Ag+ ions are effective elicitors for enhancing the production of phenolic acids and tanshinones in Salvia aristata Aucher ex Benth. hairy roots

Ag+ ions are effective elicitors for enhancing the production of phenolic acids and tanshinones in Salvia aristata Aucher ex Benth. hairy roots | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Ag+ ions are effective elicitors for enhancing the production of phenolic acids and tanshinones in Salvia aristata Aucher ex Benth. hairy roots Raziey Rahchamani, Tayebeh Radjabian, Parvaneh Abrishamchi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4303897/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Aug, 2024 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted 4 You are reading this latest preprint version Abstract Salvia aristata Aucher ex Benth., due to containing tanshinones and phenolic acids, two main groups of bioactive metabolites, is one of the most valuable medicinal plant species in Iran. In this study, for the first time, hairy root (HR) cultures were established from 14-day-old seedlings inoculated with Agrobacterium rhizogenes strain ATCC 15834. Additionally, the effects of elicitation with Ag + ions (15 and 25 µM) were investigated on the growth indices and content of phenolic acids and tanshinones of HRs in a time-course experiment. The findings of this work showed that exposure of HRs to Ag + at both concentrations caused significant increases in the levels of rosmarinic acid (1.34- to 1.43-fold of control) and salvianolic acid B (1.71- to 1.82-fold of control). Specifically, 7.25-, 7.78-, 6.47-, and 3.9-fold increases were attained in total tanshinone, tanshinone I, tanshinone II-A, and cryptotanshinone contents of HRs, respectively, after seven days of exposure to 25 µM Ag + ions compared to the control groups. The analysis revealed that exposure to Ag + ions significantly enhanced the secretion of tanshinones, notably tanshinone II-A (31.49 ± 0.65 µg mL − 1 ) by HRs into the culture medium. The changes in transcript levels of crucial genes in the biosynthesis pathways of phenolic acids ( PAL , TAT , and RAS ) and tanshinones ( CPS and CYP76AH1 ) were associated with their contents in HRs under elicitation with Ag + ions. Our findings confirmed the effectiveness of an elicitation strategy to improve metabolite production in HR cultures of S. aristata as potent natural sources of phenolic acids and tanshinones. Salvia aristata Aucher ex Benth. Hairy root culture Ag+ ions Phenolic acids Tanshinones Gene expression Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Salvia aristata Aucher ex Benth. (Lamiaceae family) is an Irano-Turanian endemic medicinal plant species whose distribution is limited to the north, northwest, and central regions of Iran (Moein et al., 2019b ). Recently several reports have mentioned the presence of this species in the east of Turkey (Behçet and Avlamaz 2009 ). There are only a few scientific reports about S. aristata ; in some of them, the antioxidant and pharmacological effects are attributed to the content of compounds such as triterpenic acids (Abdollahi-Ghehi et al. 2019 ), essential oil compounds (Farshid et al. 2015 ; Emadipoor et al. 2016 ), phenolics, and flavonoids (Emadipoor et al. 2016 ). Phenolic acids, predominantly rosmarinic acid (RA), salvianolic acid A (Sal-A), salvianolic acid B (Sal-B), caffeic acid (CA), vanillic acid (VA), and chlorogenic acid (CGA) (Shi et al. 2019 ; Wang et al. 2019 ), along with tanshinones including tanshinone I )T-I(, tanshinone IIA (T-IIA), cryptotanshinone (CT), and dihydrotanshinone I (DT-I) are the most valuable metabolites in Salvia L. species (Bisio et al. 2019 ; Wang and Peters 2022 ). Phenolic acids are used for the treatment of atherogenic dyslipidemia, and cholestatic liver damage, and have antioxidant and antidepressant effects (Tan et al. 2016 ; Ingole et al. 2021 ; Xie et al. 2021 ; He et al. 2023 ; Caylak 2024 ). Tanshinones belong to a natural group of abietane-type norditerpenoid quinones that manifest remarkable pharmacological properties such as anti-cancer, antibacterial, antiviral, and neuroprotective effects (Fu et al. 2020 ; Wang et al. 2020 ; Lai et al. 2021 ; Sudha and Singh 2024 ). The biosynthetic pathways of phenolic acids have been identified in Salvia miltiorrhiza Bunge (Shi et al. 2019 ). Phenolic acids, especially RA, are generally produced from two pathways: the phenylalanine and tyrosine-derived pathways. The first-point reactions in these pathways are catalyzed by phenylalanine ammonia-lyase (PAL) and tyrosine aminotransferase (TAT), respectively. The biosynthetic pathway of tanshinones proceeds in three steps: formation of terpenoid precursors, the creation of tanshinone skeleton, and subsequent skeletal modification such as oxidation, methylation, decarboxylation, or cyclization which produce diverse tanshinones. Recent studies have demonstrated that the S. miltiorrhiza HR cultures accumulate tanshinones in a manner that is consistent with the transcript levels of certain key enzymes. These enzymes include 1-deoxy-D-xylulose-5-phosphate synthase (DXS) and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), which are situated upstream of the methylerythritol 4-phosphate (MEP) pathway, as well as geranylgeranyl diphosphate (GGPP), copalyl diphosphate synthetase (CPS), kaurene synthase-like (KSL(, and cytochrome P450 monooxygenases) CYP76AH1, CYP76AH3, and CYP76AK1(, which are located downstream of the MEP pathway (Jiang et al. 2019 ; Hu et al. 2021 ; Wang and Peters 2022 ). Elicitation is a suitable method to increase the production of valuable compounds from medicinal plants, which can influence the gene expression of regulatory enzymes in the biosynthetic pathways and the accumulation of secondary metabolites (Bhaskar et al. 2022 ; Grzegorczyk-Karolak et al. 2024 ). Heavy metals are effective stimuli in inducing secondary metabolite production. Among the metal ions, Ag + ions have been widely used to induce the production of secondary compounds in plants. Recent studies have demonstrated the effectiveness of this elicitor in increasing the content of tanshinones and phenolic acids (Xing et al. 2014 ; Dowom et al. 2017 ; Bayesteh et al. 2021 ; Pesaraklu et al. 2021 ; Attaran Dowom et al. 2022 ). Salvia aristata is considered a rare, vulnerable, or endangered species due to its limited occupation level and the small population in Iran (Moein et al. 2019a ). Consequently, it is necessary to employ biotechnological methods to exploit and protect the genetic preservation of this medicinal species. Furthermore, because phenolic acids and terpenoids exist in the shoots and roots of this species, HR culture could serve as a potent tool for in vitro production of these metabolites (Gantait and Mukherjee 2021 ; Roy 2021 ; Atabaki et al. 2024 ). In this study, HR cultures of S. aristata were established for the first time. Moreover, the accumulation of phenolic acids and tanshinones, as well as the gene expression of the crucial enzymes involved in their biosynthesis pathways, were investigated in the HRs under elicitation with Ag + ions. Materials and Methods Explants preparing using the seed culture method The mature seeds of S. aristata Aucher ex Benth. were collected in September 2018 from a naturally occurring population in Gardane Kaman, Qazvain province, located in the northwest of Iran, situated at latitude 36° 27' 49'' N, longitude 50° 07' 59'' E, with an altitude of 2034 m above sea level. A voucher specimen was deposited at the herbarium of Bu-Ali Sina University of Hamedan (BASU 34046). The collected seeds were soaked in sterile water for 10 min, followed by sterilization with 70% ethanol (v/v) for 1 min and sodium hypochlorite solution (10%) for 10 min. Since the mucilaginous coat on S. aristata seeds reduces their germination rate, the seed coats were cut and removed using a sterilized scalpel. After the removal of the seed coats, they were placed on solid MS media (Classic Murashige and Skoog 1962 ), solidified with 7 g -1 L agar, and incubated at 25 ± 1°C under a light/dark cycle of 8/16 h for a period of 14 days. The 14-day-old seedlings were selected for inoculation with the bacterial strain. Preparation of bacterial strain The A. rhizogenes ATCC 15834 strain (American-type culture collection) was obtained from the microbial collection of the Biotechnology Research Center, Karaj, Iran. Initially, bacterial cells were cultured on Luria-Bertani medium (LB) agar medium supplemented with 50 mg − 1 L (Sezonov et al. 2007 ). The cultures were then transferred to a rotary shaker and incubated at 28°C with a speed of 180 rpm for 48 h under dark conditions. Hairy root culture The nodal explants obtained from the 14-day-old seedlings were inoculated with a needle previously immersed in an A. rhizogenes bacterial suspension. Subsequently, the explants were transferred to MS medium supplemented with 6 g − 1 L agar and maintained in darkness at 25°C. Control explants were inoculated using a sterile needle dipped in sterile water. After an incubation period of 48 h, the explants were rinsed with a cefotaxime solution at a concentration of 500 mg − 1 L and then placed on an MS culture medium containing the same antibiotic concentration along with 150 µM acetosyringone. The cultures were incubated under a 16/8 hour (light/dark) photoperiod (45 µmol m − 2 s − 1 , provided by cool white fluorescent lamps), and incubated at 25°C. The experiment was repeated three times with five explants. Twelve days after infection with A. rhizogenes , HRs began to appear on the explants, and ten days after their emergence, six fast-growing lines were selected and transferred to MS media, which solidified with 6 g − 1 L agar and maintained at 25°C in dark condition. One week later, the selected HR lines were moved to 150 mL Erlenmeyer flasks containing 50 mL of hormone-free liquid MS medium and incubated at 25°C in the dark on a rotary shaker at 120 rpm. The HRs were subcultured into the same fresh medium every four weeks. After two cycles of subculturing, (approximately after two months of culture), the dry weight (DW) and tanshinone content of the HR lines were determined. Due to the significant levels of tanshinones along with high biomass, HR line 2 was selected for elicitor treatments. Confirmation of transgenic hairy root lines Genomic DNA (gDNA) from six HR lines and non-transformed roots of S. aristata was extracted from 100 mg plant tissue using the CTAB method (Khan et al. 2007 ). In this work, DNA from the ATCC 15834 strain of A. rhizogenes and the extracted DNA from the 50-day-old non-infected roots served as the positive and negative controls, respectively. The polymerase chain reaction (PCR) was performed to confirm the transformation of HR lines using the C1000 Touch TM 96-Well Thermal Cycler (Bio-Rad, USA), with gene-specific primers designed to detect an internal rolC gene fragment (612 bp) were F: 5' -CTCCTGACATCAAACTCGTC-3' and R:5´ -TGCTTCGAGTTATGGGTACA-3'. The PCR reaction contained Taq PCR Master Mix Kit (Qiagen), gDNA (100 ng total DNA), and oligonucleotide primers (10 µM final concentration in the total volume of 15 µL). The total volume of the reaction was achieved by mixing 0.5 µL DNA Template, 0.5 µL Premix, 5 µL 2X Blue Load Master Mix, and 4 µL of dH 2 O. The PCR procedure was performed with an initial pre-denaturation step at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 40 s, and extension at 72°C for 40 s, with a final extention step was then carried out at 72°C for 7 min. For analysis, 5 µL of the PCR products were run on a 1% (w/v) agarose gel, stained with GelRed, and visualized under UV light by a Gel Doc System (Farjin Poish-Doc, Iran). Elicitation of hairy roots In this study, Ag + ions were utilized to elicit HR cultures of line 2. A stock solution of Ag + ions was prepared by dissolving AgNO 3 (Sigma-Aldrich) in deionized water. The solution was then added to a liquid hormone-free basal MS medium to achieve specified concentrations (15 and 25 µM) for 50-day-old HR cultures. Different concentrations of AgNO 3 solutions were added to the freshly prepared culture media after sterilization through 0.2 µm pore-size filters. HR samples were collected from the culture media on days 0, 1, 3, 5, and 7 following elicitation with Ag + ions. To determine the optimal time for elicitor treatments, the growth curve of HR line 2 was plotted. Accordingly, root tips (0.6 g) were extracted from one-month-old HRs and transferred to 150 mL flasks containing 50 mL of liquid MS medium. The cultures were shaken (100 rpm) at 25°C under continuous darkness. Fresh weight (FW) of HR samples was measured at 4-day intervals for 70 days after cultivation, and a growth curve was constructed based on the obtained values. Treatments of the HRs with the elicitor were carried out at the end of the exponential phase, on day 50 of the HR growth curve. The same volume of water, as the solvent of AgNO3, was added to 50 mL of liquid MS medium for the control group. Measurement of total phenolic content The total phenolic content (TPC) of the elicited HRs was determined using the Folin-Ciocalteu method (Singleton et al. 1999 ). Initially, 150 µL of each HR extract was mixed with the Folin-Cicalteu reagent, and after 5 min, 1500 µL of 7% sodium carbonate solution was added to the mixture. The total volume of the solution was then adjusted to 3000 µL with distilled water. After 90 min of incubation, the absorbance was measured at 750 nm using a spectrophotometer. A standard curve was plotted with different concentrations of gallic acid (GAE), and the results were expressed as mg gallic acid per gram DW (GAE g − 1 DW). Extraction and HPLC analysis of phenolic acids and tanshinones Initially, 100 mg of dried HR powder was extracted after soaking in 1 mL of methanol for 24 h. Then, the extracts were centrifugated at 10,000 rpm for 10 min, and the supernatant was filtered through a 0.45 µm Millipore filter. Phenolic acids and tanshinones present in the extracts were quantified using a Smartline HPLC system (Kenuer, Germany) equipped with a quadruple pump and a C18 Eurospher-100 reversed-phase column (5 µm particle, 250 mm × 4.6 mm). For the detection and quantification of phenolic acids, the solvent system consisted of 0.1% (v/v) phosphoric acid in water (solvent A) and acetonitrile (solvent B). The elution gradient program was set as follows: 90 − 10% A (v/v) in 0–15 min, 75 − 25% A (v/v) in 15–40 min, 20–80% A (v/v) in 40–45 min, 0-100% A (v/v) in 45–50 min, 0-100% A (v/v) in 50–55 min, 10–90% A (v/v) in 55–60 min. Tanshinones in the extracts were identified using a specific mobile phase composed of 0.02% (v/v) phosphoric acid in water (solvent C) and acetonitrile (solvent D) and a gradient washing program with the following parameters: 39–61% A (v/v) in 0–5 minutes, 90 − 10% A (v/v) 22 − 5 in min, 61 − 39% A (v/v) in 22–30 min, 61 − 39% A (v/v) in 30–35 min. The detection of phenolic acids and tanshinones was performed at 280 and 270 nm, respectively. The flow rate through the column was maintained at 1 mL min − 1 . Calibration curves, generated using standard solutions of phenolic acids (y CA =222904x-302560, r 2 = 0.9957; y RA = 41606x, r 2 = 0.988; y Sal−B =2055x, r 2 = 0.997; y Sal−A = 19497x, r 2 = 0.996; y VA = 40885x, r 2 = 0.903; and tanshinones (y T−I = 22523x, r 2 = 0.996; y T−IIA =2055x, r 2 = 0.995; y CT = 109103x, r 2 = 0.993) were utilized to estimate the contents of phenolic acids and tanshinones present in the HRs extracts. All analyses were conducted three times, and the contents of the examined compounds were expressed as mg g − 1 DW. RNA extraction, cDNA synthesis, and gene expression analysis Total RNA was extracted from frozen HR tissues in liquid nitrogen using an RNX-Plus kit (RN7713C, CinnaGen, Iran), following the manufacturer's protocol with slight modifications. Before using in cDNA synthesis, the integrity of RNA molecules was assessed through 1% agarose gel electrophoresis. The purity and quantity of the RNA were determined using a SPECTROstar Nano microplate reader (BMG LABTECH, Germany). For each RNA sample, 1 µg of total RNA with a final concentration of 10 U µL − 1 was prepared. cDNA was synthesized from the prepared RNA samples using a 2-step Revert Aid Reverse Transcriptase kit (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. Specific primers for the studied genes ( PAL , TAT , RAS , CPS , and CYP76AH1 ) were designed based on the conserved regions within the Lamiaceae family sequences, using Gene Runner software (Table 1 ). These primers then were analyzed using BLAST software on NCBI. Table 1 Nucleotide sequences of the designed primers for the examined genes Gene Forward primer (5ʹ→ 3ʹ) Reverse primer (5ʹ→ 3ʹ) 5.8S rRNA GATATCTCGGCTCTCGCATC GGCTTCGGGCGCAACTTG TAT ATGGGAGGTTGATCTCGATG TCTTTAGGTGCTGATATGAGTAGA RAS ATCGCCACGTGCGGCGA TCAAACGGCGCCGCCCA PAL ATGTGCAGAGCGCGGAG AGTAGGTTGAAGACATGAGTTTAA CYP76AH1 CTGTCGGAGCATTTCTGGAC ATGCGCAAGATATGCAAGGAG CPS GGAGCACATGACTTGTGG GGAGGGAGACGTGAGGAA To quantify gene expression levels, qRT-PCR assays were performed using a Corbett Rotor-Gene 6000 Real-Time PCR system (Qiagen, USA) with SYBR®Green Master Mix 2 × (Ampliqon, Denmark), following the manufacturer’s protocol. 5.8S ribosomal rRNA was used as the reference gene in the PCR analyses. The amplification reactions (10 µL final volume) consisted of 5 µL of 2× SYBR Green Real-Time PCR Master Mix (Parstous, Iran), 0.5 µL each of forward and reverse primers, 0.5 µL of cDNA, and 4 µL of nuclease-free PCR-grade water. The amplification program was as follows: one cycle of initial denaturation at 94°C for 10 min, followed by 30 cycles of 15 s at 95°C, 30 s at 60°C, and 40 s at 72°C, and finally, one cycle of 72°C for 5 min. The relative transcript levels of the examined genes were calculated using the comparative cycle threshold (Ct) method, employing the 2 −ΔΔCT formula. Statistical analysis Experiments were conducted using a randomized factorial design, and analyses were repeated three times per treatment. Data were analyzed using SPSS software, version 24.0. A one-way analysis of variance (ANOVA) was performed to identify any statistical significance between the treatment groups. The Duncan test was applied to compare the differences between mean values, with statistical significance set at P < 0.05. All data were presented as mean ± standard deviation (SD). Results Induction of hairy roots and confirmation of transgenic genome In this study, 14-day-old sterile seedlings obtained from seed culture (Fig. 1 ) were inoculated with five A. rhizogenes strains (ATCC 15834, A4, R1000, C58C1, and GM1534). The explants inoculated with the bacterial strain ATCC 15834 showed only HR formation after 12 days at the node wound site (Fig. 2 ). The formation of HR was not observed on the explants inoculated with other bacterial strains or in the control group. A 47% infection frequency was achieved for the explants infected with the ATCC 15834 strain. Among the HR lines induced by the ATCC 15834 strain, six lines that continued to grow were confirmed for the presence of the rolC gene in their genomes (Fig. 3 ). Hairy root line 2, with the highest tanshinone content and biomass, was selected for further experiments with Ag + ions. Furthermore, a growth curve was plotted to find the optimum timing for elicitor treatment (Fig. 4 ). Effects of Ag + ions on the growth of S. aristata hairy roots Among the lines induced by the ATCC 15843 strain, S. aristata HR line 2, distinguished by the highest biomass and tanshinone content, was chosen for elicitor treatment. Our findings revealed that exposing HR line 2 to Ag + ions on the fifth day of growth enhanced its biomass in shake-flask cultures in a concentration- and time-dependent manner. Exposure to 25 µM Ag + ions led to significant increases in the FW of HRs on all days post-exposure, compared to groups treated with 15 µM elicitor and the control. However, enhancements in the DW of HR cultures were observed only after 5 and 7 days of Ag + ions exposure at both concentrations compared to the control. Nevertheless, the rise in the DW of elicited HRs with 25 µM Ag + ions was significant only after 7 days of exposure compared to HRs exposed to a 15 µM concentration of the elicitor. Seven days post-elicitation with 25 µM Ag + ions, both DW (1.86 ± 0.01 g) and FW (7.74 ± 0.00 g) of HR cultures reached maximum values, which were 1.30- and 1.66–fold higher than those of the untreated cultures, respectively (Fig. 5 ). Effects of Ag + ions on the total phenolic content in S. aristata hairy roots The TPC of HR line 2 cultures were measured at intervals of 0, 1, 3, 5, and 7 days following elicitation with Ag + ions. As illustrated in Table 2 , HRs treated with 25 µM Ag + ions exhibited elevated levels of TPC on days 1, 3, 5, and 7 days after treatment compared to their corresponding control groups at the same exposure times; however, the increase in TPC was significant only on the fifth day after treatment. Conversely, no significant increases were found in TPC of elicited HRs with 15 µM Ag + ions at most times of the experiment, except on the initial day of exposure, compared to controls. The highest TPC (49.09 ± 0.31 mg GAE g − 1 DW, 1.60-fold of the control group) was attained in HR cultures treated with 25 µM Ag + ions for 5 days. Subsequently, the TPC of HRs dropped 7 days after treatment with both concentrations of Ag + ions. The observed decrease was statistically significant only in HRs exposed to 15 µM of the elicitor compared to the control. Table 2 Effect of elicitation with two concentrations of Ag + ions on total phenol content of S. aristata hairy roots Ag + ions (µM) Time after treatment (day) Total phenol content (mg GAE g − 1 DW) Control 0 21.31 ± 1.15 de Control 1 22.41 ± 3.44 ef Control 3 30.77 ± 0.01 b − e Control 5 30.66 ± 0.33 b − e Control 7 22.57 ± 1.39 d − f Ag + (15) 0 20.63 ± 1.47 f Ag + (15) 1 31.49 ± 5.77 b − d Ag + (15) 3 31.74 ± 0.25 bc Ag + (15) 5 35.90 ± 0.00 b Ag + (15) 7 18.31 ± 5.66 f Ag + (25) 0 25.74 ± 0.49 c − f Ag + (25) 1 25.54 ± 0.08 c − f Ag + (25) 3 37.10 ± 0.03 b Ag + (25) 5 49.09 ± 0.31 a Ag + (25) 7 25.78 ± 4.61 c − f The values represent the mean ± SD, which are labeled following Duncan’s Multiple Range Test. Means signed with the same letter in each column are not significantly different ( P ≤ 0.05) Effects of Ag + ions on the content of phenolic acids and tanshinones in S. aristata hairy roots In this study, methanolic extracts from both elicited and non-elicited HRs of line 2 with Ag + ions were quantitatively analyzed for their phenolic acid and tanshinone content using the HPLC method. In the chromatograms of the elicited HR extracts, four distinct phenolic acids (RA, Sal-A, Sal-B, and VA) and three tanshinones (T-I, T-IIA, and CT), were identified and their contents were subsequently quantified. The HPLC chromatograms of phenolic acids and tanshinones from the HRs elicited with 15 µM Ag + ions for 5 days, are shown alongside their corresponding standards in Fig. 6 . The variable capacities of elicited S. aristata HR cultures to accumulate phenolic acids are depicted in Fig. 7 . The presence of Ag + ions in the culture media at both concentrations effectively increased the accumulation of CA in HRs, depending on the duration of exposure. Consequently, 1.26- and 1.37–fold increases were recorded in the content of phenolic acids after 3 and 5 days of exposure to 25 and 15 µM elicitors, respectively. Exposure to both concentrations of Ag + ions significantly enhanced the RA content in HRs on days 1, 5, and 7 post-treatment. HRs treated with 15 and 25 µM Ag + ions accumulated up to 0.66 ± 0.06 and 0.62 ± 0.04 mg g − 1 DW of RA, respectively, 7 days after treatment, representing nearly 1.43- and 1.34-fold increases compared to the control groups at the same exposure time, respectively. However, the stimulatory effect of Ag + ions on Sal-B accumulation in HRs was significant only one day after exposure. The highest contents of Sal-B were recorded at 0.51 ± 0.07 and 0.48 ± 0.06 mg g − 1 DW when HRs were exposed to 15 and 25 µM Ag + ions for one day, respectively. These values were 1.82- and 1.71-fold higher than those in the control groups at the same exposure time. Data analysis revealed that Ag + ions had no stimulatory effects on the accumulation of Sal-A and VA in HRs; thus, treatment with both concentrations of the elicitor slightly, but not significantly, reduced the content of Sal-A and VA in the HRs at most exposure times compared to controls. Based on the results of this research, chlorogenic acid was not detected in the HR extracts. Based on the obtained results, exposure to Ag + ions at both concentrations efficiently stimulated the accumulation of tanshinones in the treated HRs. Consequently, the levels of total tanshinones were consistently higher than those in the control groups across all harvesting times (Fig. 8 ). After seven days of exposure to the elicitor, Ag + ions at a concentration of 25 µM exhibited the most significant stimulatory effect on the accumulation of all tested tanshinones. In comparison with the controls, there was a remarkable increase of 7.78-, 6.47-, and 3.9-fold in the content of T-I, T-IIA, and CT of HRs, respectively. Additionally, under this treatment condition, the total amount of tanshinones (1360 ± 0.01 µg g − 1 DW) in the elicited leaves was enhanced by 7.25-fold compared to the control group. Additionally, under this treatment condition, the total amount of tanshinones (1360 ± 0.01 µg g − 1 DW) in the elicited HRs was enhanced by 7.25-fold compared to the control group. Among the three tanshinones, only the content of T- IIA showed a significant increase in the HRs treated with 15 µM Ag + ions, reaching nearly 3.16- to 6.8-fold of the control group during the one to 5 days after elicitation. Effect of Ag + ions on the metabolites released by S. aristata hairy roots into the culture medium The metabolite contents in methanolic extract derived from ethyl acetate extraction of the culture media were quantified using the HPLC method. The analyses indicated that the quantity of phenolic acids released into the culture media was not significant compared to the content of those produced in the elicited HRs (data not provided). In contrast, the findings demonstrated that exposure to Ag + ions significantly enhanced the production of tanshinones in the HRs, followed by their release into the culture medium. As detailed in Table 3 , after a 5-day treatment with 25 µM of the elicitor, the HRs secreted the highest levels of CT (1.87 ± 0.06 µg mL − 1 ), T-I (30.08 ± 3.27 µg mL − 1 ), and T-IIA (31.49 ± 0.65 µg mL − 1 ) into the culture medium. These levels were approximately 23.37-, 32.69-, and 15.58-fold higher, respectively, than those levels released by the control group during the same period of exposure. Table 3 Effect of Ag + ions on the content of tanshinones released by S. aristata hairy roots into the culture medium Elicitor (µM) Exposure time (day) Cryptotanshinone (µg mL − 1 ) Tanshinone I (µg mL − 1 ) Tanshinone IIA (µg mL − 1 ) Total Tanshinone (µg mL 1 ) Control 0 0.06 ± 0.00 d 8.24 ± 0.25 b 10.57 ± 0.00 c 18.88 ± 0.25 cd Control 1 0.11 ± 0.00 bc 1.35 ± 0.00 c 2.60 ± 0.00 gh 4.07 ± 0.00 h Control 3 013 ± 0.00 bc 1.26 ± 0.00 c 7.78 ± 0.00 d 9.18 ± 0.00 e − h Control 5 0.08 ± 0.00 bc 0.92 ± 0.02 c 2.02 ± 0.00 h 3.03 ± 0.02 h Control 7 0.10 ± 1.03 bc 7.97 ± 0.18 b 1.99 ± 0.04 h 10.07 ± 0.20 e − h Ag + 15 0 0.14 ± 0.00 bc 8.14 ± 0.00 b 11.04 ± 0.00 c 19.33 ± 0.00 cd Ag + 15 1 0.09 ± 0.00 bc 1.18 ± 0.91 c 3.67 ± 0.02 fg 4.96 ± 0.94 h Ag + 15 3 0.09 ± 0.01 bc 1.74 ± 0.15 c 5.39 ± 0.25 ef 7.23 ± 0.42 gh Ag + 15 5 0.13 ± 0.02 bc 2.07 ± 0.21 c 4.70 ± 0.23 e − g 6.91 ± 0.04 gh Ag + 15 7 0.45 ± 0.12 b 5.99 ± 1.25 cd 6.00 ± 0.00 de 12.00 ± 1.12 d − f Ag + 25 0 0.12 ± 0.00 bc 4.14 ± 0.00 bc 10.21 ± 0.00 c 14.48 ± 0.01 c − e Ag + 25 1 0.09 ± 0.01 bc 0.91 ± 0.53 c 3.10 ± 0.00 f − h 4.11 ± 0.53 h Ag + 25 3 0.16 ± 0.01 c 4.67 ± 0.06 bc 16.00 ± 0.23 b 20.84 ± 0.18 c Ag + 25 5 1.87 ± 0.063 a 30.08 ± 3.27 a 31.49 ± 0.65 a 63.45 ± 3.99 a Ag + 25 7 0.12 ± 0.02 bc 29.02 ± 7.63 a 14.64 ± 3.44 b 43.79 ± 11.10 b The values represent the average of three replicates ± SD. According to Duncan’s Multiple Range Test, means labeled with the same letter within a column are not significantly different ( P ≤ 0.05) Effects of Ag + ions on the gene expression of enzymes involved in metabolites biosynthetic pathways in S. aristata hairy roots We evaluated the gene expression levels of three pivotal enzymes (PAL, TAT, and RAS) in the phenolic acid biosynthesis pathways in S. aristata HRs elicited with Ag + ions (Fig. 9 ), and statistical analysis underlined substantial changes in the transcript levels of the assessed genes following exposure to both elicitor concentrations. Our results demonstrated significant increases in the relative expression levels of PAL in HRs exposed to 15 µM Ag + ions for 1, 3, and 7 days. The maximum expression level of PAL attained 35.01-fold higher than the control one day after elicitation with 15 µM Ag + ions. The highest expression level of TAT , nearly 11.08-fold of the control group, was detected in HRs after three days of treatment with the same concentration of the elicitor. Compared to PAL and TAT , the gene expression levels of RAS in HRs were affected by both elicitor concentrations. In particular, the transcript levels of RAS increased in the initial days (0, 1, and 3) after treatment with 25 µM of Ag + ions, attaining its maximum level (3.23-fold higher than the control) on the third day after elicitation. Moreover, the stimulatory effect of 15 µM Ag + ions on the induction of RAS persisted up to 7 days after exposure in the HRs. Consequently, the highest increase in the gene expression level (2.77-fold compared to the untreated group at the same exposure time) was observed seven days after treatment of HRs with the elicitor. In this assay, the relative expression levels of two vital genes, CPS and CYP76AH1 , involved in the biosynthesis pathways of tanshinones, were estimated in Ag + ions-elicited S. aristata HRs using RT-qPCR (Fig. 10 ). The results indicate that both concentrations of Ag + ions induced significant increases in the expression level of gene CPS for up to three days post-treatment, compared with the control at similar exposure times. The maximum relative gene expression level was estimated to be 15.59-fold higher than that of the control for CPS in HRs treated for three days with a 25 µM elicitor. Similarly, treatment of HRs with 15 µM of the elicitor for only one day efficiently enhanced transcript levels of CYP76AH1 up to 38.26-fold compared to the control at the same exposure time. It was notable that prolonging the treatment time over one and three days led to statistical decreases in the transcript levels of CYP76AH1 and CPS , respectively, in HRs after exposure to both concentrations of Ag + ions. Discussion Hairy root establishment The utilization of fast-growing HRs regenerated from A. rhizogenes transformation represents an efficient in vitro culture system to produce significant quantities of plant bioactive metabolites. In our current study, we conducted an original experiment to establish HRs in S. aristata . Additionally, we investigated the effects of Ag + ions on HR growth and the accumulation of phenolic acids and tanshinones, as well as the expression patterns of some principal genes in related biosynthetic pathways. Our findings approve the successful establishment of S. aristata HRs through the A. rhizogenes ATCC 15834 strain-mediated transformation. PCR amplification of the rolC gene fragment confirmed the transformation of HRs by the used strain. In previous research (Yang et al. 2018 ; Attaran Dowom et al. 2022 ; Wojciechowska et al. 2020 ; Li et al. 2016 ), leaves and shoot tips of Salvia species have been the primary explants for transformation. However, our results indicate that wounding at the node sites before infection was a more efficient approach for HR generation (achieving a 47% infection frequency) in S. aristata . Li et al. ( 2016 ) documented that infection of leaf explants of Salvia castanea Diels f. tomentosa Stib., a medicinal plant endemic to China with A. rhizogenes ATCC 15834 strain, led to HR regeneration with frequencies ranging from 3.92 to 8%. Additionally, Khoshsokhan et al. ( 2022 ) induced HRs in Salvia nemorosa L. using A. rhizogenes ATCC 15834, A4, R1000, and GM1534 strains. Their results indicated that the maximum transformation efficiency (76%) was related to the ATCC 15834 strain. In a study conducted by Attaran Dowom et al. ( 2022 ) on Salvia virgata Jacq., the highest transformation frequency (56%) for HR induction was obtained by infection of leaf explants with A. rhizogenes ATCC 15834 strain. Among the developed HR lines, the AT3, generated by the ATCC 15834 strain, was notable for producing the highest biomass (2.29 ± 0.04 g) and RA content (5.47 ± 0.16 mg g − 1 DW) in this species. Our findings are consistent with previously mentioned studies demonstrating successful HR induction using the A. rhizogenes ATCC 15834 strain in various plant species. However, the effectiveness of A. rhizogenes strains may vary depending on the specific plant species (Srivastava et al. 2019 ). Phenolic acids production and gene expression patterns after elicitation Elicitation, as a technique, has been widely adopted to improve the content of bioactive compounds in plants. However, as highlighted by Halder et al. ( 2019 ) and Guru et al. ( 2022 ), the effects of elicitation are multifaceted and influenced by factors such as the type and concentration of elicitor, harvesting time, and the plant species involved. Salvia species are well known for their rich repertoire of phenolic compounds, including RA and salvianolic acids, and their pharmacological significance provides insights into elicitation strategies for enhancing their synthesis (Krzemińska et al. 2022 ). Furthermore, as noted in existing literature, Ag + ions have emerged as potent abiotic elicitors, especially in augmenting secondary metabolite production across diverse plant species (Halder et al. 2019 ). In the current study, we observed a concentration-dependent stimulatory impact of Ag + ions on the growth of S. aristata HRs and significant increases in their biomass after exposure to a 25 µM concentration. Several studies, including those by Xing et al. ( 2014 ) and Li et al. ( 2016 ), have illustrated the stimulatory effects of Ag + ions on biomass and secondary metabolite production and associated gene expression in S. miltiorrhiza . Xing et al. ( 2014 ) reported that DW/FW significantly increased on days 1, 2, 6, and 9 after stimulation with Ag + in HRs of S. miltiorrhiza. Consistent with these findings, our study demonstrated the effective influence of Ag + ions at a 15 µM concentration in enhancing the synthesis of phenolic acids and tanshinones in S. aristata HRs. As a result, treating HRs with 15 µM Ag + ions led to significant increases in the content of RA and Sal-B by 1.43 and 1.28 times, respectively. However, the elicitor had no significant effect on the contents of VA and Sal-A. An increase in the production of phenolic acids in Salvia species is correlated with the overexpression of regulatory genes, specifically PAL , TAT , and RAS , in the phenylpropanoid pathway following exposure to the elicitors (Xing et al. 2014 ; Dowom et al. 2017 ). In their study on two Iranian Salvia species, Salvia officinalis L. and Salvia verticillata L., Pesaraklu et al. ( 2021 ) showed that elicitation of both species with methyl jasmonate and Ag + ions led to significantly higher expression of crucial genes (such as PAL, TAT, HPPR (4-hydroxyphenylpyruvate reductase), RAS , and CYP98A14 ) involved in both the phenylpropanoid and tyrosine pathways, which are responsible for the production of phenolic acids (RA, CA, Sal-A and Sal-B). However, the study found that Ag + ions were more effective in enhancing the production of phenolic acids. The results of Xing et al. ( 2014 ) on phenolic acid production in HRs of S. miltiorrhiza showed that elicitation with Ag + ions (15 µM) significantly enhanced the expression levels of genes in the biosynthesis pathway of RA. Among these genes, the upstream genes ( PAL , C4H (cinnamate 4-hydroxylase), 4CL (hydroxycinnamate coenzyme A ligase), TAT , and HPPR ) were notably upregulated during the earlier stages of exposure, while the downstream genes ( RAS , and CYP98A14 ) were more sensitive to Ag + ions at later stages. According to the findings of Xing et al. ( 2018 ), the accumulation of phenolic acids in HR cultures of S. miltiorrhiza following treatment with methyl jasmonate was significantly correlated with increases in transcript levels of PAL, 4CL, C4H, TAT, HPPR , and RAS in a time-course manner. Kwon et al. ( 2021 ) reported a 5-fold increase in the accumulation of RA in HRs of green basil ( Ocimum basilicum L.) compared to natural roots, which was found to be associated with higher transcript levels of TAT , PAL , and C4H . Comparable to the previous studies, our findings indicated that the expression of upstream genes in the phenolic acid production pathways, namely PAL and TAT , increased on the first and third days after exposure of HRs to 15 µM Ag + ions by 35.01- and 11.08-fold of the control, respectively. The up-regulation of these essential genes indicated the involvement of two phenylalanine and tyrosine-derived pathways in phenolic acid production in S. aristata HRs under the elicitation of Ag + ions. Compared with the findings of Xing et al. ( 2014 ), the results of this investigation revealed that the expression of RAS, one of the downstream genes in the phenolic acids biosynthesis pathway, increased in elicited- HRs after the three initial exposure days, reaching its maximum relative expression level (3.46-fold of the control) on the third day after exposing HRs to 15 µM Ag + ions. Tanshinone production and gene expression patterns after elicitation Tanshinones, a class of abietane diterpenes, are predominantly found in certain Salvia species, with S. miltiorrhiza roots being well-known as a rich natural source of these metabolites. Tanshinones, including DT-I, T-I, CT, and T-IIA, have been identified as the principal bioactive constituents found in certain Salvia species and they are attributed to the pharmacological properties exhibited by these plants (Zhang et al. 2012 ). Ozyigit et al. ( 2023 ) reviewed a comprehensive range of biotechnological approaches for producing secondary metabolites in plants. They emphasized the use of HR cultures, citing the production of CT and T-II in Salvia abrotanoides (Kar.) Sytsma (formerly Perovskia abrotanoides Kar.). Su et al. ( 2022 ) developed a novel technique for the one-step induction of high tanshinones production by optimizing parameters associated with A. rhizogenes transformation in S. miltiorrhiza. According to their results, the contents of T-IIA and CT significantly increased in transgenic HRs. Li et al. ( 2016 ) showed a significant increase in T-IIA accumulation (1.80-fold compared with the control) in transgenic HRs of S. castanea after elicitation with 15µM Ag + ions. Ma et al. ( 2020 ) confirmed the elicitation effects of Ag + ions released from silver nanoparticles on tanshinone production by S. miltiorrhiza HRs. They reported a 1.80-fold increase in tanshinone accumulation compared to the control. In the present work, we observed significant concentration- and time-dependent increases in tanshinone contents of S. aristata HRs in response to Ag + ions elicitation. Specifically, T-I, T-IIA, and CT accumulated 7.78-, 6.47-, and 3.90-fold, respectively, in HRs after exposure to the elicitor. The production of tanshinones in Salvia species could be enhanced by the upregulation of central biosynthetic enzymes, such as CPS, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR), 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS), GGPPS, DXS, CYP76AH3, and CYP76AH1. The activation of these genes leads to the buildup of tanshinones, hence contributing to the therapeutic effects of plants. (Kai et al. 2011 ; Yang et al. 2013 ; Xing et al. 2014 : Yang et al. 2018 ; Deng et al. 2019 ; Wei et al. 2019 ). Kai et al. ( 2011 ) demonstrated that overexpression of SmDXS, SmGGPPS , and SmHMGR led to enhancement in tanshinones production in S. miltiorrhiza HR lines; additionally, co-expression of SmGGPPS and SmHMGR caused a 4.74-fold increase in their tanshinones content compared to control. Inhibitor-mediated changes in the expression and activity of rate-limiting enzymes (HMGR, DXS, and DXR) in HRs of S. miltiorrhiza indicated that tanshinone synthesis is primarily affected by the mevalonate (MVA) pathway; however, the MEP pathway was more effective on HR growth (Yang et al. 2013 ). According to the findings of Deng et al. ( 2019 ), overexpression of the transcription factor of SmWRKY2 , known as a positive regulator of SmDXS2 and SmCPS , was associated with increased tanshinones accumulation in HRs of S. miltiorrhiza . Moreover, the co-overexpression of SmDXR and SmHMGR genes in S. miltiorrhiza HRs led to a higher accumulation of tanshinones. The results of Zhou et al. ( 2020 ) confirmed the pivotal roles of CPS and CYP76AH1 in the biosynthesis of tanshinones; they showed that the upregulation of these crucial genes occurred concurrently with the increased concentrations of tanshinones in S. miltiorrhiza roots. In this work, concentration-dependent increases were observed in transcript levels of genes in the tanshinones biosynthesis pathway in response to elicitor. Specifically, the highest transcript level of CPS (15.59-fold increase compared to control) was recorded in HRs exposed to 25 µM of Ag + ions, and the expression of CYP76AH1 reached its maximum level (38.26-fold increase compared to control) after exposure to HRs to 15µM elicitor. Xing et al. ( 2014 ) reported that Ag + ions, as heavy metal elicitors, could trigger the accumulation of T-I, T-IIA, CT, and DT-I and total tanshinones in S. miltiorrhiza HRs through the induction of crucial genes in their biosynthesis pathway. Their findings also revealed that upstream genes ( HMGR , DXS , DXR , and GGPPS ) responded to the elicitor earlier than the downstream genes ( CPS , KSL , and CYP76AH1 ) in the pathway. Yang et al. ( 2018 ) investigated the changes in tanshinone contents and transcript levels of related genes ( DXS2, GGPPS1, CPS1, CYP76AH1 , and CYP76AH3 ) in HR cultures of two Salvia species under elicitation with Ag + ions. Their findings indicated that exposure to the elicitor was more effective in inducing gene expression and consequently enhanced the accumulation of DT-I, T-I, and T-IIA in S. miltiorrhiza HRs compared to S. castanea HRs. Wei et al. ( 2019 ) also observed that the application of Ag + ions on transgenic HRs expressing, a key gene in the tanshinone biosynthesis pathway, caused a 2.50-fold increase in total tanshinone content compared to non-transgenic ones. In this work, concentration-dependent increases were observed in transcript levels of genes in the tanshinones biosynthesis pathway in response to elicitor. Specifically, the highest transcript level of CPS (15.59-fold increase compared to control) was recorded in HRs exposed to 25 µM of Ag + ions, and the expression of CYP76AH1 reached its maximum level (38.26-fold increase compared to control) after exposure to HRs to 15µM elicitor. Release of tanshinones by S. aristata hairy roots into culture medium Large-scale production of bioactive substances in HRs depends on the efficient secretion of secondary metabolites into the culture medium. This approach eliminates the need for repetitive plant cultivation and harvesting, reducing time-consuming downstream processing and enabling continuous or intermittent extraction of bioactive compounds (Xu et al. 2021 ). Yang et al. ( 2012 ) investigated the effects of MEP and MVA pathway inhibitors on the production and secretion of tanshinones from S. miltiorrhiza HRs into the culture medium. Their findings exhibited that the concentration of tanshinones in the medium was generally low, and among the examined ones, HRs released higher amounts of T-IIA. Our results also supported their findings, with the highest value recorded for T-IIA (31.49 ± 0.65 µg mL − 1 ) in the medium after five days of elicitation of HRs with 25 µM of Ag + ions. Additionally, the findings confirmed that Ag + ions were potent stimulants, causing the secretion of all three tested tanshinones by S. aristata HRs into the medium. At a concentration of 25 µM, the elicitor significantly increased the secretion of T-I, T-IIA, and CT in culture media, up to 3.64-, 15.53-, and 23.95- fold of the control, respectively. During the treatment period, it was evident that although the effectiveness of the elicitor was comparable in the accumulation of phenolic acids in S. aristata HRs at two applied concentrations, Ag + ions were more influential on tanshinones production and their secretion into the culture media at 25 µM. Conclusion In this study, for the first time, we introduced the successful establishment of HR cultures as an effective method for improving the production of secondary metabolites in S. aristata . Among the different examined A. rhizogenese strains, the ATCC 15834 strain was considered the most suitable for HR induction and the production of secondary metabolites, mainly tanshinones. Our findings also underscored that elicitation with Ag + ions effectively encouraged the growth and production of secondary metabolites in S. aristata HRs. The stimulatory effects of Ag + ions on metabolite production in HRs relied on their used concentration and the harvesting time. Furthermore, our findings showed that elicitation of HRs with Ag + ion could enhance the release of tanshinones, especially T-IIA, into the culture medium. Collectively, the findings of this research provide an opportunity for future research on S. aristata and ascertain the potential of elicitors and transgenic HRs to improve the production of valuable bioactive metabolites in this species as an alternative natural source of phenolic acids and tanshinones. Abbreviations HR Hairy root RA Rosmarinic acid Sal-A Salvianolic acid A Sal-B Salvianolic acid B CA Caffeic acid VA Vanillic acid CGA Chlorogenic acid T-I Tanshinone I T-IIA Tanshinone IIA CT Cryptotanshinone DT-I Dihydrotanshinone I PAL Phenylalanine ammonia-lyase TAT Tyrosine aminotransferase DXS 1-Deoxy-D-xylulose-5-phosphate synthase DXR 1-Deoxy-D-xylulose-5-phosphate reductoisomerase MEP Methylerythritol 4-phosphate GGPP Geranylgeranyl diphosphate CPS Copalyl diphosphate synthetase KSL Kaurene synthase-like CYP76AH1 Cytochrome P450 monooxygenases ATCC American-type culture collection DW Dry weight FW Fresh weight HPPR 4-Hydroxyphenylpyruvate reductase C4H Cinnamate 4-hydroxylase 4CL Hydroxycinnamate coenzyme A ligase PCR The polymerase chain reaction TPC The total phenolic content HMGR 3-Hydroxy-3-methylglutaryl coenzyme A reductase MDS 2-C-Methyl-D-erythritol 2,4-cyclodiphosphate synthase MVA Mevalonate Declarations Acknowledgments This work was supported by a research grant funded by Shahed University of Tehran for the plant physiology PhD thesis. Author contributions This research paper was accomplished through collaboration among the authors. Raziey Rahchamani conducted the experiments analyses, and interpretation of the data and wrote the manuscript. Tayebeh Radjabian designed and supervised the study; and contributed to the conceptualization, interpretation of data, and participated in the review, and editing. Parvaneh Abrishamchi participated in the revisions of the manuscript. All authors read and approved the final manuscript. Conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Any ethical rights have been observed in writing this article, and the scientific contribution of all individuals in this research has been fully clarified and agreed upon by all. Data Availability The data that support the findings of this study are included in the article. References Abdollahi-Ghehi H, Sonboli A, Ebrahimi, SN, Esmaeili, MA, Mirjalili, MH (2019) Triterpenic acid content and cytotoxicity of some Salvia species from Iran. Nat Prod Commun 14:1-8. https://doi.org/10.1177/1934578X19842722 Atabaki N, Shaharuddin NA, Ahmad SA, Nulit R, Malik S, Vahedi M, Kalhori N, Abiri R. (2024) Hairy root culture: a reliable bioreactor from transgenic plants. In: Jain A, Malik S (eds) Peptide and protein drug delivery using polysaccharides, Academic Press is an imprint of Elsevier, London, pp 25-50. https://doi.org/10.1016/B978-0-443-18925-8.00013-1 Attaran Dowom S, Abrishamchi P, Radjabian T, Salami SA (2022) Elicitor-induced phenolic acids accumulation in Salvia virgata Jacq. hairy root cultures. Plant Cell Tiss Org (PCTOC) 148:107-117. https://doi.org/10.1007/s11240-021-02170-8 Bayesteh B, Abrishamchi P, Asili J, Zaker A (2021) In vitro production of tanshinones in adventitious root cultures of Perovskia abrotanoides Kar. under Ag + ion and yeast extract elicitation. J Plant Res 34:139-151. 20.1001.1.23832592.1400.34.1.11.8 Behçet L, Avlamaz D (2009) A new record for Turkey: Salvia aristata Aucher ex Benth. (Lamiaceae). Turk J Bot 33: 61-63. https://doi.org/10.3906/bot-0808-14 Bhaskar R, Xavier LSE, Udayakumaran G, Kumar DS, Venkatesh R, Nagella P (2022) Biotic elicitors: A boon for the in-vitro production of plant secondary metabolites. Plant Cell Tiss Org (PCTOC) 149:7-24. https://doi.org/10.1007/s11240-021-02131-1 Bisio A, Pedrelli F, D’Ambola M, Labanca F, Schito AM, Govaerts R., De Tommasi N, Milella L (2019) Quinone diterpenes from Salvia species: chemistry, botany, and biological activity. Phytochem. Rev 18:665-842. https://doi.org/10.1007/s11101-019-09633-z Caylak E (2024) Determination of antioxidant and anti-inflammatory properties of Salvia aethiopis / sclarea and synthesized silver nanoparticles. Ann Med Res 31:169–176. https://doi.org/10.5455/annalsmedres.2024.01.08 Deng C, Hao X, Shi M, Fu R, Wang Y, Zhang Y, Makunga NP, Kai G (2019) Tanshinone production could be increased by the expression of SmWRKY2 in Salvia miltiorrhiza hairy roots. J Plant Sci 284:1-8. https://doi.org/10.1016/j.plantsci.2019.03.007 Dowom SA, Abrishamchi P, Radjabian T, Salami S A (2017) Enhanced phenolic acids production in regenerated shoot cultures of Salvia virgata Jacq. after elicitation with Ag + ions, methyl jasmonate and yeast extract. Ind Crops Prod 103:81-88. https://doi.org/10.1016/j.indcrop.2017.03.043 Emadipoor E, Jamzad M, Ghaffari K, Ghadami B, Jamzad Z (2016) Essential oil composition, total phenolic and flavonoid contents, and biological activities of Salvia aristata Aucher ex Benth. extracts. J Essent Oil-Bear. Plants 19:1426-1434. https://doi.org/10.1080/0972060X.2016.1216333 Farshid F, Rashid J, Reza H (2015) Comparison of essential oil components and antioxidant activity between Salvia syriaca and Salvia aristata in their natural habitats in West Azerbaijan province, Iran. J Pharm Pharmacol 3:400-404. https://doi.org/10.17265/2328-2150/2015.08.006 Fotovvat M, Radjabian T, Saboora A (2018) HPLC fingerprint of important phenolic compounds in some Salvia L. species from Iran. Rec Nat Prod 13:37-49. http://doi.org/10.25135/rnp.72.18.02.228 Fu L, Han B, Zhou Y, Ren J, Cao W, Patel G, Kai G, Zhang J (2020) The anticancer properties of tanshinones and the pharmacological effects of their active ingredients. Front Pharmacol 11:193-211. https://doi.org/10.3389/fphar.2020.00193 Gantait S, Mukherjee E (2021) Hairy root culture technology: applications, constraints and prospect. Appl Microbiol Biotechnol 105:35-53. https://doi.org/10.1007/s00253-020-11017-9 Ghorbani A, Esmaeilizadeh M (2017) Pharmacological properties of Salvia officinalis and its components. J Tradit Complement Med 7:433-440. https://doi.org/10.1016/j.jtcme.2016.12.014 Grzegorczyk-Karolak I, Krzemińska M, Grąbkowska R, Gomulski J, Żekanowski C, Gaweda-Walerych K (2024) Accumulation of polyphenols and associated gene expression in hairy roots of Salvia viridis exposed to methyl jasmonate. Int J Mol Sci 25:764-778. https://doi.org/10.3390/ijms25020764 Guru A, Dwivedi P, Kaur P, Pandey DK (2022) Exploring the role of elicitors in enhancing medicinal values of plants under in vitro condition. S Afr J Bot 149:1029-1043. https://doi.org/10.1016/j.sajb.2021.10.014 Gutierrez-Valdes N, Häkkinen ST, Lemasson C, Guillet M, Oksman-Caldentey KM, Ritala A, Cardon F (2020) Hairy root cultures—a versatile tool with multiple applications. Front Plant Sci 11:33-44. https://doi.org/10.3389/fpls.2020.00033 Halder M, Sarkar S, Jha S (2019) Elicitation: A biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Eng Life Sci 19:880-895. https://doi.org/10.1002/elsc.201900058 He G, Chen G, Liu W, Ye D, Liu X, Liang X, Song J (2023) Salvianolic Acid B: A review of pharmacological effects, safety, combination therapy, new dosage forms, and novel drug delivery routes. Pharmaceutics 15:2235-2292. https://doi.org/10.3390/pharmaceutics15092235 Hu Z, Liu X, Tian M, Ma Y, Jin B, Gao W, Cui G, Guo J, Huang L (2021) Recent progress and new perspectives for diterpenoid biosynthesis in medicinal plants. Med Res Rev 41:2971-2997. https://doi.org/10.1002/med.21816 Ingole A, Kadam MP, Dalu AP, Kute SM, Mange PR, Theng VD, Lahane OR, Nikas AP, Kawal YV, Nagrik SU, Patil PA (2021) A review of the pharmacological characteristics of vanillic acid. J Drug Deliv Ther 11:200-204. https://doi.org/10.22270/jddt.v11i2-S.4823 Jiang Z, Gao W, Huang L (2019) Tanshinones, critical pharmacological components in Salvia miltiorrhiza . Front Pharmacol 10:202-216. https://doi.org/10.3389/fphar.2019.00202 Kai G, Xu H, Zhou C, Liao P, Xiao J, Luo X, You L, Zhang L (2011) Metabolic engineering tanshinone biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. Metab Eng 13:319-327. https://doi.org/10.1016/j.ymben.2011.02.003 Khan S, Qureshi MI, Alam T, Abdin MZ (2007) Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. Afr J Biotechnol 6:175-179. https://doi.org/10.5897/AJB06.612 Khoshsokhan F, Babalar M, Salami SA, Sheikhakbari-Mehr R, Mirjalili MH (2022) Rosmarinic acid production in hairy root cultures of Salvia nemorosa L. (Lamiaceae). Biocatal Agric Biotechnol 45:102494. https://doi.org/10.1016/j.bcab.2022.102494 Krzemińska M, Owczarek A, Gonciarz W, Chmiela M, Olszewska MA, Grzegorczyk-Karolak I (2022) The antioxidant, cytotoxic and antimicrobial potential of phenolic acids-enriched extract of elicited hairy roots of Salvia bulleyana . Molecules 27:992-1012. https://doi.org/10.3390/molecules27030992 Kwon DY, Kim YB, Kim JK, Park SU (2021) Production of rosmarinic acid and correlated gene expression in hairy root cultures of green and purple basil ( Ocimum basilicum L.). Prep Biochem Biotechnol 51:35-43. https://doi.org/10.1080/10826068.2020.1789990 Lai Z, He J, Zhou C, Zhao H, Cui S (2021). Tanshinones: An update in the medicinal chemistry in recent 5 years. Curr Med Chem 28:2807-2827. https://doi.org/10.2174/0929867327666200521124850 Li B, Wang B, Li H, Peng L, Ru M, Liang Z, Yan X, Zhu Y (2016) Establishment of Salvia castanea Diels f. tomentosa Stib. hairy root cultures and the promotion of tanshinone accumulation and gene expression with Ag + , methyl jasmonate, and yeast extract elicitation. Protoplasma 253:87-100. https://doi.org/10.1007/s00709-015-0790-9 Ma YJ, Xia J, Wang Y, Wang JW (2020) Stimulation of tanshinone production in Salvia miltiorrhiza hairy roots by β-cyclodextrin-coated silver nanoparticles. Sustain Chem Pharm 18:100271-100282. https://doi.org/10.1016/j.scp.2020.100271 Marchica A, Cotrozzi L, Detti R., Lorenzini G, Pellegrini E, Petersen M, Nali C (2020) The biosynthesis of phenolic compounds is an integrated defense mechanism to prevent ozone injury in Salvia officinalis . Antioxidants 9:1274-1290. https://doi.org/10.3390/antiox9121274 Moein F, Jamzad Z, Rahiminejad M (2019a) An integrating study of genetic diversity and ecological niche modelling in Salvia aristata (Lamiaceae). Acta Bot Hung 61:185-204. https://doi.org/10.1556/034.61.2019.1-2.10 Moein F, Jamzad Z, Rahiminejad MR (2019b) Current geographical distribution of Salvia aristata (Lamiaceae), prediction of its future distribution based on climatical data; a guide for its conservation. Iran J Bot 25:11-21. https://doi.org/10.22092/ijb.2019.119094 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473-497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x Ozyigit II, Dogan I, Erdogan A, Kaya Y (2023) Production of secondary metabolites using tissue culture-based biotechnological applications. Front Plant Sci 14:1132555. https://doi.org/10.3389/fpls.2023.1132555 Pesaraklu A, Radjabian T, Salami SA (2021) Methyl jasmonate and Ag + as effective elicitors for enhancement of phenolic acids contents in Salvia officinalis and Salvia verticillata , as two traditional medicinal plants. S Afr J Bot 141:105-115. https://doi.org/10.1016/j.sajb.2021.04.032 Roy A (2021) Hairy root culture an alternative for bioactive compound production from medicinal plants. Curr Pharm Biotechnol 22:136-149. https://doi.org/10.2174/1389201021666201229110625 Sezonov G, Joseleau-Petit D, d'Ari R (2007). Escherichia coli physiology in Luria-Bertani broth. J. Bacteriol 189: 8746-8749. https://doi.org/10.1128/jb.01368-07 Shi M, Huang F, Deng C, Wang Y, Kai G (2019) Bioactivities, biosynthesis and biotechnological production of phenolic acids in Salvia miltiorrhiza . Crit Rev Food Sci Nutr 59:953-964. https://doi.org/10.1080/10408398.2018.1474170 Singleton VL, Orthofer R, Lamuela-Raventós RM (1999) Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods Enzymol 299:152-178. https://doi.org/10.1016/S0076-6879(99)99017-1 Srivastava M, Singh G, Sharma S, Shukla S, Misra P (2019) Elicitation enhanced the yield of glycyrrhizin and antioxidant activities in hairy root cultures of Glycyrrhiza glabra L. J Plant Growth Regul 38:373-384. https://doi.org/10.1007/s00344-018-9847-2 Su Y, Song Z, Wang J (2022) One-step regeneration of hairy roots to induce high tanshinone plants in Salvia miltiorrhiza . Front Plant Sci 13:913985-913995. https://doi.org/10.3389/fpls.2022.913985 Sudha S, Singh M (2024) Therapeutic significance of tanshinone.. In: Tulsawani R, ‎ Vohora D (eds) Adaptation under stressful environments through biological adjustments and interventions, Springer Nature, Singapore, pp 185-201. https://doi.org/10.1007/978-981-99-7652-2_13 Tan Z, Luo M, Yang J, Cheng Y, Huang J, Lu C, Song D, Ye M, Dai M, Gonzalez FJ, Liu A (2016) Chlorogenic acid inhibits cholestatic liver injury induced by α-naphthylisothiocyanate: involvement of STAT3 and NFκB signalling regulation. J Pharm Pharmacol 68:1203-1213. https://doi.org/10.1111/jphp.12592 Wang J, Xu J, Gong X, Yang M, Zhang C, Li M (2019) Biosynthesis, chemistry, and pharmacology of polyphenols from Chinese Salvia species: A review. Molecules 24:155-178. https://doi.org/10.3390/molecules24010155 Wang X, Yang Y, Liu X, Gao X (2020) Pharmacological properties of tanshinones, the natural products from Salvia miltiorrhiza . Adv Pharmacol 87:43-70. https://doi.org/10.1016/bs.apha.2019.10.001 Wang Z, Peters R J (2022) Tanshinones: Leading the way into Lamiaceae labdane-related diterpenoid biosynthesis. Curr Opin Plant Biol 66:102189-102217. https://doi.org/10.1016/j.pbi.2022.102189 Wei T, Gao Y, Deng K, Zhang L, Yang M, Liu X, Qi C, Wang C, Song W, Zhang Y, Chen C (2019) Enhancement of tanshinone production in Salvia miltiorrhiza hairy root cultures by metabolic engineering. Plant Methods 15:1-11. https://doi.org/10.1186/s13007-019-0439-3 Wojciechowska M, Owczarek A, Kiss AK, Grąbkowska R, Olszewska MA, Grzegorczyk-Karolak I (2020) Establishment of hairy root cultures of Salvia bulleyana Diels for production of polyphenolic compounds. J Biotech 318:10-19. https://doi.org/10.1016/j.jbiotec.2020.05.002 Xie Y, Liu J, Shi Y, Bin Wang, Wang X, Wang W, Sun M, Xu X, He S (2021) Synthesis and evaluation of new sesamol-based phenolic acid derivatives with hypolipidemic, antioxidant, and hepatoprotective effects. Med Chem Res 30:1688-1702. https://doi.org/10.1007/s00044-021-02770-1 Xing B, Yang D, Guo W, Liang Z, Yan X, Zhu Y, Liu Y (2014) Ag + as a more effective elicitor for production of tanshinones than phenolic acids in Salvia miltiorrhiza hairy roots. Molecules 20:309-324. https://doi.org/10.3390/molecules20010309 Xing B, Yang D, Liu L, Han R, Sun Y, Liang Z (2018) Phenolic acid production is more effectively enhanced than tanshinone production by methyl jasmonate in Salvia miltiorrhiza hairy roots. Plant Cell Tiss Org (PCTOC) 134:119-129. https://doi.org/10.1007/s11240-018-1405-x Xu J, Wei K, Zhang G, Lei L, Yang D, Wang W, Han Q, Xia Y, Bi Y, Yang M, Li M (2018) Ethnopharmacology, phytochemistry, and pharmacology of Chinese Salvia species: A review. J Ethnopharmacol 225:18-30. https://doi.org/10.1016/j.jep.2018.06.029 Xu W, Jin X, Yang M, Xue S, Luo L, Cao X, Zhang C, Qiao S, Zhang C, Li J, Wu J (2021) Primary and secondary metabolites produced in Salvia miltiorrhiza hairy roots by an endophytic fungal elicitor from Mucor fragilis . Plant Physiol Biochem 160:404-412. https://doi.org/10.1016/j.plaphy.2021.01.023 Yang D, Du X, Liang X, Han R, Liang Z, Liu Y, Liu F, Zhao J (2012) Different roles of the mevalonate and methylerythritol phosphate pathways in cell growth and tanshinone production of Salvia miltiorrhiza hairy roots. PloS one 7:46797-46806. https://doi.org/10.1371/journal.pone.0046797 Yang D, Fang Y, Xia P, Zhang X, Liang Z (2018) Diverse responses of tanshinone biosynthesis to biotic and abiotic elicitors in hairy root cultures of Salvia miltiorrhiza and Salvia castanea Diels f. tomentosa . Gene 643:61-67. https://doi.org/10.1016/j.gene.2017.11.067 Yang L, Ding G, Lin H, Cheng H, Kong Y, Wei Y, Fang X, Liu R, Wang L, Chen X, Yang C (2013) Transcriptome analysis of medicinal plant Salvia miltiorrhiza and identification of genes related to tanshinone biosynthesis. PLoS One 8:80464-80477. https://doi.org/10.1371/annotation/fd65b655-d35b-47d1-8793-07da2273c144 Zhang Y, Jiang P, Ye M, Kim SH, Jiang C, Lü J (2012) Tanshinones: sources, pharmacokinetics and anti-cancer activities. Int J Mol Sci 13:13621-13666. https://doi.org/10.3390/ijms131013621 Zhou Y, Feng J, Li Q, Huang D, Chen X, Du Z, Lv Z, Xiao Y, Han Y, Chen J, Chen W (2020) Sm MYC2b enhances tanshinone accumulation in Salvia miltiorrhiza by activating pathway genes and promoting lateral root development. Front Plant Sci 11:559438-559450. https://doi.org/10.3389/fpls.2020.559438 Cite Share Download PDF Status: Published Journal Publication published 17 Aug, 2024 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted Reviewers agreed at journal 27 May, 2024 Reviewers invited by journal 27 May, 2024 Editor assigned by journal 27 Apr, 2024 First submitted to journal 24 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4303897","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":307400632,"identity":"8e992311-a2fa-4a80-bb13-ece3bd07d1af","order_by":0,"name":"Raziey Rahchamani","email":"","orcid":"","institution":"Department of Biology, Faculty of Basic Sciences, Shahed University, Tehran, Iran","correspondingAuthor":false,"prefix":"","firstName":"Raziey","middleName":"","lastName":"Rahchamani","suffix":""},{"id":307400633,"identity":"a5a633b7-81d8-4be9-a00d-8eb34905628e","order_by":1,"name":"Tayebeh Radjabian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIie3OsYrCMBzH8Z90cEnpWqnoK+QQ6lDwWRIKdSlSuEU4wU46uvYxBME5JaBL5NZCF+8RxFGRy3HLuaTeJpgPGRL4f8kfsKznxBxQwAOBg5+jiYeSTv6P5HeMij+J0XApvs5ZNpoMPg/lOZtG8JaiJaeGpKtYHBQ0fg+rib6oMXzFUCpD4oOxgFCHbytCA3chgQooc1PiHeMLoXO+WanBxb1J9BsTnyX6F8nXSMPAzSVoc3JMooLueVGlYUR2Y/KmeN6wWBrX2fWDr/RiNZlFvd5eypMpAQi7fwItcwC0RcOAZVnWy/sGZotLiRgFeNQAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-8280-9409","institution":"Shahed University","correspondingAuthor":true,"prefix":"","firstName":"Tayebeh","middleName":"","lastName":"Radjabian","suffix":""},{"id":307400634,"identity":"e69e19b0-23fc-4bd6-a286-bb65aeb22f55","order_by":2,"name":"Parvaneh Abrishamchi","email":"","orcid":"","institution":"Department of Biology, Faculty of Science, Ferdowsi Mashhad, Mashhad, Iran","correspondingAuthor":false,"prefix":"","firstName":"Parvaneh","middleName":"","lastName":"Abrishamchi","suffix":""}],"badges":[],"createdAt":"2024-04-22 07:25:48","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4303897/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4303897/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11240-024-02844-z","type":"published","date":"2024-08-17T15:57:45+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58029765,"identity":"db334833-faa1-4330-8b36-2de58d08e495","added_by":"auto","created_at":"2024-06-10 07:33:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":743964,"visible":true,"origin":"","legend":"\u003cp\u003eThe different stages of \u003cem\u003eS. aristata\u003c/em\u003e seed culture on MS solid medium. The sterilized seeds were on filter paper (a), the uncoated seeds (b), the germinated seeds (c), and the 2-week-old seedlings (d) (scale bar =1 cm)\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/d64c28bca0373b4f31a57823.png"},{"id":58029769,"identity":"bea368df-021d-4ad6-8fc6-48dfec810f1c","added_by":"auto","created_at":"2024-06-10 07:33:59","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":702526,"visible":true,"origin":"","legend":"\u003cp\u003eHairy root induction in nodal explants of 2-week-old \u003cem\u003eS. aristata\u003c/em\u003e seedling on MS medium (a),\u003cem\u003e \u003c/em\u003e10 days after infection with \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain. Growth of hairy roots on MS medium containing 6 g L\u003csup\u003e-1\u003c/sup\u003e agar (b and c), and 55-day-old hairy root cultures in MS liquid medium (d) (scale bar =1 cm)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/82ac55eb678b0538eea3e7b2.png"},{"id":58028980,"identity":"3655e2da-1f5e-4f76-b6ab-f8cdd5368641","added_by":"auto","created_at":"2024-06-10 07:25:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":336308,"visible":true,"origin":"","legend":"\u003cp\u003ePCR analysis was\u003cem\u003e \u003c/em\u003eperformed on \u003cem\u003eS. aristata\u003c/em\u003e HRs transformed by \u003cem\u003eA. rhizogenes\u003c/em\u003e using specific primers for the \u003cem\u003erolC\u003c/em\u003e gene (612 bp). Genomic DNA from \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain was loaded in lane C+ (positive control), non-transformed roots in lane C- (negative control), and hairy root lines in lanes 1-6. Lane L represents the molecular weight marker (1 kb DNA ladder). The leftward arrow indicates the amplified fragment of the \u003cem\u003erolC\u003c/em\u003e(612 bp) gene\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/6f00d67e359e21588d3a3ca4.png"},{"id":58028987,"identity":"74f37c8a-b7a3-4a33-919a-912649ba7366","added_by":"auto","created_at":"2024-06-10 07:25:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":373602,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth curve of \u003cem\u003eS. aristata\u003c/em\u003e hairy root line 2 after 70 days culture in free-hormone liquid MS medium\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/a218db353ba3cf29c7bec85c.png"},{"id":58028983,"identity":"a8e06b7a-cb18-4a72-b5d3-7e396d40a1db","added_by":"auto","created_at":"2024-06-10 07:25:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":257594,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of elicitation with Ag\u003csup\u003e+ \u003c/sup\u003eions on the changes in biomass of \u003cem\u003eS. aristata\u003c/em\u003e\u0026nbsp;hairy root cultures of line 2 during 0, 1, 3, 5, and 7 days after treatment. Values represent the mean of three replicates\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/7da4c5626560eb02056462b5.png"},{"id":58029767,"identity":"5752005c-e8d9-414d-9063-2381f9a9861b","added_by":"auto","created_at":"2024-06-10 07:33:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":226638,"visible":true,"origin":"","legend":"\u003cp\u003eHPLC chromatograms of methanolic extracts from \u003cem\u003eS. aristata\u003c/em\u003e\u0026nbsp;hairy roots.\u0026nbsp;The identified phenolic acids in the elicited HRs with 15 µM Ag\u003csup\u003e+\u003c/sup\u003e ions for 5 days (a)\u003cstrong\u003e \u003c/strong\u003eand the standards of phenolic acids\u003cstrong\u003e \u003c/strong\u003e(b). The detected tanshinones in the elicited HRs with 15 µM Ag\u003csup\u003e+ \u003c/sup\u003eions for 5 days (c) and the authentic tanshinones (d). Vanillic acid (VA), chlorogenic acid (CGA), caffeic acid (CA), rosmarinic acid (RA), salvianolic acid B (Sal-B), salvianolic acid A (Sal-A), cryptotanshinone (CT), tanshinone I (T-I), and tanshinone II A (T-IIA)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/d60e4033381202338471c54d.png"},{"id":58028985,"identity":"d43aa41c-9990-408f-976d-910832f6508d","added_by":"auto","created_at":"2024-06-10 07:25:58","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":592869,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions on phenolic acids content of\u0026nbsp;\u003cem\u003eS. aristata\u003c/em\u003e\u0026nbsp;hairy roots. CA: caffeic acid, RA: rosmarinic acid, Sal-A: salvianolic acid A, Sal-B: salvianolic acid B and VA: vanillic acid. The vertical bars represent the ± SD values (n = 3). Mean values on columns labeled with different superscript letter(s) are considered significant at \u003cem\u003eP\u003c/em\u003e ≤ 0.05 based on Duncan's test\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/52e37b12122eba1c59df1b5a.png"},{"id":58029766,"identity":"d8961795-41ac-447a-9466-c7c0985d4b0b","added_by":"auto","created_at":"2024-06-10 07:33:58","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":483845,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions on the content of tanshinones in \u003cem\u003eS. aristata\u003c/em\u003e\u0026nbsp;hairy roots. The vertical bars represent the ± SD values (n = 3). Mean values on columns labeled with different superscript letter(s) indicate significance at\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026nbsp;≤ 0.05 by Duncan's test\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/afbe6067948105927ff98e3d.png"},{"id":58030579,"identity":"7b56a286-051a-4745-a5df-55a9f36ab0d8","added_by":"auto","created_at":"2024-06-10 07:41:58","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":345713,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Ag\u003csup\u003e+\u003c/sup\u003e ions on the relative expression levels of three key genes in the biosynthetic pathways of phenolic acids in\u0026nbsp;\u003cem\u003eS. aristata\u003c/em\u003e\u0026nbsp;hairy roots. The vertical bars represent the ± SD values (n = 3). Mean values on columns labeled with a different superscript letter(s) indicate significance at\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026nbsp;≤ 0.05 according to Duncan's test. \u003cem\u003ePAL\u003c/em\u003e: phenylalanine ammonia-lyase,\u0026nbsp;\u003cem\u003eTAT\u003c/em\u003e: tyrosine aminotransferase,\u0026nbsp;\u003cem\u003eRAS\u003c/em\u003e: rosmarinic acid synthase\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/330756c96aa5c05f85e44946.png"},{"id":58028989,"identity":"421f497f-9b21-4e6e-be67-fcda4e56a686","added_by":"auto","created_at":"2024-06-10 07:25:58","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":231506,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Ag\u003csup\u003e+\u003c/sup\u003e ions on the relative expression levels of two key genes in the biosynthesis pathway of tanshinones in\u0026nbsp;\u003cem\u003eS. aristata\u003c/em\u003e\u0026nbsp;hairy roots. The vertical bars represent the ± SD values (n = 3). Mean values on columns labeled with a different superscript letter(s) indicate significance at\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026nbsp;≤ 0.05 according to Duncan's test. \u003cem\u003eCPS\u003c/em\u003e: copalyl diphosphate synthase,\u0026nbsp;\u003cem\u003eCYP76AH1\u003c/em\u003e: cytochrome P450-dependent monooxygenase\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/67f39f72c54d7ecb67eb63db.png"},{"id":63071309,"identity":"0456b4cf-6613-406e-a25d-d05fc996ccc4","added_by":"auto","created_at":"2024-08-22 20:06:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7464611,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4303897/v1/7040ea2a-498d-4273-bc26-a1282be46c95.pdf"}],"financialInterests":"","formattedTitle":"Ag+ ions are effective elicitors for enhancing the production of phenolic acids and tanshinones in Salvia aristata Aucher ex Benth. hairy roots","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eSalvia aristata\u003c/em\u003e Aucher ex Benth. (Lamiaceae family) is an Irano-Turanian endemic medicinal plant species whose distribution is limited to the north, northwest, and central regions of Iran (Moein et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e). Recently several reports have mentioned the presence of this species in the east of Turkey (Beh\u0026ccedil;et and Avlamaz \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). There are only a few scientific reports about \u003cem\u003eS. aristata\u003c/em\u003e; in some of them, the antioxidant and pharmacological effects are attributed to the content of compounds such as triterpenic acids (Abdollahi-Ghehi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), essential oil compounds (Farshid et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Emadipoor et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), phenolics, and flavonoids (Emadipoor et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Phenolic acids, predominantly rosmarinic acid (RA), salvianolic acid A (Sal-A), salvianolic acid B (Sal-B), caffeic acid (CA), vanillic acid (VA), and chlorogenic acid (CGA) (Shi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), along with tanshinones including tanshinone I )T-I(, tanshinone IIA (T-IIA), cryptotanshinone (CT), and dihydrotanshinone I (DT-I) are the most valuable metabolites in \u003cem\u003eSalvia\u003c/em\u003e L. species (Bisio et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Wang and Peters \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Phenolic acids are used for the treatment of atherogenic dyslipidemia, and cholestatic liver damage, and have antioxidant and antidepressant effects (Tan et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ingole et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Xie et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; He et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Caylak \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Tanshinones belong to a natural group of abietane-type norditerpenoid quinones that manifest remarkable pharmacological properties such as anti-cancer, antibacterial, antiviral, and neuroprotective effects (Fu et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Lai et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Sudha and Singh \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe biosynthetic pathways of phenolic acids have been identified in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Bunge (Shi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Phenolic acids, especially RA, are generally produced from two pathways: the phenylalanine and tyrosine-derived pathways. The first-point reactions in these pathways are catalyzed by phenylalanine ammonia-lyase (PAL)\u003c/p\u003e \u003cp\u003eand tyrosine aminotransferase (TAT), respectively.\u003c/p\u003e \u003cp\u003eThe biosynthetic pathway of tanshinones proceeds in three steps: formation of terpenoid precursors, the creation of tanshinone skeleton, and subsequent skeletal modification such as oxidation, methylation, decarboxylation, or cyclization which produce diverse tanshinones. Recent studies have demonstrated that the \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HR cultures accumulate tanshinones in a manner that is consistent with the transcript levels of certain key enzymes. These enzymes include 1-deoxy-D-xylulose-5-phosphate synthase (DXS) and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), which are situated upstream of the methylerythritol 4-phosphate (MEP) pathway, as well as geranylgeranyl diphosphate (GGPP), copalyl diphosphate synthetase (CPS), kaurene synthase-like (KSL(, and cytochrome P450 monooxygenases) CYP76AH1, CYP76AH3, and CYP76AK1(, which are located downstream of the MEP pathway (Jiang et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wang and Peters \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eElicitation is a suitable method to increase the production of valuable compounds from medicinal plants, which can influence the gene expression of regulatory enzymes in the biosynthetic pathways and the accumulation of secondary metabolites (Bhaskar et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Grzegorczyk-Karolak et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Heavy metals are effective stimuli in inducing secondary metabolite production. Among the metal ions, Ag\u003csup\u003e+\u003c/sup\u003e ions have been widely used to induce the production of secondary compounds in plants. Recent studies have demonstrated the effectiveness of this elicitor in increasing the content of tanshinones and phenolic acids (Xing et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Dowom et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Bayesteh et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Pesaraklu et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Attaran Dowom et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eSalvia aristata\u003c/em\u003e is considered a rare, vulnerable, or endangered species due to its limited occupation level and the small population in Iran (Moein et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e). Consequently, it is necessary to employ biotechnological methods to exploit and protect the genetic preservation of this medicinal species. Furthermore, because phenolic acids and terpenoids exist in the shoots and roots of this species, HR culture could serve as a potent tool for \u003cem\u003ein vitro\u003c/em\u003e production of these metabolites (Gantait and Mukherjee \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Roy \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Atabaki et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, HR cultures of \u003cem\u003eS. aristata\u003c/em\u003e were established for the first time. Moreover, the accumulation of phenolic acids and tanshinones, as well as the gene expression of the crucial enzymes involved in their biosynthesis pathways, were investigated in the HRs under elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExplants preparing using the seed culture method\u003c/h2\u003e \u003cp\u003eThe mature seeds of \u003cem\u003eS. aristata\u003c/em\u003e Aucher ex Benth. were collected in September 2018 from a naturally occurring population in Gardane Kaman, Qazvain province, located in the northwest of Iran, situated at latitude 36\u0026deg; 27' 49'' N, longitude 50\u0026deg; 07' 59'' E, with an altitude of 2034 m above sea level. A voucher specimen was deposited at the herbarium of Bu-Ali Sina University of Hamedan (BASU 34046).\u003c/p\u003e \u003cp\u003eThe collected seeds were soaked in sterile water for 10 min, followed by sterilization with 70% ethanol (v/v) for 1 min and sodium hypochlorite solution (10%) for 10 min. Since the mucilaginous coat on \u003cem\u003eS. aristata\u003c/em\u003e seeds reduces their germination rate, the seed coats were cut and removed using a sterilized scalpel. After the removal of the seed coats, they were placed on solid MS media (Classic Murashige and Skoog \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1962\u003c/span\u003e), solidified with 7 g\u003csup\u003e-1\u003c/sup\u003e L agar, and incubated at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C under a light/dark cycle of 8/16 h for a period of 14 days. The 14-day-old seedlings were selected for inoculation with the bacterial strain.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of bacterial strain\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain (American-type culture collection) was obtained from the microbial collection of the Biotechnology Research Center, Karaj, Iran. Initially, bacterial cells were cultured on Luria-Bertani medium (LB) agar medium supplemented with 50 mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e L (Sezonov et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The cultures were then transferred to a rotary shaker and incubated at 28\u0026deg;C with a speed of 180 rpm for 48 h under dark conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eHairy root culture\u003c/h2\u003e \u003cp\u003eThe nodal explants obtained from the 14-day-old seedlings were inoculated with a needle previously immersed in an \u003cem\u003eA. rhizogenes\u003c/em\u003e bacterial suspension. Subsequently, the explants were transferred to MS medium supplemented with 6 g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e L agar and maintained in darkness at 25\u0026deg;C. Control explants were inoculated using a sterile needle dipped in sterile water. After an incubation period of 48 h, the explants were rinsed with a cefotaxime solution at a concentration of 500 mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e L and then placed on an MS culture medium containing the same antibiotic concentration along with 150 \u0026micro;M acetosyringone. The cultures were incubated under a 16/8 hour (light/dark) photoperiod (45 \u0026micro;mol m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, provided by cool white fluorescent lamps), and incubated at 25\u0026deg;C. The experiment was repeated three times with five explants. Twelve days after infection with \u003cem\u003eA. rhizogenes\u003c/em\u003e, HRs began to appear on the explants, and ten days after their emergence, six fast-growing lines were selected and transferred to MS media, which solidified with 6 g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e L agar and maintained at 25\u0026deg;C in dark condition. One week later, the selected HR lines were moved to 150 mL Erlenmeyer flasks containing 50 mL of hormone-free liquid MS medium and incubated at 25\u0026deg;C in the dark on a rotary shaker at 120 rpm. The HRs were subcultured into the same fresh medium every four weeks. After two cycles of subculturing, (approximately after two months of culture), the dry weight (DW) and tanshinone content of the HR lines were determined. Due to the significant levels of tanshinones along with high biomass, HR line 2 was selected for elicitor treatments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eConfirmation of transgenic hairy root lines\u003c/h2\u003e \u003cp\u003eGenomic DNA (gDNA) from six HR lines and non-transformed roots of \u003cem\u003eS. aristata\u003c/em\u003e was extracted from 100 mg plant tissue using the CTAB method (Khan et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). In this work, DNA from the ATCC 15834 strain of \u003cem\u003eA. rhizogenes\u003c/em\u003e and the extracted DNA from the 50-day-old non-infected roots served as the positive and negative controls, respectively. The polymerase chain reaction (PCR) was performed to confirm the transformation of HR lines using the C1000 Touch TM 96-Well Thermal Cycler (Bio-Rad, USA), with gene-specific primers designed to detect an internal \u003cem\u003erolC\u003c/em\u003e gene fragment (612 bp) were F: 5' -CTCCTGACATCAAACTCGTC-3' and R:5\u0026acute; -TGCTTCGAGTTATGGGTACA-3'. The PCR reaction contained Taq PCR Master Mix Kit (Qiagen), gDNA (100 ng total DNA), and oligonucleotide primers (10 \u0026micro;M final concentration in the total volume of 15 \u0026micro;L). The total volume of the reaction was achieved by mixing 0.5 \u0026micro;L DNA Template, 0.5 \u0026micro;L Premix, 5 \u0026micro;L 2X Blue Load Master Mix, and 4 \u0026micro;L of dH\u003csub\u003e2\u003c/sub\u003eO. The PCR procedure was performed with an initial pre-denaturation step at 95\u0026deg;C for 3 min, followed by 35 cycles of denaturation at 95\u0026deg;C for 30 s, annealing at 55\u0026deg;C for 40 s, and extension at 72\u0026deg;C for 40 s, with a final extention step was then carried out at 72\u0026deg;C for 7 min. For analysis, 5 \u0026micro;L of the PCR products were run on a 1% (w/v) agarose gel, stained with GelRed, and visualized under UV light by a Gel Doc System (Farjin Poish-Doc, Iran).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eElicitation of hairy roots\u003c/h2\u003e \u003cp\u003eIn this study, Ag\u003csup\u003e+\u003c/sup\u003e ions were utilized to elicit HR cultures of line 2. A stock solution of Ag\u003csup\u003e+\u003c/sup\u003e ions was prepared by dissolving AgNO\u003csub\u003e3\u003c/sub\u003e (Sigma-Aldrich) in deionized water. The solution was then added to a liquid hormone-free basal MS medium to achieve specified concentrations (15 and 25 \u0026micro;M) for 50-day-old HR cultures. Different concentrations of AgNO\u003csub\u003e3\u003c/sub\u003e solutions were added to the freshly prepared culture media after sterilization through 0.2 \u0026micro;m pore-size filters. HR samples were collected from the culture media on days 0, 1, 3, 5, and 7 following elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions. To determine the optimal time for elicitor treatments, the growth curve of HR line 2 was plotted. Accordingly, root tips (0.6 g) were extracted from one-month-old HRs and transferred to 150 mL flasks containing 50 mL of liquid MS medium. The cultures were shaken (100 rpm) at 25\u0026deg;C under continuous darkness. Fresh weight (FW) of HR samples was measured at 4-day intervals for 70 days after cultivation, and a growth curve was constructed based on the obtained values. Treatments of the HRs with the elicitor were carried out at the end of the exponential phase, on day 50 of the HR growth curve. The same volume of water, as the solvent of AgNO3, was added to 50 mL of liquid MS medium for the control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of total phenolic content\u003c/h2\u003e \u003cp\u003eThe total phenolic content (TPC) of the elicited HRs was determined using the Folin-Ciocalteu method (Singleton et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Initially, 150 \u0026micro;L of each HR extract was mixed with the Folin-Cicalteu reagent, and after 5 min, 1500 \u0026micro;L of 7% sodium carbonate solution was added to the mixture. The total volume of the solution was then adjusted to 3000 \u0026micro;L with distilled water. After 90 min of incubation, the absorbance was measured at 750 nm using a spectrophotometer. A standard curve was plotted with different concentrations of gallic acid (GAE), and the results were expressed as mg gallic acid per gram DW (GAE g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eExtraction and HPLC analysis of phenolic acids and tanshinones\u003c/h2\u003e \u003cp\u003eInitially, 100 mg of dried HR powder was extracted after soaking in 1 mL of methanol for 24 h. Then, the extracts were centrifugated at 10,000 rpm for 10 min, and the supernatant was filtered through a 0.45 \u0026micro;m Millipore filter. Phenolic acids and tanshinones present in the extracts were quantified using a Smartline HPLC system (Kenuer, Germany) equipped with a quadruple pump and a C18 Eurospher-100 reversed-phase column (5 \u0026micro;m particle, 250 mm \u0026times; 4.6 mm). For the detection and quantification of phenolic acids, the solvent system consisted of 0.1% (v/v) phosphoric acid in water (solvent A) and acetonitrile (solvent B). The elution gradient program was set as follows: 90\u0026thinsp;\u0026minus;\u0026thinsp;10% A (v/v) in 0\u0026ndash;15 min, 75\u0026thinsp;\u0026minus;\u0026thinsp;25% A (v/v) in 15\u0026ndash;40 min, 20\u0026ndash;80% A (v/v) in 40\u0026ndash;45 min, 0-100% A (v/v) in 45\u0026ndash;50 min, 0-100% A (v/v) in 50\u0026ndash;55 min, 10\u0026ndash;90% A (v/v) in 55\u0026ndash;60 min. Tanshinones in the extracts were identified using a specific mobile phase composed of 0.02% (v/v) phosphoric acid in water (solvent C) and acetonitrile (solvent D) and a gradient washing program with the following parameters: 39\u0026ndash;61% A (v/v) in 0\u0026ndash;5 minutes, 90\u0026thinsp;\u0026minus;\u0026thinsp;10% A (v/v) 22\u0026thinsp;\u0026minus;\u0026thinsp;5 in min, 61\u0026thinsp;\u0026minus;\u0026thinsp;39% A (v/v) in 22\u0026ndash;30 min, 61\u0026thinsp;\u0026minus;\u0026thinsp;39% A (v/v) in 30\u0026ndash;35 min. The detection of phenolic acids and tanshinones was performed at 280 and 270 nm, respectively. The flow rate through the column was maintained at 1 mL min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Calibration curves, generated using standard solutions of phenolic acids (y\u003csub\u003eCA\u003c/sub\u003e=222904x-302560, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.9957; y\u003csub\u003eRA\u003c/sub\u003e= 41606x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.988; y\u003csub\u003eSal\u0026minus;B\u003c/sub\u003e=2055x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.997; y\u003csub\u003eSal\u0026minus;A\u003c/sub\u003e = 19497x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.996; y\u003csub\u003eVA\u003c/sub\u003e = 40885x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.903; and tanshinones (y\u003csub\u003eT\u0026minus;I\u003c/sub\u003e = 22523x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.996; y\u003csub\u003eT\u0026minus;IIA\u003c/sub\u003e =2055x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.995; y\u003csub\u003eCT\u003c/sub\u003e = 109103x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.993) were utilized to estimate the contents of phenolic acids and tanshinones present in the HRs extracts. All analyses were conducted three times, and the contents of the examined compounds were expressed as mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction, cDNA synthesis, and gene expression analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from frozen HR tissues in liquid nitrogen using an RNX-Plus kit (RN7713C, CinnaGen, Iran), following the manufacturer's protocol with slight modifications. Before using in cDNA synthesis, the integrity of RNA molecules was assessed through 1% agarose gel electrophoresis. The purity and quantity of the RNA were determined using a SPECTROstar Nano microplate reader (BMG LABTECH, Germany). For each RNA sample, 1 \u0026micro;g of total RNA with a final concentration of 10 U \u0026micro;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was prepared.\u003c/p\u003e \u003cp\u003ecDNA was synthesized from the prepared RNA samples using a 2-step Revert Aid Reverse Transcriptase kit (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. Specific primers for the studied genes (\u003cem\u003ePAL\u003c/em\u003e, \u003cem\u003eTAT\u003c/em\u003e, \u003cem\u003eRAS\u003c/em\u003e, \u003cem\u003eCPS\u003c/em\u003e, and \u003cem\u003eCYP76AH1\u003c/em\u003e) were designed based on the conserved regions within the Lamiaceae family sequences, using Gene Runner software (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These primers then were analyzed using BLAST software on NCBI.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNucleotide sequences of the designed primers for the examined genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5ʹ\u0026rarr; 3ʹ)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5ʹ\u0026rarr; 3ʹ)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e5.8S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATATCTCGGCTCTCGCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTTCGGGCGCAACTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTAT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGGAGGTTGATCTCGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTTAGGTGCTGATATGAGTAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRAS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGCCACGTGCGGCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAAACGGCGCCGCCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePAL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGTGCAGAGCGCGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTAGGTTGAAGACATGAGTTTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCYP76AH1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTCGGAGCATTTCTGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGCGCAAGATATGCAAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCPS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGCACATGACTTGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGGAGACGTGAGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTo quantify gene expression levels, qRT-PCR assays were performed using a Corbett Rotor-Gene 6000 Real-Time PCR system (Qiagen, USA) with SYBR\u0026reg;Green Master Mix 2 \u0026times; (Ampliqon, Denmark), following the manufacturer\u0026rsquo;s protocol. \u003cem\u003e5.8S\u003c/em\u003e ribosomal \u003cem\u003erRNA\u003c/em\u003e was used as the reference gene in the PCR analyses. The amplification reactions (10 \u0026micro;L final volume) consisted of 5 \u0026micro;L of 2\u0026times; SYBR Green Real-Time PCR Master Mix (Parstous, Iran), 0.5 \u0026micro;L each of forward and reverse primers, 0.5 \u0026micro;L of cDNA, and 4 \u0026micro;L of nuclease-free PCR-grade water. The amplification program was as follows: one cycle of initial denaturation at 94\u0026deg;C for 10 min, followed by 30 cycles of 15 s at 95\u0026deg;C, 30 s at 60\u0026deg;C, and 40 s at 72\u0026deg;C, and finally, one cycle of 72\u0026deg;C for 5 min. The relative transcript levels of the examined genes were calculated using the comparative cycle threshold (Ct) method, employing the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e formula.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eExperiments were conducted using a randomized factorial design, and analyses were repeated three times per treatment. Data were analyzed using SPSS software, version 24.0. A one-way analysis of variance (ANOVA) was performed to identify any statistical significance between the treatment groups. The Duncan test was applied to compare the differences between mean values, with statistical significance set at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eInduction of hairy roots and confirmation of transgenic genome\u003c/h2\u003e \u003cp\u003eIn this study, 14-day-old sterile seedlings obtained from seed culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were inoculated with five \u003cem\u003eA. rhizogenes\u003c/em\u003e strains (ATCC 15834, A4, R1000, C58C1, and GM1534). The explants inoculated with the bacterial strain ATCC 15834 showed only HR formation after 12 days at the node wound site (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The formation of HR was not observed on the explants inoculated with other bacterial strains or in the control group. A 47% infection frequency was achieved for the explants infected with the ATCC 15834 strain. Among the HR lines induced by the ATCC 15834 strain, six lines that continued to grow were confirmed for the presence of the \u003cem\u003erolC\u003c/em\u003e gene in their genomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Hairy root line 2, with the highest tanshinone content and biomass, was selected for further experiments with Ag\u003csup\u003e+\u003c/sup\u003e ions. Furthermore, a growth curve was plotted to find the optimum timing for elicitor treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of Ag\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eions on the growth of\u003c/b\u003e \u003cb\u003eS. aristata\u003c/b\u003e \u003cb\u003ehairy roots\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAmong the lines induced by the ATCC 15843 strain, \u003cem\u003eS. aristata\u003c/em\u003e HR line 2, distinguished by the highest biomass and tanshinone content, was chosen for elicitor treatment. Our findings revealed that exposing HR line 2 to Ag\u003csup\u003e+\u003c/sup\u003e ions on the fifth day of growth enhanced its biomass in shake-flask cultures in a concentration- and time-dependent manner. Exposure to 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions led to significant increases in the FW of HRs on all days post-exposure, compared to groups treated with 15 \u0026micro;M elicitor and the control. However, enhancements in the DW of HR cultures were observed only after 5 and 7 days of Ag\u003csup\u003e+\u003c/sup\u003e ions exposure at both concentrations compared to the control. Nevertheless, the rise in the DW of elicited HRs with 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions was significant only after 7 days of exposure compared to HRs exposed to a 15 \u0026micro;M concentration of the elicitor. Seven days post-elicitation with 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions, both DW (1.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 g) and FW (7.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00 g) of HR cultures reached maximum values, which were 1.30- and 1.66\u0026ndash;fold higher than those of the untreated cultures, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of Ag\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eions on the total phenolic content in\u003c/b\u003e \u003cb\u003eS. aristata\u003c/b\u003e \u003cb\u003ehairy roots\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe TPC of HR line 2 cultures were measured at intervals of 0, 1, 3, 5, and 7 days following elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions. As illustrated in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, HRs treated with 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions exhibited elevated levels of TPC on days 1, 3, 5, and 7 days after treatment compared to their corresponding control groups at the same exposure times; however, the increase in TPC was significant only on the fifth day after treatment. Conversely, no significant increases were found in TPC of elicited HRs with 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions at most times of the experiment, except on the initial day of exposure, compared to controls. The highest TPC (49.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31 mg GAE g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW, 1.60-fold of the control group) was attained in HR cultures treated with 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions for 5 days. Subsequently, the TPC of HRs dropped 7 days after treatment with both concentrations of Ag\u003csup\u003e+\u003c/sup\u003e ions. The observed decrease was statistically significant only in HRs exposed to 15 \u0026micro;M of the elicitor compared to the control.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of elicitation with two concentrations of Ag\u003csup\u003e+\u003c/sup\u003e ions on total phenol content of \u003cem\u003eS. aristata\u003c/em\u003e hairy roots\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e ions\u003c/p\u003e \u003cp\u003e(\u0026micro;M)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTime after treatment\u003c/p\u003e \u003cp\u003e(day)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal phenol content\u003c/p\u003e \u003cp\u003e(mg GAE g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003ede\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.41\u0026thinsp;\u0026plusmn;\u0026thinsp;3.44\u003csup\u003eef\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u0026thinsp;\u0026minus;\u0026thinsp;e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003csup\u003eb\u0026thinsp;\u0026minus;\u0026thinsp;e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.57\u0026thinsp;\u0026plusmn;\u0026thinsp;1.39\u003csup\u003ed\u0026thinsp;\u0026minus;\u0026thinsp;f\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.63\u0026thinsp;\u0026plusmn;\u0026thinsp;1.47\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e31.49\u0026thinsp;\u0026plusmn;\u0026thinsp;5.77\u003csup\u003eb\u0026thinsp;\u0026minus;\u0026thinsp;d\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e31.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.31\u0026thinsp;\u0026plusmn;\u0026thinsp;5.66\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003csup\u003ec\u0026thinsp;\u0026minus;\u0026thinsp;f\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003ec\u0026thinsp;\u0026minus;\u0026thinsp;f\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e37.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e49.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e (25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.78\u0026thinsp;\u0026plusmn;\u0026thinsp;4.61\u003csup\u003ec\u0026thinsp;\u0026minus;\u0026thinsp;f\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eThe values represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, which are labeled following Duncan\u0026rsquo;s Multiple Range Test. Means signed with the same letter in each column are not significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of Ag\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eions on the content of phenolic acids and tanshinones in\u003c/b\u003e \u003cb\u003eS. aristata\u003c/b\u003e \u003cb\u003ehairy roots\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn this study, methanolic extracts from both elicited and non-elicited HRs of line 2 with Ag\u003csup\u003e+\u003c/sup\u003e ions were quantitatively analyzed for their phenolic acid and tanshinone content using the HPLC method. In the chromatograms of the elicited HR extracts, four distinct phenolic acids (RA, Sal-A, Sal-B, and VA) and three tanshinones (T-I, T-IIA, and CT), were identified and their contents were subsequently quantified. The HPLC chromatograms of phenolic acids and tanshinones from the HRs elicited with 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions for 5 days, are shown alongside their corresponding standards in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe variable capacities of elicited \u003cem\u003eS. aristata\u003c/em\u003e HR cultures to accumulate phenolic acids are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. The presence of Ag\u003csup\u003e+\u003c/sup\u003e ions in the culture media at both concentrations effectively increased the accumulation of CA in HRs, depending on the duration of exposure. Consequently, 1.26- and 1.37\u0026ndash;fold increases were recorded in the content of phenolic acids after 3 and 5 days of exposure to 25 and 15 \u0026micro;M elicitors, respectively. Exposure to both concentrations of Ag\u003csup\u003e+\u003c/sup\u003e ions significantly enhanced the RA content in HRs on days 1, 5, and 7 post-treatment. HRs treated with 15 and 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions accumulated up to 0.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 and 0.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW of RA, respectively, 7 days after treatment, representing nearly 1.43- and 1.34-fold increases compared to the control groups at the same exposure time, respectively. However, the stimulatory effect of Ag\u003csup\u003e+\u003c/sup\u003e ions on Sal-B accumulation in HRs was significant only one day after exposure. The highest contents of Sal-B were recorded at 0.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07 and 0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW when HRs were exposed to 15 and 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions for one day, respectively. These values were 1.82- and 1.71-fold higher than those in the control groups at the same exposure time. Data analysis revealed that Ag\u003csup\u003e+\u003c/sup\u003e ions had no stimulatory effects on the accumulation of Sal-A and VA in HRs; thus, treatment with both concentrations of the elicitor slightly, but not significantly, reduced the content of Sal-A and VA in the HRs at most exposure times compared to controls. Based on the results of this research, chlorogenic acid was not detected in the HR extracts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the obtained results, exposure to Ag\u003csup\u003e+\u003c/sup\u003e ions at both concentrations efficiently stimulated the accumulation of tanshinones in the treated HRs. Consequently, the levels of total tanshinones were consistently higher than those in the control groups across all harvesting times (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). After seven days of exposure to the elicitor, Ag\u003csup\u003e+\u003c/sup\u003e ions at a concentration of 25 \u0026micro;M exhibited the most significant stimulatory effect on the accumulation of all tested tanshinones. In comparison with the controls, there was a remarkable increase of 7.78-, 6.47-, and 3.9-fold in the content of T-I, T-IIA, and CT of HRs, respectively. Additionally, under this treatment condition, the total amount of tanshinones (1360\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 \u0026micro;g g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW) in the elicited leaves was enhanced by 7.25-fold compared to the control group. Additionally, under this treatment condition, the total amount of tanshinones (1360\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 \u0026micro;g g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW) in the elicited HRs was enhanced by 7.25-fold compared to the control group. Among the three tanshinones, only the content of T- IIA showed a significant increase in the HRs treated with 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions, reaching nearly 3.16- to 6.8-fold of the control group during the one to 5 days after elicitation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of Ag\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eions on the metabolites released by\u003c/b\u003e \u003cb\u003eS. aristata\u003c/b\u003e \u003cb\u003ehairy roots into the culture medium\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe metabolite contents in methanolic extract derived from ethyl acetate extraction of the culture media were quantified using the HPLC method. The analyses indicated that the quantity of phenolic acids released into the culture media was not significant compared to the content of those produced in the elicited HRs (data not provided). In contrast, the findings demonstrated that exposure to Ag\u003csup\u003e+\u003c/sup\u003e ions significantly enhanced the production of tanshinones in the HRs, followed by their release into the culture medium. As detailed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, after a 5-day treatment with 25 \u0026micro;M of the elicitor, the HRs secreted the highest levels of CT (1.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), T-I (30.08\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), and T-IIA (31.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) into the culture medium. These levels were approximately 23.37-, 32.69-, and 15.58-fold higher, respectively, than those levels released by the control group during the same period of exposure.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of Ag\u003csup\u003e+\u003c/sup\u003e ions on the content of tanshinones released by \u003cem\u003eS. aristata\u003c/em\u003e hairy roots into the culture medium\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eElicitor (\u0026micro;M)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eExposure time (day)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCryptotanshinone\u003c/p\u003e \u003cp\u003e(\u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTanshinone I\u003c/p\u003e \u003cp\u003e(\u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTanshinone IIA\u003c/p\u003e \u003cp\u003e(\u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTotal Tanshinone\u003c/p\u003e \u003cp\u003e(\u0026micro;g mL\u003csup\u003e1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e18.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003egh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e013\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ee\u0026thinsp;\u0026minus;\u0026thinsp;h\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.10\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003csup\u003ee\u0026thinsp;\u0026minus;\u0026thinsp;h\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e19.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003efg\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.94\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003eef\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003csup\u003egh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003csup\u003ee\u0026thinsp;\u0026minus;\u0026thinsp;g\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003egh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.99\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25\u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ede\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12\u003csup\u003ed\u0026thinsp;\u0026minus;\u0026thinsp;f\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ec\u0026thinsp;\u0026minus;\u0026thinsp;e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ef\u0026thinsp;\u0026minus;\u0026thinsp;h\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.063\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.08\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e31.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e63.45\u0026thinsp;\u0026plusmn;\u0026thinsp;3.99\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAg\u003csup\u003e+\u003c/sup\u003e 25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e29.02\u0026thinsp;\u0026plusmn;\u0026thinsp;7.63\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14.64\u0026thinsp;\u0026plusmn;\u0026thinsp;3.44\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e43.79\u0026thinsp;\u0026plusmn;\u0026thinsp;11.10\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eThe values represent the average of three replicates\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. According to Duncan\u0026rsquo;s Multiple Range Test, means labeled with the same letter within a column are not significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of Ag\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eions on the gene expression of enzymes involved in metabolites biosynthetic pathways in\u003c/b\u003e \u003cb\u003eS. aristata\u003c/b\u003e \u003cb\u003ehairy roots\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe evaluated the gene expression levels of three pivotal enzymes (PAL, TAT, and RAS) in the phenolic acid biosynthesis pathways in \u003cem\u003eS. aristata\u003c/em\u003e HRs elicited with Ag\u003csup\u003e+\u003c/sup\u003e ions (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e), and statistical analysis underlined substantial changes in the transcript levels of the assessed genes following exposure to both elicitor concentrations. Our results demonstrated significant increases in the relative expression levels of \u003cem\u003ePAL\u003c/em\u003e in HRs exposed to 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions for 1, 3, and 7 days. The maximum expression level of \u003cem\u003ePAL\u003c/em\u003e attained 35.01-fold higher than the control one day after elicitation with 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions. The highest expression level of \u003cem\u003eTAT\u003c/em\u003e, nearly 11.08-fold of the control group, was detected in HRs after three days of treatment with the same concentration of the elicitor. Compared to \u003cem\u003ePAL\u003c/em\u003e and \u003cem\u003eTAT\u003c/em\u003e, the gene expression levels of \u003cem\u003eRAS\u003c/em\u003e in HRs were affected by both elicitor concentrations. In particular, the transcript levels of \u003cem\u003eRAS\u003c/em\u003e increased in the initial days (0, 1, and 3) after treatment with 25 \u0026micro;M of Ag\u003csup\u003e+\u003c/sup\u003e ions, attaining its maximum level (3.23-fold higher than the control) on the third day after elicitation. Moreover, the stimulatory effect of 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions on the induction of \u003cem\u003eRAS\u003c/em\u003e persisted up to 7 days after exposure in the HRs. Consequently, the highest increase in the gene expression level (2.77-fold compared to the untreated group at the same exposure time) was observed seven days after treatment of HRs with the elicitor.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn this assay, the relative expression levels of two vital genes, \u003cem\u003eCPS\u003c/em\u003e and \u003cem\u003eCYP76AH1\u003c/em\u003e, involved in the biosynthesis pathways of tanshinones, were estimated in Ag\u003csup\u003e+\u003c/sup\u003e ions-elicited \u003cem\u003eS. aristata\u003c/em\u003e HRs using RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). The results indicate that both concentrations of Ag\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e ions induced significant increases in the expression level of gene \u003cem\u003eCPS\u003c/em\u003e for up to three days post-treatment, compared with the control at similar exposure times. The maximum relative gene expression level was estimated to be 15.59-fold higher than that of the control for \u003cem\u003eCPS\u003c/em\u003e in HRs treated for three days with a 25 \u0026micro;M elicitor. Similarly, treatment of HRs with 15 \u0026micro;M of the elicitor for only one day efficiently enhanced transcript levels of \u003cem\u003eCYP76AH1\u003c/em\u003e up to 38.26-fold compared to the control at the same exposure time. It was notable that prolonging the treatment time over one and three days led to statistical decreases in the transcript levels of \u003cem\u003eCYP76AH1\u003c/em\u003e and \u003cem\u003eCPS\u003c/em\u003e, respectively, in HRs after exposure to both concentrations of Ag\u003csup\u003e+\u003c/sup\u003e ions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eHairy root establishment\u003c/h2\u003e \u003cp\u003eThe utilization of fast-growing HRs regenerated from \u003cem\u003eA. rhizogenes\u003c/em\u003e transformation represents an efficient \u003cem\u003ein vitro\u003c/em\u003e culture system to produce significant quantities of plant bioactive metabolites. In our current study, we conducted an original experiment to establish HRs in \u003cem\u003eS. aristata\u003c/em\u003e. Additionally, we investigated the effects of Ag\u003csup\u003e+\u003c/sup\u003e ions on HR growth and the accumulation of phenolic acids and tanshinones, as well as the expression patterns of some principal genes in related biosynthetic pathways. Our findings approve the successful establishment of \u003cem\u003eS. aristata\u003c/em\u003e HRs through\u003c/p\u003e \u003cp\u003ethe \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain-mediated transformation. PCR amplification of the \u003cem\u003erolC\u003c/em\u003e gene fragment confirmed the transformation of HRs by the used strain. In previous research (Yang et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Attaran Dowom et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Wojciechowska et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), leaves and shoot tips of \u003cem\u003eSalvia\u003c/em\u003e species have been the primary explants for transformation. However, our results indicate that wounding at the node sites before infection was a more efficient approach for HR generation (achieving a 47% infection frequency) in \u003cem\u003eS. aristata\u003c/em\u003e. Li et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) documented that infection of leaf explants of \u003cem\u003eSalvia castanea\u003c/em\u003e Diels f. \u003cem\u003etomentosa\u003c/em\u003e Stib., a medicinal plant endemic to China with \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain, led to HR regeneration with frequencies ranging from 3.92 to 8%. Additionally, Khoshsokhan et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) induced HRs in \u003cem\u003eSalvia nemorosa\u003c/em\u003e L. using \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834, A4, R1000, and GM1534 strains. Their results indicated that the maximum transformation efficiency (76%) was related to the ATCC 15834 strain. In a study conducted by Attaran Dowom et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) on \u003cem\u003eSalvia virgata\u003c/em\u003e Jacq., the highest transformation frequency (56%) for HR induction was obtained by infection of leaf explants with \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain.\u003c/p\u003e \u003cp\u003eAmong the developed HR lines, the AT3, generated by the ATCC 15834 strain, was notable for producing the highest biomass (2.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 g) and RA content (5.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e DW) in this species. Our findings are consistent with previously mentioned studies demonstrating successful HR induction using the \u003cem\u003eA. rhizogenes\u003c/em\u003e ATCC 15834 strain in various plant species. However, the effectiveness of \u003cem\u003eA. rhizogenes\u003c/em\u003e strains may vary depending on the specific plant species (Srivastava et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePhenolic acids production and gene expression patterns after elicitation\u003c/h2\u003e \u003cp\u003eElicitation, as a technique, has been widely adopted to improve the content of bioactive compounds in plants. However, as highlighted by Halder et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and Guru et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), the effects of elicitation are multifaceted and influenced by factors such as the type and concentration of elicitor, harvesting time, and the plant species involved. \u003cem\u003eSalvia\u003c/em\u003e species are well known for their rich repertoire of phenolic compounds, including RA and salvianolic acids, and their pharmacological significance provides insights into elicitation strategies for enhancing their synthesis (Krzemińska et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Furthermore, as noted in existing literature, Ag\u003csup\u003e+\u003c/sup\u003e ions have emerged as potent abiotic elicitors, especially in augmenting secondary metabolite production across diverse plant species (Halder et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the current study, we observed a concentration-dependent stimulatory impact of Ag\u003csup\u003e+\u003c/sup\u003e ions on the growth of \u003cem\u003eS. aristata\u003c/em\u003e HRs and significant increases in their biomass after exposure to a 25 \u0026micro;M concentration. Several studies, including those by Xing et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and Li et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), have illustrated the stimulatory effects of Ag\u003csup\u003e+\u003c/sup\u003e ions on biomass and secondary metabolite production and associated gene expression in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. Xing et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported that DW/FW significantly increased on days 1, 2, 6, and 9 after stimulation with Ag\u003csup\u003e+\u003c/sup\u003e in HRs of \u003cem\u003eS. miltiorrhiza.\u003c/em\u003e Consistent with these findings, our study demonstrated the effective influence of Ag\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e ions at a 15 \u0026micro;M concentration in enhancing the synthesis of phenolic acids and tanshinones in \u003cem\u003eS. aristata\u003c/em\u003e HRs. As a result, treating HRs with 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions led to significant increases in the content of RA and Sal-B by 1.43 and 1.28 times, respectively. However, the elicitor had no significant effect on the contents of VA and Sal-A. An increase in the production of phenolic acids in \u003cem\u003eSalvia\u003c/em\u003e species is correlated with the overexpression of regulatory genes, specifically \u003cem\u003ePAL\u003c/em\u003e, \u003cem\u003eTAT\u003c/em\u003e, and \u003cem\u003eRAS\u003c/em\u003e, in the phenylpropanoid pathway following exposure to the elicitors (Xing et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Dowom et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In their study on two Iranian \u003cem\u003eSalvia\u003c/em\u003e species, \u003cem\u003eSalvia officinalis\u003c/em\u003e L. and \u003cem\u003eSalvia verticillata\u003c/em\u003e L., Pesaraklu et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) showed that elicitation of both species with methyl jasmonate and Ag\u003csup\u003e+\u003c/sup\u003e ions led to significantly higher expression of crucial genes (such as \u003cem\u003ePAL, TAT, HPPR\u003c/em\u003e (4-hydroxyphenylpyruvate reductase), \u003cem\u003eRAS\u003c/em\u003e, and \u003cem\u003eCYP98A14\u003c/em\u003e) involved in both the phenylpropanoid and tyrosine pathways, which are responsible for the production of phenolic acids (RA, CA, Sal-A and Sal-B). However, the study found that Ag\u003csup\u003e+\u003c/sup\u003e ions were more effective in enhancing the production of phenolic acids.\u003c/p\u003e \u003cp\u003eThe results of Xing et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) on phenolic acid production in HRs of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e showed that elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions (15 \u0026micro;M) significantly enhanced the expression levels of genes in the biosynthesis pathway of RA. Among these genes, the upstream genes (\u003cem\u003ePAL\u003c/em\u003e, \u003cem\u003eC4H\u003c/em\u003e (cinnamate 4-hydroxylase), \u003cem\u003e4CL\u003c/em\u003e (hydroxycinnamate coenzyme A ligase), \u003cem\u003eTAT\u003c/em\u003e, and \u003cem\u003eHPPR\u003c/em\u003e) were notably upregulated during the earlier stages of exposure, while the downstream genes (\u003cem\u003eRAS\u003c/em\u003e, and \u003cem\u003eCYP98A14\u003c/em\u003e) were more sensitive to Ag\u003csup\u003e+\u003c/sup\u003e ions at later stages. According to the findings of Xing et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), the accumulation of phenolic acids in HR cultures of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e following treatment with methyl jasmonate was significantly correlated with increases in transcript levels of \u003cem\u003ePAL, 4CL, C4H, TAT, HPPR\u003c/em\u003e, and \u003cem\u003eRAS\u003c/em\u003e in a time-course manner. Kwon et al. (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) reported a 5-fold increase in the accumulation of RA in HRs of green basil (\u003cem\u003eOcimum basilicum\u003c/em\u003e L.) compared to natural roots, which was found to be associated with higher transcript levels of \u003cem\u003eTAT\u003c/em\u003e, \u003cem\u003ePAL\u003c/em\u003e, and \u003cem\u003eC4H\u003c/em\u003e. Comparable to the previous studies, our findings indicated that the expression of upstream genes in the phenolic acid production pathways, namely \u003cem\u003ePAL\u003c/em\u003e and \u003cem\u003eTAT\u003c/em\u003e, increased on the first and third days after exposure of HRs to 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions by 35.01- and 11.08-fold of the control, respectively. The up-regulation of these essential genes indicated the involvement of two phenylalanine and tyrosine-derived pathways in phenolic acid production in \u003cem\u003eS. aristata\u003c/em\u003e HRs under the elicitation of Ag\u003csup\u003e+\u003c/sup\u003e ions. Compared with the findings of Xing et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), the results of this investigation revealed that the expression of RAS, one of the downstream genes in the phenolic acids biosynthesis pathway, increased in elicited- HRs after the three initial exposure days, reaching its maximum relative expression level (3.46-fold of the control) on the third day after exposing HRs to 15 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eTanshinone production and gene expression patterns after elicitation\u003c/h2\u003e \u003cp\u003eTanshinones, a class of abietane diterpenes, are predominantly found in certain \u003cem\u003eSalvia\u003c/em\u003e species, with \u003cem\u003eS. miltiorrhiza\u003c/em\u003e roots being well-known as a rich natural source of these metabolites. Tanshinones, including DT-I, T-I, CT, and T-IIA, have been identified as the principal bioactive constituents found in certain \u003cem\u003eSalvia\u003c/em\u003e species and they are attributed to the pharmacological properties exhibited by these plants (Zhang et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Ozyigit et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) reviewed a comprehensive range of biotechnological approaches for producing secondary metabolites in plants. They emphasized the use of HR cultures, citing the production of CT and T-II in \u003cem\u003eSalvia abrotanoides\u003c/em\u003e (Kar.) Sytsma (formerly \u003cem\u003ePerovskia abrotanoides\u003c/em\u003e Kar.). Su et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) developed a novel technique for the one-step induction of high tanshinones production by optimizing parameters associated with \u003cem\u003eA. rhizogenes\u003c/em\u003e transformation in \u003cem\u003eS. miltiorrhiza.\u003c/em\u003e According to their results, the contents of T-IIA and CT significantly increased in transgenic HRs. Li et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) showed a significant increase in T-IIA accumulation (1.80-fold compared with the control) in transgenic HRs of \u003cem\u003eS. castanea\u003c/em\u003e after elicitation with 15\u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions. Ma et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) confirmed the elicitation effects of Ag\u003csup\u003e+\u003c/sup\u003e ions released from silver nanoparticles on tanshinone production by \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HRs. They reported a 1.80-fold increase in tanshinone accumulation compared to the control. In the present work, we observed significant concentration- and time-dependent increases in tanshinone contents of \u003cem\u003eS. aristata\u003c/em\u003e HRs in response to Ag\u003csup\u003e+\u003c/sup\u003e ions elicitation. Specifically, T-I, T-IIA, and CT accumulated 7.78-, 6.47-, and 3.90-fold, respectively, in HRs after exposure to the elicitor.\u003c/p\u003e \u003cp\u003eThe production of tanshinones in \u003cem\u003eSalvia\u003c/em\u003e species could be enhanced by the upregulation of central biosynthetic enzymes, such as CPS, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR), 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS), GGPPS, DXS, CYP76AH3, and CYP76AH1. The activation of these genes leads to the buildup of tanshinones, hence contributing to the therapeutic effects of plants. (Kai et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Xing et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e: Yang et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Deng et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Wei et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Kai et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) demonstrated that overexpression of \u003cem\u003eSmDXS, SmGGPPS\u003c/em\u003e, and \u003cem\u003eSmHMGR\u003c/em\u003e led to enhancement in tanshinones production in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HR lines; additionally, co-expression of \u003cem\u003eSmGGPPS\u003c/em\u003e and \u003cem\u003eSmHMGR\u003c/em\u003e caused a 4.74-fold increase in their tanshinones content compared to control. Inhibitor-mediated changes in the expression and activity of rate-limiting enzymes (HMGR, DXS, and DXR) in HRs of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e indicated that tanshinone synthesis is primarily affected by the mevalonate (MVA) pathway; however, the MEP pathway was more effective on HR growth (Yang et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). According to the findings of Deng et al. (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), overexpression of the transcription factor of \u003cem\u003eSmWRKY2\u003c/em\u003e, known as a positive regulator of \u003cem\u003eSmDXS2\u003c/em\u003e and \u003cem\u003eSmCPS\u003c/em\u003e, was associated with increased tanshinones accumulation in HRs of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. Moreover, the co-overexpression of \u003cem\u003eSmDXR\u003c/em\u003e and \u003cem\u003eSmHMGR\u003c/em\u003e genes in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HRs led to a higher accumulation of tanshinones. The results of Zhou et al. (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) confirmed the pivotal roles of \u003cem\u003eCPS\u003c/em\u003e and \u003cem\u003eCYP76AH1\u003c/em\u003e in the biosynthesis of tanshinones; they showed that the upregulation of these crucial genes occurred concurrently with the increased concentrations of tanshinones in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e roots. In this work, concentration-dependent increases were observed in transcript levels of genes in the tanshinones biosynthesis pathway in response to elicitor. Specifically, the highest transcript level of \u003cem\u003eCPS\u003c/em\u003e (15.59-fold increase compared to control) was recorded in HRs exposed to 25 \u0026micro;M of Ag\u003csup\u003e+\u003c/sup\u003e ions, and the expression of \u003cem\u003eCYP76AH1\u003c/em\u003e reached its maximum level (38.26-fold increase compared to control) after exposure to HRs to 15\u0026micro;M elicitor.\u003c/p\u003e \u003cp\u003eXing et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported that Ag\u003csup\u003e+\u003c/sup\u003e ions, as heavy metal elicitors, could trigger the accumulation of T-I, T-IIA, CT, and DT-I and total tanshinones in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HRs through the induction of crucial genes in their biosynthesis pathway. Their findings also revealed that upstream genes (\u003cem\u003eHMGR\u003c/em\u003e, \u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003eDXR\u003c/em\u003e, and \u003cem\u003eGGPPS\u003c/em\u003e) responded to the elicitor earlier than the downstream genes (\u003cem\u003eCPS\u003c/em\u003e, \u003cem\u003eKSL\u003c/em\u003e, and \u003cem\u003eCYP76AH1\u003c/em\u003e) in the pathway. Yang et al. (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) investigated the changes in tanshinone contents and transcript levels of related genes (\u003cem\u003eDXS2, GGPPS1, CPS1, CYP76AH1\u003c/em\u003e, and \u003cem\u003eCYP76AH3\u003c/em\u003e) in HR cultures of two \u003cem\u003eSalvia\u003c/em\u003e species under elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions. Their findings indicated that exposure to the elicitor was more effective in inducing gene expression and consequently enhanced the accumulation of DT-I, T-I, and T-IIA in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HRs compared to \u003cem\u003eS. castanea\u003c/em\u003e HRs. Wei et al. (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) also observed that the application of Ag\u003csup\u003e+\u003c/sup\u003e ions on transgenic HRs expressing, a key gene in the tanshinone biosynthesis pathway, caused a 2.50-fold increase in total tanshinone content compared to non-transgenic ones.\u003c/p\u003e \u003cp\u003eIn this work, concentration-dependent increases were observed in transcript levels of genes in the tanshinones biosynthesis pathway in response to elicitor. Specifically, the highest transcript level of \u003cem\u003eCPS\u003c/em\u003e (15.59-fold increase compared to control) was recorded in HRs exposed to 25 \u0026micro;M of Ag\u003csup\u003e+\u003c/sup\u003e ions, and the expression of \u003cem\u003eCYP76AH1\u003c/em\u003e reached its maximum level (38.26-fold increase compared to control) after exposure to HRs to 15\u0026micro;M elicitor.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRelease of tanshinones by\u003c/b\u003e \u003cb\u003eS. aristata\u003c/b\u003e \u003cb\u003ehairy roots into culture medium\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLarge-scale production of bioactive substances in HRs depends on the efficient secretion of secondary metabolites into the culture medium. This approach eliminates the need for repetitive plant cultivation and harvesting, reducing time-consuming downstream processing and enabling continuous or intermittent extraction of bioactive compounds (Xu et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Yang et al. (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) investigated the effects of MEP and MVA pathway inhibitors on the production and secretion of tanshinones from \u003cem\u003eS. miltiorrhiza\u003c/em\u003e HRs into the culture medium. Their findings exhibited that the concentration of tanshinones in the medium was generally low, and among the examined ones, HRs released higher amounts of T-IIA. Our results also supported their findings, with the highest value recorded for T-IIA (31.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) in the medium after five days of elicitation of HRs with 25 \u0026micro;M of Ag\u003csup\u003e+\u003c/sup\u003e ions. Additionally, the findings confirmed that Ag\u003csup\u003e+\u003c/sup\u003e ions were potent stimulants, causing the secretion of all three tested tanshinones by \u003cem\u003eS. aristata\u003c/em\u003e HRs into the medium. At a concentration of 25 \u0026micro;M, the elicitor significantly increased the secretion of T-I, T-IIA, and CT in culture media, up to 3.64-, 15.53-, and 23.95- fold of the control, respectively. During the treatment period, it was evident that although the effectiveness of the elicitor was comparable in the accumulation of phenolic acids in \u003cem\u003eS. aristata\u003c/em\u003e HRs at two applied concentrations, Ag\u003csup\u003e+\u003c/sup\u003e ions were more influential on tanshinones production and their secretion into the culture media at 25 \u0026micro;M.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, for the first time, we introduced the successful establishment of HR cultures as an effective method for improving the production of secondary metabolites in \u003cem\u003eS. aristata\u003c/em\u003e. Among the different examined \u003cem\u003eA. rhizogenese\u003c/em\u003e strains, the ATCC 15834 strain was considered the most suitable for HR induction and the production of secondary metabolites, mainly tanshinones. Our findings also underscored that elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions effectively encouraged the growth and production of secondary metabolites in \u003cem\u003eS. aristata\u003c/em\u003e HRs. The stimulatory effects of Ag\u003csup\u003e+\u003c/sup\u003e ions on metabolite production in HRs relied on their used concentration and the harvesting time. Furthermore, our findings showed that elicitation of HRs with Ag\u003csup\u003e+\u003c/sup\u003e ion could enhance the release of tanshinones, especially T-IIA, into the culture medium. Collectively, the findings of this research provide an opportunity for future research on \u003cem\u003eS. aristata\u003c/em\u003e and ascertain the potential of elicitors and transgenic HRs to improve the production of valuable bioactive metabolites in this species as an alternative natural source of phenolic acids and tanshinones.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHR\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Hairy root\u003c/p\u003e\n\u003cp\u003eRA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Rosmarinic acid\u003c/p\u003e\n\u003cp\u003eSal-A\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Salvianolic acid A\u003c/p\u003e\n\u003cp\u003eSal-B\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Salvianolic acid B\u003c/p\u003e\n\u003cp\u003eCA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Caffeic acid\u003c/p\u003e\n\u003cp\u003eVA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Vanillic acid\u003c/p\u003e\n\u003cp\u003eCGA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Chlorogenic acid\u003c/p\u003e\n\u003cp\u003eT-I\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Tanshinone I\u003c/p\u003e\n\u003cp\u003eT-IIA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Tanshinone IIA\u003c/p\u003e\n\u003cp\u003eCT\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Cryptotanshinone\u003c/p\u003e\n\u003cp\u003eDT-I\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Dihydrotanshinone I\u003c/p\u003e\n\u003cp\u003ePAL\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Phenylalanine ammonia-lyase\u003c/p\u003e\n\u003cp\u003eTAT\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Tyrosine aminotransferase\u003c/p\u003e\n\u003cp\u003eDXS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;1-Deoxy-D-xylulose-5-phosphate synthase\u003c/p\u003e\n\u003cp\u003eDXR\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;1-Deoxy-D-xylulose-5-phosphate reductoisomerase\u003c/p\u003e\n\u003cp\u003eMEP\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Methylerythritol 4-phosphate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGGPP\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Geranylgeranyl diphosphate\u003c/p\u003e\n\u003cp\u003eCPS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Copalyl diphosphate synthetase\u003c/p\u003e\n\u003cp\u003eKSL\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Kaurene synthase-like\u003c/p\u003e\n\u003cp\u003eCYP76AH1\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Cytochrome P450 monooxygenases\u003c/p\u003e\n\u003cp\u003eATCC\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;American-type culture collection\u003c/p\u003e\n\u003cp\u003eDW\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Dry weight\u003c/p\u003e\n\u003cp\u003eFW\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Fresh weight\u003c/p\u003e\n\u003cp\u003eHPPR\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;4-Hydroxyphenylpyruvate reductase\u003c/p\u003e\n\u003cp\u003eC4H\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Cinnamate 4-hydroxylase\u003c/p\u003e\n\u003cp\u003e4CL\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Hydroxycinnamate coenzyme A ligase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePCR\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eTPC\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The total phenolic content\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHMGR\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;3-Hydroxy-3-methylglutaryl coenzyme A reductase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMDS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;2-C-Methyl-D-erythritol 2,4-cyclodiphosphate synthase\u003c/p\u003e\n\u003cp\u003eMVA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Mevalonate\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a research grant funded by Shahed University of Tehran for the plant physiology PhD thesis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research paper was accomplished through collaboration among the authors. Raziey Rahchamani conducted the experiments analyses, and interpretation of the data and wrote the manuscript. Tayebeh Radjabian designed and supervised the study; and contributed to the conceptualization, interpretation of data,\u0026nbsp;and participated in the review, and editing. Parvaneh Abrishamchi participated in the revisions of the manuscript.\u0026nbsp;All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e This article does not contain any studies with human participants or animals performed by any of the authors. Any ethical rights have been observed in writing this article, and the scientific contribution of all individuals in this research has been fully clarified and agreed upon by all.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e The data that support the findings of this study are included in the article.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdollahi-Ghehi H, Sonboli A, Ebrahimi, SN, Esmaeili, MA, Mirjalili, MH (2019) Triterpenic acid content and cytotoxicity of some \u003cem\u003eSalvia\u003c/em\u003e species from Iran. Nat Prod Commun 14:1-8. https://doi.org/10.1177/1934578X19842722 \u003c/li\u003e\n\u003cli\u003eAtabaki N, Shaharuddin NA, Ahmad SA, Nulit R, Malik S, Vahedi M, Kalhori N, Abiri R. (2024) Hairy root culture: a reliable bioreactor from transgenic plants. In: Jain A, Malik S (eds) Peptide and protein drug delivery using polysaccharides, Academic Press is an imprint of Elsevier, London, pp 25-50. https://doi.org/10.1016/B978-0-443-18925-8.00013-1\u003c/li\u003e\n\u003cli\u003eAttaran Dowom S, Abrishamchi P, Radjabian T, Salami SA (2022) Elicitor-induced phenolic acids accumulation in \u003cem\u003eSalvia virgata \u003c/em\u003eJacq. hairy root cultures. Plant Cell Tiss Org (PCTOC) 148:107-117. https://doi.org/10.1007/s11240-021-02170-8\u003c/li\u003e\n\u003cli\u003eBayesteh\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e B, Abrishamchi P, Asili J, Zaker A (2021) \u003cem\u003eIn vitro\u003c/em\u003e production of tanshinones in adventitious root cultures of \u003cem\u003ePerovskia abrotanoides\u003c/em\u003e Kar. under Ag\u003csup\u003e+\u003c/sup\u003e ion and yeast extract elicitation. J Plant Res 34:139-151. 20.1001.1.23832592.1400.34.1.11.8\u003c/li\u003e\n\u003cli\u003eBeh\u0026ccedil;et L, Avlamaz D (2009) A new record for Turkey: \u003cem\u003eSalvia aristata\u003c/em\u003e Aucher ex Benth. (Lamiaceae). Turk J Bot 33: 61-63. https://doi.org/10.3906/bot-0808-14\u003c/li\u003e\n\u003cli\u003eBhaskar R, Xavier LSE, Udayakumaran G, Kumar DS, Venkatesh R, Nagella P (2022) Biotic elicitors: A boon for the \u003cem\u003ein-vitro\u003c/em\u003e production of plant secondary metabolites. Plant Cell Tiss Org (PCTOC) 149:7-24. https://doi.org/10.1007/s11240-021-02131-1\u003c/li\u003e\n\u003cli\u003eBisio A, Pedrelli F, D\u0026rsquo;Ambola M, Labanca F, Schito AM, Govaerts R., De Tommasi N, Milella L\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e(2019) Quinone diterpenes from \u003cem\u003eSalvia\u003c/em\u003e species: chemistry, botany, and biological activity. Phytochem. Rev 18:665-842. https://doi.org/10.1007/s11101-019-09633-z\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eCaylak E (2024) Determination of antioxidant and anti-inflammatory properties of \u003cem\u003eSalvia aethiopis\u003c/em\u003e/\u003cem\u003esclarea\u003c/em\u003e and synthesized silver nanoparticles. Ann Med Res 31:169\u0026ndash;176. https://doi.org/10.5455/annalsmedres.2024.01.08\u003c/li\u003e\n\u003cli\u003eDeng C, Hao X, Shi M, Fu R, Wang Y, Zhang Y, Makunga NP, Kai G (2019) Tanshinone production could be increased by the expression of \u003cem\u003eSmWRKY2\u003c/em\u003e in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. J Plant Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e284:1-8. https://doi.org/10.1016/j.plantsci.2019.03.007\u003c/li\u003e\n\u003cli\u003eDowom SA, Abrishamchi P, Radjabian T, Salami S A (2017) Enhanced phenolic acids production in regenerated shoot cultures of \u003cem\u003eSalvia virgata\u003c/em\u003e Jacq. after elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions, methyl jasmonate and yeast extract. Ind Crops Prod\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e103:81-88. https://doi.org/10.1016/j.indcrop.2017.03.043\u003c/li\u003e\n\u003cli\u003eEmadipoor E, Jamzad M, Ghaffari K, Ghadami B, Jamzad Z (2016) Essential oil composition, total phenolic and flavonoid contents, and biological activities of \u003cem\u003eSalvia aristata\u003c/em\u003e Aucher ex Benth. extracts.\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eJ Essent Oil-Bear. Plants\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e19:1426-1434. https://doi.org/10.1080/0972060X.2016.1216333\u003c/li\u003e\n\u003cli\u003eFarshid\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eF, Rashid\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eJ, Reza H (2015) Comparison of essential oil components and antioxidant activity between \u003cem\u003eSalvia syriaca\u003c/em\u003e and \u003cem\u003eSalvia aristata\u003c/em\u003e in their natural habitats in West Azerbaijan province, Iran. J Pharm Pharmacol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e3:400-404. https://doi.org/10.17265/2328-2150/2015.08.006\u003c/li\u003e\n\u003cli\u003eFotovvat M, Radjabian T, Saboora A (2018) HPLC fingerprint of important phenolic compounds in some \u003cem\u003eSalvia\u003c/em\u003e L. species from Iran. Rec Nat Prod\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e13:37-49. http://doi.org/10.25135/rnp.72.18.02.228\u003c/li\u003e\n\u003cli\u003eFu L, Han B, Zhou Y, Ren J, Cao W, Patel G, Kai G, Zhang J (2020) The anticancer properties of tanshinones and the pharmacological effects of their active ingredients. Front Pharmacol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e11:193-211. https://doi.org/10.3389/fphar.2020.00193\u003c/li\u003e\n\u003cli\u003eGantait S, Mukherjee E (2021) Hairy root culture technology: applications, constraints and prospect. Appl Microbiol Biotechnol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e105:35-53. https://doi.org/10.1007/s00253-020-11017-9 \u003c/li\u003e\n\u003cli\u003eGhorbani A, Esmaeilizadeh M (2017) Pharmacological properties of \u003cem\u003eSalvia officinalis\u003c/em\u003e and its components. J Tradit Complement Med\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e7:433-440. https://doi.org/10.1016/j.jtcme.2016.12.014\u003c/li\u003e\n\u003cli\u003eGrzegorczyk-Karolak I, Krzemińska M, Grąbkowska R, Gomulski J, Żekanowski C, Gaweda-Walerych K (2024) Accumulation of polyphenols and associated gene expression in hairy roots of \u003cem\u003eSalvia viridis\u003c/em\u003e exposed to methyl jasmonate. Int J Mol Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e25:764-778. https://doi.org/10.3390/ijms25020764 \u003c/li\u003e\n\u003cli\u003eGuru A, Dwivedi P, Kaur P, Pandey DK (2022) Exploring the role of elicitors in enhancing medicinal values of plants under \u003cem\u003ein vitro\u003c/em\u003e condition. S Afr J Bot\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e149:1029-1043. https://doi.org/10.1016/j.sajb.2021.10.014\u003c/li\u003e\n\u003cli\u003eGutierrez-Valdes N, H\u0026auml;kkinen ST, Lemasson C, Guillet M, Oksman-Caldentey KM, Ritala A, Cardon F (2020) Hairy root cultures\u0026mdash;a versatile tool with multiple applications. Front Plant Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e11:33-44. https://doi.org/10.3389/fpls.2020.00033\u003c/li\u003e\n\u003cli\u003eHalder M, Sarkar S, Jha S (2019) Elicitation: A biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Eng Life Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e19:880-895. https://doi.org/10.1002/elsc.201900058\u003c/li\u003e\n\u003cli\u003eHe G, Chen G, Liu W, Ye D, Liu X, Liang X, Song J (2023) Salvianolic Acid B: A review of pharmacological effects, safety, combination therapy, new dosage forms, and novel drug delivery routes. Pharmaceutics\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e15:2235-2292. https://doi.org/10.3390/pharmaceutics15092235\u003c/li\u003e\n\u003cli\u003eHu Z, Liu X, Tian M, Ma Y, Jin B, Gao W, Cui G, Guo J, Huang L (2021) Recent progress and new perspectives for diterpenoid biosynthesis in medicinal plants. Med Res Rev\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e41:2971-2997. https://doi.org/10.1002/med.21816\u003c/li\u003e\n\u003cli\u003eIngole A, Kadam MP, Dalu AP, Kute SM, Mange PR, Theng VD, Lahane OR, Nikas AP, Kawal YV, Nagrik SU, Patil PA (2021) A review of the pharmacological characteristics of vanillic acid. J Drug Deliv Ther\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e11:200-204. https://doi.org/10.22270/jddt.v11i2-S.4823\u003c/li\u003e\n\u003cli\u003eJiang Z, Gao W, Huang L (2019) Tanshinones, critical pharmacological components in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e. Front Pharmacol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e10:202-216. https://doi.org/10.3389/fphar.2019.00202\u003c/li\u003e\n\u003cli\u003eKai G, Xu H, Zhou C, Liao P, Xiao J, Luo X, You L, Zhang L (2011) Metabolic engineering tanshinone biosynthetic pathway in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy root cultures. Metab Eng\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e13:319-327. https://doi.org/10.1016/j.ymben.2011.02.003\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eKhan S, Qureshi MI, Alam T, Abdin MZ (2007) Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. Afr J Biotechnol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e6:175-179. https://doi.org/10.5897/AJB06.612\u003c/li\u003e\n\u003cli\u003eKhoshsokhan\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eF, Babalar M, Salami SA, Sheikhakbari-Mehr R, Mirjalili MH (2022) Rosmarinic acid production in hairy root cultures of \u003cem\u003eSalvia nemorosa\u003c/em\u003e L. (Lamiaceae). Biocatal Agric Biotechnol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e45:102494. https://doi.org/10.1016/j.bcab.2022.102494\u003c/li\u003e\n\u003cli\u003eKrzemińska M, Owczarek A, Gonciarz W, Chmiela M, Olszewska MA, Grzegorczyk-Karolak I (2022) The antioxidant, cytotoxic and antimicrobial potential of phenolic acids-enriched extract of elicited hairy roots of \u003cem\u003eSalvia bulleyana\u003c/em\u003e. Molecules\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e27:992-1012. https://doi.org/10.3390/molecules27030992\u003c/li\u003e\n\u003cli\u003eKwon DY, Kim YB, Kim JK, Park SU (2021) Production of rosmarinic acid and correlated gene expression in hairy root cultures of green and purple basil (\u003cem\u003eOcimum basilicum \u003c/em\u003eL.). Prep Biochem Biotechnol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e51:35-43. https://doi.org/10.1080/10826068.2020.1789990\u003c/li\u003e\n\u003cli\u003eLai Z, He J, Zhou C, Zhao H, Cui S (2021). Tanshinones: An update in the medicinal chemistry in recent 5 years. Curr Med Chem\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e28:2807-2827. https://doi.org/10.2174/0929867327666200521124850\u003c/li\u003e\n\u003cli\u003eLi B, Wang B, Li H, Peng L, Ru M, Liang Z, Yan X, Zhu Y (2016) Establishment of \u003cem\u003eSalvia castanea\u003c/em\u003e Diels f. \u003cem\u003etomentosa\u003c/em\u003e Stib. hairy root cultures and the promotion of tanshinone accumulation and gene expression with Ag\u003csup\u003e+\u003c/sup\u003e, methyl jasmonate, and yeast extract elicitation. Protoplasma\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e253:87-100.\u003cbr\u003e https://doi.org/10.1007/s00709-015-0790-9\u003c/li\u003e\n\u003cli\u003eMa YJ, Xia J, Wang Y, Wang JW (2020) Stimulation of tanshinone production in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots by \u0026beta;-cyclodextrin-coated silver nanoparticles. Sustain Chem Pharm\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e18:100271-100282. https://doi.org/10.1016/j.scp.2020.100271\u003c/li\u003e\n\u003cli\u003eMarchica A, Cotrozzi L, Detti R., Lorenzini G, Pellegrini E, Petersen M, Nali C (2020) The biosynthesis of phenolic compounds is an integrated defense mechanism to prevent ozone injury in \u003cem\u003eSalvia officinalis\u003c/em\u003e. Antioxidants\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003cbr\u003e 9:1274-1290. https://doi.org/10.3390/antiox9121274\u003c/li\u003e\n\u003cli\u003eMoein F, Jamzad Z, Rahiminejad M (2019a) An integrating study of genetic diversity and ecological niche modelling in \u003cem\u003eSalvia aristata\u003c/em\u003e (Lamiaceae). Acta Bot Hung\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e61:185-204. https://doi.org/10.1556/034.61.2019.1-2.10\u003c/li\u003e\n\u003cli\u003eMoein F, Jamzad Z, Rahiminejad MR (2019b) Current geographical distribution of \u003cem\u003eSalvia aristata\u003c/em\u003e (Lamiaceae), prediction of its future distribution based on climatical data; a guide for its conservation. Iran J\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eBot\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e25:11-21. https://doi.org/10.22092/ijb.2019.119094 \u003c/li\u003e\n\u003cli\u003e\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eMurashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e15:473-497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x \u003c/li\u003e\n\u003cli\u003eOzyigit II, Dogan I, Erdogan A, Kaya Y (2023) Production of secondary metabolites using tissue culture-based biotechnological applications. Front Plant Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e14:1132555. https://doi.org/10.3389/fpls.2023.1132555 \u003c/li\u003e\n\u003cli\u003ePesaraklu A, Radjabian T, Salami SA (2021) Methyl jasmonate and Ag\u003csup\u003e+\u003c/sup\u003e as effective elicitors for enhancement of phenolic acids contents in \u003cem\u003eSalvia officinalis\u003c/em\u003e and \u003cem\u003eSalvia verticillata\u003c/em\u003e, as two traditional medicinal plants. S Afr J Bot\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e141:105-115. https://doi.org/10.1016/j.sajb.2021.04.032\u003c/li\u003e\n\u003cli\u003eRoy A (2021) Hairy root culture an alternative for bioactive compound production from medicinal plants. Curr Pharm Biotechnol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e22:136-149. https://doi.org/10.2174/1389201021666201229110625\u003c/li\u003e\n\u003cli\u003eSezonov G, Joseleau-Petit D, d\u0026apos;Ari R (2007). \u003cem\u003eEscherichia coli\u003c/em\u003e physiology in Luria-Bertani broth. J. Bacteriol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e189: 8746-8749. https://doi.org/10.1128/jb.01368-07\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eShi M, Huang F, Deng C, Wang Y, Kai G (2019) Bioactivities, biosynthesis and biotechnological production of phenolic acids in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e. Crit Rev Food Sci Nutr\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e59:953-964. https://doi.org/10.1080/10408398.2018.1474170\u003c/li\u003e\n\u003cli\u003eSingleton VL, Orthofer R, Lamuela-Ravent\u0026oacute;s RM (1999)\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eAnalysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods Enzymol 299:152-178. https://doi.org/10.1016/S0076-6879(99)99017-1\u003c/li\u003e\n\u003cli\u003eSrivastava M, Singh G, Sharma S, Shukla S, Misra P (2019) Elicitation enhanced the yield of glycyrrhizin and antioxidant activities in hairy root cultures of \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e L. J Plant Growth Regul\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e38:373-384. https://doi.org/10.1007/s00344-018-9847-2\u003c/li\u003e\n\u003cli\u003eSu Y, Song Z, Wang J (2022) One-step regeneration of hairy roots to induce high tanshinone plants in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e. Front Plant Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e13:913985-913995. https://doi.org/10.3389/fpls.2022.913985\u003c/li\u003e\n\u003cli\u003eSudha S, Singh M (2024) Therapeutic significance of tanshinone.. In: Tulsawani R, \u0026lrm; Vohora D (eds) Adaptation under stressful environments through biological adjustments and interventions, Springer Nature, Singapore, pp 185-201. https://doi.org/10.1007/978-981-99-7652-2_13\u003c/li\u003e\n\u003cli\u003eTan Z, Luo M, Yang J, Cheng Y, Huang J, Lu C, Song D, Ye M, Dai M, Gonzalez FJ, Liu A (2016) Chlorogenic acid inhibits cholestatic liver injury induced by \u0026alpha;-naphthylisothiocyanate: involvement of STAT3 and NF\u0026kappa;B signalling regulation. J Pharm Pharmacol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e68:1203-1213. https://doi.org/10.1111/jphp.12592\u003c/li\u003e\n\u003cli\u003eWang J, Xu J, Gong X, Yang M, Zhang C, Li M (2019) Biosynthesis, chemistry, and pharmacology of polyphenols from Chinese \u003cem\u003eSalvia\u003c/em\u003e species: A review. Molecules\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e24:155-178. https://doi.org/10.3390/molecules24010155\u003c/li\u003e\n\u003cli\u003eWang X, Yang Y, Liu X, Gao X (2020) Pharmacological properties of tanshinones, the natural products from \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e. Adv Pharmacol 87:43-70. https://doi.org/10.1016/bs.apha.2019.10.001\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e \u003c/li\u003e\n\u003cli\u003eWang Z, Peters R J (2022) Tanshinones: Leading the way into Lamiaceae labdane-related diterpenoid biosynthesis. Curr Opin Plant Biol 66:102189-102217. https://doi.org/10.1016/j.pbi.2022.102189\u003c/li\u003e\n\u003cli\u003eWei T, Gao Y, Deng K, Zhang L, Yang M, Liu X, Qi C, Wang C, Song W, Zhang Y, Chen C (2019) Enhancement of tanshinone production in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy root cultures by metabolic engineering. Plant Methods\u003cspan dir=\"RTL\"\u003e\u003cbr\u003e \u003c/span\u003e15:1-11. https://doi.org/10.1186/s13007-019-0439-3\u003c/li\u003e\n\u003cli\u003eWojciechowska M, Owczarek A, Kiss AK, Grąbkowska R, Olszewska MA, Grzegorczyk-Karolak I (2020) Establishment of hairy root cultures of \u003cem\u003eSalvia bulleyana\u003c/em\u003e Diels for production of polyphenolic compounds. J Biotech\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e318:10-19. https://doi.org/10.1016/j.jbiotec.2020.05.002\u003c/li\u003e\n\u003cli\u003eXie Y, Liu J, Shi Y, Bin Wang, Wang X, Wang W, Sun M, Xu X, He S (2021) Synthesis and evaluation of new sesamol-based phenolic acid derivatives with hypolipidemic, antioxidant, and hepatoprotective effects. Med Chem Res\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e30:1688-1702. https://doi.org/10.1007/s00044-021-02770-1\u003c/li\u003e\n\u003cli\u003eXing B, Yang D, Guo W, Liang Z, Yan X, Zhu Y, Liu Y (2014) Ag\u003csup\u003e+\u003c/sup\u003e as a more effective elicitor for production of tanshinones than phenolic acids in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. Molecules\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e20:309-324. https://doi.org/10.3390/molecules20010309\u003c/li\u003e\n\u003cli\u003eXing B, Yang D, Liu L, Han R, Sun Y, Liang Z (2018) Phenolic acid production is more effectively enhanced than tanshinone production by methyl jasmonate in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. Plant Cell Tiss Org (PCTOC) 134:119-129. https://doi.org/10.1007/s11240-018-1405-x\u003c/li\u003e\n\u003cli\u003eXu J, Wei K, Zhang G, Lei L, Yang D, Wang W, Han Q, Xia Y, Bi Y, Yang M, Li M (2018) Ethnopharmacology, phytochemistry, and pharmacology of Chinese \u003cem\u003eSalvia\u003c/em\u003e species: A review. J Ethnopharmacol\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e225:18-30. https://doi.org/10.1016/j.jep.2018.06.029\u003c/li\u003e\n\u003cli\u003eXu W, Jin X, Yang M, Xue S, Luo L, Cao X, Zhang C, Qiao S, Zhang C, Li J, Wu J (2021) Primary and secondary metabolites produced in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots by an endophytic fungal elicitor from \u003cem\u003eMucor fragilis\u003c/em\u003e. Plant Physiol Biochem\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e160:404-412. https://doi.org/10.1016/j.plaphy.2021.01.023\u003c/li\u003e\n\u003cli\u003eYang D, Du X, Liang X, Han R, Liang Z, Liu Y, Liu F, Zhao J (2012) Different roles of the mevalonate and methylerythritol phosphate pathways in cell growth and tanshinone production of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. PloS one 7:46797-46806. https://doi.org/10.1371/journal.pone.0046797\u003c/li\u003e\n\u003cli\u003eYang D, Fang Y, Xia P, Zhang X, Liang Z (2018) Diverse responses of tanshinone biosynthesis to biotic and abiotic elicitors in hairy root cultures of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e and \u003cem\u003eSalvia castanea\u003c/em\u003e Diels f. \u003cem\u003etomentosa\u003c/em\u003e. Gene\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e643:61-67. https://doi.org/10.1016/j.gene.2017.11.067 \u003c/li\u003e\n\u003cli\u003eYang L, Ding G, Lin H, Cheng H, Kong Y, Wei Y, Fang X, Liu R, Wang L, Chen X, Yang C (2013) Transcriptome analysis of medicinal plant \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e and identification of genes related to tanshinone biosynthesis. PLoS One\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e8:80464-80477. https://doi.org/10.1371/annotation/fd65b655-d35b-47d1-8793-07da2273c144\u003c/li\u003e\n\u003cli\u003eZhang Y, Jiang P, Ye M, Kim SH, Jiang C, L\u0026uuml; J (2012) Tanshinones: sources, pharmacokinetics and anti-cancer activities. Int J Mol Sci\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e13:13621-13666. https://doi.org/10.3390/ijms131013621\u003c/li\u003e\n\u003cli\u003eZhou Y, Feng J, Li Q, Huang D, Chen X, Du Z, Lv Z, Xiao Y, Han Y, Chen J, Chen W (2020) Sm MYC2b enhances tanshinone accumulation in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e by activating pathway genes and promoting lateral root development. Front Plant Sci 11:559438-559450. https://doi.org/10.3389/fpls.2020.559438\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Salvia aristata Aucher ex Benth., Hairy root culture, Ag+ ions, Phenolic acids, Tanshinones, Gene expression","lastPublishedDoi":"10.21203/rs.3.rs-4303897/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4303897/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eSalvia aristata\u003c/em\u003e Aucher ex Benth., due to containing tanshinones and phenolic acids, two main groups of bioactive metabolites, is one of the most valuable medicinal plant species in Iran. In this study, for the first time, hairy root (HR) cultures were established from 14-day-old seedlings inoculated with \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e strain ATCC 15834. Additionally, the effects of elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions (15 and 25 \u0026micro;M) were investigated on the growth indices and content of phenolic acids and tanshinones of HRs in a time-course experiment. The findings of this work showed that exposure of HRs to Ag\u003csup\u003e+\u003c/sup\u003e at both concentrations caused significant increases in the levels of rosmarinic acid (1.34- to 1.43-fold of control) and salvianolic acid B (1.71- to 1.82-fold of control). Specifically, 7.25-, 7.78-, 6.47-, and 3.9-fold increases were attained in total tanshinone, tanshinone I, tanshinone II-A, and cryptotanshinone contents of HRs, respectively, after seven days of exposure to 25 \u0026micro;M Ag\u003csup\u003e+\u003c/sup\u003e ions compared to the control groups. The analysis revealed that exposure to Ag\u003csup\u003e+\u003c/sup\u003e ions significantly enhanced the secretion of tanshinones, notably tanshinone II-A (31.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) by HRs into the culture medium. The changes in transcript levels of crucial genes in the biosynthesis pathways of phenolic acids (\u003cem\u003ePAL\u003c/em\u003e, \u003cem\u003eTAT\u003c/em\u003e, and \u003cem\u003eRAS\u003c/em\u003e) and tanshinones (\u003cem\u003eCPS\u003c/em\u003e and \u003cem\u003eCYP76AH1\u003c/em\u003e) were associated with their contents in HRs under elicitation with Ag\u003csup\u003e+\u003c/sup\u003e ions. Our findings confirmed the effectiveness of an elicitation strategy to improve metabolite production in HR cultures of \u003cem\u003eS. aristata\u003c/em\u003e as potent natural sources of phenolic acids and tanshinones.\u003c/p\u003e","manuscriptTitle":"Ag+ ions are effective elicitors for enhancing the production of phenolic acids and tanshinones in Salvia aristata Aucher ex Benth. hairy roots","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-10 07:25:54","doi":"10.21203/rs.3.rs-4303897/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-05-28T00:10:22+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-27T19:43:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-27T12:58:05+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell, Tissue and Organ Culture (PCTOC)","date":"2024-04-24T15:45:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6cb03f33-2809-4e6d-a399-5daf3605c85d","owner":[],"postedDate":"June 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-22T19:35:45+00:00","versionOfRecord":{"articleIdentity":"rs-4303897","link":"https://doi.org/10.1007/s11240-024-02844-z","journal":{"identity":"plant-cell-tissue-and-organ-culture-pctoc","isVorOnly":false,"title":"Plant Cell, Tissue and Organ Culture (PCTOC)"},"publishedOn":"2024-08-17 15:57:45","publishedOnDateReadable":"August 17th, 2024"},"versionCreatedAt":"2024-06-10 07:25:54","video":"","vorDoi":"10.1007/s11240-024-02844-z","vorDoiUrl":"https://doi.org/10.1007/s11240-024-02844-z","workflowStages":[]},"version":"v1","identity":"rs-4303897","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4303897","identity":"rs-4303897","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}