The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of streptozotocin- induced diabetic male rats

The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of streptozotocin- induced diabetic male rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of streptozotocin- induced diabetic male rats Mehdi Soltani Ichi, Fatemeh Shabkhiz, Mohammadreza Kordi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4492446/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background/objectives: MicroRNAs have been reported as potentially useful biomarkers for various diseases, including diabetes, heart diseases, and neurological diseases. The aim of this study was to assess whether microRNA-146a and its inflammatory mediator (TNF-a) and microRNA-29c may be changed in the hippocampus of streptozotocin-induced diabetic rats, after a period of high – intensity interval training. Methods Twenty-four male Wistar rats (180 ± 10 g, 8–10 weeks age) were assigned to 4 groups: control (C), diabetes (D-1w), diabetes (D-6w), and diabetes high-intensity interval training (DHIIT). Diabetes induced by the single-dose injection of streptozotocin (STZ; 55 mg/kg dissolved in 0.1 M of citrate buffer; pH 4.5; i.p.) in 12-h fasted and blood sugar higher than 250 was considered diabetic. The effects of six weeks of HIIT on hippocampus microRNA-146a, microRNA-29c, as well as evaluation of tumor necrosis factor-alpha (TNF-α ) in serum were evaluated using Real-Time PCR and ELISA techniques respectively. Results The results indicated a reduction in expression of miR-146a and an increase in expression of microRNA-29c genes in the hippocampus of diabetic rats compared to control. Also TNFα increased in the D groups in comparison with C group. However, HIIT training in DHIIT significantly decreased the microRNA-29c and TNFα and increased microRNA-146a expression in comparison of D-6w group. Conclusion Our results implied that increased hyperglycemia and inflammation status were associated with brain impairment in DM rats, which were negatively correlated with miR-146a and microRNA-29c expression. It seems that HIIT training improves hypoglycemic and inflammatory conditions in diabetic rats. HIIT Hippocampus mir-29c miR-146a TNFα Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction diabetes mellitus (DM) is one of the most common endocrine disorders, which has already gained high public attention in the past few decades. Diabetes causes disorders in the central nervous system. Impaired glucose tolerance, insulin resistance, and hyperinsulinemia all cause negative effects on memory that are associated with hippocampal atrophy ]1,2[ .Recently, dysfunction of the brain induced by DM has emerged as a new concern, which mainly refers to a variety of neurological abnormalities, including decline in cognition, attention, memory, and psychomotor deficits caused by chronic hyperglycemia in the brain ]3[. Particularly, mild cognitive decline caused by diabetes mellitus has been recently highlighted as an early manifestation, a preclinical transitional state from normal cognition to dementia ]4[. The exact mechanism underlying cognitive impairment in diabetes is complex; however, impaired glucose metabolism and abnormal insulin function are often associated with cognitive impairment. Studies have shown that hyperglycemia leads to hypertension, dyslipidemia, inflammation, and abnormalities in hypothalamic-pituitary-adrenocortical axis ]5,6[. Moreover, chronic hyperglycemia is toxic to neurons and leads to the formation of advanced glycation end products leading to oxidative damage and neuronal injury. Inflammation and dyslipidemia are the other important factors that can cause neuronal damage leading to cognitive impairment ]7 [. These pathological processes may cause irreversible structural damages of brain, like disruption of white matter integrity and cerebral atrophy, thus contributing to cerebral dysfunction ]8,9,10[. Among these complicated pathogenesis, Hyperglycemia and inflammation were most researched and recognized for cerebral damage in diabetes ]11,12[. Hyperglycemia may activate the Toll-like receptors (TLRs), a family of pattern recognition receptors responsible for triggering the downstream inflammatory cascade ]13[, thus causing neuronal lesions in the brain of chronic DM. It has been shown that hyperglycemic conditions can strongly affect brain function. On the other hand, hypoglycemic shock induced by diabetes can lead to the central nervous system (CNS) dysfunction and brain cell death ]14[. Glucose is the primary source of metabolic energy for the CNS and it goes across the plasma membrane of neurons with the help of glucose transporters (GLUTs) ]15,16[. GLUTs are widely distributed in the CNS, especially in the hippocampus, and play a vital role in brain glucose homeostasis ]17,18[. MicroRNAs (miRNAs) are small non-coding single-stranded RNAs, with approximately 22 nucleotides, that act in mechanisms of post-transcriptional regulation of gene expression. It has recently been reported miRNAs play an essential role in various pathological processes like insulin resistance, inflammation, immunity, oxidative stress, carcinogenesis and could help to reach an early diagnosis of DM ]19,20–23. [ Recently, increasing studies suggested that miR-146a played a vital role in inflammatory process in various disorders including diabetes ]24,25,26[. In addition, miR-146a was reported to exert anti-inflammatory effect in the pathogenesis of various diabetic complications like diabetic nephropathy, retinopathy, neuropathy, cardiovascular disorders, even tending to be a potential biomarker of inflammatory status in these diseases ]27,28,29[. Moreover, it was demonstrated that the expression of miR-146a was down-regulated in hippocampal tissues of diabetic rats ]30[ as well as in the serum of T2DM patients, which may serve as a biomarker of the chronic inflammatory condition ]31[. In fact, it has been uncovered that miR-146a could suppress the expressions of the NF-kB-mediated inflammatory mediators like COX-2, TNF-a, IL-6 and IL-1b by targeting the 30-UTR of IRAK1 and TRAF6 mRNA, which are the downstream adaptors of TLRs]32 [. Some studies have demonstrated that tumor necrosis factor-alpha (TNF-α) is one of the important pro-inflammatory mediators in insulin resistance and β-cell damage ]33[. The pro-inflammatory cytokine TNF-α is an important molecule in the development of insulin resistance and type 2 diabetes. Furthermore, in healthy individuals, TNF-α inhibits peripheral insulin stimulated glucose uptake by disrupting the phosphorylation of the substrate Akt 160, which is a key step in the canonical regulation of insulin signaling and the glucose transporter type 4 cascade and canonical insulin signaling transduction. It prevents the absorption of glucose and signal transmission by insulin in the whole body ]34 [. Also, Studies have highlighted the role of the microRNA-29 (miR-29) family in glucose homeostasis ]35 [. miR-29 family with three mature members of miR-29a, miR-29b, and miR-29c is a sensitive microRNA family to insulin deficiency and hyperglycemia ]36,37[. Studies in diabetic patients and animal models revealed that the expression of miR-29 family is increased in different tissues, including liver, pancreas, kidney, skeletal muscle, adipose tissue, and brain ] 38– 45[. It is well known that miR- 29 family negatively regulates the expression of GLUTs and IGF-1 in diabetic conditions ]37,46– 49[. Collectively, miR-29 family members can be considered as early markers of DM ]50[. To prevent the harmful effects of diabetes on different parts of the body, experts use different treatment methods such as nutritional therapy, pharmacotherapy and insulin injection. Recent studies have shown that sports activity as a non-pharmacological treatment in the brain tissue and hippocampus of diabetic rats prevents the reduction of cognitive level. Studies have shown that high intensity intermittent training increases the oxidation capacity, changes in carbohydrate metabolism, increases GLUT4 enzymes and resting glycogen content, and increases the number of GLUT4 as a factor in glycolysis ]51[. In recent years, research interest has been increased in the field of aspects related to the body’s response to exercise, in which miRNAs appear to play a key role. Some new studies have recently revealed that exercise can modulate the expression of some miRNAs in certain tissues including the skeletal muscle ]52[, heart ]53[, and neutrophils ]54[. In this regard, research shows an increase in the expression of miR-146a ]55,56,57[ and a decrease in the expression of MiRNA-29c ]47,58[ in diabetic human and animal samples following exercise. In addition, A meta-analysis study showed that HIIT improves level of serum TNF-α and the result shows that HIIT may be an effective and time-efficient intervention to reduce low-grade inflammation in metabolic diseases such as diabetes ]59[. Therefore, it is possible that exercise especially HIIT may cause an adjustment in miRNAs and pro-inflammatory mediators expression changes in the diabetic hippocampus and finally prevent cerebral dysfunction. To assess this hypothesis, we surveyed the expression of miR-146a, miR-29c, and TNF-α in the hippocampus of diabetic rats following HIIT. Materials and Methods Animals 24 adult-male Wistar rats (6–8 W) weighing between 180 ± 10 g were obtained from the Pasteur Institute, Tehran, Iran. The animals were maintained at room temperature (22–25°C) with 12:12h light-dark cycles and, free access to food and water, and resettled as three animals to a cage. The study protocol was designed in accordance with NIH guidelines and the guidelines of the Ethics committee for the use of animals in research at Tehran University (Ethic Approved Code IR.UT.SPORT.REC.1402.057). The animals were allocated randomly into four groups containing 6 rats, including Normal Control (N), one week Diabetic (1W), six week Diabetic (6W) and diabetes high intensity interval training (Dia-Exe) groups. Induction of Diabete The Diabetic groups were induced by intraperitoneal (IP) injection single-dose of Streptozotocin (SIGMA Company) 55 mg/kg of animals body weight (dissolved in 0.1 M of citrate buffer; pH 4.5; i.p.) in 12-h fasted rats. Non-diabetic animals were also injected with a volume equivalent of citrate buffer ]2, 60,61 [ .After 72 hours, blood was collected from the tail vein and blood glucose levels were measured using glucometer (Easy Gluco, Infopia, South Korea). Diabetes mellitus was defined as fasting blood glucose > 250 mg/dl. Blood glucose concentrations and body weight of all rats was also measured weekly. Animals failing this criterion were excluded from the experiment ]62[ .There was no mortality due to good maintenance. Exercise protocol Before starting the formal 6 weeks HIIT training protocol, animals were familiarized to treadmill running. HIIT training protocol including HIIT program included 3 sessions of 40 minutes per week,running on the rodent treadmill (Danesh Salar Iranian company) at a speed equal to 70–110% of the maximum oxygen consumption was performed for 6 weeks. In general, during six weeks, the animals performed 6–10 1-minute repetitions with 2-minute active rest intervals (Vo2max 45–50%). This protocol was designed based on the changed and modified study of previous studies] 63–65 [ .All training sessions were accompanied by 5 minutes of warming up and 5 minutes of cooling down at a Vo2max 45–50%. Moderate electrical shock was used for motivating the animals to run. Control groups were placed on a turned-off treadmill for 10–15 min / day for 3 days a week. blood sample and Tissue collection After 24 hours of the last session of training, all rats were injected with ketamine 10% (75 mg/kg), and xylozine 2% (5 mg/kg) to anesthetize ]2[ .Adequate blood samples were collected directly from the left ventricle of rats. The animals’ hippocampus were immediately removed and hippocampus and serum samples were snap-frozen in the liquid nitrogen and then stored at a freezer (-80°C). Measurement of blood sugar, Plasma insulin and insulin resistance The serum glucose level was measured by an enzymatic method (Pars Azmoun kit, Tehran, Iran) with an autoanalyzer (A-classic -AT plus, Alpha Classic, IRAN). The serum concentration of insulin was also measured by ELISA method and using a human insulin kit (E-D-2101, Monobind, Usa ). The insulin resistance index was calculated using the following equation ]66[; HOMA-IR= (glucose in mmol/L x insulin in mIU/mL) / 22.5RNA extraction and real-time PCR RNA extraction and real-time PCR In this study mRNA and miRNA expressions in hippocampal tissue performed by real-time PCR .Total RNA (microRNA) was extracted from the hippocampal tissues using a QIAzol Lysis Reagent (Qiagen, Usa). RNA content and purity were evaluated with Nanodrop 2000 Vis spectrophotometer (Thermo Scientific, USA) based on the relative absorbance ratio at A260/ A280 and A260/A230 ratios. The samples were utilized in a concentration of 522 ng/µl. The cDNA synthesis kit (Hyper Script RT premix with Random hexamer- Gene All، South Korea ) were used for determination expression of miR-29c gene. Stem loop RT primer method was used for the synthesis of cDNA from the target microRNAs. For cDNA synthesis, 4 to 6 nucleotides complementary to the 3' end of the desired microRNA were added to the 3' end of the sequence. Each cDNA was used as a template for real-time PCR assay using the SYBR Green master mix (Ampliqon, Denmark). Real-time PCR were performed on a Rotor-Gene Q cycler (Qiagen, Usa). The PCR reaction was performed using 2 µl of cDNA, 5 µl of SYBR Green PCR master mix and 1 µl of primer mixture in a final reaction volume of 10 µl. The relative amount of mRNA and miRNA for each target gene was calculated based on its threshold cycle (Ct) compared to the Ct of the house-keeping (reference) gene (U6 and mir29c, mir146a). The relative quantification was performed by 2-ΔΔ Ct method. The specificity of the PCR reactions was verified by generation of a melting curve analysis. The sequence of primers used in Real-Time PCR steps is presented in Table 1 . Table 1 Reverse And Forward primer sequence of miR-29c and mir146a genes for Real-time PCR reaction U6 Forward CTCGCTTCGGCAGCACATATACT Reverse ACGCTTCACGAATTTGCGTGTC Stem loop CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGACnnnnnnnn Mir-29c Forward GTGATTAGCACCATGTGA Reverse AACTGGTGTCGTGGAGTC mir146a Forward GTGATGAGAACTGAATTC Reverse AACTGGTGTCGTGGAGTC TNFα analysis blood was conducted to determine TNF analysis with ELISA laboratory method. We used a commercial kit (KPG-HTNF-a, Iran) with a sensitivity of less than 4 pg/ml and TNF Intra-assay CVs were 3%. Data analysis Results are expressed as mean ± SD. Statistical analysis was performed using SPSS software (version 16). Tukey's post hoc test and MANOVA with significance level (P ≤ 0.05) were used to determine significance. GraphPad Prism software was used to draw figures and graphs. Results blood glucose, plasma insulin The results of the ANOVA test showed a significant difference between the studied groups (p < 0.002). the results of Tukey's post hoc test showed a significant increase in blood glucose (P < 0.001, P < 0.001, P < 0.002) and plasma insulin levels (P < 0.044, P < 0.001) in the Diabetic groups compared to the Control group and also a significant decrease in blood glucose (P < 0.001) and plasma insulin levels (P < 0.0016) in the Dia-Exe group compared to the Dia (6W) group (Fig. 1 ). Insulin Resistance Index (HOMA-IR) The results of the ANOVA test showed a significant difference between the studied groups (p < 0.001). the results of Tukey's post hoc test showed a significant increase in Insulin Resistance Index (P < 0.003, P < 0.001, P < 0.078) in the Diabetic groups compared to the Control group and a significant decrease in Insulin Resistance Index (P < 0.001) in the Dia-Exe group compared to the Dia (6W) group (Fig. 2 ). Expressions of miR-146a and miR-29c genes The results of the ANOVA test showed a significant difference between the studied groups (p < 0.001). results of Tukey's post hoc test showed a Down-regulation of miR-146a (p < 0.001) ) in the Diabetic groups compared to the Control group and a significant increase in the expression of miR-146a in the Dia-Exe group compared to the Dia (6W) group (p < 0.001) (Fig. 3 )(a). In addition a Up-regulation of miR-29c in the Dia (6W) and Dia-Exe group compared with the Control group (p < 0.000, p < 0.012). Meanwhile, HIIT decreased the expression of miR-29c in the Dia-Exe group compared to the Dia (6W) group (p < 0.086) (Fig. 3 ) (b) . TNF-α Levels the results showed a significant difference between the studied groups (p < 0.002). results of Tukey's post hoc test showed a significant increase in the TNF-α Levels in diabetic groups (P < 0.085, P < 0.001. P < 0.028 ) compared with the Control group. Moreover, TNF-α were decreased significantly in the Dia + Exe group compare to Dia (6W) group (P < 0.076) (Fig. 4 ). Discussion 6 weeks of HIIT decreased blood sugar, insulin resistance (HOMA-IR index) and insulin levels in Diab + Exe group rats. In previous studies ]2, 67, 68[, a decrease in blood sugar and insulin resistance following exercise was reported that the results of the present research are in line with the results of the mentioned research. Insulin resistance is defined as an inadequate response in insulin-sensitive tissues (liver, skeletal muscle, and adipose tissue) to circulating levels of insulin. Also, a decrease in the number of insulin receptor proteins leads to insulin resistance. Inflammatory mediators through Increased production of cytokines and fatty acids or lipotoxin activates inflammatory pathways in immune and metabolic cells. Activation of inflammatory pathways interferes with insulin signaling and results in insulin resistance ] 69[. Physical activity increases the function and signaling of insulin, increases glucose transporters from the inside to the cell membrane, increases the rate of glucose uptake, increases capillary density, increases the expression of genes or the activity of different proteins involved in insulin signaling, increases the activity of glycogen synthetase, and finally increases Glycogen storage affects glucose homeostasis and increases insulin sensitivity ]70[. Regarding the intensity of exercise and its effects on insulin sensitivity, the results of studies have shown that high intensity exercise has a greater effect on insulin sensitivity and improving type 2 diabetes. Probably, most environmental adaptations following the HIIT program are related to enzyme changes in muscle cells, according to which the molecular mechanism and enzymatic adaptations are attributed to the activation of a protein called adenosine monophosphate-activating protein kinase (AMPK)]71[. This protein is one of the possible mechanisms to increase the entry of glucose into cells, especially muscle cells during HIIT program, which increases insulin sensitivity. In addition, studies have shown that the increase in insulin sensitivity following intense periodic activities is due to the increase in the expression of the PGC-1α gene and the expression level of the AdipoR1 (Adiponectin receptor 1) gene]72,73[. Results of this study indicate a significant decrease in miR-146a genes in the hippocampus of Stz-Induced control rats compared with the control group. Our data are in line with data of Feng et al. (2011), Balasubramanyam et al. ( 2011 ),.Shamshadi et al.(2022) and Habibi et al. (2016) who have shown the declination in miRNA-146a expression in cardiac, retina, peripheral mononuclear, Hippocampus and renal cells of diabetic patients, which led to the development of diabetes]24,30.67,70[.As a regulative factor, miR-146a is induced by Toll-like receptors (TLRs), which depends on NF-KB. Two important adapter molecules, named TRAF6 and IRAK1, participate in the TLR signaling pathway which is known as direct target for miR-146a ]74[. In the present study, it is observed that diabetes decreases miR-146a expression gene; therefore, it is possible to conclude that negative effects are applied to miR-146a due to the dominance of proinflammatory and inflammatory factors like NF-KB, TRAF6, and IRAK1 in hippocampal tissues, which consequently reduces miR-146a. On the other hand, Tukey's post hoc test results showed a significant increase in the expression of miR-146a in hippocampal tissues in the Diab + Exe group compared to Dia (6W) group. Our data are in line with data of Improta et al.(2018), Kangas et al.(2017), Shamshadi et al.(2023) and Sarraf-S et al. (2021)]2,58,75,76[. mir146a acts as an important regulatory molecule in immune responses and autoimmune diseases. mir146a activates the receptor (TLR-thol-like 4) in the signaling pathway dependent on NF-KB and leads to the reduction of interleukin-1 receptor-dependent kinase (IRAK- 1) and the factor associated with the nuclear transcription factor receptor (TRAF-6). In fact, activated NF-κB induces the transcription of mir146a, and as a result, the expression of TRAF-6 and IRAK-1 is inhibited and the TLR signaling pathway is inhibited ]77[. mir146a plays an important regulatory role in innate immunity, inflammatory responses, viral infections and some malignancies. mir146a is introduced as an anti-inflammatory mirNA that is activated by cytokines such as IL-1ß, TNF-a and the NF-κB pathway and by suppressing the components of the NF-κB pathway (IRAK1 and TRAF6) and as a result suppressing the expression of IL-8, IL- 6 and TNF-α affects the reduction of inflammation ]78[. Although these indicators were not investigated in the present study, the increase in the expression of this gene may be considered as a result of a decrease in the activity of the upstream pathways and a decrease in the possible release of inflammatory cytokines. Another result of this research was the increase in the expression of miR-29c in diabetic groups. In diabetic rodent models and humans, an increase in miR-29 family miRNAs is reported in different tissues including liver, pancreas, kidney, skeletal muscle, adipose tissue, and brain ]39–44 [. In this regard, Dini et al. ( 2021 ) showed that the expression of miR-29c in the hippocampus of mice with type 2 diabetes is higher than in mice with normal insulin sensitivity ]79[. Both hyperglycemia and proinflammatory cytokines, the hallmarks of diabetes mellitus, upregulate the expression of miR-29 family miRNAs ]80,81,82[. Increasing the expression of miR-29c decreases the expression of Glut4 and Glut1 receptors. Also, the expression of this microRNA reduces the expression of hexokinase2 (HK2), the limiting enzyme of glycolysis. Meanwhile, overexpression of miR-29 downregulates the mRNA expression of IRS1, PIK3R3, and AKT2, also confirming the role of miR-29c as a modulator of insulin signaling and glucose metabolism ]48[. In contrast, 6 weeks of HIIT training decreased the expression of miR-29c in the hippocampal tissue of Diab + Exe group rats compared to Dia (6W) group. Other studies also reported the effect of sports activity on the reduction of miR-29c expression in diabetic and healthy human and animal samples. ]48,83,84 [. Regarding the miR-29c that were altered by regular physical training in the present study, Dahlmans et al. ( 2017 ) have shown a negative correlation between skeletal muscle miRNA-29b/miRNA-29c and peripheral insulin sensitivity in human study participants (involving T2DM patients, non-diabetic obese and lean subjects, athletes)]83[. Furthermore, Dooley et al. ( 2016 ) ] 46[ demonstrated that miRNA-29c-deficient mice were protected against the onset of diet-induced insulin resistance. Glucose metabolism and insulin action are regulated by miRNAs in several tissues, including liver, adipose and skeletal muscle]85[.It is well studied that majority of glucose absorption in the hippocampus is mediated through GLUT1 which is expressed in microvessels, as well as GLUT2 and GLUT3 that are highly expressed in pyramidal cells located in the CA3 and dentate gyrus ]17,86,87[. In addition, GLUT4 is an insulin-sensitive glucose transporter and exhibits overlapping distributions with the insulin receptor and IGF-1 receptor in the hippocampus of the rodent brain ]88 [. 6 weeks of HIIT decreased the serum TNF-α levels in STZ-induced diabetic + Exe group rats compared to Dia (6W) group rats. Our data are in line with data of Khaledi et al ( 2023 ), Salimi Avansar (2017), Dünnwald et al (2019) and Davoudi et al (2023( ]63,89,90,91[.exercise is an effective intervention to improve the condition of chronic inflammation, however, the effects of exercise can depend on its type and intensity. Previous meta-analysis studies have provided conflicting results of the effects of exercise training on the inflammatory cytokines IL-6 and TNF-α. The increase in circulating levels of the inflammatory cytokine TNF-α is associated with an increase in the risk of developing type 2 diabetes, which can be due to the development of insulin resistance due to the effects of adipose tissue secretion, especially visceral fat, macrophages, adipose tissue ]92[. Conclusion Our findings indicate that Upregulation of miR-29c and down-regulation mir146a in the hippocampal tissue of Stz - induced diabetic rats leads to Hyperglycemia and inflammation and finally disorders in the central nervous system .Conversely, downregulation of miR-29c and Upregulation of mir146a following HIIT may improve the situation and prevention from negative effects on memory that are associated with hippocampal atrophy in aging. Abbreviations HIIT High-intensity interval training Declarations Acknowledgments This article is derived from PhD dissertation of Mehdi Soltani Ichi, entitled “The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of diabetic male rats”. Author’s contributions Mehdi Soltani Ichi designed the project. Ethical Approval The study protocol was designed in accordance with NIH guidelines and the guidelines of the Ethics committee for the use of animals in research at Tehran University (Ethic Approved Code IR.UT.SPORT.REC.1402.057). Funding This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. Availability of data and materials The data that support the findings of this study are available from the corresponding author upon reasonable request. Conflict of Interest The authors declare that they have no conflict of interest. References Sims-Robinson C, et al. The role of oxidized cholesterol in diabetes-induced lysosomal dysfunction in the brain. Mol Neurobiol. 2016;53:2287–96. Shamshadi B, et al. Investigation of an Increase in the Expression of the Mir146a Gene in The Hippocampus and a Decrease in the Levels of Blood Sugar, Insulin, and Insulin Resistance in Elderly Diabetic Rats after a Period of High-Intensity Interval Training. NK Univ Med Sci. 2023;14(4):75–86. Wang Z et al. Endoplasmic reticulum stress-induced neuronal inflammatory response and apoptosis likely plays a key role in the development of diabetic encephalopathy. Oncotarget. 2016; 78455–72. Ma F, et al. Conversion of mild cognitive impairment to dementia among subjects with diabetes: a population-based study of incidence and risk factors with five years of follow-up. J Alzheimers Dis. 2015;43:1441–9. Rama MR, Sagar GR. Association of Cognitive Impairment and Type 2 Diabetes Mellitus. A Case-Control Study; 2019. Hazari MAH, et al. Cognitive impairment in type 2 diabetes mellitus. Int J Diabetes Mellitus. 2015;3(1):19–24. Naguib R et al. Cognitive impairment among patients with diabetes in Saudi Arabia: a cross-sectional study. Middle East Curr Psychiatry. 2020;27(1). Takeda S, Sato N et al. Diabetes-accelerated memory dysfunction via cerebrovascular inflammation and Abeta deposition in an Alzheimer mouse model with diabetes. Proc. Natl. Acad. Sci. U.S.A. 2010; 107, 7036–7041. Wang B, et al. Inflammatory macrophages promotes development of diabetic encephalopathy. Cell Physiol Biochem. 2015;36:1142–50. Yin Z, et al. Asiaticoside attenuates diabetes-induced cognition deficits by regulating PI3K/Akt/NF- kB pathway. Behav Brain Res. 2015;292:288–99. Moghaddam HK, Baluchnejad m, et al. Berberine ameliorate oxidative stress and astrogliosis in the hippocampus of STZ-induced diabetic rats. Mol Neurobiol. 2014;49:820–6. Verdile G, Keane KN et al. Inflammation and oxidative stress: the molecular connectivity between insulin resistance, obesity, and Alzheimer’s disease. Mediators Inflamm. 2015; 2015:105828. Rajamani U, Jialal I. Hyperglycemia induces Toll-like receptor-2 and – 4 expression and activity in human microvascular retinal endothelial cells: implications for diabetic retinopathy. J. Diabetes Res. 2014; 2014:790902. Cryer PE. Hypoglycemia, functional brain failure, and brain death. J Clin Investig. 2007;117:868870. Bronisz A, Ozorowski M, Hagner DM. Pregnancy ketonemia and development of the fetal central nervous system. Int J Endocrinol 2018; (4):1–7. Leão LL, et al. Does hyperglycemia downregulate glucose transporters in the brain? Med Hypotheses. 2020;139(2):109614. Reznikov LR, Reagan L. Expression and Functional Activities of Glucose Transporters in the Central Nervous System. In book: Handbook of Neurochemistry and Molecular Neurobiology. 2007; (pp.387–404). Sayem ASM, et al. Action of phytochemicals on insulin signaling pathways accelerating glucose transporter (GLUT4) protein translocation. Molecules. 2018;23(2):258. Kantharidis P, et al. Diabetes complications: the microRNA perspective. Diabetes Metab Res Rev. 2011;60:1832–7. Kantharidis P, Wang B, Carew RM, Lan HY. Diabetes complications: the microRNA perspective. Diabetes Metab. 2011;60(7):1832–7. Stepien EL, Durak-Kozica M, Kami´ A, Targosz-Korecka M, Libera M, Tylko G, Opali´ A, Kapusta M, Solnica B, Georgescu A, et al. Circulating ectosomes: Determination of angiogenic microRNAs in type 2 diabetes. Theranostics. 2018;8(14):3874–90. Tang X, Tang G, Özcan S. Role of microRNAs in diabetes. Biochim Biophys Acta. 2008;1779(11):697–701. Welch C, Chen Y, Stallings R. MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2007;26(34):5017–22. Balasubramanyam M, et al. Impaired miR-146a expression links subclinical inflammation and insulin resistance in Type 2 diabetes. Mol Cell Biochem. 2011;351:197–205. Cheng HS, Sivachandran N, et al. MicroRNA-146 represses endothelial activation by inhibiting proinflammatory pathways. EMBO Mol Med. 2013;5:1017–34. Li K, Ching D, Luk FS, Raffai RL. Apolipoprotein E enhances microRNA-146a in monocytes and macrophages to suppress nuclear factor kappaB- driven inflammation and atherosclerosis. Circ Res. 2015;117:e1–11. Yousefzadeh N, Alipour MR, Soufi FG. Deregulation of NF-small ka, CyrillicB-miR-146a negative feedback loop may be involved in the pathogenesis of diabetic neuropathy. J Physiol Biochem. 2015;71:51–8. Bhatt K, Lanting LL, et al. AntiInflammatory Role of MicroRNA-146a in the pathogenesis of diabetic nephropathy. J Am Soc Nephrol. 2016;27:2277–88. Chen S, Feng B, Thomas AA, Chakrabarti S. miR-146a regulates glucose induced upregulation of inflammatory cytokines extracellular matrix proteins in the retina and kidney in diabetes. PLoS ONE. 2017;12:e0173918. Feng B, Chen S, Gordon AD, Chakrabarti S. miR-146a mediates inflammatory changes and fibrosis in the heart in diabetes. J Mol Cell Cardiol. 2015;105:70–6. Yavari R, Badalzadeh R, Alipour MR, Tabatabaei SM. Modulation of hippocampal gene expression of microRNA-146a/microRNA-155-nuclear factor-kappa B inflammatory signaling by troxerutin in healthy and diabetic rats. Indian J Pharmacol. 2016;48:675–80. Baldeon RL, Weigelt K, de Wit H, Ozcan B, van Oudenaren A, Sempertegui F, et al. Decreased serum level of miR-146a as sign of chronic inflammation in type 2 diabetic patients. PLoS ONE. 2014;9(12):e115209. Taganov KD, Boldin MP, Chang KJ, Baltimore D. NF-kB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA. 2006;103(33):12481–6. Pedersen BK. Anti-inflammatory effects of exercise: role in diabetes and cardiovascular disease. Eur J Clin Invest. 2017;47(8):600–11. Karstoft K, Pedersen BK. Exercise and type 2 diabetes: focus on metabolism and inflammation. Immunol Cell Biol. 2016;94(2):146–50. Tang X, Tang G, Özcan S. Role of microRNAs in diabetes. Biochim Biophys Acta. 2008;1779:697–701. Welch C, Chen Y, Stallings R. MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2006;26(34):5017–22. Esteves JV, et al. Diabetes modulates MicroRNAs 29b–3p, 29c–3p, 199a–5p and 532–3p expression in muscle: possible role in GLUT4 and HK2 repression. Front Endocrinol. 2018;9:536. Bagge A, et al. MicroRNA-29a is up-regulated in beta-cells by glucose and decreases glucose stimulated insulin secretion. Biochem Biophys Res Commun. 2012;426(2):266–72. Roggli E, et al. Changes in microRNA expression contribute to pancreatic β-cell dysfunction in prediabetic NOD mice. Diabetes. 2012;61(7):1742–51. Pandey AK, et al. miR-29a levels are elevated in the db/db mice liver and its overexpression leads to attenuation of insulin action on PEPCK gene expression in HepG2 cells. Mol Cell Endocrinol. 2011;332(1–2):125–33. Liang J, et al. MicroRNA-29a-c decrease fasting blood glucose levels by negatively regulating hepatic gluconeogenesis. J Hepatol. 2013;58(3):535–42. Long J, Wang Y, Wang W, Chang BH, Danesh FR. MicroRNA-29c is a signature microRNA under high glucose conditions that targets Sprouty homolog 1, and its in vivo knockdown prevents progression of diabetic nephropathy. J Biol Chem. 2011;286(13):11837–48. Nielsen LB et al. Circulating levels of microRNA from children with newly diagnosed type 1 diabetes and healthy controls: Evidence that miR-25 associates to residual beta-cell function and glycaemic control during disease progression. Exp. Diabetes Res. 2012; 2012(9):896362. Volpicelli F, et al. The microRNA-29a modulates serotonin 5-HT7 receptor expression and its effects on hippocampal neuronal morphology. Mol Neurobiol. 2019;56(12):8617–27. Dooley, et al. The microRNA-29 Family Dictates the Balance Between Homeostatic and Pathological Glucose Handling in Diabetes and Obesity. Diabetes. 2016;65(1):53–61. Hirata T, et al. Pathological and gene expression analysis of a polygenic diabetes model, NONcNZO10/LtJ mice. Gene. 2017;20:629:52–8. Massart J, et al. Altered miR-29 expression in type 2 diabetes influences glucose and lipid metabolism in skeletal muscle. Diabetes. 2017;66(7):1807–18. Han C, et al. miR-29a promotes myocardial cell apoptosis induced by high glucose through down-regulating IGF-1. Int J Clin Exp Med. 2015;15(8):14352–62. Li J, et al. miR-29b contributes to multiple types of muscle atrophy. Nat Commun. 2015;8:1–15. Slusarz A, Pulakat L. The two faces of miR-29. J Cardiovasc Med. 2015;16(7):480–90. Salehi, et al. The Effects of Endurance Trainings on Serum BDNF and Insulin Levels in Streptozotocin-Induced Diabetic Rats. Neurosci J Shefaye Khatam. 2017;5(2):52–61. Larsen S, Danielsen JH, Søndergård SD, Søgaard D, Vigelsoe A, Dybboe R, et al. The effect of high-intensity training on mitochondrial fat oxidation in skeletal muscle and subcutaneous adipose tissue. Scand J Med Sci Sports. 2015;25(1):59–69. McCarthy JJ, Esser KA. MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. J Appl Physiol. 2007;102(1):306–13. Ma Z, Qi J, Meng S, Wen B, Zhang J. Swimming exercise training-induced left ventricular hypertrophy involves microRNAs and synergistic regulation of the PI3K/AKT/mTOR signaling pathway. Eur J Appl Physiol. 2013;113(10):2473–86. Radom-Aizik S, Zaldivar F, Oliver S, Galassetti P, Cooper DM. Evidence for microRNA involvement in exercise associated neutrophil gene expression changes. J Appl Physiol. 2010;109(1):252–61. Improta Caria AC, Nonaka CKV, Pereira CS, Soares MBP, Macambira SG, Souza BSF. Exercise training-induced changes in microRNAs: beneficial regulatory effects in hypertension, type 2 diabetes, and obesity. Int J Mol Sci. 2018;19(11):3608. Kangas R, Törmäkangas T, Heinonen A, Alen M, Suominen H, Kovanen V, et al. Declining physical performance associates with serum fasl, mir-21, and mir-146a in aging sprinters. Biomed Res Int. 2017;2017(14):1–14. Oghbaei H, Asl NA, Sheikhzadeh F. Can regular moderate exercise lead to changes in mirNA 146a and its adapter proteins in the kidney of streptozotocin-induced diabetic male rats? Endocr Regul. 2017;51(3):145–52. Molanouri SM, Hassan ZH, Gharakhanlou R, Quinn LS, Azadmanesh K, Baghersad L, et al. Expression of interleukin-15 and inflammatory cytokines in skeletal muscles of STZ-induced diabetic rats: effect of resistance exercise training. Endocrine. 2014;46(1):60–9. Samuel RO, Gomes-Filho JE, Dezan-Júnior E, Cintra LT. Streptozotocin-induced rodent models of diabetes: Protocol comparisons.2014. Ozkaya YG, Agar A, Hacioglu G, Yargicoglu P. Exercise improves visual deficits tested by visual evoked potentials in streptozotocin-induced diabetic rats. Tohoku J Exp Med. 2007;213(4):313–21. Khaledi N, et al. The Effect of High-Intensity Interval Training on Apoptotic-Related Genes in Skeletal Muscle and Serumic TNF-Alpha of Diabetic Rats. IJDO. 2023;15(1):59–65. ‎. Songstad NT, et al. Effects of High Intensity Interval Training on Pregnant Rats, and the Placenta, Heart and Liver of Their Fetuses. PLoS ONE. 2015;10(11):e0143095. Sara K, Mehran G. The Effect of High- and Low-Intensity Interval Training on Myostatin Gene Expression Levels in Muscles Fibers of Rats with Myocardial Infarction. J Nutr Fast Health. 2022;10(4):295–9. Cacho J, Sevillano J, de Castro J, Herrera E, Ramos P. Validation of simple indexes to assess insulin sensitivity during pregnancy in Wistar and Sprague-Dawley rats. Am Physiol Endocrinol Metab. 2008;295(5):E1269–76. Hwang CL, et al. Novel all-extremity high-intensity interval training improves aerobic fitness, cardiac function and insulin resistance in healthy older adults. Exp Gerontol. 2016;82:112–9. Masoumeh H, Maryam H. The synergistic effect of eight weeks high-intensity interval training and resveratrol consumption on il-10 and tnf-α in diabetic male rats. Iran J Diabetes Metabolism. 2020;19(3):134–42. Huh JY, et al. Irisin in response to exercise in humans with and without metabolic syndrome. J Clin Endocrinol Metab. 2015;100(3):E453–7. ADA. Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes. Diabetes Care. 2011;34(1):4–10. Rose AJ, Richter EA. Skeletal muscle glucose uptake during exercise: how is it regulated? Physiology (Bethesda).2005:20:260 – 70. Gibala MJ, et al. Physiological adaptations to low-volume, high-intensity interval training in health and disease. J Physiol. 2012;590(5):1077–84. Gibala MJ, McGee SL. Metabolic adaptations to short-term high-intensity interval training: a little pain for a lot of gain? Exerc Sport Sci Rev. 2008;36(2):58–63. Lovis P, Roggli E, Laybutt DR, Gattesco S, Yang JY, Widmann C, et al. Alterations in microrna expression contribute to fatty acid-induced pancreatic beta-cell dysfunction. Diabetes. 2008;57(10):2728–36. Improta C, et al. Exercise Training-Induced Changes in MicroRNAs: Beneficial Regulatory Effects in Hypertension, Type 2 Diabetes, and Obesity. Int J Mol Sci. 2018;19(11):3608. vahid s-s. Comparison of changes in miR-146a gene expression and serum levels of TNF-α, IL-6 and CRP following interval or continuous aerobic training with calorie restriction in obese women. (JPSBS). 2021;9(20):30–43. Li L, Chen X-P, Li Y-J. MicroRNA-146a and human disease. Scand J Immunol. 2010;71(4):227–31. Olivieri F, et al. Toll like receptor signaling in inflammaging: microRNA as new players. Immun Ageing. 2013;19(1):11. Dini S, et al. Quercetin–conjugated superparamagnetic iron oxide nanoparticles modulate glucose metabolism–related genes and miR–29 family in the hippocampus of diabetic rats. Sci Rep. 2021;11(1):8618. Kriegel AJ, Liu Y, Fang Y, Ding X, Liang M, et al. The miR-29 family: genomics, cell biology, and relevance to renal and cardiovascular injury. Physiol Genomics. 2012;44(4):237–44. Eyholzer M, Schmid S, Wilkens L, Mueller BU, Pabst T, et al. The tumour-suppressive miR-29a/b1 cluster is regulated by CEBPA and blocked in human AML. Br J Cancer. 2010;103(2):275–84. Balkhi MY, Iwenofu OH, Bakkar N, Ladner KJ, Chandler DS, Houghton PJ et al. miR-29 acts as a decoy in sarcomas to protect the tumor suppressor A20 mRNA from degradation by HuR. Sci Signal. 2013; 6(286). Dahlmans D, et al. Evaluation of Muscle microRNA Expression in Relation to Human Peripheral Insulin Sensitivity: A Cross-Sectional Study in Metabolically Distinct Subject Groups. Front Physiol. 2017;8:711. ` Sarah S, Benedikt S-K, et al. Evidence for Training-Induced Changes in miRNA Levels in the Skeletal Muscle of Patients With Type 2 Diabetes Mellitus. Front Physiol. 2020;3:11599651. Massart J, Katayama M, Krook A. micro Managing glucose and lipid metabolism in skeletal muscle: role of microRNAs. Biochim Biophys Acta. 2016;1861(12 Pt B):2130–8. Grillo CA, et al. Insulin-stimulated translocation of GLUT4 to the plasma membrane in rat hippocampus is PI3-kinase dependent. Brain Res. 2009;3:1296:35–45. Lv H, Tang L, Guo C, Jiang Y, Gao C, Wang Y, Jian C. Intranasal insulin administration may be highly effective in improving cognitive function in mice with cognitive dysfunction by reversing brain insulin resistance. Cogn Neurodyn. 2020;14(3):323–38. Reagan LP. Neuronal insulin signal transduction mechanisms in diabetes phenotypes. Neurobiol Aging 2005:26 Suppl 1:56–9. Morteza SA, et al. The effects of 8 weeks high intensity interval training on serum levels of TNF-α and insulin resistance index in obese men with type-2 diabetes. Health Serv. 2017;39(4):53–62. Tobias D, et al. Supervised Short-term High-intensity Training on Plasma Irisin Concentrations in Type 2 Diabetic Patients. Int J Sports Med. 2019;40(3):158–64. Mana D, Akbar NH, Behrouz B. The Effect of Eight Weeks of High-Intensity Interval Training with L-Cysteine Consumption on CRP and TNF-α in Heart Tissue of Young Rats with Type 2 Diabetes. Dis Diagn. 2023;12(4):187–92. Mirza S, et al. Type 2-Diabetes is Associated With Elevated Levels of TNF-alpha, IL-6 and Adiponectin and Low Levels of Leptin in a Population of Mexican American: A Cross Sectional Study. Cytokine. 2012;57(1):136–42. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4492446","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":311859319,"identity":"490eeaaf-3af0-4e54-a146-bd5117aead06","order_by":0,"name":"Mehdi Soltani Ichi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYHACxgNAgoeN4fDxHx+ALDZ2IvQcAOrh4WM8liA5A6SFmUgtDHLMZwykeUBcQlp0+w8fOPyh5o4MG9sBA2ObX9vk+ZgZGD98zMGtxexGWsKBA8ee8bDxHEhIzu27bdjGzMAsOXMbPi08BgcOsB3mYZM4cOBwbs9tRqAWNmZefFrOnwFq+QfUIv+wsdmy57Y9YS0HcgwOHGw7DApkZmaGH7cTCWsB+eVsH0jLMTbG3obbyW3MjM34/XL+8MEHFd8O28s3nP/G8OPPbdv57c0HP3zEowUVMLaByQZi1YPAH1IUj4JRMApGwUgBAAJIWUWXCHPdAAAAAElFTkSuQmCC","orcid":"","institution":"tehran University","correspondingAuthor":true,"prefix":"","firstName":"Mehdi","middleName":"Soltani","lastName":"Ichi","suffix":""},{"id":311859320,"identity":"0294f345-ffb6-499f-9ade-9880b435fe7e","order_by":1,"name":"Fatemeh Shabkhiz","email":"","orcid":"","institution":"tehran University","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Shabkhiz","suffix":""},{"id":311859321,"identity":"0626033d-52a8-486f-8b6e-50adc28ef2ac","order_by":2,"name":"Mohammadreza Kordi","email":"","orcid":"","institution":"tehran University","correspondingAuthor":false,"prefix":"","firstName":"Mohammadreza","middleName":"","lastName":"Kordi","suffix":""}],"badges":[],"createdAt":"2024-05-28 17:18:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4492446/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4492446/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58133071,"identity":"78fe932a-0995-48a4-9571-cb6d938ddecb","added_by":"auto","created_at":"2024-06-11 14:57:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":98124,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in plasma insulin levels (a) and blood glucose(b) in the studied groups: Bars represent the mean ± SD (n=6).(a) *P\u0026lt; 0.044, **P\u0026lt; 0.001 significant deference vs Control group and *#P\u0026lt; 0.006 significant deference vs Dia (6W) group ; (b)*P\u0026lt; 0.001, **P\u0026lt; 0.001 , *#P\u0026lt; 0.002 significant deference vs Control group and *#P\u0026lt; 0.001 significant deference vs Dia (6W) group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4492446/v1/dd17ab7f3ce4adad71b89610.png"},{"id":58133072,"identity":"76d01909-8459-4e3f-b781-e6999b95c51f","added_by":"auto","created_at":"2024-06-11 14:57:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":66045,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in Insulin Resistance Index (HOMA-IR) in the studied groups: Bars represent the mean ± SD (n=6). (*P\u0026lt; 0.003, **P\u0026lt; 0.001, *#P\u0026lt; 0.078) significant deference vs Control group and *#P\u0026lt; 0.001 significant deference vs Dia (6W) group\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4492446/v1/f989962485a21c2df8bb7305.png"},{"id":58133517,"identity":"bb37d27f-ff11-4bf3-97c7-7c4427615724","added_by":"auto","created_at":"2024-06-11 15:05:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":88959,"visible":true,"origin":"","legend":"\u003cp\u003ehippocampus expression levels of miR-146a and miR-29c genes in studied groups. Data are presented as mean ± SEM. (a) (\u003csup\u003e*\u003c/sup\u003eP\u0026lt; 0.001, \u003csup\u003e**\u003c/sup\u003eP\u0026lt; 0.001, \u003csup\u003e*#\u003c/sup\u003eP\u0026lt; 0.001) significant deference vs Control group and \u003csup\u003e*#\u003c/sup\u003eP\u0026lt; 0.001 significant deference vs Dia (6W) group.(b) \u003csup\u003e*\u003c/sup\u003ep \u0026lt; 0.000, \u003csup\u003e*#\u003c/sup\u003ep \u0026lt; 0.012 significant deference vs Control group and \u003csup\u003e*#\u003c/sup\u003ep \u0026lt; 0.086 significant deference vs Dia (6W) group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4492446/v1/e42c53fd7e0a0d7142cd4b1c.png"},{"id":58133074,"identity":"a2ca1c79-2a99-4bda-a7d0-56a939ad1297","added_by":"auto","created_at":"2024-06-11 14:57:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":80945,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in\u003cstrong\u003e \u003c/strong\u003eTNF\u003cstrong\u003e-\u003c/strong\u003eα levels in the studied groups: Bars represent the mean ± SD (n=6). (\u003csup\u003e*\u003c/sup\u003eP\u0026lt; 0.085, \u003csup\u003e**\u003c/sup\u003eP\u0026lt; 0.001, \u003csup\u003e*#\u003c/sup\u003eP\u0026lt; 0.028) significant deference vs Control group and\u0026nbsp; \u003csup\u003e*#\u003c/sup\u003eP\u0026lt; 0.076 significant deference vs Dia (6W) group.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4492446/v1/330b064fa12414f8c2f8299c.png"},{"id":59071757,"identity":"0e24c8e7-952b-473a-902e-55e122751dad","added_by":"auto","created_at":"2024-06-26 04:52:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":760052,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4492446/v1/88af1565-1650-444d-9b19-6708928cf9d8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of streptozotocin- induced diabetic male rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003ediabetes mellitus (DM) is one of the most common endocrine disorders, which has already gained high public attention in the past few decades. Diabetes causes disorders in the central nervous system. Impaired glucose tolerance, insulin resistance, and hyperinsulinemia all cause negative effects on memory that are associated with hippocampal atrophy ]1,2[ .Recently, dysfunction of the brain induced by DM has emerged as a new concern, which mainly refers to a variety of neurological abnormalities, including decline in cognition, attention, memory, and psychomotor deficits caused by chronic hyperglycemia in the brain ]3[. Particularly, mild cognitive decline caused by diabetes mellitus has been recently highlighted as an early manifestation, a preclinical transitional state from normal cognition to dementia ]4[. The exact mechanism underlying cognitive impairment in diabetes is complex; however, impaired glucose metabolism and abnormal insulin function are often associated with cognitive impairment. Studies have shown that hyperglycemia leads to hypertension, dyslipidemia, inflammation, and abnormalities in hypothalamic-pituitary-adrenocortical axis ]5,6[. Moreover, chronic hyperglycemia is toxic to neurons and leads to the formation of advanced glycation end products leading to oxidative damage and neuronal injury. Inflammation and dyslipidemia are the other important factors that can cause neuronal damage leading to cognitive impairment ]7 [. These pathological processes may cause irreversible structural damages of brain, like disruption of white matter integrity and cerebral atrophy, thus contributing to cerebral dysfunction ]8,9,10[. Among these complicated pathogenesis, Hyperglycemia and inflammation were most researched and recognized for cerebral damage in diabetes ]11,12[. Hyperglycemia may activate the Toll-like receptors (TLRs), a family of pattern recognition receptors responsible for triggering the downstream inflammatory cascade ]13[, thus causing neuronal lesions in the brain of chronic DM. It has been shown that hyperglycemic conditions can strongly affect brain function. On the other hand, hypoglycemic shock induced by diabetes can lead to the central nervous system (CNS) dysfunction and brain cell death ]14[. Glucose is the primary source of metabolic energy for the CNS and it goes across the plasma membrane of neurons with the help of glucose transporters (GLUTs) ]15,16[. GLUTs are widely distributed in the CNS, especially in the hippocampus, and play a vital role in brain glucose homeostasis ]17,18[.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are small non-coding single-stranded RNAs, with approximately 22 nucleotides, that act in mechanisms of post-transcriptional regulation of gene expression. It has recently been reported miRNAs play an essential role in various pathological processes like insulin resistance, inflammation, immunity, oxidative stress, carcinogenesis and could help to reach an early diagnosis of DM ]19,20\u0026ndash;23. [\u003c/p\u003e \u003cp\u003eRecently, increasing studies suggested that miR-146a played a vital role in inflammatory process in various disorders including diabetes ]24,25,26[. In addition, miR-146a was reported to exert anti-inflammatory effect in the pathogenesis of various diabetic complications like diabetic nephropathy, retinopathy, neuropathy, cardiovascular disorders, even tending to be a potential biomarker of inflammatory status in these diseases ]27,28,29[. Moreover, it was demonstrated that the expression of miR-146a was down-regulated in hippocampal tissues of diabetic rats ]30[ as well as in the serum of T2DM patients, which may serve as a biomarker of the chronic inflammatory condition ]31[. In fact, it has been uncovered that miR-146a could suppress the expressions of the NF-kB-mediated inflammatory mediators like COX-2, TNF-a, IL-6 and IL-1b by targeting the 30-UTR of IRAK1 and TRAF6 mRNA, which are the downstream adaptors of TLRs]32 [. Some studies have demonstrated that tumor necrosis factor-alpha (TNF-α) is one of the important pro-inflammatory mediators in insulin resistance and β-cell damage ]33[. The pro-inflammatory cytokine TNF-α is an important molecule in the development of insulin resistance and type 2 diabetes. Furthermore, in healthy individuals, TNF-α inhibits peripheral insulin stimulated glucose uptake by disrupting the phosphorylation of the substrate Akt 160, which is a key step in the canonical regulation of insulin signaling and the glucose transporter type 4 cascade and canonical insulin signaling transduction. It prevents the absorption of glucose and signal transmission by insulin in the whole body ]34 [.\u003c/p\u003e \u003cp\u003eAlso, Studies have highlighted the role of the microRNA-29 (miR-29) family in glucose homeostasis ]35 [. miR-29 family with three mature members of miR-29a, miR-29b, and miR-29c is a sensitive microRNA family to insulin deficiency and hyperglycemia ]36,37[. Studies in diabetic patients and animal models revealed that the expression of miR-29 family is increased in different tissues, including liver, pancreas, kidney, skeletal muscle, adipose tissue, and brain ] 38\u0026ndash; 45[. It is well known that miR- 29 family negatively regulates the expression of GLUTs and IGF-1 in diabetic conditions ]37,46\u0026ndash; 49[. Collectively, miR-29 family members can be considered as early markers of DM ]50[.\u003c/p\u003e \u003cp\u003eTo prevent the harmful effects of diabetes on different parts of the body, experts use different treatment methods such as nutritional therapy, pharmacotherapy and insulin injection. Recent studies have shown that sports activity as a non-pharmacological treatment in the brain tissue and hippocampus of diabetic rats prevents the reduction of cognitive level. Studies have shown that high intensity intermittent training increases the oxidation capacity, changes in carbohydrate metabolism, increases GLUT4 enzymes and resting glycogen content, and increases the number of GLUT4 as a factor in glycolysis ]51[. In recent years, research interest has been increased in the field of aspects related to the body\u0026rsquo;s response to exercise, in which miRNAs appear to play a key role. Some new studies have recently revealed that exercise can modulate the expression of some miRNAs in certain tissues including the skeletal muscle ]52[, heart ]53[, and neutrophils ]54[. In this regard, research shows an increase in the expression of miR-146a ]55,56,57[ and a decrease in the expression of MiRNA-29c ]47,58[ in diabetic human and animal samples following exercise. In addition, A meta-analysis study showed that HIIT improves level of serum TNF-α and the result shows that HIIT may be an effective and time-efficient intervention to reduce low-grade inflammation in metabolic diseases such as diabetes ]59[.\u003c/p\u003e \u003cp\u003eTherefore, it is possible that exercise especially HIIT may cause an adjustment in miRNAs and pro-inflammatory mediators expression changes in the diabetic hippocampus and finally prevent cerebral dysfunction. To assess this hypothesis, we surveyed the expression of miR-146a, miR-29c, and TNF-α in the hippocampus of diabetic rats following HIIT.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e24 adult-male Wistar rats (6\u0026ndash;8 W) weighing between 180\u0026thinsp;\u0026plusmn;\u0026thinsp;10 g were obtained from the Pasteur Institute, Tehran, Iran. The animals were maintained at room temperature (22\u0026ndash;25\u0026deg;C) with 12:12h light-dark cycles and, free access to food and water, and resettled as three animals to a cage. The study protocol was designed in accordance with NIH guidelines and the guidelines of the Ethics committee for the use of animals in research at Tehran University (Ethic Approved Code IR.UT.SPORT.REC.1402.057). The animals were allocated randomly into four groups containing 6 rats, including Normal Control (N), one week Diabetic (1W), six week Diabetic (6W) and diabetes high intensity interval training (Dia-Exe) groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eInduction of Diabete\u003c/h2\u003e \u003cp\u003eThe Diabetic groups were induced by intraperitoneal (IP) injection single-dose of Streptozotocin (SIGMA Company) 55 mg/kg of animals body weight (dissolved in 0.1 M of citrate buffer; pH 4.5; i.p.) in 12-h fasted rats. Non-diabetic animals were also injected with a volume equivalent of citrate buffer ]2, 60,61 [ .After 72 hours, blood was collected from the tail vein and blood glucose levels were measured using glucometer (Easy Gluco, Infopia, South Korea). Diabetes mellitus was defined as fasting blood glucose\u0026thinsp;\u0026gt;\u0026thinsp;250 mg/dl. Blood glucose concentrations and body weight of all rats was also measured weekly. Animals failing this criterion were excluded from the experiment ]62[ .There was no mortality due to good maintenance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eExercise protocol\u003c/h2\u003e \u003cp\u003eBefore starting the formal 6 weeks HIIT training protocol, animals were familiarized to treadmill running. HIIT training protocol including HIIT program included 3 sessions of 40 minutes per week,running on the rodent treadmill (Danesh Salar Iranian company) at a speed equal to 70\u0026ndash;110% of the maximum oxygen consumption was performed for 6 weeks. In general, during six weeks, the animals performed 6\u0026ndash;10 1-minute repetitions with 2-minute active rest intervals (Vo2max 45\u0026ndash;50%). This protocol was designed based on the changed and modified study of previous studies] 63\u0026ndash;65 [ .All training sessions were accompanied by 5 minutes of warming up and 5 minutes of cooling down at a Vo2max 45\u0026ndash;50%. Moderate electrical shock was used for motivating the animals to run. Control groups were placed on a turned-off treadmill for 10\u0026ndash;15 min / day for 3 days a week.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eblood sample and Tissue collection\u003c/h2\u003e \u003cp\u003eAfter 24 hours of the last session of training, all rats were injected with ketamine 10% (75 mg/kg), and xylozine 2% (5 mg/kg) to anesthetize ]2[ .Adequate blood samples were collected directly from the left ventricle of rats. The animals\u0026rsquo; hippocampus were immediately removed and hippocampus and serum samples were snap-frozen in the liquid nitrogen and then stored at a freezer (-80\u0026deg;C).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of blood sugar, Plasma insulin and insulin resistance\u003c/h2\u003e \u003cp\u003eThe serum glucose level was measured by an enzymatic method (Pars Azmoun kit, Tehran, Iran) with an autoanalyzer (A-classic -AT plus, Alpha Classic, IRAN). The serum concentration of insulin was also measured by ELISA method and using a human insulin kit (E-D-2101, Monobind, Usa ). The insulin resistance index was calculated using the following equation ]66[;\u003c/p\u003e \u003cp\u003eHOMA-IR= (glucose in mmol/L x insulin in mIU/mL) / 22.5RNA extraction and real-time PCR\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and real-time PCR\u003c/h2\u003e \u003cp\u003eIn this study mRNA and miRNA expressions in hippocampal tissue performed by real-time PCR .Total RNA (microRNA) was extracted from the hippocampal tissues using a QIAzol Lysis Reagent (Qiagen, Usa). RNA content and purity were evaluated with Nanodrop 2000 Vis spectrophotometer (Thermo Scientific, USA) based on the relative absorbance ratio at A260/ A280 and A260/A230 ratios. The samples were utilized in a concentration of 522 ng/\u0026micro;l. The cDNA synthesis kit (Hyper Script RT premix with Random hexamer- Gene All، South Korea ) were used for determination expression of miR-29c gene. Stem loop RT primer method was used for the synthesis of cDNA from the target microRNAs. For cDNA synthesis, 4 to 6 nucleotides complementary to the 3' end of the desired microRNA were added to the 3' end of the sequence.\u003c/p\u003e \u003cp\u003eEach cDNA was used as a template for real-time PCR assay using the SYBR Green master mix (Ampliqon, Denmark). Real-time PCR were performed on a Rotor-Gene Q cycler (Qiagen, Usa). The PCR reaction was performed using 2 \u0026micro;l of cDNA, 5 \u0026micro;l of SYBR Green PCR master mix and 1 \u0026micro;l of primer mixture in a final reaction volume of 10 \u0026micro;l. The relative amount of mRNA and miRNA for each target gene was calculated based on its threshold cycle (Ct) compared to the Ct of the house-keeping (reference) gene (U6 and mir29c, mir146a). The relative quantification was performed by 2-ΔΔ Ct method. The specificity of the PCR reactions was verified by generation of a melting curve analysis. The sequence of primers used in Real-Time PCR steps is presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReverse And Forward primer sequence of miR-29c and mir146a genes for Real-time PCR reaction\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"1\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003cp\u003eForward CTCGCTTCGGCAGCACATATACT\u003c/p\u003e \u003cp\u003eReverse ACGCTTCACGAATTTGCGTGTC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStem loop\u003c/p\u003e \u003cp\u003eCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGACnnnnnnnn\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMir-29c\u003c/p\u003e \u003cp\u003eForward GTGATTAGCACCATGTGA\u003c/p\u003e \u003cp\u003eReverse AACTGGTGTCGTGGAGTC\u003c/p\u003e \u003cp\u003emir146a\u003c/p\u003e \u003cp\u003eForward GTGATGAGAACTGAATTC\u003c/p\u003e \u003cp\u003eReverse AACTGGTGTCGTGGAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTNFα analysis\u003c/h2\u003e \u003cp\u003eblood was conducted to determine TNF analysis with ELISA laboratory method. We used a commercial kit (KPG-HTNF-a, Iran) with a sensitivity of less than 4 pg/ml and TNF Intra-assay CVs were 3%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eResults are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Statistical analysis was performed using SPSS software (version 16). Tukey's post hoc test and MANOVA with significance level (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) were used to determine significance. GraphPad Prism software was used to draw figures and graphs.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eblood glucose, plasma insulin\u003c/h2\u003e \u003cp\u003eThe results of the ANOVA test showed a significant difference between the studied groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.002). the results of Tukey's post hoc test showed a significant increase in blood glucose (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, P\u0026thinsp;\u0026lt;\u0026thinsp;0.002) and plasma insulin levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.044, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the Diabetic groups compared to the Control group and also a significant decrease in blood glucose (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and plasma insulin levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0016) in the Dia-Exe group compared to the Dia (6W) group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eInsulin Resistance Index (HOMA-IR)\u003c/h2\u003e \u003cp\u003eThe results of the ANOVA test showed a significant difference between the studied groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). the results of Tukey's post hoc test showed a significant increase in Insulin Resistance Index (P\u0026thinsp;\u0026lt;\u0026thinsp;0.003, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, P\u0026thinsp;\u0026lt;\u0026thinsp;0.078) in the Diabetic groups compared to the Control group and a significant decrease in Insulin Resistance Index (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the Dia-Exe group compared to the Dia (6W) group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eExpressions of miR-146a and miR-29c genes\u003c/h2\u003e \u003cp\u003eThe results of the ANOVA test showed a significant difference between the studied groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). results of Tukey's post hoc test showed a Down-regulation of miR-146a (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) ) in the Diabetic groups compared to the Control group and a significant increase in the expression of miR-146a in the Dia-Exe group compared to the Dia (6W) group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e)(a). In addition a Up-regulation of miR-29c in the Dia (6W) and Dia-Exe group compared with the Control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.000, p\u0026thinsp;\u0026lt;\u0026thinsp;0.012). Meanwhile, HIIT decreased the expression of miR-29c in the Dia-Exe group compared to the Dia (6W) group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.086) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) (b) .\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eTNF-α Levels\u003c/h2\u003e \u003cp\u003ethe results showed a significant difference between the studied groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.002). results of Tukey's post hoc test showed a significant increase in the TNF-α Levels in diabetic groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.085, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001. P\u0026thinsp;\u0026lt;\u0026thinsp;0.028 ) compared with the Control group. Moreover, TNF-α were decreased significantly in the Dia\u0026thinsp;+\u0026thinsp;Exe group compare to Dia (6W) group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.076) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e6 weeks of HIIT decreased blood sugar, insulin resistance (HOMA-IR index) and insulin levels in Diab\u0026thinsp;+\u0026thinsp;Exe group rats. In previous studies ]2, 67, 68[, a decrease in blood sugar and insulin resistance following exercise was reported that the results of the present research are in line with the results of the mentioned research. Insulin resistance is defined as an inadequate response in insulin-sensitive tissues (liver, skeletal muscle, and adipose tissue) to circulating levels of insulin. Also, a decrease in the number of insulin receptor proteins leads to insulin resistance. Inflammatory mediators through Increased production of cytokines and fatty acids or lipotoxin activates inflammatory pathways in immune and metabolic cells. Activation of inflammatory pathways interferes with insulin signaling and results in insulin resistance ] 69[.\u003c/p\u003e \u003cp\u003ePhysical activity increases the function and signaling of insulin, increases glucose transporters from the inside to the cell membrane, increases the rate of glucose uptake, increases capillary density, increases the expression of genes or the activity of different proteins involved in insulin signaling, increases the activity of glycogen synthetase, and finally increases Glycogen storage affects glucose homeostasis and increases insulin sensitivity ]70[.\u003c/p\u003e \u003cp\u003eRegarding the intensity of exercise and its effects on insulin sensitivity, the results of studies have shown that high intensity exercise has a greater effect on insulin sensitivity and improving type 2 diabetes. Probably, most environmental adaptations following the HIIT program are related to enzyme changes in muscle cells, according to which the molecular mechanism and enzymatic adaptations are attributed to the activation of a protein called adenosine monophosphate-activating protein kinase (AMPK)]71[. This protein is one of the possible mechanisms to increase the entry of glucose into cells, especially muscle cells during HIIT program, which increases insulin sensitivity. In addition, studies have shown that the increase in insulin sensitivity following intense periodic activities is due to the increase in the expression of the PGC-1α gene and the expression level of the AdipoR1 (Adiponectin receptor 1) gene]72,73[.\u003c/p\u003e \u003cp\u003eResults of this study indicate a significant decrease in miR-146a genes in the hippocampus of Stz-Induced control rats compared with the control group. Our data are in line with data of Feng et al. (2011), Balasubramanyam et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e),.Shamshadi et al.(2022) and Habibi et al. (2016) who have shown the declination in miRNA-146a expression in cardiac, retina, peripheral mononuclear, Hippocampus and renal cells of diabetic patients, which led to the development of diabetes]24,30.67,70[.As a regulative factor, miR-146a is induced by Toll-like receptors (TLRs), which depends on NF-KB. Two important adapter molecules, named TRAF6 and IRAK1, participate in the TLR signaling pathway which is known as direct target for miR-146a ]74[. In the present study, it is observed that diabetes decreases miR-146a expression gene; therefore, it is possible to conclude that negative effects are applied to miR-146a due to the dominance of proinflammatory and inflammatory factors like NF-KB, TRAF6, and IRAK1 in hippocampal tissues, which consequently reduces miR-146a.\u003c/p\u003e \u003cp\u003eOn the other hand, Tukey's post hoc test results showed a significant increase in the expression of miR-146a in hippocampal tissues in the Diab\u0026thinsp;+\u0026thinsp;Exe group compared to Dia (6W) group. Our data are in line with data of Improta et al.(2018), Kangas et al.(2017), Shamshadi et al.(2023) and Sarraf-S et al. (2021)]2,58,75,76[. mir146a acts as an important regulatory molecule in immune responses and autoimmune diseases. mir146a activates the receptor (TLR-thol-like 4) in the signaling pathway dependent on NF-KB and leads to the reduction of interleukin-1 receptor-dependent kinase (IRAK- 1) and the factor associated with the nuclear transcription factor receptor (TRAF-6). In fact, activated NF-κB induces the transcription of mir146a, and as a result, the expression of TRAF-6 and IRAK-1 is inhibited and the TLR signaling pathway is inhibited ]77[. mir146a plays an important regulatory role in innate immunity, inflammatory responses, viral infections and some malignancies. mir146a is introduced as an anti-inflammatory mirNA that is activated by cytokines such as IL-1\u0026szlig;, TNF-a and the NF-κB pathway and by suppressing the components of the NF-κB pathway (IRAK1 and TRAF6) and as a result suppressing the expression of IL-8, IL- 6 and TNF-α affects the reduction of inflammation ]78[. Although these indicators were not investigated in the present study, the increase in the expression of this gene may be considered as a result of a decrease in the activity of the upstream pathways and a decrease in the possible release of inflammatory cytokines.\u003c/p\u003e \u003cp\u003eAnother result of this research was the increase in the expression of miR-29c in diabetic groups. In diabetic rodent models and humans, an increase in miR-29 family miRNAs is reported in different tissues including liver, pancreas, kidney, skeletal muscle, adipose tissue, and brain ]39\u0026ndash;44 [. In this regard, Dini et al. (\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) showed that the expression of miR-29c in the hippocampus of mice with type 2 diabetes is higher than in mice with normal insulin sensitivity ]79[. Both hyperglycemia and proinflammatory cytokines, the hallmarks of diabetes mellitus, upregulate the expression of miR-29 family miRNAs ]80,81,82[. Increasing the expression of miR-29c decreases the expression of Glut4 and Glut1 receptors. Also, the expression of this microRNA reduces the expression of hexokinase2 (HK2), the limiting enzyme of glycolysis. Meanwhile, overexpression of miR-29 downregulates the mRNA expression of IRS1, PIK3R3, and AKT2, also confirming the role of miR-29c as a modulator of insulin signaling and glucose metabolism ]48[.\u003c/p\u003e \u003cp\u003eIn contrast, 6 weeks of HIIT training decreased the expression of miR-29c in the hippocampal tissue of Diab\u0026thinsp;+\u0026thinsp;Exe group rats compared to Dia (6W) group. Other studies also reported the effect of sports activity on the reduction of miR-29c expression in diabetic and healthy human and animal samples. ]48,83,84 [. Regarding the miR-29c that were altered by regular physical training in the present study, Dahlmans et al. (\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) have shown a negative correlation between skeletal muscle miRNA-29b/miRNA-29c and peripheral insulin sensitivity in human study participants (involving T2DM patients, non-diabetic obese and lean subjects, athletes)]83[. Furthermore, Dooley et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) ] 46[ demonstrated that miRNA-29c-deficient mice were protected against the onset of diet-induced insulin resistance. Glucose metabolism and insulin action are regulated by miRNAs in several tissues, including liver, adipose and skeletal muscle]85[.It is well studied that majority of glucose absorption in the hippocampus is mediated through GLUT1 which is expressed in microvessels, as well as GLUT2 and GLUT3 that are highly expressed in pyramidal cells located in the CA3 and dentate gyrus ]17,86,87[. In addition, GLUT4 is an insulin-sensitive glucose transporter and exhibits overlapping distributions with the insulin receptor and IGF-1 receptor in the hippocampus of the rodent brain ]88 [.\u003c/p\u003e \u003cp\u003e6 weeks of HIIT decreased the serum TNF-α levels in STZ-induced diabetic\u0026thinsp;+\u0026thinsp;Exe group rats compared to Dia (6W) group rats. Our data are in line with data of Khaledi et al (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), Salimi Avansar (2017), D\u0026uuml;nnwald et al (2019) and Davoudi et al (2023( ]63,89,90,91[.exercise is an effective intervention to improve the condition of chronic inflammation, however, the effects of exercise can depend on its type and intensity. Previous meta-analysis studies have provided conflicting results of the effects of exercise training on the inflammatory cytokines IL-6 and TNF-α. The increase in circulating levels of the inflammatory cytokine TNF-α is associated with an increase in the risk of developing type 2 diabetes, which can be due to the development of insulin resistance due to the effects of adipose tissue secretion, especially visceral fat, macrophages, adipose tissue ]92[.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur findings indicate that Upregulation of miR-29c and down-regulation mir146a in the hippocampal tissue of Stz - induced diabetic rats leads to Hyperglycemia and inflammation and finally disorders in the central nervous system .Conversely, downregulation of miR-29c and Upregulation of mir146a following HIIT may improve the situation and prevention from negative effects on memory that are associated with hippocampal atrophy in aging.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHIIT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHigh-intensity interval training\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e This article is derived from PhD dissertation of Mehdi Soltani Ichi, entitled \u0026ldquo;The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of diabetic male rats\u0026rdquo;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u003c/strong\u003e Mehdi Soltani Ichi designed the project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol was designed in accordance with NIH guidelines and the guidelines of the Ethics committee for the use of animals in research at Tehran University (Ethic Approved Code IR.UT.SPORT.REC.1402.057).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSims-Robinson C, et al. The role of oxidized cholesterol in diabetes-induced lysosomal dysfunction in the brain. Mol Neurobiol. 2016;53:2287\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShamshadi B, et al. Investigation of an Increase in the Expression of the Mir146a Gene in The Hippocampus and a Decrease in the Levels of Blood Sugar, Insulin, and Insulin Resistance in Elderly Diabetic Rats after a Period of High-Intensity Interval Training. NK Univ Med Sci. 2023;14(4):75\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z et al. Endoplasmic reticulum stress-induced neuronal inflammatory response and apoptosis likely plays a key role in the development of diabetic encephalopathy. Oncotarget. 2016; 78455\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa F, et al. Conversion of mild cognitive impairment to dementia among subjects with diabetes: a population-based study of incidence and risk factors with five years of follow-up. J Alzheimers Dis. 2015;43:1441\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRama MR, Sagar GR. Association of Cognitive Impairment and Type 2 Diabetes Mellitus. A Case-Control Study; 2019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHazari MAH, et al. Cognitive impairment in type 2 diabetes mellitus. Int J Diabetes Mellitus. 2015;3(1):19\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaguib R et al. Cognitive impairment among patients with diabetes in Saudi Arabia: a cross-sectional study. Middle East Curr Psychiatry. 2020;27(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakeda S, Sato N et al. Diabetes-accelerated memory dysfunction via cerebrovascular inflammation and Abeta deposition in an Alzheimer mouse model with diabetes. Proc. Natl. Acad. Sci. U.S.A. 2010; 107, 7036\u0026ndash;7041.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang B, et al. Inflammatory macrophages promotes development of diabetic encephalopathy. Cell Physiol Biochem. 2015;36:1142\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin Z, et al. Asiaticoside attenuates diabetes-induced cognition deficits by regulating PI3K/Akt/NF- kB pathway. Behav Brain Res. 2015;292:288\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoghaddam HK, Baluchnejad m, et al. Berberine ameliorate oxidative stress and astrogliosis in the hippocampus of STZ-induced diabetic rats. Mol Neurobiol. 2014;49:820\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerdile G, Keane KN et al. Inflammation and oxidative stress: the molecular connectivity between insulin resistance, obesity, and Alzheimer\u0026rsquo;s disease. Mediators Inflamm. 2015; 2015:105828.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajamani U, Jialal I. Hyperglycemia induces Toll-like receptor-2 and \u0026ndash;\u0026thinsp;4 expression and activity in human microvascular retinal endothelial cells: implications for diabetic retinopathy. J. Diabetes Res. 2014; 2014:790902.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCryer PE. Hypoglycemia, functional brain failure, and brain death. J Clin Investig. 2007;117:868870.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBronisz A, Ozorowski M, Hagner DM. Pregnancy ketonemia and development of the fetal central nervous system. Int J Endocrinol 2018; (4):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe\u0026atilde;o LL, et al. Does hyperglycemia downregulate glucose transporters in the brain? Med Hypotheses. 2020;139(2):109614.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReznikov LR, Reagan L. Expression and Functional Activities of Glucose Transporters in the Central Nervous System. In book: Handbook of Neurochemistry and Molecular Neurobiology. 2007; (pp.387\u0026ndash;404).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayem ASM, et al. Action of phytochemicals on insulin signaling pathways accelerating glucose transporter (GLUT4) protein translocation. Molecules. 2018;23(2):258.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKantharidis P, et al. Diabetes complications: the microRNA perspective. Diabetes Metab Res Rev. 2011;60:1832\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKantharidis P, Wang B, Carew RM, Lan HY. Diabetes complications: the microRNA perspective. Diabetes Metab. 2011;60(7):1832\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStepien EL, Durak-Kozica M, Kami\u0026acute; A, Targosz-Korecka M, Libera M, Tylko G, Opali\u0026acute; A, Kapusta M, Solnica B, Georgescu A, et al. Circulating ectosomes: Determination of angiogenic microRNAs in type 2 diabetes. Theranostics. 2018;8(14):3874\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang X, Tang G, \u0026Ouml;zcan S. Role of microRNAs in diabetes. Biochim Biophys Acta. 2008;1779(11):697\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWelch C, Chen Y, Stallings R. MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2007;26(34):5017\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalasubramanyam M, et al. Impaired miR-146a expression links subclinical inflammation and insulin resistance in Type 2 diabetes. Mol Cell Biochem. 2011;351:197\u0026ndash;205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng HS, Sivachandran N, et al. MicroRNA-146 represses endothelial activation by inhibiting proinflammatory pathways. EMBO Mol Med. 2013;5:1017\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi K, Ching D, Luk FS, Raffai RL. Apolipoprotein E enhances microRNA-146a in monocytes and macrophages to suppress nuclear factor kappaB- driven inflammation and atherosclerosis. Circ Res. 2015;117:e1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYousefzadeh N, Alipour MR, Soufi FG. Deregulation of NF-small ka, CyrillicB-miR-146a negative feedback loop may be involved in the pathogenesis of diabetic neuropathy. J Physiol Biochem. 2015;71:51\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhatt K, Lanting LL, et al. AntiInflammatory Role of MicroRNA-146a in the pathogenesis of diabetic nephropathy. J Am Soc Nephrol. 2016;27:2277\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Feng B, Thomas AA, Chakrabarti S. miR-146a regulates glucose induced upregulation of inflammatory cytokines extracellular matrix proteins in the retina and kidney in diabetes. PLoS ONE. 2017;12:e0173918.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng B, Chen S, Gordon AD, Chakrabarti S. miR-146a mediates inflammatory changes and fibrosis in the heart in diabetes. J Mol Cell Cardiol. 2015;105:70\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYavari R, Badalzadeh R, Alipour MR, Tabatabaei SM. Modulation of hippocampal gene expression of microRNA-146a/microRNA-155-nuclear factor-kappa B inflammatory signaling by troxerutin in healthy and diabetic rats. Indian J Pharmacol. 2016;48:675\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldeon RL, Weigelt K, de Wit H, Ozcan B, van Oudenaren A, Sempertegui F, et al. Decreased serum level of miR-146a as sign of chronic inflammation in type 2 diabetic patients. PLoS ONE. 2014;9(12):e115209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaganov KD, Boldin MP, Chang KJ, Baltimore D. NF-kB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA. 2006;103(33):12481\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePedersen BK. Anti-inflammatory effects of exercise: role in diabetes and cardiovascular disease. Eur J Clin Invest. 2017;47(8):600\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarstoft K, Pedersen BK. Exercise and type 2 diabetes: focus on metabolism and inflammation. Immunol Cell Biol. 2016;94(2):146\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang X, Tang G, \u0026Ouml;zcan S. Role of microRNAs in diabetes. Biochim Biophys Acta. 2008;1779:697\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWelch C, Chen Y, Stallings R. MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2006;26(34):5017\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsteves JV, et al. Diabetes modulates MicroRNAs 29b\u0026ndash;3p, 29c\u0026ndash;3p, 199a\u0026ndash;5p and 532\u0026ndash;3p expression in muscle: possible role in GLUT4 and HK2 repression. Front Endocrinol. 2018;9:536.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBagge A, et al. MicroRNA-29a is up-regulated in beta-cells by glucose and decreases glucose stimulated insulin secretion. Biochem Biophys Res Commun. 2012;426(2):266\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoggli E, et al. Changes in microRNA expression contribute to pancreatic β-cell dysfunction in prediabetic NOD mice. Diabetes. 2012;61(7):1742\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey AK, et al. miR-29a levels are elevated in the db/db mice liver and its overexpression leads to attenuation of insulin action on PEPCK gene expression in HepG2 cells. Mol Cell Endocrinol. 2011;332(1\u0026ndash;2):125\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang J, et al. MicroRNA-29a-c decrease fasting blood glucose levels by negatively regulating hepatic gluconeogenesis. J Hepatol. 2013;58(3):535\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLong J, Wang Y, Wang W, Chang BH, Danesh FR. MicroRNA-29c is a signature microRNA under high glucose conditions that targets Sprouty homolog 1, and its in vivo knockdown prevents progression of diabetic nephropathy. J Biol Chem. 2011;286(13):11837\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNielsen LB et al. Circulating levels of microRNA from children with newly diagnosed type 1 diabetes and healthy controls: Evidence that miR-25 associates to residual beta-cell function and glycaemic control during disease progression. Exp. Diabetes Res. 2012; 2012(9):896362.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVolpicelli F, et al. The microRNA-29a modulates serotonin 5-HT7 receptor expression and its effects on hippocampal neuronal morphology. Mol Neurobiol. 2019;56(12):8617\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDooley, et al. The microRNA-29 Family Dictates the Balance Between Homeostatic and Pathological Glucose Handling in Diabetes and Obesity. Diabetes. 2016;65(1):53\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirata T, et al. Pathological and gene expression analysis of a polygenic diabetes model, NONcNZO10/LtJ mice. Gene. 2017;20:629:52\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMassart J, et al. Altered miR-29 expression in type 2 diabetes influences glucose and lipid metabolism in skeletal muscle. Diabetes. 2017;66(7):1807\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan C, et al. miR-29a promotes myocardial cell apoptosis induced by high glucose through down-regulating IGF-1. Int J Clin Exp Med. 2015;15(8):14352\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, et al. miR-29b contributes to multiple types of muscle atrophy. Nat Commun. 2015;8:1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlusarz A, Pulakat L. The two faces of miR-29. J Cardiovasc Med. 2015;16(7):480\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehi, et al. The Effects of Endurance Trainings on Serum BDNF and Insulin Levels in Streptozotocin-Induced Diabetic Rats. Neurosci J Shefaye Khatam. 2017;5(2):52\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarsen S, Danielsen JH, S\u0026oslash;nderg\u0026aring;rd SD, S\u0026oslash;gaard D, Vigelsoe A, Dybboe R, et al. The effect of high-intensity training on mitochondrial fat oxidation in skeletal muscle and subcutaneous adipose tissue. Scand J Med Sci Sports. 2015;25(1):59\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCarthy JJ, Esser KA. MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. J Appl Physiol. 2007;102(1):306\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Z, Qi J, Meng S, Wen B, Zhang J. Swimming exercise training-induced left ventricular hypertrophy involves microRNAs and synergistic regulation of the PI3K/AKT/mTOR signaling pathway. Eur J Appl Physiol. 2013;113(10):2473\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadom-Aizik S, Zaldivar F, Oliver S, Galassetti P, Cooper DM. Evidence for microRNA involvement in exercise associated neutrophil gene expression changes. J Appl Physiol. 2010;109(1):252\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImprota Caria AC, Nonaka CKV, Pereira CS, Soares MBP, Macambira SG, Souza BSF. Exercise training-induced changes in microRNAs: beneficial regulatory effects in hypertension, type 2 diabetes, and obesity. Int J Mol Sci. 2018;19(11):3608.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKangas R, T\u0026ouml;rm\u0026auml;kangas T, Heinonen A, Alen M, Suominen H, Kovanen V, et al. Declining physical performance associates with serum fasl, mir-21, and mir-146a in aging sprinters. Biomed Res Int. 2017;2017(14):1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOghbaei H, Asl NA, Sheikhzadeh F. Can regular moderate exercise lead to changes in mirNA 146a and its adapter proteins in the kidney of streptozotocin-induced diabetic male rats? Endocr Regul. 2017;51(3):145\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolanouri SM, Hassan ZH, Gharakhanlou R, Quinn LS, Azadmanesh K, Baghersad L, et al. Expression of interleukin-15 and inflammatory cytokines in skeletal muscles of STZ-induced diabetic rats: effect of resistance exercise training. Endocrine. 2014;46(1):60\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamuel RO, Gomes-Filho JE, Dezan-J\u0026uacute;nior E, Cintra LT. Streptozotocin-induced rodent models of diabetes: Protocol comparisons.2014.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzkaya YG, Agar A, Hacioglu G, Yargicoglu P. Exercise improves visual deficits tested by visual evoked potentials in streptozotocin-induced diabetic rats. Tohoku J Exp Med. 2007;213(4):313\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhaledi N, et al. The Effect of High-Intensity Interval Training on Apoptotic-Related Genes in Skeletal Muscle and Serumic TNF-Alpha of Diabetic Rats. IJDO. 2023;15(1):59\u0026ndash;65. \u0026lrm;.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSongstad NT, et al. Effects of High Intensity Interval Training on Pregnant Rats, and the Placenta, Heart and Liver of Their Fetuses. PLoS ONE. 2015;10(11):e0143095.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSara K, Mehran G. The Effect of High- and Low-Intensity Interval Training on Myostatin Gene Expression Levels in Muscles Fibers of Rats with Myocardial Infarction. J Nutr Fast Health. 2022;10(4):295\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCacho J, Sevillano J, de Castro J, Herrera E, Ramos P. Validation of simple indexes to assess insulin sensitivity during pregnancy in Wistar and Sprague-Dawley rats. Am Physiol Endocrinol Metab. 2008;295(5):E1269\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang CL, et al. Novel all-extremity high-intensity interval training improves aerobic fitness, cardiac function and insulin resistance in healthy older adults. Exp Gerontol. 2016;82:112\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasoumeh H, Maryam H. The synergistic effect of eight weeks high-intensity interval training and resveratrol consumption on il-10 and tnf-α in diabetic male rats. Iran J Diabetes Metabolism. 2020;19(3):134\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuh JY, et al. Irisin in response to exercise in humans with and without metabolic syndrome. J Clin Endocrinol Metab. 2015;100(3):E453\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eADA. Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes. Diabetes Care. 2011;34(1):4\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRose AJ, Richter EA. Skeletal muscle glucose uptake during exercise: how is it regulated? Physiology (Bethesda).2005:20:260\u0026thinsp;\u0026ndash;\u0026thinsp;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibala MJ, et al. Physiological adaptations to low-volume, high-intensity interval training in health and disease. J Physiol. 2012;590(5):1077\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibala MJ, McGee SL. Metabolic adaptations to short-term high-intensity interval training: a little pain for a lot of gain? Exerc Sport Sci Rev. 2008;36(2):58\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLovis P, Roggli E, Laybutt DR, Gattesco S, Yang JY, Widmann C, et al. Alterations in microrna expression contribute to fatty acid-induced pancreatic beta-cell dysfunction. Diabetes. 2008;57(10):2728\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImprota C, et al. Exercise Training-Induced Changes in MicroRNAs: Beneficial Regulatory Effects in Hypertension, Type 2 Diabetes, and Obesity. Int J Mol Sci. 2018;19(11):3608.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evahid s-s. Comparison of changes in miR-146a gene expression and serum levels of TNF-α, IL-6 and CRP following interval or continuous aerobic training with calorie restriction in obese women. (JPSBS). 2021;9(20):30\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Chen X-P, Li Y-J. MicroRNA-146a and human disease. Scand J Immunol. 2010;71(4):227\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlivieri F, et al. Toll like receptor signaling in inflammaging: microRNA as new players. Immun Ageing. 2013;19(1):11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDini S, et al. Quercetin\u0026ndash;conjugated superparamagnetic iron oxide nanoparticles modulate glucose metabolism\u0026ndash;related genes and miR\u0026ndash;29 family in the hippocampus of diabetic rats. Sci Rep. 2021;11(1):8618.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKriegel AJ, Liu Y, Fang Y, Ding X, Liang M, et al. The miR-29 family: genomics, cell biology, and relevance to renal and cardiovascular injury. Physiol Genomics. 2012;44(4):237\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEyholzer M, Schmid S, Wilkens L, Mueller BU, Pabst T, et al. The tumour-suppressive miR-29a/b1 cluster is regulated by CEBPA and blocked in human AML. Br J Cancer. 2010;103(2):275\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalkhi MY, Iwenofu OH, Bakkar N, Ladner KJ, Chandler DS, Houghton PJ et al. miR-29 acts as a decoy in sarcomas to protect the tumor suppressor A20 mRNA from degradation by HuR. Sci Signal. 2013; 6(286).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDahlmans D, et al. Evaluation of Muscle microRNA Expression in Relation to Human Peripheral Insulin Sensitivity: A Cross-Sectional Study in Metabolically Distinct Subject Groups. Front Physiol. 2017;8:711.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e` Sarah S, Benedikt S-K, et al. Evidence for Training-Induced Changes in miRNA Levels in the Skeletal Muscle of Patients With Type 2 Diabetes Mellitus. Front Physiol. 2020;3:11599651.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMassart J, Katayama M, Krook A. micro Managing glucose and lipid metabolism in skeletal muscle: role of microRNAs. Biochim Biophys Acta. 2016;1861(12 Pt B):2130\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrillo CA, et al. Insulin-stimulated translocation of GLUT4 to the plasma membrane in rat hippocampus is PI3-kinase dependent. Brain Res. 2009;3:1296:35\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv H, Tang L, Guo C, Jiang Y, Gao C, Wang Y, Jian C. Intranasal insulin administration may be highly effective in improving cognitive function in mice with cognitive dysfunction by reversing brain insulin resistance. Cogn Neurodyn. 2020;14(3):323\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReagan LP. Neuronal insulin signal transduction mechanisms in diabetes phenotypes. Neurobiol Aging 2005:26 Suppl 1:56\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorteza SA, et al. The effects of 8 weeks high intensity interval training on serum levels of TNF-α and insulin resistance index in obese men with type-2 diabetes. Health Serv. 2017;39(4):53\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTobias D, et al. Supervised Short-term High-intensity Training on Plasma Irisin Concentrations in Type 2 Diabetic Patients. Int J Sports Med. 2019;40(3):158\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMana D, Akbar NH, Behrouz B. The Effect of Eight Weeks of High-Intensity Interval Training with L-Cysteine Consumption on CRP and TNF-α in Heart Tissue of Young Rats with Type 2 Diabetes. Dis Diagn. 2023;12(4):187\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMirza S, et al. Type 2-Diabetes is Associated With Elevated Levels of TNF-alpha, IL-6 and Adiponectin and Low Levels of Leptin in a Population of Mexican American: A Cross Sectional Study. Cytokine. 2012;57(1):136\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"HIIT, Hippocampus, mir-29c, miR-146a, TNFα","lastPublishedDoi":"10.21203/rs.3.rs-4492446/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4492446/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground/objectives:\u003c/h2\u003e \u003cp\u003eMicroRNAs have been reported as potentially useful biomarkers for various diseases, including diabetes, heart diseases, and neurological diseases. The aim of this study was to assess whether microRNA-146a and its inflammatory mediator (TNF-a) and microRNA-29c may be changed in the hippocampus of streptozotocin-induced diabetic rats, after a period of high \u0026ndash; intensity interval training.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eTwenty-four male Wistar rats (180\u0026thinsp;\u0026plusmn;\u0026thinsp;10 g, 8\u0026ndash;10 weeks age) were assigned to 4 groups: control (C), diabetes (D-1w), diabetes (D-6w), and diabetes high-intensity interval training (DHIIT). Diabetes induced by the single-dose injection of streptozotocin (STZ; 55 mg/kg dissolved in 0.1 M of citrate buffer; pH 4.5; i.p.) in 12-h fasted and blood sugar higher than 250 was considered diabetic. The effects of six weeks of HIIT on hippocampus microRNA-146a, microRNA-29c, as well as evaluation of tumor necrosis factor-alpha (TNF-α ) in serum were evaluated using Real-Time PCR and ELISA techniques respectively.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results indicated a reduction in expression of miR-146a and an increase in expression of microRNA-29c genes in the hippocampus of diabetic rats compared to control. Also TNFα increased in the D groups in comparison with C group. However, HIIT training in DHIIT significantly decreased the microRNA-29c and TNFα and increased microRNA-146a expression in comparison of D-6w group.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur results implied that increased hyperglycemia and inflammation status were associated with brain impairment in DM rats, which were negatively correlated with miR-146a and microRNA-29c expression. It seems that HIIT training improves hypoglycemic and inflammatory conditions in diabetic rats.\u003c/p\u003e","manuscriptTitle":"The effect of 6 weeks of high intensity interval training (HIIT) on expression of mirRNA29-c and mirRNA146-a in the hippocampus of streptozotocin- induced diabetic male rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-11 14:57:29","doi":"10.21203/rs.3.rs-4492446/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a7b83944-650b-408e-b826-c8ab60e1229d","owner":[],"postedDate":"June 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-26T04:44:13+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-11 14:57:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4492446","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4492446","identity":"rs-4492446","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}