A Gaussia luciferase reporter assay for the evaluation of coronavirus Nsp5/3CLpro inhibitors | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A Gaussia luciferase reporter assay for the evaluation of coronavirus Nsp5/3CLpro inhibitors Asimenia Vlachou, Rayhane Nchioua, Kerstin Regensburger, Frank Kirchhoff, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4365319/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted 14 You are reading this latest preprint version Abstract Human coronaviruses (hCoVs) infect millions of people every year. Among these, MERS, SARS-CoV-1, and SARS-CoV-2 caused significant morbidity and mortality and their emergence highlights the risks associated with possible future coronavirus outbreaks. Therefore, broadly-active anti-coronavirus drugs are needed. Pharmacological inhibition of the hCoV protease 3CLpro (Nsp5) in COVID-19 patients is clinically beneficial as shown by the wide and effective use of Paxlovid (nirmaltrevir, ritonavir). However, further treatment options are required due to the emergence of drug resistance in some SARS-CoV-2 strains. To facilitate protease inhibitor discovery and evaluation, we developed an assay allowing rapid and reliable quantification of 3CLpro activity under biosafety level 1 conditions. It is based on an ACE2 receptor - Gal4 transcription factor fusion protein separated by a 3CLpro recognition site. Cleavage by 3CLpro releases the Gal4 transcription factor, which then induces the expression of Gaussia luciferase. Our assay is compatible with 3CLpro proteases from all hCoVs, and allows simultaneous measurement of inhibitory and cytotoxic effects of the tested compounds. Proof-of-concept IC 50 measurements confirmed that nirmaltrevir, GC376 and lopinavir inhibit SARS-CoV-2 3CLpro function without inducing cytotoxicity. Overall, the Gaussia luciferase-based reporter assay is suitable for evaluating viral protease function and screening of potential 3CLpro inhibitors. Biological sciences/Microbiology/Virology/Sars cov 2 Biological sciences/Drug discovery/Drug screening Biological sciences/Biological techniques SARS-CoV-2 coronaviruses Gaussia reporter assay Nsp5 3CLpro protease inhibitor Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Since 2019, the coronavirus disease 2019 (COVID-19) pandemic claimed the lives of more than seven million people and affected the health and livelihoods of almost everyone [ 1 ]. Prior to the emergence of its causative agent, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), four other human coronaviruses (hCoVs), often referred to as common cold coronaviruses (ccCoVs; NL63, 229E, OC43 and HKU1) were endemic, and two others - Severe Acute Respiratory Syndrome (SARS-CoV-1) and Middle East Respiratory Syndrome (MERS-CoV) – caused regionally limited epidemic outbreaks of severe respiratory diseases [ 2 ]. ccCoV infections generally do not require medical intervention in healthy individuals, but can lead to hospitalization and death in children, elderly and immunocompromised patients[ 3 ]. In comparison, SARS-CoV-1, SARS-CoV-2 and MERS-CoV infections are more severe with average case fatality rates of approximately 10%, 1% and 40%, respectively [ 4 ], [ 5 ], [ 6 ]. The repeated emergence of hCoVs in the recent decades and the speed at which SARS-CoV-2 spread globally highlight the risk of possible future outbreaks of novel zoonotic coronaviruses. Altogether, there is a need to develop effective and broadly active antiviral compounds against the present and future strains of hCoVs. All coronaviruses have large RNA (25–32 kb) RNA genomes, two thirds of which is taken by open reading frame (ORF) 1ab . The product, polyprotein pp1ab, is cleaved into 16 non-structural proteins (Nsp) by 2 viral proteases, the papain-like protease Nsp3 and the main protease Nsp5 [ 3 ]. Both of these enzymes are functionally conserved among coronaviruses and are essential for their replication. Thus, they represent useful targets of antiviral therapies. Nsp3 cleaves pp1ab at 3 sites leading to Nsps 1–3, while the main protease Nsp5 cleaves at 11 sites, generating the remaining Nsps 4–16 [ 3 ]. Protease inhibitors that block pp1ab processing are highly efficient at limiting CoV replication, as they target an early and essential step in virus replication. Paxlovid, a combination of the two viral protease inhibitors nirmatrelvir and ritonavir, is one of the few approved and widely used treatments for COVID-19 and has been reported to show ~ 88% efficacy in preventing hospitalization or death [ 7 ]. Alarmingly, recent studies identified several mutations in the SARS-CoV-2 3CLpro protease that give rise to nirmatrelvir resistance, highlighting the need for additional anti-coronavirus compounds [ 8 ], [ 9 ], [ 10 ], [ 11 ], [ 12 ], [ 13 ], [ 14 ], [ 15 ]. Other protease inhibitors have been considered but are not currently approved for COVID-19 treatment. For example, GC376 is used in veterinary medicine to treat fatal feline coronavirus infection, and lopinavir blocks retroviral protease activity and is used in anti-retroviral therapy of HIV-infected patients [ 16 ], [ 17 ], [ 18 ]. Lufotrelvir is the phosphate prodrug of the 3CLpro inhibitor PF-00835231 [ 19 ]. Lufotrelvir was investigated in pre-clinical and clinical trials against COVID-19 but was less successful than nirmatrelvir due to its low oral bioavailability and fast systemic clearance [ 20 ]. Additional 3CLpro inhibitors such as simotrelvir, bofutrelvir and 11d, have shown promising efficacy and tolerability in vitro and in vivo [ 21 ], [ 22 ], [ 23 ], [ 24 ]. While still not widely available, U.S. Food and Drug Administration (FDA) has granted the Fast Track designation for an investigational COVID-19 oral antiviral ensitrelvir following its approval in Japan and Singapore [ 25 ].Since experiments with infectious SARS-CoV-2, SARS-CoV-1, and MERS require biosafety level 3 facilities, virus-free drug screening platforms are strongly desired to foster drug discovery. Since 2020, several SARS-CoV-2 protease reporter assays have been developed [ 26 ], [ 27 ], [ 28 ]. These methods mostly rely on the quantification of the fluorescence signal produced upon 3CLpro-mediated cleavage of Flip-GFP inducing its conformational change from a non-fluorescent to a fluorescent state. However, this approach is associated with significant background signal due to activation by cellular proteases and does not allow to easily distinguish between protease-specific and cytotoxicity-related decreases in cell fluorescence. GFP is also pH-sensitive and prone to photobleaching, which might lead to a lack of reproducibility during high-throughput drug screening. To overcome these issues, we designed a Gaussia luciferase-based 3CLpro reporter system that produces a robust signal within as little as 24 h and is compatible with affordable and effective MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability measurements. Reporters based on secreted Gaussia luciferase offer non-invasive sampling and kinetic measurements, high stability, and compatibility with virus inactivation procedures. Thus, they represent useful tools for studying 3CLpro function and inhibition. Results Generation of a Gaussia luciferase-based coronavirus 3CLpro activity reporter 3CLpro (Nsp5) is crucial for processing of Nsps 5–16, making it an essential component of the SARS-CoV-2 replication machinery (Fig. 1 A). 3CLpro cleaves after a glutamine motif (Q) [ 3 ], which is highly conserved and found at all SARS-CoV-2 Nsp5-16 borders (Fig. 1 B). To exploit the specificity of 3CLpro in designing a novel coronavirus reporter assay, we generated a plasmid encoding a fusion protein of angiotensin-converting-enzyme 2 (ACE2), and the transcription factor galactose utilization 4 (Gal4). ACE2 was selected due to its role as the major entry receptor of three human coronaviruses (SARS-CoV-1, SARS-CoV-2 and NL63) to facilitate CoV infection of otherwise poorly permissive HEK293T cells. The two components were joined by a flexible G/S-linker containing the 3CLpro recognition sequence ARLQSGF. In the presence of active 3CLpro, this fusion protein undergoes cleavage and Gal4, which contains a nuclear import signal, translocates to the nucleus, where it activates the transcription of an integrated Gaussia luciferase reporter (Fig. 1 C). Gaussia luciferase is then released into the cell supernatant, where it can be detected in a non-invasive manner following the addition of its substrate coelenterazine. This method produces a stable luminescence signal, which allows to readily measure changes in 3CLpro activity without cell staining or lysis. It is also compatible with assays measuring cell viability/metabolic activity, such as the cost-effective MTT, which is commonly used to evaluate drug candidate cytotoxicity (Fig. 1 D). At 18 h post-transfection, the assay showed a dose-dependent increase in Gaussia luciferase activity with no signs of protease-induced cytotoxicity (Fig. 1 E-F). The reporter detected as little as 4 ng of the transfected Nsp5 expression construct, indicating that it is a sensitive and robust method of evaluating coronavirus 3CLpro activity. The results were highly reproducible and the highest Nsp5 gene dose (500 ng) resulted in an ~ 8-fold increase in Gaussia activity over background at 18 h post-transfection (Fig. S1 A). With longer incubation times the background signal increased gradually, leading to a lower signal-to-noise ratio at later time points (Fig. S1 B). Therefore, 18h was selected as a standard for further experiments. Dose-dependent cleavage of the ACE2-Gal4 reporter by Nsp5 was also observed in Western blot analysis of the transfected cell lysates, although this method was less sensitive than the luciferase reporter assay (Fig. 1 G). Overall, the developed 3CLpro reporter was found to be a sensitive and rapid new method of quantifying SARS-CoV-2 main protease activity. Comparison of the activity of 3CLpro proteins from all seven hCoVs The Nsp5 proteins encoded by the seven different hCoVs have conserved function and all contain H41 and C145 catalytic residues. However, these homologs share less than 50% amino acid sequence identity, with multiple changes within the reported substrate binding site [ 29 ] (Fig. 2 A). Therefore, we investigated if the developed 3CLpro reporter could detect the activity of proteases from diverse hCoVs. To address this, we synthesized expression constructs containing codon-optimized Nsp5 sequences from the seven hCoV species and co-expressed each of them with the ACE2-Gal4 reporter. The expression of 3CLpro from all hCoVs led to significant and dose-dependent increases in reporter activity, with NL63 (alpha-coronavirus), OC43 and HKU1 (beta-coronaviruses) showing up to 15-fold increase over background at the highest dose of 500 ng (Fig. 2 B). Expression of 3CLpro from SARS-CoV-1, MERS or 229E resulted in 7- to 9-fold signal increases at the highest dose, which was consistent with the lower efficiency of ACE2-Gal4 reporter cleavage observed in western blotting of cell lysates (Fig. 2 C). Furthermore, the expression levels of Nsp5 proteins did not correlate with reporter activation (Fig. 2 D). This suggests that proteases from different hCoVs might not be equally active and/or have different substrate preferences, which might be linked to mutations found upstream and downstream of the glutamine cleavage sites in the Nsp5 substrates of distinct hCoV species (Fig. S2). Overall, the activity of all hCoV Nsp5s could be quantified by the 3CLpro reporter, showing a substantial overlap in substrate recognition and cleavage and highlighting the suitability of the developed assay for studying protease activity by diverse hCoVs. 3CLpro reporter is compatible with hCoV inactivation procedures and activated by virally expressed Nsp5 During SARS-CoV-2 infection, ORF1ab, which encodes all nonstructural proteins including Nsp5, is the most abundantly expressed viral transcript [ 30 ]. To verify if the 3CLpro reporter assay is sensitive enough to detect the activity of endogenously expressed Nsp5, we measured the reporter activation after hCoV infection. We first confirmed that similarly to wild type ACE2 protein, the ACE2-Gal4 fusion protein promotes SARS-CoV-2 infection of the otherwise poorly-permissive HEK293T cells used in this assay (Fig. 3 A). To test whether the 3CLpro assay is sensitive enough to detect endogenous 3CLpro activity, it was necessary to first evaluate whether the reporter is compatible with any of the temperature, alcohol, and various detergents and fixative-based coronavirus inactivation procedures (Fig. S3). Gaussia luciferase-containing culture supernatants were unaffected by the tested conditions, with the exception of 4% PFA and 0.5% SDS treatment (Fig. S3). We therefore sought to evaluate the performance of the reporter assay following SARS-CoV-2 sample inactivation at 65°C for 30 min. Following infection, a significant increase in the Gaussia luciferase signal was observed for both of the tested multiplicities of infection (MOIs) after 24 h (Fig. 3 B). Cleavage of the ACE2-Gal reporter was also clearly visible in western blot analysis of cellular lysates harvested 3 days post infection (Fig. 3 C). Notably, ACE2-Gal4 reporter cleavage was also observed after infection with the ACE2-utilizing NL63 CoV but not with hCoVs OC42 and 229E that use other receptors for entry (Fig. S4). These results demonstrate that the sensitivity of the 3CLpro reporter assay is unaffected by most virus inactivation procedures and it can be utilized to detect endogenous Nsp5 activity of ACE2-utilizing hCoVs. Evaluation of viral protease inhibitor activity using the 3CLpro reporter assay Nirmatrelvir is currently the only widely used coronavirus 3CLpro inhibitor [ 31 ]. However, several other protease inhibitors such as GC376, lopinavir and PF-00835231 have been evaluated in vitro and show potential for targeting 3CLpro [ 16 ], [ 17 ], [ 18 ], [ 32 ]. To verify the activity of these inhibitors and compare their relative effectiveness in inhibiting the main protease of SARS-CoV-2, we tested them in our 3CLpro reporter assay, with nirmatrelvir serving as a positive control. Nirmatrelvir and GC376 treatment significantly decreased the Gaussia luciferase signal in Nsp5-transfected HEK293T Gaussia reporter cells at concentrations ≥ 20 µM, with IC 50 values of 83 µM and 86 µM, respectively (Fig. 4 A-B). Lopinavir was also found to significantly inhibit 3CLpro at ≥ 20 µM with an IC 50 of 21 µM but appeared to be cytotoxic at all of the tested active concentrations (Fig. 4 C). For PF-00835231, 100 µM was the lowest tested dose that significantly inhibited 3CLpro reporter activity, whereby the IC50 was estimated by interpolation to be 39 µM; however, this and higher doses strongly reduced cell viability (Fig. 4 D). The low specific activity of this compound could be due to the efflux transporter P-glycoprotein, which is highly expressed in HEK293T cells and was previously reported to diminish the effects of PF-00835231 [ 20 ], [ 33 ]. To determine if lopinavir and PF-00835231 inhibit 3CLpro activity at concentrations that do not affect cell viability, additional concentrations were tested. Lopinavir was found to be effective and non-cytotoxic within the 8–64 µM concentration range with an IC50 of 12 µM (Fig. 4 E), while PF-00835231 did not have a significant effect on 3CLpro at non-cytotoxic concentrations ≤ 50 µM (Fig. 4 F). Overall, the 3CLpro reporter assay was found to be suitable for the evaluation of viral protease inhibitors and showed that nirmaltrevir and GC376 have similar inhibitory efficacy, while lopinavir is more effective but also more cytotoxic. Discussion We developed and evaluated a reporter assay for fast and efficient screening of inhibitors of the functionally conserved hCoV protease 3CLpro (Nsp5), which is among the most promising targets for treating coronavirus infections [ 32 ]. Our assay allows simultaneous quantification of a compound’s potency and cytotoxicity within 24 h, and can facilitate the discovery and evaluation of coronavirus protease inhibitors in the future. Whereas the currently most widely used COVID-19 treatment Paxlovid already targets 3CLpro, the development of further inhibitors is warranted due to the risk of drug resistance [ 8 ], [ 9 ], [ 10 ]. Our assay can be performed in a 96-well format, requires only a luminescence plate reader, and is compatible with the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cytotoxicity assay, supporting high-throughput screening and rapid evaluation of potency and specificity. hCoV 3CLpro proteases show 20–50% overall amino sequence diversity but share core structural homology and have similar substrate specificity [ 29 ]. Therefore, it is possible to develop broadly active hCoV protease inhibitors and a universal assay to study their activities [ 26 ]. We demonstrated that our reporter is compatible with 3CLpro homologs from all seven human coronaviruses as well as with most virus inactivation procedures. Furthermore, the assay has high sensitivity and a dynamic range of approximately 10-fold between the lowest and the highest tested dose, making it suitable for reliable quantification of potency. Using proof-of-concept assessments of IC 50 values of nirmaltrevir, GC376, and lopinavir, we demonstrated the suitability of our system for evaluating SARS-CoV-2 3CLpro inhibitors. There has been substantial interest in 3CLpro reporter assays since the start of the SARS-CoV-2 pandemic, and several versions of such assays exist, many of which rely on fluorescent Flip-GFP technology [ 26 ], [ 27 ], [ 28 ], [ 34 ], [ 35 ], [ 36 ]. Our luciferase-based assay overcomes several disadvantages of GFP-based reporters, such as their considerable confound by pH, the potential autofluorescence of tested compounds, and photobleaching. Compared to GFP, Gaussia luciferase offers higher stability and thus more reliable quantification [ 37 ], [ 38 ]. Furthermore, the secretion of the luciferase reporter into cell media allows non-invasive sampling and long-term sample storage. While screening for potential 3CLpro inhibitors in a virus-free mode is certainly its most prominent application, our assay could also be further optimized towards higher sensitivity for the detection of endogenous 3CLpro activity resulting from actual hCoV infections. This is enabled by the fusion of the 3CLpro cleavage sequence to human ACE2, which serves as major entry receptor for SARS-CoV-1, SARS-CoV-2, and NL63. The resulting receptor-reporter fusion protein effectively promoted SARS-CoV-2 entry into the otherwise poorly permissive HEK293T cells[ 39 ]. Notably, the produced Gaussia luciferase signal withstood temperature and disinfectant-based virus inactivation procedures without compromising assay sensitivity. The assay detected 3CLpro activity of all human coronaviruses (SARS-CoV-1, SARS-CoV-2, MERS, NL63, OC43, 229E, and HKU1), supporting rapid testing of inhibitors against both existing and potentially emerging pathogens. This finding also implies that it can be used to compare the drug sensitivity and protease function of different coronavirus lineages and to monitor the impact of 3CLpro and pp1ab mutations in emerging SARS-CoV-2 variants on nirmaltrevir sensitivity. While our assay is currently limited to the detection of inhibitors of 3CLpro, its design principle can be reiterated to develop reporter assays for other viral proteases, such as hCoV PLpro. Recent studies reported that SARS-CoV-2 3CLpro cleaves not only the viral polyprotein 1ab but also cellular factors such as NF-κB Essential Modulator (NEMO), septin and Caspase recruitment domain-containing protein 8 (CARD8) which play roles in immune sensing and cell homeostasis [ 40 ], [ 41 ], [ 42 ]. Our assay could be utilized for studying cellular 3CLpro substrates and to evaluate inhibitors that not only directly limit viral replication through blocking pp1ab processing but also prevent the 3CLpro associated cellular dysfunction. Since our drug evaluations were performed using higher Nsp5 expression levels from overexpressed plasmid as compared to the endogenous levels observed during infection, the IC 50 values assay are likely to be higher than those measured during experiments utilizing a genuine virus. Indeed, the reported IC 50 values of nirmaltrevir obtained during SARS-CoV-2 infection assays in cell lines are 10 times lower than those measured in our study [ 8 ]. Therefore, it is highly advisable for any drug screening study to confirm the activity of newly discovered inhibitors using independent methods and in the context of genuine virus infection. Overall, our findings highlight the application of the developed Gaussia luciferase-based reporter assay for studying coronavirus protease function and identifying/evaluating antiviral drug candidates. Other potential applications include monitoring the impact of emerging SARS-CoV-2 3CLpro mutations on proteolytic activity and drug sensitivity. Although already highly versatile in its current form, the assay could be easily modified to study the function other viral proteases, as well as the impact of mutations and polymorphisms at the 3CLpro recognition site. The sensitivity, compatibility, and rapid and broad applicability of this assay make it a valuable tool for drug discovery efforts aimed at combating current and future coronavirus outbreaks. Materials and Methods Cell lines and culture HEK293T B0166 Gal4 Gaussia luciferase reporter cells [ 43 ], [ 44 ] were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, catalog no. 41965039) supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco, catalog no. 10270106), 2 mM L-glutamine (Gibco, catalog no. 25030081), 100 units/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher, catalog no. 15140122). Huh7 (human hepatocyte-derived carcinoma cell line), LLC-MK2 (rhesus monkey kidney epithelial cell line) and Vero E6 cells ( Cercopithecus aethiops -derived epithelial kidney line; ATCC) were grown in DMEM with 10% FCS, 100 U/mL penicillin, 100 µg/mL streptomycin and 2 mM L-glutamine. ACE2-Gal4 reporter and hCoV Nsp5 construct cloning hACE2 was amplified from pLV-EF1a-human ACE2-IRES-puro template (primers: TAGAAGCGCGTAGGCCTTTCTAGACCATGTCAAGCTCTTCCTGGCTCCTT and AAATCCACTTTGAAGACGAGCTACTCCTCCTCCAAAGGAGGTCTGAACATCAT; Biomers.net) while Gal4-p65 fusion protein sequence was amplified from MaMTH C-tagged bait vector (primers: CTCGTCTTCAAAGTGGATTTGGAGGAGGAATGAAGCTACTGTCTTCTAT and TAGTACTCCGGGATCCGAACGCGTTACGTAGAATCGAGACCGAG; Biomers.net). The PCR products were ligated into XbaI/MluI HF digested pCG IRES eGFP vector using Gibson assembly (NEB). The correctness of the final construct (pCG hAEC2-VARLQSGF- Gal4-p65 IRES eGFP) was confirmed by Sanger sequencing (Eurofins Genomics). Codon-optimized hCoV Nsp5 sequences were synthesized by Twist Bioscience. Strep-tagged ORFs were cloned by Gibson assembly (NEB) into the EcoRI/BamHI sites of pLVX-EF1alpha − 2xStrep-IRES-Puro vector using the primers: 2229Efwd: (gaggatctatttccggtgaattcaccatggcagggctgaggaaa), 229Erev: (gggagggagaggggcgggatcctcacttttcaaactg), OC43fwd: (gaggatctatttccggtgaattcaccatgtctggcattgtcaaa), OC43rev: (gggagggagaggggcgggatccctacttttcaaactg), NL63fwd: (gtcgtgaggatctatttccggtgaattcgccgccaccatgtcaggcctgaagaagatg), NL63rev: (gttaggggggggggagggagaggggcgggatcctcatttctcgaactggggatg), HKU1fwd: (gaggatctatttccggtgaattcaccatgagtggcatagtaaaa), HKU1rev: (gggagggagaggggcgggatcctcacttttcaaactg), MERSfwd: (gaggatctatttccggtgaattcaccatgtcaggactggtgaag), MERSrev: (gggagggagaggggcgggatcctcatttctcaaattg), SARS-CoV-1fwd: (gaggatctatttccggtgaattcaccatgagtggcttcaggaaa), SARS-CoV-1rev: (gggagggagaggggcgggatcctcatttttcaaactg). The correctness of the final constructs was confirmed by Sanger sequencing (Eurofins Genomics). Western blotting To examine the cleavage of hACE2-Gal4 protein by overexpressed Nsp5 proteins or following hCoV infection, cells were lysed in coimmunoprecipitation (CO-IP) buffer (150 mM NaCl, 50 mM HEPES, 5 mM EDTA, 0.10% NP-40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche). Samples were reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min. Proteins were separated in 4–12% Bis-Tris gradient acrylamide gels (Invitrogen), blotted onto a polyvinylidene difluoride (PVDF) membrane, and incubated with Strep Tag (Cat#ab76949; Abcam), ACE2 (Cat# sc-390851; Santa Cruz Biotechnology), GAPDH (Cat# 607902; BioLegend), Hsp90 (Cat# sc-13119, Santa Cruz Biotechnology) SARS-CoV-2 N (Cat#GTX135357, GenTex), GFP (Cat# ab290, Abcam), NL63 N (Cat#M.30.HCo.I2D4, Ingenasa), OC43 N (Cat# MAB9012, Millipore) and 229E N (Cat# 40640-T62, SinoBiological) antibodies. Subsequently, blots were probed with IRDye 680RD goat anti-rabbit IgG(H + L) (catalog no. 926-68071; LI-COR), IRDye 800CW goat anti-mouse IgG(H + L) (catalog no. 926-32210; LI-COR) or IRDye 800CW goat anti-rat IgG(H + L) (catalog no. 926-32219; LI-COR) Odyssey antibodies and scanned using a LI-COR Odyssey reader. SARS-CoV-2 Nsp5 cleavage site analysis and sequence alignment The Nsp5 cleavage sites of reference SARS-CoV-2 strain 1ab sequence (GenBank: NC_045512.2), as well as Nsp5 sequences of other hCoVs (NL63: NC_005831.2; 229E: NC_002645.1, OC43: NC_006213.1, HKU1: NC_006577.2, SARS: NC_004718.3, MERS: NC_019843.3) were aligned using Multialign tool ( http://multalin.toulouse.inra.fr/multalin/ ) [ 45 ]. Sequence logos were generated using WebLogo creator ( https://weblogo.berkeley.edu/logo.cgi ) [ 46 ], [ 47 ]. Transfection of reporter cells BOI66 cells (0.3 million per well in 12-well format) were incubated overnight at 37°C. The following day the cells were transfected with 500ng 3CLpro reporter and 0-500ng of Nsp5 or GFP control DNA using PEI Max or LT1. The medium was changed 5–16 h after transfection to either DMEM only (Nsp5 overexpression experiments), DMEM containing hCoVs (hCoV infection experiments), or DMEM containing different concentrations of 3CLpro inhibitors (for the IC50 titration experiments), as indicated in the figure legends. Gaussia luciferase assay Supernatants from the transfected cells were harvested at 18–48 h post-transfection unless otherwise stated. Gaussia luciferase activity was measured using luminometer plate reader, 2 s after the injection of the coelenterazine substrate. MTT assay To measure the metabolic activity of reporter cells, 100µl of Methyl-Thiazolyl blue–Tetrazolium bromide salt (MTT-salt) was added to cells in 900µl medium (12-well plate). The plates were incubated at 37°C for 3h. Formed salt crystals were dissolved in 1 ml of DMSO/EtOH solution. The solution was transferred to a flat bottom 96-well plate followed by measurement at 490nm – 650nm using a plate reader. hCoV virus stock generation The BetaCoV/Netherlands/01/NL/2020 strain was obtained from the European Virus Archive and propagated on Vero E6 cells. Cells were inoculated with the SARS-CoV-2 isolate (MOI of 0.03 to 0.1) in serum-free medium. The cells were incubated at 37°C. HCoV-229E was obtained from ATCC (VR-740TM) and HCoV-OC43 was obtained from ATCC (CR-1558TM). HCoV-NL63 was propagated on LLC-MK2 cells, and 229E and OC43 were propagated on Huh7 cells as described previously [ 48 ]. The virus stocks were harvested when the cytopathic effect (CPE) became apparent. The cells were incubated at 37°C (SARS-CoV-2) or 32°C (remaining hCoVs). The virus stocks were centrifuged for 5 min at 1,000 × g to remove cellular debris, aliquoted, and stored at − 80°C until further use. hCoV infection BOI HEK293T cells were transfected with ACE2-Gal4 (0.5µg plasmid, 12-well plate) and 12 h later inoculated with SARS-CoV-2 strain NL-2020, NL63, OC43 or 229E at different MOIs as previously described [ 49 ]. SARS-CoV-2 infected cells were incubated at 37°C and other hCoV infected cells were kept at 32°C. After 6 h input virus was removed and cells were washed in PBS three times. The last PBS wash was kept as a negative control for qRT PCR. Fresh DMEM medium was added and the supernatants and cell were harvested 30 h post transfection. qRT PCR RNA from virus-infected cell supernatants was isolated using QIAamp viral RNA minikit (Qiagen, cat#52904) according to the manufacturer’s instructions. Real-time quantitative PCR (RT-qPCR) was performed as previously described[ 50 ] using TaqMan Fast Virus 1-step master mix (Thermo Fisher, catalog no. 4444436). The sequences of the primers and probe for SARS-CoV-2 N gene were as follows: forward primer (HKU-NF), 5′-TAA TCA GAC AAG GAA CTG ATT A-3′; reverse primer (HKU-NR), 5′-CGA AGG TGT GAC TTC CAT G-3′; probe (HKU-NP), 5′-FAM (6-carboxyfluorescein)-GCA AAT TGT GCA ATT TGC GG-TAMRA (6-carboxytetramethylrhodamine)-3′. Primers were purchased from Biomers (Ulm, Germany). Synthetic SARS-CoV-2 RNA (Twist Bioscience, catalog no. 102024) was used as a quantitative standard to obtain viral copy numbers. All reactions were run in triplicate. TCID50 assay To determine the infectious titers of hCoV-229E, hCoV-NL63, and hCoV-OC43, 10,000 Huh-7 cells or Caco-2 (SARS-CoV-2) were seeded 1 day before infection in a 96-well plate. The following day, cells were inoculated with a 10-fold serial dilution of the respective virus stock. 4–7 days after infection, cytopathic effects were observed by light microscopy and the tissue culture infectious dose 50 (TCID50) was calculated according to Reed-Münch method [ 51 ]. Statistical and IC50 analysis Statistical analysis was performed using GraphPad Prism software. Two-tailed Student’s t -test were used to determine statistical significance. Significant differences are indicated as: *, p < 0.05; **, p < 0.01; ***, p < 0.001. The statistical parameters used are specified in the figure legends. IC50 values were calculated using GraphPad Prism software (non-linear fit [Inhibitor vs. response] option). Declarations Acknowledgements We thank Regina Burger, Jana Romana Fischer, Daniela Krnavek, Martha Mayer, Birgit Ott, and Nicola Schrott for laboratory assistance. Prof. Nevan Krogan (University of California San Francisco) kindly provided the pLVX-EF1alpha GFP and SARS-CoV-2 Nsp5 constructs. pLV-EF1a-human ACE2-IRES-puro plasmid was kindly provided by Prof. Kei Sato (University of Tokyo). Prof. Igor Stagljar (University of Toronto) kindly provided the HEK293T BOI66 Gal4 reporter cells and Gal4 plasmid. Huh7 cells were kindly provided by Dr. Anna-Laura Kretz (Ulm University Medical Center) and LLC-MK2 cells were kindly provided by Prof. Lia van der Hoek (Amsterdam University). We thank Prof. Dennis Kätzel (Ulm University) and Prof. Konstantin Sparrer (Ulm University) for critical reading of the article and helpful discussions. Author contributions Conceptualization and funding acquisition: DK and FK; experiments: AV, RN, KR and DK; analysis and writing of the original draft: DK; revision: all authors. Data availability statement The primary datasets generated and analyzed during the study that are not included in the supplementary material are available from the corresponding author upon request. Funding This work was supported by a Marie Sklodowska-Curie Fellowship (to DK), by the Else-Kröner-Fresenius Stiftung (to DK), and by the German Research Foundation (DFG KM 5/3-1 to DK, CRC 1279 Young Investigator Award to DK; CRC 1279 grant to FK, SPP 1923 grant to FK). Competing Interests Statement The authors report that there are no competing interests to declare. References “Coronavirus disease (COVID-19).” Accessed: Apr. 18, 2024. [Online]. Available: https://www.who.int/news-room/fact-sheets/detail/coronavirus-disease-(covid-19 ) H. Hoenigsperger, R. Sivarajan, and K. M. Sparrer, “Differences and similarities between innate immune evasion strategies of human coronaviruses,” Curr. Opin. Microbiol., vol. 79, p. 102466, Jun. 2024, doi: 10.1016/j.mib.2024.102466 . P. V’kovski, A. Kratzel, S. Steiner, H. Stalder, and V. Thiel, “Coronavirus biology and replication: implications for SARS-CoV-2,” Nat. Rev. Microbiol. , vol. 19, no. 3, Art. no. 3, Mar. 2021, doi: 10.1038/s41579-020-00468-6 . J. S. M. Peiris, K. Y. Yuen, A. D. M. E. Osterhaus, and K. Stöhr, “The Severe Acute Respiratory Syndrome,” N. Engl. J. Med. , vol. 349, no. 25, pp. 2431–2441, Dec. 2003, doi: 10.1056/NEJMra032498 . B. M. J. Lampl, B. Edenharter, M. F. Leitzmann, and B. Salzberger, “COVID-19-related deaths: a 2-year inter-wave comparison of mortality data from Germany,” Infection , vol. 51, no. 4, pp. 1147–1152, Aug. 2023, doi: 10.1007/s15010-023-01982-4 . Munster Vincent J., Koopmans Marion, van Doremalen Neeltje, van Riel Debby, and de Wit Emmie, “A Novel Coronavirus Emerging in China — Key Questions for Impact Assessment,” N. Engl. J. Med. , vol. 382, no. 8, pp. 692–694, Feb. 2020, doi: 10.1056/NEJMp2000929 . E. Mahase, “Covid-19: Pfizer’s paxlovid is 89% effective in patients at risk of serious illness, company reports,” BMJ , vol. 375, p. n2713, Nov. 2021, doi: 10.1136/bmj.n2713 . S. Iketani et al. , “Multiple pathways for SARS-CoV-2 resistance to nirmatrelvir,” Nature , vol. 613, no. 7944, Art. no. 7944, Jan. 2023, doi: 10.1038/s41586-022-05514-2 . Y. Zhou et al. , “Nirmatrelvir-resistant SARS-CoV-2 variants with high fitness in an infectious cell culture system,” Sci. Adv., vol. 8, no. 51, p. eadd7197, Dec. 2022, doi: 10.1126/sciadv.add7197 . S. Lan et al. , “Nirmatrelvir Resistance in SARS-CoV-2 Omicron_BA.1 and WA1 Replicons and Escape Strategies.” bioRxiv, p. 2022.12.31.522389, Jan. 03, 2023. doi: 10.1101/2022.12.31.522389 . S. A. Moghadasi, R. G. Biswas, D. A. Harki, and R. S. Harris, “Rapid resistance profiling of SARS-CoV-2 protease inhibitors,” Npj Antimicrob. Resist. , vol. 1, no. 1, pp. 1–4, Aug. 2023, doi: 10.1038/s44259-023-00009-0 . Y. Hu et al. , “Naturally Occurring Mutations of SARS-CoV-2 Main Protease Confer Drug Resistance to Nirmatrelvir,” ACS Cent. Sci. , vol. 9, no. 8, pp. 1658–1669, Aug. 2023, doi: 10.1021/acscentsci.3c00538 . J. D. Ip et al. , “Global prevalence of SARS-CoV-2 3CL protease mutations associated with nirmatrelvir or ensitrelvir resistance,” EBioMedicine, vol. 91, p. 104559, May 2023, doi: 10.1016/j.ebiom.2023.104559 . D. Jochmans et al. , “The Substitutions L50F, E166A, and L167F in SARS-CoV-2 3CLpro Are Selected by a Protease Inhibitor In Vitro and Confer Resistance To Nirmatrelvir,” mBio , vol. 14, no. 1, p. e0281522, Feb. 2023, doi: 10.1128/mbio.02815-22 . E. Heilmann et al. , “A VSV-based assay quantifies coronavirus Mpro/3CLpro/Nsp5 main protease activity and chemical inhibition,” Commun. Biol. , vol. 5, no. 1, Art. no. 1, Apr. 2022, doi: 10.1038/s42003-022-03277-0 . K.-T. Choy et al. , “Remdesivir, lopinavir, emetine, and homoharringtonine inhibit SARS-CoV-2 replication in vitro,” Antiviral Res., vol. 178, p. 104786, Jun. 2020, doi: 10.1016/j.antiviral.2020.104786 . B. Cao et al. , “A Trial of Lopinavir–Ritonavir in Adults Hospitalized with Severe Covid-19,” N. Engl. J. Med., vol. 382, no. 19, pp. 1787–1799, May 2020, doi: 10.1056/NEJMoa2001282 . K. Sharun, R. Tiwari, and K. Dhama, “Protease inhibitor GC376 for COVID-19: Lessons learned from feline infectious peritonitis,” Ann. Med. Surg., vol. 61, pp. 122–125, Dec. 2020, doi: 10.1016/j.amsu.2020.12.030 . C. Allais et al. , “Early Clinical Development of Lufotrelvir as a Potential Therapy for COVID-19,” Org. Process Res. Dev. , vol. 27, no. 12, pp. 2223–2239, Dec. 2023, doi: 10.1021/acs.oprd.2c00375 . M. de Vries et al. , “A comparative analysis of SARS-CoV-2 antivirals characterizes 3CLpro inhibitor PF-00835231 as a potential new treatment for COVID-19,” J. Virol. , vol. 95, no. 7, pp. e01819-20, JVI.01819-20, Mar. 2021, doi: 10.1128/JVI.01819-20 . P. Li et al. , “Potent 3CLpro inhibitors effective against SARS-CoV-2 and MERS-CoV in animal models by therapeutic treatment,” mBio, vol. 15, no. 2, p. e0287823, Feb. 2024, doi: 10.1128/mbio.02878-23 . L. Tian et al. , “Development of de-novo coronavirus 3-chymotrypsin-like protease (3CLpro) inhibitors since COVID-19 outbreak: A strategy to tackle challenges of persistent virus infection,” Eur. J. Med. Chem., vol. 264, p. 115979, Jan. 2024, doi: 10.1016/j.ejmech.2023.115979 . S. Kawashima et al. , “Ensitrelvir is effective against SARS-CoV-2 3CL protease mutants circulating globally,” Biochem. Biophys. Res. Commun., vol. 645, pp. 132–136, Feb. 2023, doi: 10.1016/j.bbrc.2023.01.040 . Cao Bin et al. , “Oral Simnotrelvir for Adult Patients with Mild-to-Moderate Covid-19,” N. Engl. J. Med., vol. 390, no. 3, pp. 230–241, Jan. 2024, doi: 10.1056/NEJMoa2301425 . “Shionogi Receives U.S. FDA Fast Track Designation for Ensitrelvir Fumaric Acid, an Investigational Oral Antiviral for COVID-19.” Accessed: Apr. 29, 2024. [Online]. Available: https://www.shionogi.com/global/en/news/2023/04/20230404.html H. M. Froggatt, B. E. Heaton, and N. S. Heaton, “Development of a Fluorescence-Based, High-Throughput SARS-CoV-2 3CLpro Reporter Assay,” J. Virol. , vol. 94, no. 22, p. 10.1128/jvi.01265-20 , Oct. 2020, doi: 10.1128/jvi.01265-20. Z.-C. Bei et al. , “Orthogonal dual reporter-based gain-of-signal assay for probing SARS-CoV-2 3CL protease activity in living cells: inhibitor identification and mutation investigation,” Emerg. Microbes Infect. , vol. 12, no. 1, p. 2211688, Dec. 2023, doi: 10.1080/22221751.2023.2211688 . H. Tan, Y. Hu, and J. Wang, “FlipGFP protease assay for evaluating in vitro inhibitory activity against SARS-CoV-2 Mpro and PLpro,” STAR Protoc., vol. 4, no. 2, p. 102323, May 2023, doi: 10.1016/j.xpro.2023.102323 . M. K. Roe, N. A. Junod, A. R. Young, D. C. Beachboard, and C. C. Stobart, “Targeting novel structural and functional features of coronavirus protease nsp5 (3CLpro, Mpro) in the age of COVID-19,” J. Gen. Virol., vol. 102, no. 3, p. 001558, Jan. 2021, doi: 10.1099/jgv.0.001558 . M. Ahmadi et al. , “Differential gene expression of SARS-CoV-2 transcriptome provides insight into the design of more sensitive diagnostic tests,” Hum. Gene, vol. 34, p. 201116, Dec. 2022, doi: 10.1016/j.humgen.2022.201116 . J. Hammond et al. , “Oral Nirmatrelvir for High-Risk, Nonhospitalized Adults with Covid-19,” N. Engl. J. Med. , vol. 386, no. 15, pp. 1397–1408, Apr. 2022, doi: 10.1056/NEJMoa2118542 . R. Chen, Y. Gao, H. Liu, H. Li, W. Chen, and J. Ma, “Advances in research on 3C-like protease (3CLpro) inhibitors against SARS-CoV-2 since 2020,” RSC Med. Chem., vol. 14, no. 1, pp. 9–21, Jan. 2023, doi: 10.1039/D2MD00344A . M. Uhlén et al. , “Proteomics. Tissue-based map of the human proteome,” Science, vol. 347, no. 6220, p. 1260419, Jan. 2015, doi: 10.1126/science.1260419 . J. M. O. Rawson, A. Duchon, O. A. Nikolaitchik, V. K. Pathak, and W.-S. Hu, “Development of a Cell-Based Luciferase Complementation Assay for Identification of SARS-CoV-2 3CLpro Inhibitors,” Viruses , vol. 13, no. 2, Art. no. 2, Feb. 2021, doi: 10.3390/v13020173 . M. Deng, C. Zhang, W. Yan, L. Chen, B. He, and Y. Li, “Development of Fluorescence-Based Assays for Key Viral Proteins in the SARS-CoV-2 Infection Process and Lifecycle,” Int. J. Mol. Sci. , vol. 25, no. 5, Art. no. 5, Jan. 2024, doi: 10.3390/ijms25052850 . J. Liu, C. Ge, L. Zha, L. Lin, and R. Li, “Simple Nano-Luciferase-Based Assay for the Rapid and High-Throughput Detection of SARS-CoV-2 3C-Like Protease,” Anal. Chem. , vol. 95, no. 2, pp. 714–719, Jan. 2023, doi: 10.1021/acs.analchem.2c02590 . D. M. Close, R. E. Hahn, S. S. Patterson, S. A. Ripp, G. S. Sayler, and S. J. Baek, “Comparison of human optimized bacterial luciferase, firefly luciferase, and green fluorescent protein for continuous imaging of cell culture and animal models,” J. Biomed. Opt., vol. 16, no. 4, p. 047003, Apr. 2011, doi: 10.1117/1.3564910 . M. Neefjes, B. a. C. Housmans, G. G. H. van den Akker, L. W. van Rhijn, T. J. M. Welting, and P. M. van der Kraan, “Reporter gene comparison demonstrates interference of complex body fluids with secreted luciferase activity,” Sci. Rep., vol. 11, no. 1, p. 1359, Jan. 2021, doi: 10.1038/s41598-020-80451-6 . M. Hoffmann et al. , “SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor,” Cell, vol. 181, no. 2, pp. 271–280.e8, Apr. 2020, doi: 10.1016/j.cell.2020.02.052 . A. R. Lee, Y. C. Kweon, S. M. Lee, and C. Y. Park, “Human coronavirus 3CL proteases cleave septins and disrupt Hedgehog signaling, causing ciliary dysfunction,” J. Med. Virol., vol. 95, no. 3, p. e28618, Mar. 2023, doi: 10.1002/jmv.28618 . M. A. Hameedi et al. , “Structural and functional characterization of NEMO cleavage by SARS-CoV-2 3CLpro,” Nat. Commun. , vol. 13, no. 1, Art. no. 1, Sep. 2022, doi: 10.1038/s41467-022-32922-9 . B. V. Tsu et al. , “Host-specific sensing of coronaviruses and picornaviruses by the CARD8 inflammasome,” PLOS Biol. , vol. 21, no. 6, p. e3002144, Jun. 2023, doi: 10.1371/journal.pbio.3002144 . J. Petschnigg et al. , “The mammalian-membrane two-hybrid assay (MaMTH) for probing membrane-protein interactions in human cells,” Nat. Methods , vol. 11, no. 5, Art. no. 5, May 2014, doi: 10.1038/nmeth.2895 . P. Saraon, I. Grozavu, S. H. Lim, J. Snider, Z. Yao, and I. Stagljar, “Detecting Membrane Protein-protein Interactions Using the Mammalian Membrane Two-hybrid (MaMTH) Assay,” Curr. Protoc. Chem. Biol., vol. 9, no. 1, pp. 38–54, 2017, doi: 10.1002/cpch.15 . F. Corpet, “Multiple sequence alignment with hierarchical clustering.,” Nucleic Acids Res. , vol. 16, no. 22, pp. 10881–10890, Nov. 1988. G. E. Crooks, G. Hon, J.-M. Chandonia, and S. E. Brenner, “WebLogo: A Sequence Logo Generator,” Genome Res. , vol. 14, no. 6, pp. 1188–1190, Jun. 2004, doi: 10.1101/gr.849004 . T. D. Schneider and R. M. Stephens, “Sequence logos: a new way to display consensus sequences.,” Nucleic Acids Res. , vol. 18, no. 20, pp. 6097–6100, Oct. 1990. J. Lawrenz et al. , “Severe Acute Respiratory Syndrome Coronavirus 2 Vaccination Boosts Neutralizing Activity Against Seasonal Human Coronaviruses,” Clin. Infect. Dis., vol. 75, no. 1, pp. e653–e661, Jul. 2022, doi: 10.1093/cid/ciac057 . Q. Xie et al. , “Endogenous IFITMs boost SARS-coronavirus 1 and 2 replication whereas overexpression inhibits infection by relocalizing ACE2,” iScience, vol. 26, no. 4, p. 106395, Apr. 2023, doi: 10.1016/j.isci.2023.106395 . R. Nchioua et al. , “SARS-CoV-2 Is Restricted by Zinc Finger Antiviral Protein despite Preadaptation to the Low-CpG Environment in Humans,” mBio , vol. 11, no. 5, pp. e01930-20, Oct. 2020, doi: 10.1128/mBio.01930-20 . L. J. REED and H. MUENCH, “A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS12,” Am. J. Epidemiol., vol. 27, no. 3, pp. 493–497, May 1938, doi: 10.1093/oxfordjournals.aje.a118408 . Additional Declarations No competing interests reported. Supplementary Files Supplementarylegendsandfigurescombined.pdf Cite Share Download PDF Status: Published Journal Publication published 05 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 29 May, 2024 Reviews received at journal 27 May, 2024 Reviews received at journal 21 May, 2024 Reviewers agreed at journal 16 May, 2024 Reviews received at journal 16 May, 2024 Reviews received at journal 12 May, 2024 Reviewers agreed at journal 12 May, 2024 Reviewers agreed at journal 10 May, 2024 Reviewers agreed at journal 09 May, 2024 Reviewers invited by journal 09 May, 2024 Editor assigned by journal 09 May, 2024 Editor invited by journal 09 May, 2024 Submission checks completed at journal 09 May, 2024 First submitted to journal 03 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4365319","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":304193645,"identity":"264c3f88-cdcc-42c0-bc3e-8d8f037e8e7c","order_by":0,"name":"Asimenia Vlachou","email":"","orcid":"","institution":"Ulm University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Asimenia","middleName":"","lastName":"Vlachou","suffix":""},{"id":304193648,"identity":"4fbea358-b385-4213-9115-84fca60914ea","order_by":1,"name":"Rayhane Nchioua","email":"","orcid":"","institution":"Ulm University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Rayhane","middleName":"","lastName":"Nchioua","suffix":""},{"id":304193649,"identity":"5586c762-2c9d-499a-9f2b-6864f39f0098","order_by":2,"name":"Kerstin Regensburger","email":"","orcid":"","institution":"Ulm University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Kerstin","middleName":"","lastName":"Regensburger","suffix":""},{"id":304193650,"identity":"74863050-9bf7-423e-bb96-e95a5ec15c0b","order_by":3,"name":"Frank Kirchhoff","email":"","orcid":"","institution":"Ulm University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Frank","middleName":"","lastName":"Kirchhoff","suffix":""},{"id":304193651,"identity":"c77eb2ae-87b7-4436-87df-7ee3dadc9bc4","order_by":4,"name":"Dorota Kmiec","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIie3PMYvCMBTA8RcCuSXoWtGvIFQKBaF3fhWl4OZaHBxcfLeczn4Mp5sjgXY5e2sGB4vgXBDESY1VEIS2jg75DwkJ/EgegMn0jonbZgPVawrAAegYgJUQcSdknhHyKtFRnl2VkEo0TbbpCJzmN13uP3HdAKs3WUDg5ZLaX+TYIgTXlcyvD3DHNUEFcT+X2KrPLMHAcyV36QAl7yhNCMoScrqS6oG2NcleIXguJku8fowzSh5EFMwSUns1sxw9i1P7iTXhCapu7OeSSoRkMzx4rd9/maTHQHbgww9VGnzlknvW07lbBkwmk8lU2AXYyFNkGqpggAAAAABJRU5ErkJggg==","orcid":"","institution":"Ulm University Medical Center","correspondingAuthor":true,"prefix":"","firstName":"Dorota","middleName":"","lastName":"Kmiec","suffix":""}],"badges":[],"createdAt":"2024-05-03 17:08:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4365319/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4365319/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-71305-6","type":"published","date":"2024-09-05T16:05:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57037210,"identity":"fd369e01-e439-4d00-ae77-ed95a942c342","added_by":"auto","created_at":"2024-05-23 18:44:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":354694,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDesign and performance of the 3CLpro reporter assay. \u003c/strong\u003e(A) Location of 3CLpro cleavage sites in coronavirus polyprotein 1ab. (B) Sequence logo of the 3CLpro recognition site based on SARS-CoV-2 1ab polyprotein. The sequence of representative cleavage site selected for testing is indicated in red. (C) Principle of 3CLpro reporter assay. Human ACE2 fused to transcription factor Gal4 is expressed in HEK293T cells containing a stable Gaussia luciferase reporter downstream of 5x Gal4 binding sites. The fusion protein contains 3CLpro recognition site in the flexible glycine linker region. Upon cleavage by 3CLpro, Gal4 fused to amino acids 364-550 of mouse NF-kB translocates into the nucleus where it activates the transcription of Gaussia luciferase, which is subsequently secreted into cell supernatant. (D) Experimental outline of the 3CLpro reporter assay. HEK293T cells containing the stable Gaussia luciferase reporter downstream of the 5x Gal4 binding sites are co-transfected with construct encoding ACE2-Gal4 fusion protein, and varying amounts of Nsp5 or GFP (negative control). At 18-20h post transfection supernatants are harvested for luminescence measurement of Gaussia luciferase activity (relative light units per second; rlu/s) using coelenterazine substrate, while the cells are subjected to 2,5-diphenyl-2H-tetrazolium bromide (MTT) assay measuring cell metabolic activity. (E) Normalized n-fold increase in Gaussia luciferase activity over background (GFP + 3CLpro reporter only) by transfected SARS-CoV-2 Nsp5, and (F) corresponding MTT assay results measured at 18h post transfection. (G) western blot of transfected cell lysates showing dose-dependent ACE2-Gal4 reporter cleavage (FL – full length, CL – cleaved). Mean of 3 independent experiments +SD. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01; ***, P \u0026lt; 0.001, ns, P\u0026gt;0.05. unpaired Student’s t-test.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4365319/v1/f68e331532c1be8f00598e6b.png"},{"id":57034399,"identity":"10edbd55-3736-4a20-bdff-4a5094ed1fe1","added_by":"auto","created_at":"2024-05-23 18:28:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":323469,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eActivation of the 3CLpro reporter assay by hCoV Nsp5. \u003c/strong\u003e(A)\u003cstrong\u003e \u003c/strong\u003eAmino acid sequence alignment of hCoV Nsp5 proteins. Catalytic residues are highlighted in red and substrate binding sites are indicated by blue brackets. Domain mapping based on similarity to SARS-CoV-2 sequence. (B) Dose-dependent activation of the 3CLpro reporter assay by overexpressed hCoV Nsp5 proteins shown as n-fold enhancement over negative control (reporter + GFP). Mean of 4 independent experiments +SD. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01; ***, P \u0026lt; 0.001, unpaired Student’s t-test. (C) Western blot of cellular lysates following co-expression of the ACE2-Gal4 reporter and indicated Strep II-tagged hCoV Nsp5 proteins. Reporter cleavage results in the appearance of lower molecular weight by-product band in ACE2 staining. GAPDH served as protein loading control. (D) Lack of significant correlation between reporter activity measured in (B) at the 100ng dose and Nsp protein expression levels observed in western blot (C).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4365319/v1/4bb98629a7f7b93f59363954.png"},{"id":57035775,"identity":"c40c38ab-de71-4636-ade0-f400ff607f1e","added_by":"auto","created_at":"2024-05-23 18:36:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":71335,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eActivation of the 3CLpro reporter assay during hCoV infection.\u003c/strong\u003e (A) SARS-CoV-2 RNA present in the supernatant of infected HEK293T reporter cells transfected with plasmid encoding human ACE2 or ACE2-Gal4 fusion protein. MOI = multiplicity of infection of input virus. Mean of one independent experiment measured by qRT PCR in technical triplicates, + SD. (B) Activation of the 3CLpro Gaussia luciferase reporter assay 24h after SARS-CoV-2 infection with indicated MOI or by transfection of 500ng of Nsp5 expression construct. Mean of 3 infections + SD. ***, P \u0026lt; 0.001, unpaired Student’s t-test. (C) Western blot of 3CLpro reporter transfected and infected cell lysates 2 d.p.i. showing cleavage of the ACE2-Gal4 reporter during SARS-CoV-2 infection (indicated by N staining). Hsp90 served as protein loading control.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4365319/v1/43704bad97bae087e10316d2.png"},{"id":57035777,"identity":"e253a3a7-747f-4bcf-ac04-3525b7b16872","added_by":"auto","created_at":"2024-05-23 18:36:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":257057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of reported 3CLpro inhibitors using the 3CLpro reporter assay. \u003c/strong\u003eHEK293T reporter cells were cotransfected with equal ratios of plasmid encoding the ACE2-Gal4 fusion protein and SARS-CoV-2 Nsp5 or GFP (negative control). After 6 h cells were treated with indicated molar concentration of inhibitors (A) Nirmaltrevir, (B) GC376, (C) Lopinavir and (D) PF-00835231 or DMSO control for 20h. The activity of secreted Gaussia luciferase was measured using luminometer and cellular metabolic activity was evaluated by the MTT assay. The activity of Lopinavir and PF-00835231 the was re-evaluated at lower, nontoxic concentrations (E and F). Mean of 3-5 independent experiments + SD. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01; ***, P \u0026lt; 0.001, paired Student’s t-test. IC50 values were calculated using Prism GraphPad.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4365319/v1/f6d33b7665c1300410d05512.png"},{"id":64185677,"identity":"cd6d056c-2151-49f8-ae24-4c0ed1735bcc","added_by":"auto","created_at":"2024-09-09 16:20:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1625816,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4365319/v1/a73a7070-a760-474b-9bc3-47b266df03b1.pdf"},{"id":57034402,"identity":"c25de184-18dc-443c-a284-526fa83c6cf3","added_by":"auto","created_at":"2024-05-23 18:28:00","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":6045396,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarylegendsandfigurescombined.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4365319/v1/00097e7986eb675fe90e6fd8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A Gaussia luciferase reporter assay for the evaluation of coronavirus Nsp5/3CLpro inhibitors","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSince 2019, the coronavirus disease 2019 (COVID-19) pandemic claimed the lives of more than seven million people and affected the health and livelihoods of almost everyone [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Prior to the emergence of its causative agent, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), four other human coronaviruses (hCoVs), often referred to as common cold coronaviruses (ccCoVs; NL63, 229E, OC43 and HKU1) were endemic, and two others - Severe Acute Respiratory Syndrome (SARS-CoV-1) and Middle East Respiratory Syndrome (MERS-CoV) \u0026ndash; caused regionally limited epidemic outbreaks of severe respiratory diseases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. ccCoV infections generally do not require medical intervention in healthy individuals, but can lead to hospitalization and death in children, elderly and immunocompromised patients[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In comparison, SARS-CoV-1, SARS-CoV-2 and MERS-CoV infections are more severe with average case fatality rates of approximately 10%, 1% and 40%, respectively [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The repeated emergence of hCoVs in the recent decades and the speed at which SARS-CoV-2 spread globally highlight the risk of possible future outbreaks of novel zoonotic coronaviruses. Altogether, there is a need to develop effective and broadly active antiviral compounds against the present and future strains of hCoVs.\u003c/p\u003e \u003cp\u003eAll coronaviruses have large RNA (25\u0026ndash;32 kb) RNA genomes, two thirds of which is taken by open reading frame (ORF) \u003cem\u003e1ab\u003c/em\u003e. The product, polyprotein pp1ab, is cleaved into 16 non-structural proteins (Nsp) by 2 viral proteases, the papain-like protease Nsp3 and the main protease Nsp5 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Both of these enzymes are functionally conserved among coronaviruses and are essential for their replication. Thus, they represent useful targets of antiviral therapies. Nsp3 cleaves pp1ab at 3 sites leading to Nsps 1\u0026ndash;3, while the main protease Nsp5 cleaves at 11 sites, generating the remaining Nsps 4\u0026ndash;16 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eProtease inhibitors that block pp1ab processing are highly efficient at limiting CoV replication, as they target an early and essential step in virus replication. Paxlovid, a combination of the two viral protease inhibitors nirmatrelvir and ritonavir, is one of the few approved and widely used treatments for COVID-19 and has been reported to show\u0026thinsp;~\u0026thinsp;88% efficacy in preventing hospitalization or death [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Alarmingly, recent studies identified several mutations in the SARS-CoV-2 3CLpro protease that give rise to nirmatrelvir resistance, highlighting the need for additional anti-coronavirus compounds [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Other protease inhibitors have been considered but are not currently approved for COVID-19 treatment. For example, GC376 is used in veterinary medicine to treat fatal feline coronavirus infection, and lopinavir blocks retroviral protease activity and is used in anti-retroviral therapy of HIV-infected patients [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Lufotrelvir is the phosphate prodrug of the 3CLpro inhibitor PF-00835231 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Lufotrelvir was investigated in pre-clinical and clinical trials against COVID-19 but was less successful than nirmatrelvir due to its low oral bioavailability and fast systemic clearance [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Additional 3CLpro inhibitors such as simotrelvir, bofutrelvir and 11d, have shown promising efficacy and tolerability \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. While still not widely available, U.S. Food and Drug Administration (FDA) has granted the Fast Track designation for an investigational COVID-19 oral antiviral ensitrelvir following its approval in Japan and Singapore [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].Since experiments with infectious SARS-CoV-2, SARS-CoV-1, and MERS require biosafety level 3 facilities, virus-free drug screening platforms are strongly desired to foster drug discovery. Since 2020, several SARS-CoV-2 protease reporter assays have been developed [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These methods mostly rely on the quantification of the fluorescence signal produced upon 3CLpro-mediated cleavage of Flip-GFP inducing its conformational change from a non-fluorescent to a fluorescent state. However, this approach is associated with significant background signal due to activation by cellular proteases and does not allow to easily distinguish between protease-specific and cytotoxicity-related decreases in cell fluorescence. GFP is also pH-sensitive and prone to photobleaching, which might lead to a lack of reproducibility during high-throughput drug screening. To overcome these issues, we designed a Gaussia luciferase-based 3CLpro reporter system that produces a robust signal within as little as 24 h and is compatible with affordable and effective MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability measurements. Reporters based on secreted Gaussia luciferase offer non-invasive sampling and kinetic measurements, high stability, and compatibility with virus inactivation procedures. Thus, they represent useful tools for studying 3CLpro function and inhibition.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of a Gaussia luciferase-based coronavirus 3CLpro activity reporter\u003c/h2\u003e \u003cp\u003e3CLpro (Nsp5) is crucial for processing of Nsps 5\u0026ndash;16, making it an essential component of the SARS-CoV-2 replication machinery (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). 3CLpro cleaves after a glutamine motif (Q) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], which is highly conserved and found at all SARS-CoV-2 Nsp5-16 borders (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To exploit the specificity of 3CLpro in designing a novel coronavirus reporter assay, we generated a plasmid encoding a fusion protein of angiotensin-converting-enzyme 2 (ACE2), and the transcription factor galactose utilization 4 (Gal4). ACE2 was selected due to its role as the major entry receptor of three human coronaviruses (SARS-CoV-1, SARS-CoV-2 and NL63) to facilitate CoV infection of otherwise poorly permissive HEK293T cells. The two components were joined by a flexible G/S-linker containing the 3CLpro recognition sequence ARLQSGF. In the presence of active 3CLpro, this fusion protein undergoes cleavage and Gal4, which contains a nuclear import signal, translocates to the nucleus, where it activates the transcription of an integrated Gaussia luciferase reporter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Gaussia luciferase is then released into the cell supernatant, where it can be detected in a non-invasive manner following the addition of its substrate coelenterazine. This method produces a stable luminescence signal, which allows to readily measure changes in 3CLpro activity without cell staining or lysis. It is also compatible with assays measuring cell viability/metabolic activity, such as the cost-effective MTT, which is commonly used to evaluate drug candidate cytotoxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eAt 18 h post-transfection, the assay showed a dose-dependent increase in Gaussia luciferase activity with no signs of protease-induced cytotoxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). The reporter detected as little as 4 ng of the transfected Nsp5 expression construct, indicating that it is a sensitive and robust method of evaluating coronavirus 3CLpro activity. The results were highly reproducible and the highest Nsp5 gene dose (500 ng) resulted in an ~\u0026thinsp;8-fold increase in Gaussia activity over background at 18 h post-transfection (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). With longer incubation times the background signal increased gradually, leading to a lower signal-to-noise ratio at later time points (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). Therefore, 18h was selected as a standard for further experiments. Dose-dependent cleavage of the ACE2-Gal4 reporter by Nsp5 was also observed in Western blot analysis of the transfected cell lysates, although this method was less sensitive than the luciferase reporter assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Overall, the developed 3CLpro reporter was found to be a sensitive and rapid new method of quantifying SARS-CoV-2 main protease activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eComparison of the activity of 3CLpro proteins from all seven hCoVs\u003c/h2\u003e \u003cp\u003eThe Nsp5 proteins encoded by the seven different hCoVs have conserved function and all contain H41 and C145 catalytic residues. However, these homologs share less than 50% amino acid sequence identity, with multiple changes within the reported substrate binding site [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Therefore, we investigated if the developed 3CLpro reporter could detect the activity of proteases from diverse hCoVs. To address this, we synthesized expression constructs containing codon-optimized Nsp5 sequences from the seven hCoV species and co-expressed each of them with the ACE2-Gal4 reporter. The expression of 3CLpro from all hCoVs led to significant and dose-dependent increases in reporter activity, with NL63 (alpha-coronavirus), OC43 and HKU1 (beta-coronaviruses) showing up to 15-fold increase over background at the highest dose of 500 ng (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Expression of 3CLpro from SARS-CoV-1, MERS or 229E resulted in 7- to 9-fold signal increases at the highest dose, which was consistent with the lower efficiency of ACE2-Gal4 reporter cleavage observed in western blotting of cell lysates (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Furthermore, the expression levels of Nsp5 proteins did not correlate with reporter activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). This suggests that proteases from different hCoVs might not be equally active and/or have different substrate preferences, which might be linked to mutations found upstream and downstream of the glutamine cleavage sites in the Nsp5 substrates of distinct hCoV species (Fig. S2). Overall, the activity of all hCoV Nsp5s could be quantified by the 3CLpro reporter, showing a substantial overlap in substrate recognition and cleavage and highlighting the suitability of the developed assay for studying protease activity by diverse hCoVs.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e3CLpro reporter is compatible with hCoV inactivation procedures and activated by virally expressed Nsp5\u003c/h3\u003e\n\u003cp\u003eDuring SARS-CoV-2 infection, ORF1ab, which encodes all nonstructural proteins including Nsp5, is the most abundantly expressed viral transcript [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. To verify if the 3CLpro reporter assay is sensitive enough to detect the activity of endogenously expressed Nsp5, we measured the reporter activation after hCoV infection. We first confirmed that similarly to wild type ACE2 protein, the ACE2-Gal4 fusion protein promotes SARS-CoV-2 infection of the otherwise poorly-permissive HEK293T cells used in this assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To test whether the 3CLpro assay is sensitive enough to detect endogenous 3CLpro activity, it was necessary to first evaluate whether the reporter is compatible with any of the temperature, alcohol, and various detergents and fixative-based coronavirus inactivation procedures (Fig. S3). Gaussia luciferase-containing culture supernatants were unaffected by the tested conditions, with the exception of 4% PFA and 0.5% SDS treatment (Fig. S3). We therefore sought to evaluate the performance of the reporter assay following SARS-CoV-2 sample inactivation at 65\u0026deg;C for 30 min.\u003c/p\u003e \u003cp\u003eFollowing infection, a significant increase in the Gaussia luciferase signal was observed for both of the tested multiplicities of infection (MOIs) after 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Cleavage of the ACE2-Gal reporter was also clearly visible in western blot analysis of cellular lysates harvested 3 days post infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Notably, ACE2-Gal4 reporter cleavage was also observed after infection with the ACE2-utilizing NL63 CoV but not with hCoVs OC42 and 229E that use other receptors for entry (Fig. S4). These results demonstrate that the sensitivity of the 3CLpro reporter assay is unaffected by most virus inactivation procedures and it can be utilized to detect endogenous Nsp5 activity of ACE2-utilizing hCoVs.\u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of viral protease inhibitor activity using the 3CLpro reporter assay\u003c/h2\u003e \u003cp\u003eNirmatrelvir is currently the only widely used coronavirus 3CLpro inhibitor [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, several other protease inhibitors such as GC376, lopinavir and PF-00835231 have been evaluated \u003cem\u003ein vitro\u003c/em\u003e and show potential for targeting 3CLpro [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. To verify the activity of these inhibitors and compare their relative effectiveness in inhibiting the main protease of SARS-CoV-2, we tested them in our 3CLpro reporter assay, with nirmatrelvir serving as a positive control.\u003c/p\u003e \u003cp\u003eNirmatrelvir and GC376 treatment significantly decreased the Gaussia luciferase signal in Nsp5-transfected HEK293T Gaussia reporter cells at concentrations\u0026thinsp;\u0026ge;\u0026thinsp;20 \u0026micro;M, with IC\u003csub\u003e50\u003c/sub\u003e values of 83 \u0026micro;M and 86 \u0026micro;M, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Lopinavir was also found to significantly inhibit 3CLpro at \u0026ge;\u0026thinsp;20 \u0026micro;M with an IC\u003csub\u003e50\u003c/sub\u003e of 21 \u0026micro;M but appeared to be cytotoxic at all of the tested active concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). For PF-00835231, 100 \u0026micro;M was the lowest tested dose that significantly inhibited 3CLpro reporter activity, whereby the IC50 was estimated by interpolation to be 39 \u0026micro;M; however, this and higher doses strongly reduced cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The low specific activity of this compound could be due to the efflux transporter P-glycoprotein, which is highly expressed in HEK293T cells and was previously reported to diminish the effects of PF-00835231 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. To determine if lopinavir and PF-00835231 inhibit 3CLpro activity at concentrations that do not affect cell viability, additional concentrations were tested. Lopinavir was found to be effective and non-cytotoxic within the 8\u0026ndash;64 \u0026micro;M concentration range with an IC50 of 12 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), while PF-00835231 did not have a significant effect on 3CLpro at non-cytotoxic concentrations\u0026thinsp;\u0026le;\u0026thinsp;50 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Overall, the 3CLpro reporter assay was found to be suitable for the evaluation of viral protease inhibitors and showed that nirmaltrevir and GC376 have similar inhibitory efficacy, while lopinavir is more effective but also more cytotoxic.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe developed and evaluated a reporter assay for fast and efficient screening of inhibitors of the functionally conserved hCoV protease 3CLpro (Nsp5), which is among the most promising targets for treating coronavirus infections [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our assay allows simultaneous quantification of a compound\u0026rsquo;s potency and cytotoxicity within 24 h, and can facilitate the discovery and evaluation of coronavirus protease inhibitors in the future. Whereas the currently most widely used COVID-19 treatment Paxlovid already targets 3CLpro, the development of further inhibitors is warranted due to the risk of drug resistance [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Our assay can be performed in a 96-well format, requires only a luminescence plate reader, and is compatible with the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cytotoxicity assay, supporting high-throughput screening and rapid evaluation of potency and specificity.\u003c/p\u003e \u003cp\u003ehCoV 3CLpro proteases show 20\u0026ndash;50% overall amino sequence diversity but share core structural homology and have similar substrate specificity [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, it is possible to develop broadly active hCoV protease inhibitors and a universal assay to study their activities [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. We demonstrated that our reporter is compatible with 3CLpro homologs from all seven human coronaviruses as well as with most virus inactivation procedures. Furthermore, the assay has high sensitivity and a dynamic range of approximately 10-fold between the lowest and the highest tested dose, making it suitable for reliable quantification of potency. Using proof-of-concept assessments of IC\u003csup\u003e50\u003c/sup\u003e values of nirmaltrevir, GC376, and lopinavir, we demonstrated the suitability of our system for evaluating SARS-CoV-2 3CLpro inhibitors.\u003c/p\u003e \u003cp\u003eThere has been substantial interest in 3CLpro reporter assays since the start of the SARS-CoV-2 pandemic, and several versions of such assays exist, many of which rely on fluorescent Flip-GFP technology [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Our luciferase-based assay overcomes several disadvantages of GFP-based reporters, such as their considerable confound by pH, the potential autofluorescence of tested compounds, and photobleaching. Compared to GFP, Gaussia luciferase offers higher stability and thus more reliable quantification [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Furthermore, the secretion of the luciferase reporter into cell media allows non-invasive sampling and long-term sample storage.\u003c/p\u003e \u003cp\u003eWhile screening for potential 3CLpro inhibitors in a virus-free mode is certainly its most prominent application, our assay could also be further optimized towards higher sensitivity for the detection of endogenous 3CLpro activity resulting from actual hCoV infections. This is enabled by the fusion of the 3CLpro cleavage sequence to human ACE2, which serves as major entry receptor for SARS-CoV-1, SARS-CoV-2, and NL63. The resulting receptor-reporter fusion protein effectively promoted SARS-CoV-2 entry into the otherwise poorly permissive HEK293T cells[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Notably, the produced Gaussia luciferase signal withstood temperature and disinfectant-based virus inactivation procedures without compromising assay sensitivity.\u003c/p\u003e \u003cp\u003eThe assay detected 3CLpro activity of all human coronaviruses (SARS-CoV-1, SARS-CoV-2, MERS, NL63, OC43, 229E, and HKU1), supporting rapid testing of inhibitors against both existing and potentially emerging pathogens. This finding also implies that it can be used to compare the drug sensitivity and protease function of different coronavirus lineages and to monitor the impact of 3CLpro and pp1ab mutations in emerging SARS-CoV-2 variants on nirmaltrevir sensitivity. While our assay is currently limited to the detection of inhibitors of 3CLpro, its design principle can be reiterated to develop reporter assays for other viral proteases, such as hCoV PLpro. Recent studies reported that SARS-CoV-2 3CLpro cleaves not only the viral polyprotein 1ab but also cellular factors such as NF-κB Essential Modulator (NEMO), septin and Caspase recruitment domain-containing protein 8 (CARD8) which play roles in immune sensing and cell homeostasis [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Our assay could be utilized for studying cellular 3CLpro substrates and to evaluate inhibitors that not only directly limit viral replication through blocking pp1ab processing but also prevent the 3CLpro associated cellular dysfunction.\u003c/p\u003e \u003cp\u003eSince our drug evaluations were performed using higher Nsp5 expression levels from overexpressed plasmid as compared to the endogenous levels observed during infection, the IC\u003csub\u003e50\u003c/sub\u003e values assay are likely to be higher than those measured during experiments utilizing a genuine virus. Indeed, the reported IC\u003csub\u003e50\u003c/sub\u003e values of nirmaltrevir obtained during SARS-CoV-2 infection assays in cell lines are 10 times lower than those measured in our study [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therefore, it is highly advisable for any drug screening study to confirm the activity of newly discovered inhibitors using independent methods and in the context of genuine virus infection.\u003c/p\u003e \u003cp\u003eOverall, our findings highlight the application of the developed Gaussia luciferase-based reporter assay for studying coronavirus protease function and identifying/evaluating antiviral drug candidates. Other potential applications include monitoring the impact of emerging SARS-CoV-2 3CLpro mutations on proteolytic activity and drug sensitivity. Although already highly versatile in its current form, the assay could be easily modified to study the function other viral proteases, as well as the impact of mutations and polymorphisms at the 3CLpro recognition site. The sensitivity, compatibility, and rapid and broad applicability of this assay make it a valuable tool for drug discovery efforts aimed at combating current and future coronavirus outbreaks.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and culture\u003c/h2\u003e \u003cp\u003eHEK293T B0166 Gal4 Gaussia luciferase reporter cells [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM; Gibco, catalog no. 41965039) supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco, catalog no. 10270106), 2 mM L-glutamine (Gibco, catalog no. 25030081), 100 units/ml penicillin and 100 \u0026micro;g/ml streptomycin (Thermo Fisher, catalog no. 15140122). Huh7 (human hepatocyte-derived carcinoma cell line), LLC-MK2 (rhesus monkey kidney epithelial cell line) and Vero E6 cells (\u003cem\u003eCercopithecus aethiops\u003c/em\u003e-derived epithelial kidney line; ATCC) were grown in DMEM with 10% FCS, 100 U/mL penicillin, 100 \u0026micro;g/mL streptomycin and 2 mM L-glutamine.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eACE2-Gal4 reporter and hCoV Nsp5 construct cloning\u003c/h2\u003e \u003cp\u003ehACE2 was amplified from pLV-EF1a-human ACE2-IRES-puro template (primers: TAGAAGCGCGTAGGCCTTTCTAGACCATGTCAAGCTCTTCCTGGCTCCTT and AAATCCACTTTGAAGACGAGCTACTCCTCCTCCAAAGGAGGTCTGAACATCAT; Biomers.net) while Gal4-p65 fusion protein sequence was amplified from MaMTH C-tagged bait vector (primers: CTCGTCTTCAAAGTGGATTTGGAGGAGGAATGAAGCTACTGTCTTCTAT and TAGTACTCCGGGATCCGAACGCGTTACGTAGAATCGAGACCGAG; Biomers.net). The PCR products were ligated into XbaI/MluI HF digested pCG IRES eGFP vector using Gibson assembly (NEB). The correctness of the final construct (pCG hAEC2-VARLQSGF- Gal4-p65 IRES eGFP) was confirmed by Sanger sequencing (Eurofins Genomics).\u003c/p\u003e \u003cp\u003eCodon-optimized hCoV Nsp5 sequences were synthesized by Twist Bioscience. Strep-tagged ORFs were cloned by Gibson assembly (NEB) into the EcoRI/BamHI sites of pLVX-EF1alpha \u0026minus;\u0026thinsp;2xStrep-IRES-Puro vector using the primers: 2229Efwd: (gaggatctatttccggtgaattcaccatggcagggctgaggaaa), 229Erev: (gggagggagaggggcgggatcctcacttttcaaactg), OC43fwd: (gaggatctatttccggtgaattcaccatgtctggcattgtcaaa), OC43rev: (gggagggagaggggcgggatccctacttttcaaactg), NL63fwd: (gtcgtgaggatctatttccggtgaattcgccgccaccatgtcaggcctgaagaagatg), NL63rev: (gttaggggggggggagggagaggggcgggatcctcatttctcgaactggggatg), HKU1fwd: (gaggatctatttccggtgaattcaccatgagtggcatagtaaaa), HKU1rev: (gggagggagaggggcgggatcctcacttttcaaactg), MERSfwd: (gaggatctatttccggtgaattcaccatgtcaggactggtgaag), MERSrev: (gggagggagaggggcgggatcctcatttctcaaattg), SARS-CoV-1fwd: (gaggatctatttccggtgaattcaccatgagtggcttcaggaaa), SARS-CoV-1rev: (gggagggagaggggcgggatcctcatttttcaaactg). The correctness of the final constructs was confirmed by Sanger sequencing (Eurofins Genomics).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eTo examine the cleavage of hACE2-Gal4 protein by overexpressed Nsp5 proteins or following hCoV infection, cells were lysed in coimmunoprecipitation (CO-IP) buffer (150 mM NaCl, 50 mM HEPES, 5 mM EDTA, 0.10% NP-40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche). Samples were reduced in the presence of β-mercaptoethanol by boiling at 95\u0026deg;C for 10 min. Proteins were separated in 4\u0026ndash;12% Bis-Tris gradient acrylamide gels (Invitrogen), blotted onto a polyvinylidene difluoride (PVDF) membrane, and incubated with Strep Tag (Cat#ab76949; Abcam), ACE2 (Cat# sc-390851; Santa Cruz Biotechnology), GAPDH (Cat# 607902; BioLegend), Hsp90 (Cat# sc-13119, Santa Cruz Biotechnology) SARS-CoV-2 N (Cat#GTX135357, GenTex), GFP (Cat# ab290, Abcam), NL63 N (Cat#M.30.HCo.I2D4, Ingenasa), OC43 N (Cat# MAB9012, Millipore) and 229E N (Cat# 40640-T62, SinoBiological) antibodies. Subsequently, blots were probed with IRDye 680RD goat anti-rabbit IgG(H\u0026thinsp;+\u0026thinsp;L) (catalog no. 926-68071; LI-COR), IRDye 800CW goat anti-mouse IgG(H\u0026thinsp;+\u0026thinsp;L) (catalog no. 926-32210; LI-COR) or IRDye 800CW goat anti-rat IgG(H\u0026thinsp;+\u0026thinsp;L) (catalog no. 926-32219; LI-COR) Odyssey antibodies and scanned using a LI-COR Odyssey reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eSARS-CoV-2 Nsp5 cleavage site analysis and sequence alignment\u003c/h2\u003e \u003cp\u003eThe Nsp5 cleavage sites of reference SARS-CoV-2 strain 1ab sequence (GenBank: NC_045512.2), as well as Nsp5 sequences of other hCoVs (NL63: NC_005831.2; 229E: NC_002645.1, OC43: NC_006213.1, HKU1: NC_006577.2, SARS: NC_004718.3, MERS: NC_019843.3) were aligned using Multialign tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://multalin.toulouse.inra.fr/multalin/\u003c/span\u003e\u003cspan address=\"http://multalin.toulouse.inra.fr/multalin/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Sequence logos were generated using WebLogo creator (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://weblogo.berkeley.edu/logo.cgi\u003c/span\u003e\u003cspan address=\"https://weblogo.berkeley.edu/logo.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTransfection of reporter cells\u003c/h2\u003e \u003cp\u003eBOI66 cells (0.3\u0026nbsp;million per well in 12-well format) were incubated overnight at 37\u0026deg;C. The following day the cells were transfected with 500ng 3CLpro reporter and 0-500ng of Nsp5 or GFP control DNA using PEI Max or LT1. The medium was changed 5\u0026ndash;16 h after transfection to either DMEM only (Nsp5 overexpression experiments), DMEM containing hCoVs (hCoV infection experiments), or DMEM containing different concentrations of 3CLpro inhibitors (for the IC50 titration experiments), as indicated in the figure legends.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eGaussia luciferase assay\u003c/h2\u003e \u003cp\u003eSupernatants from the transfected cells were harvested at 18\u0026ndash;48 h post-transfection unless otherwise stated. Gaussia luciferase activity was measured using luminometer plate reader, 2 s after the injection of the coelenterazine substrate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMTT assay\u003c/h2\u003e \u003cp\u003eTo measure the metabolic activity of reporter cells, 100\u0026micro;l of Methyl-Thiazolyl blue\u0026ndash;Tetrazolium bromide salt (MTT-salt) was added to cells in 900\u0026micro;l medium (12-well plate). The plates were incubated at 37\u0026deg;C for 3h. Formed salt crystals were dissolved in 1 ml of DMSO/EtOH solution. The solution was transferred to a flat bottom 96-well plate followed by measurement at 490nm \u0026ndash; 650nm using a plate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ehCoV virus stock generation\u003c/h2\u003e \u003cp\u003eThe BetaCoV/Netherlands/01/NL/2020 strain was obtained from the European Virus Archive and propagated on Vero E6 cells. Cells were inoculated with the SARS-CoV-2 isolate (MOI of 0.03 to 0.1) in serum-free medium. The cells were incubated at 37\u0026deg;C. HCoV-229E was obtained from ATCC (VR-740TM) and HCoV-OC43 was obtained from ATCC (CR-1558TM). HCoV-NL63 was propagated on LLC-MK2 cells, and 229E and OC43 were propagated on Huh7 cells as described previously [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The virus stocks were harvested when the cytopathic effect (CPE) became apparent. The cells were incubated at 37\u0026deg;C (SARS-CoV-2) or 32\u0026deg;C (remaining hCoVs). The virus stocks were centrifuged for 5 min at 1,000 \u0026times; g to remove cellular debris, aliquoted, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until further use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003ehCoV infection\u003c/h2\u003e \u003cp\u003eBOI HEK293T cells were transfected with ACE2-Gal4 (0.5\u0026micro;g plasmid, 12-well plate) and 12 h later inoculated with SARS-CoV-2 strain NL-2020, NL63, OC43 or 229E at different MOIs as previously described [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. SARS-CoV-2 infected cells were incubated at 37\u0026deg;C and other hCoV infected cells were kept at 32\u0026deg;C. After 6 h input virus was removed and cells were washed in PBS three times. The last PBS wash was kept as a negative control for qRT PCR. Fresh DMEM medium was added and the supernatants and cell were harvested 30 h post transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eqRT PCR\u003c/h2\u003e \u003cp\u003eRNA from virus-infected cell supernatants was isolated using QIAamp viral RNA minikit (Qiagen, cat#52904) according to the manufacturer\u0026rsquo;s instructions. Real-time quantitative PCR (RT-qPCR) was performed as previously described[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] using TaqMan Fast Virus 1-step master mix (Thermo Fisher, catalog no. 4444436). The sequences of the primers and probe for SARS-CoV-2 N gene were as follows: forward primer (HKU-NF), 5\u0026prime;-TAA TCA GAC AAG GAA CTG ATT A-3\u0026prime;; reverse primer (HKU-NR), 5\u0026prime;-CGA AGG TGT GAC TTC CAT G-3\u0026prime;; probe (HKU-NP), 5\u0026prime;-FAM (6-carboxyfluorescein)-GCA AAT TGT GCA ATT TGC GG-TAMRA (6-carboxytetramethylrhodamine)-3\u0026prime;. Primers were purchased from Biomers (Ulm, Germany). Synthetic SARS-CoV-2 RNA (Twist Bioscience, catalog no. 102024) was used as a quantitative standard to obtain viral copy numbers. All reactions were run in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eTCID50 assay\u003c/h2\u003e \u003cp\u003eTo determine the infectious titers of hCoV-229E, hCoV-NL63, and hCoV-OC43, 10,000 Huh-7 cells or Caco-2 (SARS-CoV-2) were seeded 1 day before infection in a 96-well plate. The following day, cells were inoculated with a 10-fold serial dilution of the respective virus stock. 4\u0026ndash;7 days after infection, cytopathic effects were observed by light microscopy and the tissue culture infectious dose 50 (TCID50) was calculated according to Reed-M\u0026uuml;nch method [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical and IC50 analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using GraphPad Prism software. Two-tailed Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test were used to determine statistical significance. Significant differences are indicated as: *, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. The statistical parameters used are specified in the figure legends. IC50 values were calculated using GraphPad Prism software (non-linear fit [Inhibitor vs. response] option).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Regina Burger, Jana Romana Fischer, Daniela Krnavek, Martha Mayer, Birgit Ott, and Nicola Schrott for laboratory assistance.\u0026nbsp;Prof. Nevan Krogan (University of California San Francisco) kindly provided the pLVX-EF1alpha GFP and SARS-CoV-2 Nsp5 constructs. pLV-EF1a-human ACE2-IRES-puro plasmid was kindly provided by Prof. Kei Sato (University of Tokyo). Prof. Igor Stagljar (University of Toronto) kindly provided the HEK293T BOI66 Gal4 reporter cells and Gal4 plasmid. Huh7 cells were kindly provided by Dr. Anna-Laura Kretz (Ulm University Medical Center) and LLC-MK2 cells were kindly provided by Prof. Lia van der Hoek (Amsterdam University). We thank Prof. Dennis K\u0026auml;tzel (Ulm University) and Prof. Konstantin Sparrer (Ulm University) for critical reading of the article and helpful discussions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization and funding acquisition: DK and FK; experiments: AV, RN, KR and DK; analysis and writing of the original draft: DK; revision: all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe primary datasets generated and analyzed during the study that are not included in the supplementary material are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a Marie Sklodowska-Curie Fellowship (to DK), by the Else-Kr\u0026ouml;ner-Fresenius Stiftung (to DK), and by the German Research Foundation (DFG KM 5/3-1 to DK, CRC 1279 Young Investigator Award to DK; CRC 1279 grant to FK, SPP 1923 grant to FK).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests Statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors report that there are no competing interests to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e\u0026ldquo;Coronavirus disease (COVID-19).\u0026rdquo; Accessed: Apr. 18, 2024. [Online]. Available: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/news-room/fact-sheets/detail/coronavirus-disease-(covid-19\u003c/span\u003e\u003cspan address=\"https://www.who.int/news-room/fact-sheets/detail/coronavirus-disease-(covid-19\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. Hoenigsperger, R. Sivarajan, and K. M. Sparrer, \u0026ldquo;Differences and similarities between innate immune evasion strategies of human coronaviruses,\u0026rdquo; Curr. Opin. Microbiol., vol. 79, p. 102466, Jun. 2024, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mib.2024.102466\u003c/span\u003e\u003cspan address=\"10.1016/j.mib.2024.102466\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. V\u0026rsquo;kovski, A. Kratzel, S. Steiner, H. Stalder, and V. Thiel, \u0026ldquo;Coronavirus biology and replication: implications for SARS-CoV-2,\u0026rdquo; \u003cem\u003eNat. Rev. Microbiol.\u003c/em\u003e, vol. 19, no. 3, Art. no. 3, Mar. 2021, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41579-020-00468-6\u003c/span\u003e\u003cspan address=\"10.1038/s41579-020-00468-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. S. M. Peiris, K. Y. Yuen, A. D. M. E. Osterhaus, and K. St\u0026ouml;hr, \u0026ldquo;The Severe Acute Respiratory Syndrome,\u0026rdquo; \u003cem\u003eN. Engl. J. Med.\u003c/em\u003e, vol. 349, no. 25, pp. 2431\u0026ndash;2441, Dec. 2003, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMra032498\u003c/span\u003e\u003cspan address=\"10.1056/NEJMra032498\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB. M. J. Lampl, B. Edenharter, M. F. Leitzmann, and B. Salzberger, \u0026ldquo;COVID-19-related deaths: a 2-year inter-wave comparison of mortality data from Germany,\u0026rdquo; \u003cem\u003eInfection\u003c/em\u003e, vol. 51, no. 4, pp. 1147\u0026ndash;1152, Aug. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s15010-023-01982-4\u003c/span\u003e\u003cspan address=\"10.1007/s15010-023-01982-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunster Vincent J., Koopmans Marion, van Doremalen Neeltje, van Riel Debby, and de Wit Emmie, \u0026ldquo;A Novel Coronavirus Emerging in China \u0026mdash; Key Questions for Impact Assessment,\u0026rdquo; \u003cem\u003eN. Engl. J. Med.\u003c/em\u003e, vol. 382, no. 8, pp. 692\u0026ndash;694, Feb. 2020, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMp2000929\u003c/span\u003e\u003cspan address=\"10.1056/NEJMp2000929\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eE. Mahase, \u0026ldquo;Covid-19: Pfizer\u0026rsquo;s paxlovid is 89% effective in patients at risk of serious illness, company reports,\u0026rdquo; \u003cem\u003eBMJ\u003c/em\u003e, vol. 375, p. n2713, Nov. 2021, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/bmj.n2713\u003c/span\u003e\u003cspan address=\"10.1136/bmj.n2713\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. Iketani \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Multiple pathways for SARS-CoV-2 resistance to nirmatrelvir,\u0026rdquo; \u003cem\u003eNature\u003c/em\u003e, vol. 613, no. 7944, Art. no. 7944, Jan. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-022-05514-2\u003c/span\u003e\u003cspan address=\"10.1038/s41586-022-05514-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Zhou \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Nirmatrelvir-resistant SARS-CoV-2 variants with high fitness in an infectious cell culture system,\u0026rdquo; Sci. Adv., vol. 8, no. 51, p. eadd7197, Dec. 2022, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/sciadv.add7197\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.add7197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. Lan \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Nirmatrelvir Resistance in SARS-CoV-2 Omicron_BA.1 and WA1 Replicons and Escape Strategies.\u0026rdquo; bioRxiv, p. 2022.12.31.522389, Jan. 03, 2023. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2022.12.31.522389\u003c/span\u003e\u003cspan address=\"10.1101/2022.12.31.522389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. A. Moghadasi, R. G. Biswas, D. A. Harki, and R. S. Harris, \u0026ldquo;Rapid resistance profiling of SARS-CoV-2 protease inhibitors,\u0026rdquo; \u003cem\u003eNpj Antimicrob. Resist.\u003c/em\u003e, vol. 1, no. 1, pp. 1\u0026ndash;4, Aug. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s44259-023-00009-0\u003c/span\u003e\u003cspan address=\"10.1038/s44259-023-00009-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Hu \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Naturally Occurring Mutations of SARS-CoV-2 Main Protease Confer Drug Resistance to Nirmatrelvir,\u0026rdquo; \u003cem\u003eACS Cent. Sci.\u003c/em\u003e, vol. 9, no. 8, pp. 1658\u0026ndash;1669, Aug. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acscentsci.3c00538\u003c/span\u003e\u003cspan address=\"10.1021/acscentsci.3c00538\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. D. Ip \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Global prevalence of SARS-CoV-2 3CL protease mutations associated with nirmatrelvir or ensitrelvir resistance,\u0026rdquo; EBioMedicine, vol. 91, p. 104559, May 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ebiom.2023.104559\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2023.104559\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. Jochmans \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The Substitutions L50F, E166A, and L167F in SARS-CoV-2 3CLpro Are Selected by a Protease Inhibitor In Vitro and Confer Resistance To Nirmatrelvir,\u0026rdquo; \u003cem\u003emBio\u003c/em\u003e, vol. 14, no. 1, p. e0281522, Feb. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mbio.02815-22\u003c/span\u003e\u003cspan address=\"10.1128/mbio.02815-22\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eE. Heilmann \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A VSV-based assay quantifies coronavirus Mpro/3CLpro/Nsp5 main protease activity and chemical inhibition,\u0026rdquo; \u003cem\u003eCommun. Biol.\u003c/em\u003e, vol. 5, no. 1, Art. no. 1, Apr. 2022, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s42003-022-03277-0\u003c/span\u003e\u003cspan address=\"10.1038/s42003-022-03277-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK.-T. Choy \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Remdesivir, lopinavir, emetine, and homoharringtonine inhibit SARS-CoV-2 replication in vitro,\u0026rdquo; Antiviral Res., vol. 178, p. 104786, Jun. 2020, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.antiviral.2020.104786\u003c/span\u003e\u003cspan address=\"10.1016/j.antiviral.2020.104786\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB. Cao \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A Trial of Lopinavir\u0026ndash;Ritonavir in Adults Hospitalized with Severe Covid-19,\u0026rdquo; N. Engl. J. Med., vol. 382, no. 19, pp. 1787\u0026ndash;1799, May 2020, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMoa2001282\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa2001282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. Sharun, R. Tiwari, and K. Dhama, \u0026ldquo;Protease inhibitor GC376 for COVID-19: Lessons learned from feline infectious peritonitis,\u0026rdquo; Ann. Med. Surg., vol. 61, pp. 122\u0026ndash;125, Dec. 2020, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.amsu.2020.12.030\u003c/span\u003e\u003cspan address=\"10.1016/j.amsu.2020.12.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Allais \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Early Clinical Development of Lufotrelvir as a Potential Therapy for COVID-19,\u0026rdquo; \u003cem\u003eOrg. Process Res. Dev.\u003c/em\u003e, vol. 27, no. 12, pp. 2223\u0026ndash;2239, Dec. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.oprd.2c00375\u003c/span\u003e\u003cspan address=\"10.1021/acs.oprd.2c00375\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. de Vries \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A comparative analysis of SARS-CoV-2 antivirals characterizes 3CLpro inhibitor PF-00835231 as a potential new treatment for COVID-19,\u0026rdquo; \u003cem\u003eJ. Virol.\u003c/em\u003e, vol. 95, no. 7, pp. e01819-20, JVI.01819-20, Mar. 2021, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.01819-20\u003c/span\u003e\u003cspan address=\"10.1128/JVI.01819-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Li \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Potent 3CLpro inhibitors effective against SARS-CoV-2 and MERS-CoV in animal models by therapeutic treatment,\u0026rdquo; mBio, vol. 15, no. 2, p. e0287823, Feb. 2024, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mbio.02878-23\u003c/span\u003e\u003cspan address=\"10.1128/mbio.02878-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. Tian \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Development of de-novo coronavirus 3-chymotrypsin-like protease (3CLpro) inhibitors since COVID-19 outbreak: A strategy to tackle challenges of persistent virus infection,\u0026rdquo; Eur. J. Med. Chem., vol. 264, p. 115979, Jan. 2024, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejmech.2023.115979\u003c/span\u003e\u003cspan address=\"10.1016/j.ejmech.2023.115979\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. Kawashima \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Ensitrelvir is effective against SARS-CoV-2 3CL protease mutants circulating globally,\u0026rdquo; Biochem. Biophys. Res. Commun., vol. 645, pp. 132\u0026ndash;136, Feb. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2023.01.040\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2023.01.040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao Bin \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Oral Simnotrelvir for Adult Patients with Mild-to-Moderate Covid-19,\u0026rdquo; N. Engl. J. Med., vol. 390, no. 3, pp. 230\u0026ndash;241, Jan. 2024, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMoa2301425\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa2301425\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026ldquo;Shionogi Receives U.S. FDA Fast Track Designation for Ensitrelvir Fumaric Acid, an Investigational Oral Antiviral for COVID-19.\u0026rdquo; Accessed: Apr. 29, 2024. [Online]. Available: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.shionogi.com/global/en/news/2023/04/20230404.html\u003c/span\u003e\u003cspan address=\"https://www.shionogi.com/global/en/news/2023/04/20230404.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. M. Froggatt, B. E. Heaton, and N. S. Heaton, \u0026ldquo;Development of a Fluorescence-Based, High-Throughput SARS-CoV-2 3CLpro Reporter Assay,\u0026rdquo; \u003cem\u003eJ. Virol.\u003c/em\u003e, vol. 94, no. 22, p. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jvi.01265-20\u003c/span\u003e\u003cspan address=\"10.1128/jvi.01265-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, Oct. 2020, doi: 10.1128/jvi.01265-20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZ.-C. Bei \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Orthogonal dual reporter-based gain-of-signal assay for probing SARS-CoV-2 3CL protease activity in living cells: inhibitor identification and mutation investigation,\u0026rdquo; \u003cem\u003eEmerg. Microbes Infect.\u003c/em\u003e, vol. 12, no. 1, p. 2211688, Dec. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/22221751.2023.2211688\u003c/span\u003e\u003cspan address=\"10.1080/22221751.2023.2211688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. Tan, Y. Hu, and J. Wang, \u0026ldquo;FlipGFP protease assay for evaluating in vitro inhibitory activity against SARS-CoV-2 Mpro and PLpro,\u0026rdquo; STAR Protoc., vol. 4, no. 2, p. 102323, May 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.xpro.2023.102323\u003c/span\u003e\u003cspan address=\"10.1016/j.xpro.2023.102323\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. K. Roe, N. A. Junod, A. R. Young, D. C. Beachboard, and C. C. Stobart, \u0026ldquo;Targeting novel structural and functional features of coronavirus protease nsp5 (3CLpro, Mpro) in the age of COVID-19,\u0026rdquo; J. Gen. Virol., vol. 102, no. 3, p. 001558, Jan. 2021, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/jgv.0.001558\u003c/span\u003e\u003cspan address=\"10.1099/jgv.0.001558\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Ahmadi \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Differential gene expression of SARS-CoV-2 transcriptome provides insight into the design of more sensitive diagnostic tests,\u0026rdquo; Hum. Gene, vol. 34, p. 201116, Dec. 2022, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.humgen.2022.201116\u003c/span\u003e\u003cspan address=\"10.1016/j.humgen.2022.201116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. Hammond \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Oral Nirmatrelvir for High-Risk, Nonhospitalized Adults with Covid-19,\u0026rdquo; \u003cem\u003eN. Engl. J. Med.\u003c/em\u003e, vol. 386, no. 15, pp. 1397\u0026ndash;1408, Apr. 2022, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMoa2118542\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa2118542\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Chen, Y. Gao, H. Liu, H. Li, W. Chen, and J. Ma, \u0026ldquo;Advances in research on 3C-like protease (3CLpro) inhibitors against SARS-CoV-2 since 2020,\u0026rdquo; RSC Med. Chem., vol. 14, no. 1, pp. 9\u0026ndash;21, Jan. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/D2MD00344A\u003c/span\u003e\u003cspan address=\"10.1039/D2MD00344A\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Uhl\u0026eacute;n \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Proteomics. Tissue-based map of the human proteome,\u0026rdquo; Science, vol. 347, no. 6220, p. 1260419, Jan. 2015, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.1260419\u003c/span\u003e\u003cspan address=\"10.1126/science.1260419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. M. O. Rawson, A. Duchon, O. A. Nikolaitchik, V. K. Pathak, and W.-S. Hu, \u0026ldquo;Development of a Cell-Based Luciferase Complementation Assay for Identification of SARS-CoV-2 3CLpro Inhibitors,\u0026rdquo; \u003cem\u003eViruses\u003c/em\u003e, vol. 13, no. 2, Art. no. 2, Feb. 2021, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v13020173\u003c/span\u003e\u003cspan address=\"10.3390/v13020173\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Deng, C. Zhang, W. Yan, L. Chen, B. He, and Y. Li, \u0026ldquo;Development of Fluorescence-Based Assays for Key Viral Proteins in the SARS-CoV-2 Infection Process and Lifecycle,\u0026rdquo; \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e, vol. 25, no. 5, Art. no. 5, Jan. 2024, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25052850\u003c/span\u003e\u003cspan address=\"10.3390/ijms25052850\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. Liu, C. Ge, L. Zha, L. Lin, and R. Li, \u0026ldquo;Simple Nano-Luciferase-Based Assay for the Rapid and High-Throughput Detection of SARS-CoV-2 3C-Like Protease,\u0026rdquo; \u003cem\u003eAnal. Chem.\u003c/em\u003e, vol. 95, no. 2, pp. 714\u0026ndash;719, Jan. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.analchem.2c02590\u003c/span\u003e\u003cspan address=\"10.1021/acs.analchem.2c02590\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. M. Close, R. E. Hahn, S. S. Patterson, S. A. Ripp, G. S. Sayler, and S. J. Baek, \u0026ldquo;Comparison of human optimized bacterial luciferase, firefly luciferase, and green fluorescent protein for continuous imaging of cell culture and animal models,\u0026rdquo; J. Biomed. Opt., vol. 16, no. 4, p. 047003, Apr. 2011, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1117/1.3564910\u003c/span\u003e\u003cspan address=\"10.1117/1.3564910\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Neefjes, B. a. C. Housmans, G. G. H. van den Akker, L. W. van Rhijn, T. J. M. Welting, and P. M. van der Kraan, \u0026ldquo;Reporter gene comparison demonstrates interference of complex body fluids with secreted luciferase activity,\u0026rdquo; Sci. Rep., vol. 11, no. 1, p. 1359, Jan. 2021, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-020-80451-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-80451-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Hoffmann \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor,\u0026rdquo; Cell, vol. 181, no. 2, pp. 271\u0026ndash;280.e8, Apr. 2020, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2020.02.052\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.02.052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. R. Lee, Y. C. Kweon, S. M. Lee, and C. Y. Park, \u0026ldquo;Human coronavirus 3CL proteases cleave septins and disrupt Hedgehog signaling, causing ciliary dysfunction,\u0026rdquo; J. Med. Virol., vol. 95, no. 3, p. e28618, Mar. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jmv.28618\u003c/span\u003e\u003cspan address=\"10.1002/jmv.28618\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. A. Hameedi \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Structural and functional characterization of NEMO cleavage by SARS-CoV-2 3CLpro,\u0026rdquo; \u003cem\u003eNat. Commun.\u003c/em\u003e, vol. 13, no. 1, Art. no. 1, Sep. 2022, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-022-32922-9\u003c/span\u003e\u003cspan address=\"10.1038/s41467-022-32922-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB. V. Tsu \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Host-specific sensing of coronaviruses and picornaviruses by the CARD8 inflammasome,\u0026rdquo; \u003cem\u003ePLOS Biol.\u003c/em\u003e, vol. 21, no. 6, p. e3002144, Jun. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pbio.3002144\u003c/span\u003e\u003cspan address=\"10.1371/journal.pbio.3002144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. Petschnigg \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The mammalian-membrane two-hybrid assay (MaMTH) for probing membrane-protein interactions in human cells,\u0026rdquo; \u003cem\u003eNat. Methods\u003c/em\u003e, vol. 11, no. 5, Art. no. 5, May 2014, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nmeth.2895\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.2895\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Saraon, I. Grozavu, S. H. Lim, J. Snider, Z. Yao, and I. Stagljar, \u0026ldquo;Detecting Membrane Protein-protein Interactions Using the Mammalian Membrane Two-hybrid (MaMTH) Assay,\u0026rdquo; Curr. Protoc. Chem. Biol., vol. 9, no. 1, pp. 38\u0026ndash;54, 2017, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cpch.15\u003c/span\u003e\u003cspan address=\"10.1002/cpch.15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF. Corpet, \u0026ldquo;Multiple sequence alignment with hierarchical clustering.,\u0026rdquo; \u003cem\u003eNucleic Acids Res.\u003c/em\u003e, vol. 16, no. 22, pp. 10881\u0026ndash;10890, Nov. 1988.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. E. Crooks, G. Hon, J.-M. Chandonia, and S. E. Brenner, \u0026ldquo;WebLogo: A Sequence Logo Generator,\u0026rdquo; \u003cem\u003eGenome Res.\u003c/em\u003e, vol. 14, no. 6, pp. 1188\u0026ndash;1190, Jun. 2004, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gr.849004\u003c/span\u003e\u003cspan address=\"10.1101/gr.849004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. D. Schneider and R. M. Stephens, \u0026ldquo;Sequence logos: a new way to display consensus sequences.,\u0026rdquo; \u003cem\u003eNucleic Acids Res.\u003c/em\u003e, vol. 18, no. 20, pp. 6097\u0026ndash;6100, Oct. 1990.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. Lawrenz \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Severe Acute Respiratory Syndrome Coronavirus 2 Vaccination Boosts Neutralizing Activity Against Seasonal Human Coronaviruses,\u0026rdquo; Clin. Infect. Dis., vol. 75, no. 1, pp. e653\u0026ndash;e661, Jul. 2022, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cid/ciac057\u003c/span\u003e\u003cspan address=\"10.1093/cid/ciac057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQ. Xie \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Endogenous IFITMs boost SARS-coronavirus 1 and 2 replication whereas overexpression inhibits infection by relocalizing ACE2,\u0026rdquo; iScience, vol. 26, no. 4, p. 106395, Apr. 2023, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2023.106395\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2023.106395\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Nchioua \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;SARS-CoV-2 Is Restricted by Zinc Finger Antiviral Protein despite Preadaptation to the Low-CpG Environment in Humans,\u0026rdquo; \u003cem\u003emBio\u003c/em\u003e, vol. 11, no. 5, pp. e01930-20, Oct. 2020, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mBio.01930-20\u003c/span\u003e\u003cspan address=\"10.1128/mBio.01930-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. J. REED and H. MUENCH, \u0026ldquo;A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS12,\u0026rdquo; Am. J. Epidemiol., vol. 27, no. 3, pp. 493\u0026ndash;497, May 1938, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/oxfordjournals.aje.a118408\u003c/span\u003e\u003cspan address=\"10.1093/oxfordjournals.aje.a118408\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"SARS-CoV-2, coronaviruses, Gaussia reporter assay, Nsp5, 3CLpro, protease inhibitor","lastPublishedDoi":"10.21203/rs.3.rs-4365319/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4365319/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHuman coronaviruses (hCoVs) infect millions of people every year. Among these, MERS, SARS-CoV-1, and SARS-CoV-2 caused significant morbidity and mortality and their emergence highlights the risks associated with possible future coronavirus outbreaks. Therefore, broadly-active anti-coronavirus drugs are needed. Pharmacological inhibition of the hCoV protease 3CLpro (Nsp5) in COVID-19 patients is clinically beneficial as shown by the wide and effective use of Paxlovid (nirmaltrevir, ritonavir). However, further treatment options are required due to the emergence of drug resistance in some SARS-CoV-2 strains. To facilitate protease inhibitor discovery and evaluation, we developed an assay allowing rapid and reliable quantification of 3CLpro activity under biosafety level 1 conditions. It is based on an ACE2 receptor - Gal4 transcription factor fusion protein separated by a 3CLpro recognition site. Cleavage by 3CLpro releases the Gal4 transcription factor, which then induces the expression of Gaussia luciferase. Our assay is compatible with 3CLpro proteases from all hCoVs, and allows simultaneous measurement of inhibitory and cytotoxic effects of the tested compounds. Proof-of-concept IC\u003csub\u003e50\u003c/sub\u003e measurements confirmed that nirmaltrevir, GC376 and lopinavir inhibit SARS-CoV-2 3CLpro function without inducing cytotoxicity. Overall, the Gaussia luciferase-based reporter assay is suitable for evaluating viral protease function and screening of potential 3CLpro inhibitors.\u003c/p\u003e","manuscriptTitle":"A Gaussia luciferase reporter assay for the evaluation of coronavirus Nsp5/3CLpro inhibitors","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-23 18:27:55","doi":"10.21203/rs.3.rs-4365319/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-29T04:46:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-27T21:53:23+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-21T13:06:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"319073042611774566067192677350933541505","date":"2024-05-16T15:04:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-16T13:46:44+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-12T13:23:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"15531948076643819561855689599419232233","date":"2024-05-12T12:32:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"64897909534686697335652486082918313316","date":"2024-05-10T13:06:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"264980521183156516373493560228631397615","date":"2024-05-09T13:23:44+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-09T08:05:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-09T07:02:07+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-05-09T06:45:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-09T06:41:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-05-03T17:05:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c55c414e-9e53-4805-af4e-24bbd5cd2fb0","owner":[],"postedDate":"May 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":32113915,"name":"Biological sciences/Microbiology/Virology/Sars cov 2"},{"id":32113916,"name":"Biological sciences/Drug discovery/Drug screening"},{"id":32113917,"name":"Biological sciences/Biological techniques"}],"tags":[],"updatedAt":"2024-09-09T16:09:52+00:00","versionOfRecord":{"articleIdentity":"rs-4365319","link":"https://doi.org/10.1038/s41598-024-71305-6","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-09-05 16:05:00","publishedOnDateReadable":"September 5th, 2024"},"versionCreatedAt":"2024-05-23 18:27:55","video":"","vorDoi":"10.1038/s41598-024-71305-6","vorDoiUrl":"https://doi.org/10.1038/s41598-024-71305-6","workflowStages":[]},"version":"v1","identity":"rs-4365319","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4365319","identity":"rs-4365319","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.