culture was performed for the first time. The data showed that it is possible to use the co-culture of algae and fungi to produce TeNPs that can inhibit the growth of human breast cancer cells.\u003c/p\u003e","manuscriptTitle":"Novel Biosynthesis and Evaluation Cytotoxic Effect of Tellurium Nano-Particle on Breast Cancer Using Co-Culture of Spirulina and Lentinula Edodes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-18 10:17:58","doi":"10.21203/rs.3.rs-4476610/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-15T06:27:08+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-14T08:08:34+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-13T11:19:53+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-11T10:28:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"198694551594135473361359148421297586403","date":"2024-07-08T13:46:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"92313327852232689826659231952250843002","date":"2024-07-08T11:03:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-08T09:11:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"219543133376739210632060030838632684282","date":"2024-07-02T09:22:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"252979041360568744371938801792804794454","date":"2024-07-01T00:28:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"105407867415737959899001458892059360721","date":"2024-06-30T09:19:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"222311316494110074019334392695051471599","date":"2024-06-04T19:47:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-04T13:46:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-04T13:40:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-04T07:18:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"BioNanoScience","date":"2024-05-25T11:28:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bionanoscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bnsc","sideBox":"Learn more about [BioNanoScience](http://link.springer.com/journal/12668)","snPcode":"12668","submissionUrl":"https://submission.nature.com/new-submission/12668/3","title":"BioNanoScience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"59d49520-ae6f-4f27-ab5a-42952449d573","owner":[],"postedDate":"June 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-20T16:49:38+00:00","versionOfRecord":{"articleIdentity":"rs-4476610","link":"https://doi.org/10.1007/s12668-024-01592-w","journal":{"identity":"bionanoscience","isVorOnly":false,"title":"BioNanoScience"},"publishedOn":"2024-08-13 00:00:00","publishedOnDateReadable":"August 13th, 2024"},"versionCreatedAt":"2024-06-18 10:17:58","video":"","vorDoi":"10.1007/s12668-024-01592-w","vorDoiUrl":"https://doi.org/10.1007/s12668-024-01592-w","workflowStages":[]},"version":"v1","identity":"rs-4476610","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4476610","identity":"rs-4476610","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}