Genomic Insights into Bordetella pertussis Evolution and Macrolide Resistance in Yiwu, China | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genomic Insights into Bordetella pertussis Evolution and Macrolide Resistance in Yiwu, China Wuqin Xu, Qianru Wei, Bian Wu, Zhiqiang Zhu, Wenjun Guan, Guangyong Chen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6608985/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Nov, 2025 Read the published version in BMC Genomics → Version 1 posted 10 You are reading this latest preprint version Abstract Pertussis, caused by Bordetella pertussis , remains a significant public health concern despite widespread vaccination. Recent increases in macrolide-resistant strains present additional challenges for treatment and control. Yiwu, China—a highly mobile and international city—offers a unique setting to study the genomic evolution and antimicrobial resistance of B. pertussis . In this study, 63 clinical isolates from Yiwu underwent whole-genome sequencing. Over 90% of isolates showed high resistance to macrolides. Genome sizes ranged from 3.53 to 4.15 Mb, with high GC content (67.69–67.80%) and variable repeat rates. Phylogenetic analysis, incorporating 14 international strains, revealed two distinct clades and lineage-specific variations in key vaccine antigen genes, indicating multiple origins and localized evolution. A comparative analysis between resistant and sensitive isolates identified an A2037G substitution in the 23S rRNA gene strongly associated with macrolide resistance. Additionally, 69 highly divergent genes related to transcriptional regulation, recombination, and membrane function were detected. Notably, two outer membrane efflux protein genes, opm D and opr M, showed nonsynonymous mutations potentially linked to resistance enhancement. The presence of genomic islands, prophages, and antigenic gene variation further underscores the dynamic evolution of B. pertussis in the region. This study highlights the urgent need for alternative therapies and improved vaccines, while also demonstrating the value of continued genomic surveillance. Insights into resistance-associated genes offer new targets for functional studies and may guide future strategies in pertussis control. Bordetella pertussis Macrolides resistance Whole genome sequence Phylogeny Genomic evolution Figures Figure 1 Figure 2 Figure 3 Background Pertussis (or whooping cough), caused by Bordetella pertussis , is a highly contagious respiratory disease characterized by paroxysmal coughing fits, often accompanied by a characteristic whooping sound upon inhalation [ 1 , 2 ]. Despite the availability of vaccines, pertussis continues to pose a significant global health threat, with periodic outbreaks reported worldwide [ 3 , 4 ]. Recent epidemiological shifts have highlighted the re-emergence of pertussis, partly fueled by the evolution of antibiotic resistance in circulating strains, particularly against macrolides like erythromycin [ 5 – 7 ]. The emergence of antimicrobial resistance among B. pertussis strains presents a formidable challenge, impacting treatment efficacy and potentially compromising disease control efforts [ 8 ]. The resurgence of pertussis is further exacerbated by the pathogen's ability to evade immune responses, even in vaccinated populations. This immune evasion, coupled with the increasing prevalence of macrolide-resistant strains, has led to a growing number of cases in both developed and developing countries, underscoring the urgent need for enhanced surveillance and novel therapeutic strategies. Understanding the genetic basis of resistance mechanisms is crucial for developing effective therapeutic strategies and optimizing public health interventions. Yiwu, a famous "small-commodity city", located in Zhejiang, China, represents a dynamic urban environment characterized by rapid population mobility and diverse demographic influxes from across the globe. This dynamic environment facilitates the cross-border carriage and cross-transmission of pathogenic microorganisms. In this study, high prevalence of macrolide resistance, combined with the genomic diversity of the isolates was observed in this region. In this context, the genomic data from Yiwu might provide a critical resource for understanding the local and global dynamics of B. pertussis evolution and offers valuable insights into the mechanisms driving the re-emergence of pertussis. Here, we conducted whole-genome sequencing of 63 clinical isolates of B. pertussis collected in Yiwu, Zhejiang, China. Additionally, we integrated genomic data from 14 isolates obtained from various international locations via the BIGSdb database [ 9 ]. Our comprehensive genomic and evolutionary analysis aims to delineate the genetic diversity, evolutionary relationships and antimicrobial resistance profiles among global B. pertussis isolates. Methods Basic information of the isolates In 2021, the Chinese Center for Disease Control and Prevention selected Yiwu in Zhejiang Province and Yongcheng in Henan Province as study sites to conduct population-based active laboratory surveillance for pertussis. The Fourth Affiliated Hospital of Zhejiang University School of Medicine, one of the designated pertussis surveillance hospitals in Yiwu, has systematically conducted preliminary work on the isolation, cultivation, and identification of clinical B. pertussis isolates. This effort has resulted in the establishment of an isolate repository containing 63 B. pertussis isolates. For this study, all 63 isolates were obtained from the isolate repository at the Fourth Affiliated Hospital of Zhejiang University School of Medicine. Patient information was extracted from medical records at the same hospital. The cryopreserved isolates were used for antibiotic resistance phenotyping and whole-genome sequencing. Patient demographic and clinical information, including age, sex, vaccination status, and vaccination dates, were recorded. Both the patient information and the resistance phenotypes of the isolates are documented in Table S1 . This study was approved by the Medical Ethics Committee of the Fourth Affiliated Hospital of Zhejiang University School of Medicine (Approval NO.: K2024244). Antimicrobial susceptibility testing Antimicrobial susceptibility testing was conducted using the E-test method to assess the response of isolated isolates to nine antimicrobial agents: erythromycin, clarithromycin, azithromycin, meropenem, trimethoprim-sulfamethoxazole (SMZ), amoxicillin-clavulanic acid, ceftriaxone, levofloxacin, and ciprofloxacin. The preserved isolates stored at -80°C were revived and subcultured. A small amount of bacterial colonies was collected using a swab and diluted to a 0.5 McFarland standard suspension. The suspension was then inoculated onto sheep blood agar plates and incubated in a 35–37°C incubator. After 96 hours of cultivation, the minimum inhibitory concentration (MIC) values were determined. Due to the lack of specific CLSI breakpoints for B. pertussis , results were interpreted based on MIC ranges and CLSI10 standards for Haemophilus influenzae [ 10 ]. Genome sequencing Genomic DNA was extracted using the SDS method [ 11 ], followed by verification through agarose gel electrophoresis and quantification with a Qubit® 2.0 Fluorometer (Thermo Scientific). A hybrid sequencing approach combining second-generation and third-generation sequencing technologies was employed. Third-generation sequencing, conducted on a PacBio platform utilizing single-molecule sequencing technology, was used as the primary method due to its capability to generate ultra-long reads, which significantly enhances genome assembly accuracy. The raw sequencing data, stored in BAM format, included sequence reads and base quality scores. Basic statistics such as total data yield, read length distribution, and quality scores were calculated to evaluate the data quality. Second-generation sequencing was utilized as a complementary approach, primarily for genome survey and assembly refinement. Raw data were processed to remove low-quality reads (quality score ≤ 38 for more than 40% of bases), reads with more than 10% ambiguous bases ('N'), and reads with significant adapter contamination (overlap > 15 bp with fewer than 3 mismatches). For samples with potential host contamination, reads were aligned against a host genome database through BLAST [ 12 ] and removed. Genome assembly Genome assembly was carried out using the Canu v.2.0 ( https://github.com/marbl/canu/ ) [ 13 ], which initially assembled the third-generation reads to produce a draft assembly reflecting the genome's basic structure. The assembly underwent three rounds of error correction using Racon v..1.4.13 [ 14 ] based on third-generation sequencing data. Subsequently, three additional rounds of polishing were performed with Pilon v.1.22 [ 15 ] using second-generation reads to achieve the final high-quality assembly. This hybrid assembly strategy effectively leveraged the strengths of both sequencing technologies, ensuring accurate and complete genome assemblies. The completeness of the genomics data was assessed by BUSCO v.5.8.0 [ 16 ]. Genome component prediction and gene function annotation Genome component prediction encompassed identifying coding genes, repetitive sequences, non-coding RNAs, genomic islands, prophages, and CRISPR sequences. For bacterial genomes, coding genes were predicted using GeneMarkS v.4.28 [ 17 ]. Interspersed repetitive sequences were identified with RepeatMasker v.4.1.2 [ 18 ], while tandem repeats were analyzed using Tandem Repeats Finder (TRF) v.4.10.0 [ 19 ]. Transfer RNA (tRNA) genes were predicted using tRNAscan-SE v.2.0.7 [ 20 , 21 ], ribosomal RNA (rRNA) genes were analyzed with RNAmmer v.1.2 [ 22 ], and small nuclear RNAs (snRNA) were identified via BLAST against the Rfam database [ 23 , 24 ]. Genomic islands were predicted with IslandPath-DIMOB [ 25 ], prophages with PHAST [ 26 ], and CRISPR sequences with CRISPRFinder [ 27 ]. Gene function annotation involved using eight databases: Gene Ontology (GO) [ 28 ], Kyoto Encyclopedia of Genes and Genomes (KEGG) [ 29 , 30 ], Clusters of Orthologous Groups (COG) [ 31 ], Non-Redundant Protein Database (NR) [ 32 ], Transporter Classification Database (TCDB) [ 33 ], Swiss-Prot [ 34 ], Carbohydrate-Active enZYmes Database (CAZy) [ 35 ] and Pfam ( http://pfam.xfam.org/ ). A whole-genome BLAST search (E-value 40%) was conducted against these databases to predict gene functions. Phylogeny To investigate the origins and evolutionary relationships of the 63 B. pertussis isolates collected from Yiwu, Zhejiang, we included an additional 14 B. pertussis isolates from Japan (ID = 507 Tohama I), the USA (ID = 533 B203, 527 A371, and 566 H617), Sweden (ID = 10013 B3582), France (ID = 10144 FR4953, 10408 5456 P2M, 10459 FR6115, and 11590 FR6597), Tunisia (ID = 10527 TN0006), and other regions of China (ID = 2052 L15189, 2076 L13030, 2078 L13055, and 2093 L14260) [ 36 ]. These data were downloaded from the BIGSdb genomic platform (project i.d. 25: https://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db= pubmlst_bordetella_isolates&page = query&project_list = 25&submit = 1). These isolates were selected to ensure broad geographic coverage and to represent the major phylogenetic lineages described in the global B. pertussis phylogeny [ 36 ]. In particular, we prioritized isolates from distinct clades in order to provide a comprehensive evolutionary context for the Yiwu strains and to facilitate comparative analyses of genomic diversity, population structure, and international transmission dynamics. All 77 isolates were then used to construct the phylogenetic tree. Orthofinder [ 37 , 38 ] was employed to identify single-copy orthologous genes across these isolates. A concatenated alignment of 839 single-copy orthologous genes was generated using MAFFT v.7.490 [ 39 ]. The aligned sequences were then used to construct the phylogenetic tree with RAxML v.8.2.12 [ 40 ]. Gene typing of vaccine antigen genes To explore the genetic diversity of vaccine antigen genes and assess their distribution among circulating B. pertussis strains, multilocus sequence typing (MLST) of the total of 77 B. pertussis isolates was performed using the mlst tool, which integrates profiles and allele sequences from the PubMLST database [ 41 ]. Gene typing focused specifically on nine vaccine antigens genes of B. pertussis , including pertussis toxin promoter ( ptx P), pertussis toxin subunit A ( ptx A), pertussis toxin subunit B ( ptx B), pertussis toxin subunit C ( ptx C), pertussis toxin subunit D ( ptx D), pertussis toxin subunit E ( ptx E), filamentous hemagglutinin precursor ( fha B), fimbrial protein 2 ( fim 2), and fimbrial protein 3 ( fim 3). Custom allele databases for these loci were downloaded from the BIGSdb-PubMLST Bordetella database ( https://bigsdb.pasteur.fr ) and formatted for local use with the mlst software. Draft genome assemblies of all 77 isolates were screened for allele matches based on nucleotide sequence identity. Genomic variations between macrolide resistant and sensitive isolates In the antimicrobial susceptibility testing of B. pertussis , we evaluated a range of antibiotics. However, we focused on macrolides (erythromycin, clarithromycin, and azithromycin) in the subsequent genomic analysis due to their critical role as first-line treatments for pertussis and the high levels of resistance observed against them in our data. Most isolates exhibited macrolide resistance, with the exception of isolate YW7, which showed significantly lower MIC values for macrolides (0.064 µg/mL) compared to the other isolates. To investigate the genomic mechanisms underlying macrolide resistance, we classified the isolates into two groups: the sensitive group (YW7) and the resistant group (the remaining 62 isolates). Two complementary approaches were employed to compare genomic differences between these groups. First, we examined the genetic variation between two groups in 23S rRNA, which is a key gene associated with macrolide antibiotic resistance [ 42 ]. Next, to comprehensively identify genome-wide variants distinguishing the two groups, we utilized MUMmer v.3.1 [ 43 ] to detect sequence variations. A variant was considered highly divergent if it was consistently present in more than 60 resistant isolates. These variants were then mapped to the coding sequence (CDS) regions of specific genes, resulting in the identification of 69 highly divergent genes, which were subsequently annotated and subjected to gene ontology (GO) enrichment analysis. Further screening of macrolide resistance associated genes To further refine the set of highly divergent genes potentially associated with macrolide resistance, we performed pathogenicity-related and antibiotic resistance gene annotation as follows: secretory proteins were predicted using the SignalP database [ 44 ], while Type I–VII secretion system proteins in pathogenic bacteria were identified using EffectiveT3 [ 45 ]. Additionally, we analyzed secondary metabolite gene clusters using antiSMASH [ 46 ] to investigate biosynthetic potential. Given the pathogenic nature of B. pertussis , we further assessed pathogenicity and antibiotic resistance by leveraging multiple specialized databases, including PHI (Pathogen-Host Interactions Database) [ 47 ], VFDB (Virulence Factors of Pathogenic Bacteria) [ 48 ], and ARDB (Antibiotic Resistance Genes Database) [ 49 ]. To identify candidate resistance-associated genes, we intersected the annotated genes related to pathogenicity and antibiotic resistance with the 69 highly divergent genes identified in the previous step. This analysis resulted in a final set of five genes, which were considered candidates for involvement in macrolide resistance mechanisms. Results The drug resistance profiles A strikingly high level of resistance was observed against macrolide antibiotics, with over 90% of isolates exhibiting MIC values greater than 256 µg/mL for erythromycin, clarithromycin and azithromycin. Notably, only a single isolate (YW7) remained susceptible to macrolides, with MIC values of 0.064 µg/mL for all three drugs. In contrast, resistance to non-macrolide antibiotics was considerably lower and more variable: approximately 10–30% of isolates showed resistance to meropenem, trimethoprim-sulfamethoxazole, and amoxicillin-clavulanic acid. Resistance to cephalosporins (ceftriaxone) and fluoroquinolones (levofloxacin and ciprofloxacin) was rare, generally affecting less than 10% of the isolates tested (Table S1 ). Genome characteristic We analyzed the genomic characteristics of the 63 clinical isolates of B. pertussis (Fig. 1 ). The genome sizes of these isolates range from 3,531,012 bp to 4,148,800 bp (Table 1 ). The N50 lengths vary between 20,692 bp and 22,720 bp, indicating the quality and contiguity of the assembled genomes. Repeat rates show significant variation among the isolates, with values ranging from 23.22–53.13%, reflecting differences in genomic repetitiveness. GC content remains consistently high across all isolates, ranging from 67.69–67.80%, typical for B. pertussis . Gene counts range from 4,018 to 5,032, with most isolates containing around 4,000 genes (Table 1 ). BUSCO results showed that the final assembly and annotation of B. pertussis genome was 95.8% (YW74) to 99.0% (YW41) complete, suggesting that most of the recovered genes could be classified as ‘complete and single-copy’ (Table 1 ; Fig. S1 ). This genomic data provides a comprehensive overview of the genetic diversity and structural features of these bacterial isolates, contributing valuable insights into their evolutionary and functional dynamics. Table 1 Genomic characteristics of 63 Bordetella pertussis clinical isolates collected from Yiwu, Zhejiang Sample ID Genome size (bp) N50 length (bp) Repeat rate (%) GC content (%) Gene number Genome completeness (%) YW1 4,129,568 21,123 29.07 67.72 4,091 97.8 YW2 4,132,002 21,123 27.98 67.72 4,089 98.0 YW4 4,133,711 21,094 31.67 67.71 4,060 97.8 YW5 4,129,344 21,095 27.67 67.75 4,055 98.0 YW6 4,130,781 21,108 28.97 67.72 4,094 97.8 YW7 4,110,520 21,242 27.66 67.71 4,018 98.2 YW8 4,135,600 21,135 28.80 67.71 4,067 98.1 YW9 4,128,919 21,108 29.63 67.72 4,041 98.1 YW10 4,130,289 21,386 32.96 67.72 4,043 98.1 YW11 4,148,293 20,940 31.40 67.70 4,101 98.0 YW12 4,130,418 22,720 23.22 67.72 4,065 97.8 YW17 4,148,800 21,093 32.46 67.71 4,098 97.7 YW18 4,128,123 21,148 27.91 67.72 4,065 97.9 YW19 4,131,464 21,095 28.30 67.72 4,079 97.9 YW20 4,131,527 21,223 29.86 67.71 4,079 97.3 YW21 4,109,737 21,223 28.48 67.70 4,057 97.8 YW23 4,130,399 21,132 27.72 67.72 4,077 98.0 YW24 4,131,969 20,697 27.64 67.71 4,092 97.8 YW25 3,531,012 21,099 30.64 67.80 4,162 98.0 YW26 4,142,753 21,108 27.82 67.71 4,073 97.9 YW28 4,129,306 21,114 29.91 67.72 4,066 97.5 YW29 4,147,608 21,214 29.28 67.72 4,064 98.0 YW31 4,130,359 21,124 30.45 67.72 4,055 98.1 YW32 4,130,360 20,693 29.71 67.72 4,048 97.9 YW34 4,125,250 21,144 28.17 67.70 4,103 97.8 YW35 4,130,415 20,692 28.04 67.72 4,083 98.1 YW36 4,145,416 21,093 29.00 67.70 4,101 97.6 YW37 4,115,814 22,702 29.21 67.70 4,053 98.1 YW38 4,110,804 21,429 27.09 67.70 4,036 97.9 YW40 4,118,889 21,123 28.61 67.72 4,060 97.6 YW41 4,110,780 21,214 26.72 67.70 5,032 99.0 YW42 4,124,320 21,239 33.24 67.71 4,075 97.7 YW43 4,129,461 21,095 31.83 67.72 4,080 96.9 YW44 4,127,586 21,454 27.18 67.69 4,091 98.3 YW49 4,109,743 21,454 27.36 67.70 4,060 96.8 YW50 4,132,548 21,132 28.41 67.71 4,063 97.9 YW51 4,124,028 21,223 37.98 67.71 4,085 98.1 YW53 4,130,465 20,819 26.61 67.72 4,079 97.8 YW54 4,105,135 22,720 28.40 67.71 4,064 97.5 YW55 4,139,940 21,223 28.56 67.72 4,088 98.1 YW56 4,107,387 22,617 26.32 67.71 4,053 97.9 YW57 4,113,079 20,940 27.46 67.70 4,097 97.3 YW58 4,124,553 21,135 26.97 67.70 4,099 97.7 YW59 4,121,597 21,223 28.27 67.70 4,095 97.7 YW64 4,109,793 21,223 27.22 67.70 4,085 97.1 YW70 4,109,908 21,223 26.55 67.71 4,079 97.8 YW71 4,115,431 21,454 29.05 67.70 4,062 98.1 YW72 4,119,634 21,150 53.13 67.72 4,101 97.1 YW74 4,111,949 20,949 29.34 67.70 4,104 95.8 YW75 4,119,063 21,239 28.00 67.70 4,079 98.0 YW76 4,119,841 21,223 28.53 67.70 4,060 98.3 YW77 4,106,607 21,214 27.87 67.71 4,059 97.9 YW79 4,108,793 21,429 26.27 67.71 4,053 97.9 YW80 4,107,719 21,214 26.19 67.71 4,066 98.1 YW82 4,108,234 21,454 28.05 67.70 4,067 97.4 YW83 4,107,756 21,429 26.84 67.71 4,046 97.7 YW84 4,104,271 21,223 28.70 67.70 4,070 97.5 YW85 4,104,934 21,214 27.86 67.71 4,059 97.6 YW86 4,105,546 21,214 26.50 67.71 4,063 98.0 YW87 4,107,547 21,086 28.15 67.71 4,073 97.5 YW88 4,106,795 21,135 26.86 67.71 4,082 97.2 YW90 4,106,638 21,144 28.28 67.71 4,061 97.6 YW91 4,104,087 22,720 27.12 67.71 4,036 97.5 Genome component Each isolate exhibits varying numbers and total lengths of different repetitive elements, including LTRs, DNA, LINEs, SINEs, RC, and unknown sequences. Notably, LTRs consistently comprise the highest number across all isolates, whereas SINEs exhibit the greatest variability in both number and total length (Table S2 ). Table S3 presents the distribution of tandem repeats (TR), minisatellite DNA, and microsatellite DNA across 63 B. pertussis isolates. TRs range from 255 to 333 instances per isolate, with sizes from 1 to 1,178 bp, contributing 0.67–1.21% of the genome. Minisatellite DNA occurs 216 to 265 times per isolate, comprising 0.23–0.24% of the genome, and microsatellite DNA ranges from 9 to 22 sequences per isolate, contributing 0.0075–0.026% of the genome. We also summarized the types and characteristics of identified non-coding RNAs (ncRNAs), including transfer RNAs (tRNAs), 5s rRNA (denovo), 16s rRNA (denovo), and 23s rRNA (denovo). Each isolate consistently exhibited 51 to 86 tRNAs with a consistent length of 78 bp, totaling between 3,994 bp and 6,783 bp. The 5s rRNA, 16s rRNA, and 23s rRNA (denovo) were observed in three to eight copies per isolate, with average lengths ranging from 112 bp to 2,982 bp, contributing to total lengths between 336 bp and 20,877 bp per isolate (Table S4 ). Genomic islands (GIs) were identified in all isolates to assess their prevalence and characteristics across the dataset. Each isolate showed variability in GI number (ranging from 23 to 31) and total length (238,010 bp to 337,219 bp). The average GI length ranged from 9,640 bp to 12,821 bp (Table S5). The number of prophages per isolate varied from 9 to 35, with total lengths ranging from 364,899 bp to 1,636,090 bp. Average prophage lengths varied from 36,490 bp to 55,976 bp. This diversity highlights the presence and variability of prophages within B. pertussis genomes, potentially contributing to genomic evolution and adaptation (Table S6). Among the accessory proteins, ten CRISPR proteins were found in isolate YW41, two in isolates YW27 and YW25, and one in isolate YW42. Phylogenetic relationships and vaccine antigen gene variation A phylogenetic tree was constructed using 839 single-copy orthologous genes from 77 B. pertussis isolates, including 63 newly sequenced isolates from Yiwu and 14 representative international isolates (Fig. 2 ). The resulting tree revealed a clear separation into two major clades, indicating that the Yiwu isolates are derived from at least two distinct evolutionary origins. To investigate potential correlations between phylogenetic structure and vaccine antigen gene profiles, allele typing was performed for nine vaccine-related genes. The results showed that ptx B, ptx D, and ptx E were highly conserved among all 77 isolates (Table S7), whereas the remaining six genes exhibited allelic variation across isolates (Fig. 2 ). Notably, ptx P, ptx C, and fha B displayed strong phylogenetic structuring. In ptx P, all isolates in Clade I carried allele type 3, including the international reference strains, while all Clade II isolates harbored type 1, except for two international strains (10408 5456 P2M and 533 B203), which retained type 3. A similar pattern of clade-specific allele distribution was observed for ptx C and fha B, supporting the hypothesis of parallel lineage divergence under differential evolutionary pressures. Furthermore, the international isolates exhibited greater allele diversity across the variable loci compared to the Yiwu isolates. For instance, multiple alleles of fim 2, fim 3, and ptx A were detected among global strains, whereas the Yiwu isolates predominantly harbored a single allele for each of these genes. This suggests a relatively clonal expansion of specific antigenic types within the local population, possibly driven by vaccine-induced selection or regional transmission dynamics. Genomic variations between macrolide resistant and sensitive isolates We classified the isolates into two groups: the sensitive group (YW7) and the resistant group (the remaining 62 isolates). Comparative analysis of 23S rRNA revealed a nucleotide substitution at position 2037, where all three copies of the 23S rRNA gene in the resistant group carried G, while all three copies in YW7 carried A, which was identical to the reference strain Tohama I and CS. This mutation has been previously reported and is known to be associated with macrolide resistance [ 5 ]. The presence of the same mutation in all copies of the 23S rRNA gene in both YW7 and the other isolates suggests that the mutation may have emerged initially in one copy under selective pressure from antibiotics and subsequently spread to the other two copies via homologous recombination [ 50 ]. To further explore the evolutionary relationships of this gene among the isolates, we constructed a phylogenetic tree based on the 23S rRNA sequences of all 63 isolates. The tree showed that YW7 clustered more closely with the reference strain Tohama I and appeared to be ancestral to the other isolates, suggesting that the resistant isolates diverged following the acquisition of this mutation (Fig. S2 ). Comparative genomic variation analysis and functional enrichment Comparative genomic variation analysis identified 110 highly divergent variations, which were mapped to 69 genes (Fig. 3 a; Table S8). GO enrichment analysis of these 69 genes classified the enriched GO terms into three major categories: Cellular Component, Molecular Function, and Biological Process (Fig. 3 b). Cellular Component. Significantly enriched terms included "intracellular cellular component" (GO:0005622) and "membrane cellular component" (GO:0016020), indicating that variable genes are associated with intracellular and membrane-related functions. Molecular Function . The Molecular Function category showed significant enrichment in DNA-binding-related activities, including "DNA binding" (GO:0003677), "sequence-specific DNA binding transcription factor activity" (GO:0003700), and "sigma factor activity" (GO:0016987). Additionally, functions linked to genetic mobility, such as "transposase activity" (GO:0004803) and "recombinase activity" (GO:0000150), were also prominent. Biological Process . In the Biological Process category, terms associated with gene regulation and genetic recombination were significantly enriched, including "DNA integration" (GO:0015074), "regulation of transcription, DNA-dependent" (GO:0006355), "transcription initiation, DNA-dependent" (GO:0006352), "transposition, DNA-mediated" (GO:0006313), and "DNA recombination" (GO:0006310). Additionally, genes involved in transport processes (GO:0006810) were also identified. These findings suggest that the highly variable genes distinguishing macrolide resistant and sensitive B. pertussis strains are primarily involved in transcriptional regulation, genetic recombination, and membrane-associated functions, potentially contributing to the observed phenotypic differences in macrolide resistance. Candidate genes potentially involved in macrolide resistance mechanisms To further investigate potential genetic factors contributing to macrolide resistance, we annotated the 69 highly divergent genes using multiple databases, including PHI, VFDB, ARDB, CARD, Secretory_Protein, and T3SS. Based on these annotations, we identified five candidate genes that may play a role in macrolide resistance mechanisms (Table 2 ; Table S8). Further analysis of mutations in these genes revealed that outer membrane protein D ( opm D) and outer membrane protein M ( opr M) contain nonsynonymous mutations (Fig. 3 c), whereas pyruvate kinase ( pyk) , filamentous hemagglutinin precursor ( fha B), and ApaG domain-containing protein ( apa G) exhibit synonymous mutations, which may not alter protein function directly. opr M encodes an outer membrane efflux protein that functions as part of a tripartite efflux system, typically associated with resistance to macrolides, β-lactams, and other antimicrobial agents. It belongs to the Resistance-Nodulation-Division (RND) family of efflux pumps, which are known to contribute to multidrug resistance (MDR) in various Gram-negative bacteria [ 51 , 52 ]. opm D is another outer membrane efflux protein that plays a role in multidrug resistance, although its function is less well-characterized compared to opr M. It may interact with periplasmic and inner membrane components to form an efflux system capable of exporting toxic compounds, including antibiotics [ 53 , 54 ]. The nonsynonymous mutations identified in opm D and opr M may lead to structural or functional modifications, potentially enhancing its drug efflux efficiency or altering substrate specificity, which could impact macrolide resistance in B. pertussis . Table 2 Nonsynonymous and synonymous mutations identified in candidate genes Gene Gene id Mutation site Nucleotide acid change (YW7/others) Frequency Mutation type Amino acid change (YW7/others) pyk pb7_GM001077 960 T/C 1 syn opm D pb7_GM001203 211–240 -/ATCGGCCTGGCGCTGGCGCGCAACCTCGAT 1 nonsyn -/IGLALARNLD opr M pb7_GM001335 1229 T/C 0.98 nonsyn V/A fha B pb7_GM003068 6081 T/C 0.98 syn apa G pb7_GM003730 285 A/G 0.98 syn Discussion This study provides a comprehensive genomic analysis of 63 B. pertussis isolates from Yiwu, China, shedding light on their genetic diversity, antimicrobial resistance profiles, and evolutionary relationships with global strains. The high prevalence of macrolide resistance among the Yiwu isolates is particularly concerning, as it underscores the challenges posed by antibiotic resistance in controlling pertussis. Over 90% of the isolates exhibited high MIC values for macrolides, including erythromycin, clarithromycin, and azithromycin, which aligns with previous reports of increasing macrolide resistance in B. pertussis strains in China and globally [ 5 , 6 ]. This widespread resistance highlights the urgent need for alternative therapeutic strategies and the development of new antibiotics or adjunct therapies to manage pertussis effectively. Genomic diversity, evolutionary insights, and global spread The genomic diversity observed in the Yiwu isolates, particularly in terms of repeat elements, prophages, and genomic islands, suggests a dynamic evolutionary landscape. The variability in repeat elements, such as LTRs, LINEs, and SINEs, as well as the presence of prophages and genomic islands, may contribute to the adaptability and evolution of B. pertussis . These elements can facilitate horizontal gene transfer and genomic rearrangements, potentially leading to the acquisition of resistance genes or virulence factors. The presence of prophages, in particular, has been linked to bacterial evolution and adaptation, as they can introduce new genetic material into the host genome [ 55 ]. The high variability in prophage content among the Yiwu isolates suggests that these elements may play a significant role in shaping the genomic landscape of B. pertussis in this region. The phylogenetic analysis based on single-copy othologous genes revealed two genetically distinct clades among the 77 B. pertussis isolates, suggesting that the Yiwu strains originated from at least two independent lineages. This division was consistent with the distribution of allele types for several vaccine-related antigen genes. Specifically, ptx P, ptx C, and fha B displayed clear clade-specific allelic segregation, with ptx P3 exclusively found in Clade I and ptx P1 in Clade II (except for two international strains). These patterns reflect lineage-specific evolution and may result from regional immune selection or transmission dynamics. Yiwu is a highly internationalized city in eastern China, characterized by intensive domestic and international population movement due to trade and commerce. Such high levels of population mobility may have facilitated the introduction and co-circulation of genetically distinct B. pertussis lineages, providing opportunities for diversification, local adaptation, and potentially, antigenic convergence under shared vaccine pressure. Moreover, allele diversity was notably higher among international strains compared to the locally circulating Yiwu isolates, supporting the hypothesis of clonal expansion within the regional population. The limited antigenic diversity observed in Yiwu may reduce the effectiveness of current acellular pertussis vaccines, which are based on fixed antigen formulations. These findings underscore the importance of integrating phylogenetic structure with antigenic profiling to understand pertussis evolution and inform surveillance and vaccine design strategies. Notably, deletions of vaccine-related genes were observed in isolates YW1 and YW57, with three and two antigen genes missing, respectively. The absence of these antigens may reduce immune recognition, potentially allowing the bacteria to evade vaccine-induced immunity. Similar patterns have been reported globally, particularly with pertactin-deficient strains, supporting the idea that antigen loss can be an adaptive response to vaccine pressure. These findings suggest that antigen deletion may contribute to immune escape and emphasize the importance of monitoring antigenic profiles in circulating strains. Genetic basis of macrolide resistance Our comparative genomic analysis of macrolide resistant and sensitive B.pertussis isolates revealed key genetic differences that may contribute to macrolide resistance, pathogenicity, and bacterial adaptation. The highly divergent variations identified between the two groups mapped to genes involved in transcriptional regulation, genetic recombination, and membrane-associated functions, highlighting their potential roles in resistance mechanisms. Notably, the A2037G mutation in the 23S rRNA gene, found in all resistant isolates, likely emerged through homologous recombination under antibiotic selection pressure, consistent with previous studies linking this mutation to macrolide resistance [ 5 , 56 ]. Beyond 23S rRNA, our screening identified two outer membrane efflux protein-encoding genes potentially involved in macrolide resistance. Efflux-mediated resistance is a well-established mechanism in bacterial survival under antibiotic stress [ 57 ]. By actively removing antibiotics from the periplasmic space and cytoplasm, efflux systems not only contribute to intrinsic resistance but also facilitate adaptive responses to antimicrobial pressure [ 58 ]. The presence of nonsynonymous mutations in opm D and opr M suggests that alterations in these efflux proteins may be an important factor in the observed antibiotic resistance among B. pertussis isolates. In Pseudomonas aeruginosa , the mexAB-oprM operon has been well characterized as a major efflux system conferring macrolide resistance, and homologous systems have been identified in Bordetella parapertussis and B. bronchiseptica [ 59 , 60 ]. However, in B. pertussis , previous studies have reported deletions in the mex AB- opr M operon, particularly a 646 bp deletion in mex A and an 84 bp in-frame deletion in opr M, which are associated with reduced efflux activity and increased antibiotic susceptibility [ 60 ]. In this study, we identified a nonsynonymous mutation (V/A) in opr M, which may lead to structural or functional modifications of the efflux pump. Given that efflux systems play a critical role in bacterial adaptation to antibiotic pressure, this mutation could potentially alter substrate specificity or efflux efficiency, impacting B. pertussis resistance to macrolides. The other three genes— pyk (a metabolic enzyme), fha B (a virulence-associated adhesin), and apa G (a metal ion transporter-related protein)—harbored only synonymous mutations, indicating that these changes are unlikely to affect their functions or contribute directly to antibiotic resistance. Further experimental validation is necessary to confirm the functional roles of these candidate genes. Understanding the genomic basis of antibiotic resistance and pathogenicity in B. pertussis is critical for developing effective treatment strategies and monitoring emerging resistant strains. Future research directions on antimicrobial resistance in B. pertussis This study primarily focuses on the resistance mechanisms associated with macrolide antibiotics—particularly erythromycin, clarithromycin, and azithromycin—because macrolides are the first-line treatment for B. pertussis infections, and rising resistance poses a major threat to clinical management and public health. Moreover, our antimicrobial susceptibility testing revealed that macrolide resistance is the most pronounced among the antibiotics tested. The genomic and phenotypic data generated here offer a valuable foundation for broader investigations. While our current analysis centers on macrolide resistance, the antimicrobial susceptibility profiles also include data on β-lactams, fluoroquinolones, and sulfonamides. These data can be further mined in future studies to uncover genetic determinants and mechanisms of resistance to other antibiotic classes, facilitating a deeper understanding of multidrug resistance in B. pertussis and informing the development of more effective treatment and control strategies. Conclusions This study provides a comprehensive genomic analysis of B. pertussis isolates from Yiwu, China, revealing their antimicrobial resistance profiles, genomic diversity, and evolutionary relationships. Over 90% of isolates exhibited high macrolide resistance, underscoring the need for alternative treatment strategies and continued surveillance. Genomic analysis showed considerable diversity in genome size, repeat elements, genomic islands, and prophages, suggesting their role in bacterial adaptation. Phylogenetic and allelic analyses revealed that the Yiwu B. pertussis isolates originated from two distinct clades, with clade-specific divergence observed in key vaccine antigen genes such as ptx P, ptx C, and fha B. Comparative analysis identified the A2037G mutation in the 23S rRNA gene as the primary determinant of macrolide resistance. Additionally, highly divergent genes opm D and opr M may play a potential role in macrolide resistance through efflux-mediated mechanisms. Overall, these findings provide key insights into B. pertussis evolution and macrolide resistance, emphasizing the need for ongoing genomic surveillance and functional studies to inform treatment strategies and vaccine development. Abbreviations bp: Base pairs; BUSCO: Benchmarking Universal Single-Copy Orthologs; MIC: Minimum Inhibitory Concentration; CLSI: Clinical and Laboratory Standards Institute; SDS: Sodium Dodecyl Sulfate; BAM: Binary Alignment Map; BLAST: Basic Local Alignment Search Tool; GO: Gene Ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes; COG: Clusters of Orthologous Groups; NR: Non-Redundant Protein Database; TCDB: Transporter Classification Database; LTRs: Long Terminal Repeats; LINEs: Long Interspersed Nuclear Elements; SINEs: Short Interspersed Nuclear Elements; RC: Rolling Circle; TR: Tandem Repeats; tRNA: transfer RNA; rRNA: ribosomal RNA; snRNA: small nuclear RNA; GIs: Genomic Islands; CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats; NCBI: National Center for Biotechnology Information; E-value: Expectation value; N50: A statistical measure of the length of contigs in a genome assembly; GC content: Guanine-Cytosine content; ncRNA: non-coding RNA; E-test: Epsilometer test (a method for antimicrobial susceptibility testing); SMZ: Sulfamethoxazole; TRF: Tandem Repeats Finder. Declarations - Ethical Approval and Consent to participate This study was approved by the Medical Ethics Committee of the Fourth Affiliated Hospital of Zhejiang University School of Medicine (Approval NO.: K2024244). The requirement for informed consent was formally waived by the committee, as the study used anonymized retrospective data and involved no direct contact with participants. This study was conducted in accordance with the principles of the Declaration of Helsinki. - Consent for publication Not applicable. - Availability of data and materials The draft genomes of 63 B. pertussis isolates were captured with sequencing reads ranging from approximately 4.9×10 6 to 7.6×10 6 sequences, with a mean sequencing depth of 135.7× per genome. The genome sequences and raw genome sequence data has been uploaded to NCBI with the BioProject accession number PRJNA1133929 (https://www.ncbi.nlm.nih.gov/biosample?LinkName=bioproject_biosample_all&from_uid=1133929). The results of the genome functional annotation were presented in the appendix file. - Competing interests The authors declare that they have no competing interests. - Funding This research was supported by the “Pioneer” and “Leading Goose” R&D Program of Zhejiang (2024SSYS0007); the National Science Foundation of China (grant no. 62376254 and 32341018). - Authors' contributions ZHX, GYC and WJG conceived and supervised the study. QRW and ZQZ collected the samples and test antibiotic resistance phenotype. WQX performed the analyses. WQX, GYC and WJG wrote the draft. BW and ZHX revised the paper. - Acknowledgements The authors declare that they have no acknowledgements to disclose. References Parkhill J, Sebaihia M, Preston A, Murphy LD, Thomson N, Harris DE, et al. Comparative analysis of the genome sequences of Bordetella pertussis , Bordetella parapertussis and Bordetella bronchiseptica . Nat Genet. 2003;35(1):32–40. https://doi.org/10.1038/ng1227. Decker MD, Edwards KM. Pertussis (whooping cough). J Infect Dis. 2021;224(Suppl 6):S310–S320. https://doi.org/10.1093/infdis/jiaa469. Bowden KE, Weigand MR, Peng Y, Cassiday PK, Sammons S, Knipe K, et al. Genome structural diversity among 31 Bordetella pertussis isolates from two recent US whooping cough statewide epidemics. mSphere. 2016;1(3):e00036-16. https://doi.org/10.1128/mSphere.00036-16. Crowcroft NS, Stein C, Duclos P, Birmingham M. How best to estimate the global burden of pertussis? Lancet Infect Dis. 2003;3(7):413–418. Xu Z, Wang J, Zhang L, Wang H, Yang J, Liu X, et al. Genomic epidemiology of erythromycin-resistant Bordetella pertussis in China. Emerg Microbes Infect. 2019;8(1):461–470. https://doi.org/10.1080/22221751.2019.1587315. Preston A. The role of B. pertussis vaccine antigen gene variants in pertussis resurgence and possible consequences for vaccine development. Hum Vaccin Immunother. 2016;12(5):1274–1276. https://doi.org/10.1080/21645515.2015.1137402. Wagner B, Melzer A, Freymüller J, Riffelmann M, Wirsing von König CH. Genetic variation of Bordetella pertussis in Austria. PLoS One. 2015;10(7):e0132623. https://doi.org/10.1371/journal.pone.0132623. Altunaiji SM, Kukuruzovic RH, Curtis NC, Massie J. Cochrane Review: Antibiotics for whooping cough (pertussis). Evid Based Child Health. 2012;7(3):893–956. https://doi.org/10.1002/14651858.CD004404.pub3. Bouchez V, Guiso N, Guillot S, Chevalier C, Brun D, Njamkepo E, et al. Genomic sequencing of Bordetella pertussis for epidemiology and global surveillance of whooping cough. Emerg Infect Dis. 2018;24(6):988–995. https://doi.org/10.3201/eid2406.171464. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. CLSI document M100-S16. Wayne, PA: CLSI; 2006. Lim H, Lee EH, Yoon Y, Chua B, Son A. Portable lysis apparatus for rapid single-step DNA extraction of Bacillus subtilis . J Appl Microbiol. 2016;120(2):379–387. https://doi.org/10.1111/jam.13011. Ye J, McGinnis S, Madden TL. BLAST: improvements for better sequence analysis. Nucleic Acids Res. 2006;34(Web Server issue):W6–W9. https://doi.org/10.1093/nar/gkl164. Koren S, Walenz BP, Berlin K, Miller JR, Bergman NH, Phillippy AM. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res. 2017;27(5):722–736. https://doi.org/10.1101/gr.215087.116. Vaser R, Sovic I, Nagarajan N, Šikić M. Fast and accurate de novo genome assembly from long uncorrected reads. Genome Res. 2017;27(5):737–746. https://doi.org/10.1101/gr.214270.116. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, et al. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One. 2014;9(11):e112963. https://doi.org/10.1371/journal.pone.0112963. Simão FA, Waterhouse RM, Ioannidis P, Kriventseva EV, Zdobnov EM. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 2015;31(19):3210–3212. https://doi.org/10.1093/bioinformatics/btv351. Besemer J, Lomsadze A, Borodovsky M. GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. Nucleic Acids Res. 2001;29(12):2607–2618. https://doi.org/10.1093/nar/29.12.2607. Saha S, Bridges S, Magbanua ZV, Peterson DG. Empirical comparison of ab initio repeat finding programs. Nucleic Acids Res. 2008;36(7):2284–2294. https://doi.org/10.1093/nar/gkn064. Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999;27(2):573–580. https://doi.org/10.1093/nar/27.2.573. Chan PP, Lin BY, Mak AJ, Lowe TM. tRNAscan-SE 2.0: improved detection and functional classification of transfer RNA genes. Nucleic Acids Res. 2021;49(16):9077–9096. https://doi.org/10.1093/nar/gkab688. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25(5):955–964. https://doi.org/10.1093/nar/25.5.955.PubMed Lagesen K, Hallin P, Rødland EA, Stærfeldt HH, Rognes T, Ussery DW. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. 2007;35(9):3100–3108. https://doi.org/10.1093/nar/gkm160. Gardner PP, Daub J, Tate J, Moore BL, Osuch IH, Griffiths-Jones S, et al. Rfam: updates to the RNA families database. Nucleic Acids Res. 2009;37(Database issue):D136–D140. https://doi.org/10.1093/nar/gkn766. Nawrocki EP, Kolbe DL, Eddy SR. Infernal 1.0: inference of RNA alignments. Bioinformatics. 2009;25(10):1335–1337. https://doi.org/10.1093/bioinformatics/btp157. Hsiao W, Wan I, Jones SJ, Brinkman FS. IslandPath: aiding detection of genomic islands in prokaryotes. Bioinformatics. 2003;19(3):418–420. https://doi.org/10.1093/bioinformatics/btg004. Zhou Y, Liang Y, Lynch KH, Dennis JJ, Wishart DS. PHAST: a fast phage search tool. Nucleic Acids Res. 2011;39(Web Server issue):W347–W352. https://doi.org/10.1093/nar/gkr485. Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35(Web Server issue):W52–W57. https://doi.org/10.1093/nar/gkm360. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, et al. Gene ontology: tool for the unification of biology. Nat Genet. 2000;25(1):25–29. https://doi.org/10.1038/75556. Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res. 2006;34(Database issue):D354–D357. https://doi.org/10.1093/nar/gkj102. Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004;32(Database issue):D277–D280. https://doi.org/10.1093/nar/gkh063. Galperin MY, Makarova KS, Wolf YI, Koonin EV. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res. 2015;43:D261–D269. https://doi.org/10.1093/nar/gku1223. Li W, Jaroszewski L, Godzik A. Tolerating some redundancy significantly speeds up clustering of large protein databases. Bioinformatics. 2002;18:77–82. https://doi.org/10.1093/bioinformatics/18.1.77. Saier MH Jr, Reddy VS, Tamang DG, Västermark Å. The transporter classification database. Nucleic Acids Res. 2014;42:D251–D258. https://doi.org/10.1093/nar/gkaa1004. Bairoch A, Apweiler R. The SWISS-PROT protein sequence database and its supplement TrEMBL in 2000. Nucleic Acids Res. 2000;28:45–48. https://doi.org/10.1093/nar/28.1.45. Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res. 2009;37:D233–D238. https://doi.org/10.1093/nar/gkn663. Bridel S, Bouchez V, Brancotte B, Hauck S, Armatys N, Landier A, et al. A comprehensive resource for Bordetella genomic epidemiology and biodiversity studies. Nat Commun. 2022;13:3807. https://doi.org/10.1038/s41467-022-31517-8. Emms DM, Kelly S. OrthoFinder: solving fundamental biases in whole genome comparisons dramatically improves orthogroup inference accuracy. Genome Biol. 2015;16:157. https://doi.org/10.1186/s13059-015-0721-2. Emms DM, Kelly S. OrthoFinder: phylogenetic orthology inference for comparative genomics. Genome Biol. 2019;20:238. https://doi.org/10.1186/s13059-019-1832-y. Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30:3059–3066. https://doi.org/10.1093/nar/gkf436. Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–1313. https://doi.org/10.1093/bioinformatics/btu033. Jolley KA, Maiden MC. BIGSdb: scalable analysis of bacterial genome variation at the population level. BMC Bioinformatics. 2010;11:595. https://doi.org/10.1186/1471-2105-11-595. Vester B, Douthwaite S. Macrolide resistance conferred by base substitutions in 23S rRNA. Antimicrob Agents Chemother. 2001;45(1):1–12. https://doi.org/10.1128/AAC.45.1.1-12.2001. Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, et al. Versatile and open software for comparing large genomes. Genome Biol. 2004;5(2):R12. https://doi.org/10.1186/gb-2004-5-2-r12. Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods. 2011;8(10):785–786. https://doi.org/10.1038/nmeth.1701. Eichinger V, Nussbaumer T, Platzer A, Jehl MA, Arnold R, Rattei T. EffectiveDB—updates and novel features for a better annotation of bacterial secreted proteins and Type III, IV, VI secretion systems. Nucleic Acids Res. 2016;44(D1):D669–D674. https://doi.org/10.1093/nar/gkv1269. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 2011;39:W339–W346. https://doi.org/10.1093/nar/gkr466. Urban M, Pant R, Raghunath A, Irvine AG, Pedro H, Hammond-Kosack KE. The Pathogen-Host Interactions database (PHI-base): additions and future developments. Nucleic Acids Res. 2015;43(D1):D645–D655. https://doi.org/10.1093/nar/gku1165. Chen L, Zheng D, Liu B, Yang J, Jin Q. VFDB 2012 update: toward the genetic diversity and molecular evolution of bacterial virulence factors. Nucleic Acids Res. 2012;40(D1):D641–D645. https://doi.org/10.1093/nar/gkr990. Liu B, Pop M. ARDB—antibiotic resistance genes database. Nucleic Acids Res. 2009;37:D443–D447. https://doi.org/10.1093/nar/gkn656. Ross JI, Eady EA, Cove JH, Baumberg S, Farrar MD, Ingham E. Clinical resistance to erythromycin and clindamycin in cutaneous propionibacteria isolated from acne patients is associated with mutations in 23S rRNA. Antimicrob Agents Chemother. 1997;41(5):1162–1165. https://doi.org/10.1128/AAC.41.5.1162. Li XZ, Plésiat P, Nikaido H. The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria. Clin Microbiol Rev. 2015;28(2):337–418. https://doi.org/10.1128/CMR.00117-14. Phan G, Picard M, Broutin I. Focus on the outer membrane factor OprM, the forgotten player from efflux pumps assemblies. Antibiotics. 2015;4(4):544–566. https://doi.org/10.3390/antibiotics4040544. Aendekerk S, Ghysels B, Cornelis P, Baysse C. Characterization of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium. Microbiology. 2002;148(8):2371–2381. https://doi.org/10.1099/00221287-148-8-2371. Murata T, Gotoh N, Nishino T. Characterization of outer membrane efflux proteins OpmE, OpmD and OpmB of Pseudomonas aeruginosa: molecular cloning and development of specific antisera. FEMS Microbiol Lett. 2002;217(1):57–63. https://doi.org/10.1111/j.1574-6968.2002.tb11456.x. Fortier LC, Sekulovic O. Importance of prophages to evolution and virulence of bacterial pathogens. Virulence. 2013;4(5):354–365. https://doi.org/10.4161/viru.24498. Xu Z, Zhang J, Zhang Y, Wang Q, Wang H, Yang C, et al. Genomic epidemiology of erythromycin-resistant Bordetella pertussis in China. Emerg Microbes Infect. 2019;8(1):461–470. https://doi.org/10.1080/22221751.2019.1587316. Van Acker H, Coenye T. The role of efflux and physiological adaptation in biofilm tolerance and resistance. J Biol Chem. 2016;291(24):12565–12572. https://doi.org/10.1074/jbc.R115.707257. Fernández L, Hancock RE. Adaptive and mutational resistance: role of porins and efflux pumps in drug resistance. Clin Microbiol Rev. 2012;25(4):661–681. https://doi.org/10.1128/CMR.00043-12. Tian ZX, Yi XX, Cho A, O’Gara F, Wang YP. CpxR activates MexAB-OprM efflux pump expression and enhances antibiotic resistance in both laboratory and clinical nalB-type isolates of Pseudomonas aeruginosa. PLoS Pathog. 2016;12(10):e1005932. https://doi.org/10.1371/journal.ppat.1005932. Fong W, Liu Y, Chen Y, Wang X, Li Z, Zhang H, et al. Genomic and transcriptomic variation in Bordetella spp. following induction of erythromycin resistance. J Antimicrob Chemother. 2022;77(11):3016–3025. https://doi.org/10.1093/jac/dkac272. Additional Declarations No competing interests reported. Supplementary Files Functionannotation.zip SupplementaryTable.xlsx FigureS1.png FigureS2.pdf AdditionalFiles.docx Cite Share Download PDF Status: Published Journal Publication published 17 Nov, 2025 Read the published version in BMC Genomics → Version 1 posted Editorial decision: Revision requested 10 Jul, 2025 Reviews received at journal 20 Jun, 2025 Reviews received at journal 16 Jun, 2025 Reviewers agreed at journal 13 Jun, 2025 Reviewers agreed at journal 09 Jun, 2025 Reviewers invited by journal 09 Jun, 2025 Editor assigned by journal 04 Jun, 2025 Editor invited by journal 15 May, 2025 Submission checks completed at journal 14 May, 2025 First submitted to journal 14 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6608985","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":469471185,"identity":"9bb16a5c-b8e8-4d94-9fd7-4d48c818f4c3","order_by":0,"name":"Wuqin Xu","email":"","orcid":"","institution":"Zhejiang Lab","correspondingAuthor":false,"prefix":"","firstName":"Wuqin","middleName":"","lastName":"Xu","suffix":""},{"id":469471186,"identity":"2d3a9843-c014-4d5c-92dc-85c472f95250","order_by":1,"name":"Qianru Wei","email":"","orcid":"","institution":"the Fourth Affiliated Hospital of School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qianru","middleName":"","lastName":"Wei","suffix":""},{"id":469471187,"identity":"4f160755-438d-42f8-95e2-a4191dfeb031","order_by":2,"name":"Bian Wu","email":"","orcid":"","institution":"Zhejiang Lab","correspondingAuthor":false,"prefix":"","firstName":"Bian","middleName":"","lastName":"Wu","suffix":""},{"id":469471188,"identity":"734c6e07-fa72-4e1c-9807-e494c52a54b7","order_by":3,"name":"Zhiqiang Zhu","email":"","orcid":"","institution":"the Fourth Affiliated Hospital of School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhiqiang","middleName":"","lastName":"Zhu","suffix":""},{"id":469471189,"identity":"42581a73-467b-4c15-aa5b-69f35c70acf0","order_by":4,"name":"Wenjun Guan","email":"","orcid":"","institution":"the Fourth Affiliated Hospital of School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenjun","middleName":"","lastName":"Guan","suffix":""},{"id":469471191,"identity":"5b606dd1-8f3e-44d7-b792-3681b8081851","order_by":5,"name":"Guangyong Chen","email":"","orcid":"","institution":"Zhejiang Lab","correspondingAuthor":false,"prefix":"","firstName":"Guangyong","middleName":"","lastName":"Chen","suffix":""},{"id":469471193,"identity":"3bedc1b9-d0b1-41f4-9717-229cf3c25b53","order_by":6,"name":"Zhihao Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIie3RsQrCMBCA4StCuxS6poN9hkBAhILPkqPQLOIsKBgQOgldfQxBEMeIYJeIq6MunV1dxNTJKbSbYH5uObhvCAFwuX4zH1ACRADcLL0OJJadiGcIVZ+lBaFXUd/u+1HCLqomME1RBmdlJfGaC4o6YwOlcgJaoAwn3Eoiwk8Eix7uDjInXnFESUJqf4i5N7PA7RIMebUgEckadcSN3xDZgsSruiEVIxqyIT8JVoRjO6GVqONnMUuiUuP1MU/7ZaDt5KuQfz7Tb3tvClSHY5fL5fqn3hZXQecXIs1NAAAAAElFTkSuQmCC","orcid":"","institution":"the Fourth Affiliated Hospital of School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Zhihao","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2025-05-07 07:08:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6608985/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6608985/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12864-025-12213-5","type":"published","date":"2025-11-17T15:57:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84377947,"identity":"866001b1-0ad5-4368-87ab-da9929cde5c3","added_by":"auto","created_at":"2025-06-11 08:41:56","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6856827,"visible":true,"origin":"","legend":"\u003cp\u003eA circular representation of the genomic structure of \u003cem\u003eBordetella pertussis\u003c/em\u003e. Isolate YW1 serves as the exemplar to illustrate the arrangement and composition of its genetic material.\u003c/p\u003e","description":"","filename":"Binder31.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/09e4987aa625cfb3fc828af7.jpg"},{"id":84375521,"identity":"f01073aa-fead-4ef3-bab8-2846fe0e490a","added_by":"auto","created_at":"2025-06-11 08:17:56","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":876808,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of \u003cem\u003eBordetella pertussis\u003c/em\u003e. The phylogenetic tree was obtained based on the 839 single-copy orthologous genes of the 77 \u003cem\u003eB. pertusis\u003c/em\u003e isolates. The tree shows two major clades (Clade I and II). The heatmap alongside the tree displays the allele types of six vaccine-related genes (\u003cem\u003eptx\u003c/em\u003eP, \u003cem\u003eptx\u003c/em\u003eA, \u003cem\u003eptx\u003c/em\u003eC, \u003cem\u003efha\u003c/em\u003eB, \u003cem\u003efim\u003c/em\u003e2, \u003cem\u003efim\u003c/em\u003e3). The outermost circle represents the countries from which these isolates were collected. Isolates sequenced in this study and are labeled in blue. The letter \"m\" in the allele type indicates a missing value.\u003c/p\u003e","description":"","filename":"Binder32.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/1792d92c57c2d08d6b0403e4.jpg"},{"id":84375525,"identity":"078467ad-c48f-449f-99f0-c40a0ad09a03","added_by":"auto","created_at":"2025-06-11 08:17:56","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":641964,"visible":true,"origin":"","legend":"\u003cp\u003eGenomic variation between macrolide resistant and sensitive groups. (a) Mutation frequency among genomic position of \u003cem\u003eBordetella pertussis\u003c/em\u003e. The red dashed lines indicate variants (highly divergent variants) that are shared by at least 60 resistant isolates. (b) GO enrichment analysis of 69 highly divergent genes. (c) The nonsynonymous mutations of genes \u003cem\u003eopm\u003c/em\u003eD and \u003cem\u003eopr\u003c/em\u003eM between two groups.\u003c/p\u003e","description":"","filename":"Binder33.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/fc60738f4d275d00581df598.jpg"},{"id":96650121,"identity":"e68e90c7-5fbc-4954-aed7-99bb91b0a6cb","added_by":"auto","created_at":"2025-11-24 16:08:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9808953,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/21537ab5-b044-4de8-a45d-b6e144a31914.pdf"},{"id":84375542,"identity":"2d6ee2a2-c453-449c-b002-52565f22ea03","added_by":"auto","created_at":"2025-06-11 08:17:59","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":46786666,"visible":true,"origin":"","legend":"","description":"","filename":"Functionannotation.zip","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/517c4366e898e1a25b63a3ef.zip"},{"id":84376572,"identity":"f5eb907c-70de-4e12-b49f-09a076bc4ea9","added_by":"auto","created_at":"2025-06-11 08:25:56","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":86016,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/fc040ad3b36facceb054a62c.xlsx"},{"id":84375528,"identity":"203a48ac-bbc0-4dcc-9ecf-242606bfbb77","added_by":"auto","created_at":"2025-06-11 08:17:56","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":805137,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.png","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/8a1249a7daaaa345770ccc26.png"},{"id":84375535,"identity":"0b880620-7ab5-40ba-b23e-23e66b49a987","added_by":"auto","created_at":"2025-06-11 08:17:56","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":7654172,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/4fdc07be250e60ea1847e8d2.pdf"},{"id":84375522,"identity":"b2776966-767a-4d1c-95b3-870b83c3437c","added_by":"auto","created_at":"2025-06-11 08:17:56","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":18198,"visible":true,"origin":"","legend":"","description":"","filename":"AdditionalFiles.docx","url":"https://assets-eu.researchsquare.com/files/rs-6608985/v1/bf81175c1f71bd05da62925d.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genomic Insights into Bordetella pertussis Evolution and Macrolide Resistance in Yiwu, China","fulltext":[{"header":"Background","content":"\u003cp\u003ePertussis (or whooping cough), caused by \u003cem\u003eBordetella pertussis\u003c/em\u003e, is a highly contagious respiratory disease characterized by paroxysmal coughing fits, often accompanied by a characteristic whooping sound upon inhalation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite the availability of vaccines, pertussis continues to pose a significant global health threat, with periodic outbreaks reported worldwide [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Recent epidemiological shifts have highlighted the re-emergence of pertussis, partly fueled by the evolution of antibiotic resistance in circulating strains, particularly against macrolides like erythromycin [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The emergence of antimicrobial resistance among \u003cem\u003eB. pertussis\u003c/em\u003e strains presents a formidable challenge, impacting treatment efficacy and potentially compromising disease control efforts [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The resurgence of pertussis is further exacerbated by the pathogen's ability to evade immune responses, even in vaccinated populations. This immune evasion, coupled with the increasing prevalence of macrolide-resistant strains, has led to a growing number of cases in both developed and developing countries, underscoring the urgent need for enhanced surveillance and novel therapeutic strategies. Understanding the genetic basis of resistance mechanisms is crucial for developing effective therapeutic strategies and optimizing public health interventions.\u003c/p\u003e \u003cp\u003eYiwu, a famous \"small-commodity city\", located in Zhejiang, China, represents a dynamic urban environment characterized by rapid population mobility and diverse demographic influxes from across the globe. This dynamic environment facilitates the cross-border carriage and cross-transmission of pathogenic microorganisms. In this study, high prevalence of macrolide resistance, combined with the genomic diversity of the isolates was observed in this region. In this context, the genomic data from Yiwu might provide a critical resource for understanding the local and global dynamics of \u003cem\u003eB. pertussis\u003c/em\u003e evolution and offers valuable insights into the mechanisms driving the re-emergence of pertussis.\u003c/p\u003e \u003cp\u003eHere, we conducted whole-genome sequencing of 63 clinical isolates of \u003cem\u003eB. pertussis\u003c/em\u003e collected in Yiwu, Zhejiang, China. Additionally, we integrated genomic data from 14 isolates obtained from various international locations via the BIGSdb database [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Our comprehensive genomic and evolutionary analysis aims to delineate the genetic diversity, evolutionary relationships and antimicrobial resistance profiles among global \u003cem\u003eB. pertussis\u003c/em\u003e isolates.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBasic information of the isolates\u003c/h2\u003e \u003cp\u003eIn 2021, the Chinese Center for Disease Control and Prevention selected Yiwu in Zhejiang Province and Yongcheng in Henan Province as study sites to conduct population-based active laboratory surveillance for pertussis.\u003c/p\u003e \u003cp\u003eThe Fourth Affiliated Hospital of Zhejiang University School of Medicine, one of the designated pertussis surveillance hospitals in Yiwu, has systematically conducted preliminary work on the isolation, cultivation, and identification of clinical \u003cem\u003eB. pertussis\u003c/em\u003e isolates. This effort has resulted in the establishment of an isolate repository containing 63 \u003cem\u003eB. pertussis\u003c/em\u003e isolates. For this study, all 63 isolates were obtained from the isolate repository at the Fourth Affiliated Hospital of Zhejiang University School of Medicine. Patient information was extracted from medical records at the same hospital.\u003c/p\u003e \u003cp\u003eThe cryopreserved isolates were used for antibiotic resistance phenotyping and whole-genome sequencing. Patient demographic and clinical information, including age, sex, vaccination status, and vaccination dates, were recorded. Both the patient information and the resistance phenotypes of the isolates are documented in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. This study was approved by the Medical Ethics Committee of the Fourth Affiliated Hospital of Zhejiang University School of Medicine (Approval NO.: K2024244).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAntimicrobial susceptibility testing\u003c/h3\u003e\n\u003cp\u003eAntimicrobial susceptibility testing was conducted using the E-test method to assess the response of isolated isolates to nine antimicrobial agents: erythromycin, clarithromycin, azithromycin, meropenem, trimethoprim-sulfamethoxazole (SMZ), amoxicillin-clavulanic acid, ceftriaxone, levofloxacin, and ciprofloxacin. The preserved isolates stored at -80\u0026deg;C were revived and subcultured. A small amount of bacterial colonies was collected using a swab and diluted to a 0.5 McFarland standard suspension. The suspension was then inoculated onto sheep blood agar plates and incubated in a 35\u0026ndash;37\u0026deg;C incubator. After 96 hours of cultivation, the minimum inhibitory concentration (MIC) values were determined. Due to the lack of specific CLSI breakpoints for \u003cem\u003eB. pertussis\u003c/em\u003e, results were interpreted based on MIC ranges and CLSI10 standards for \u003cem\u003eHaemophilus influenzae\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eGenome sequencing\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was extracted using the SDS method [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], followed by verification through agarose gel electrophoresis and quantification with a Qubit\u0026reg; 2.0 Fluorometer (Thermo Scientific). A hybrid sequencing approach combining second-generation and third-generation sequencing technologies was employed. Third-generation sequencing, conducted on a PacBio platform utilizing single-molecule sequencing technology, was used as the primary method due to its capability to generate ultra-long reads, which significantly enhances genome assembly accuracy. The raw sequencing data, stored in BAM format, included sequence reads and base quality scores. Basic statistics such as total data yield, read length distribution, and quality scores were calculated to evaluate the data quality. Second-generation sequencing was utilized as a complementary approach, primarily for genome survey and assembly refinement. Raw data were processed to remove low-quality reads (quality score\u0026thinsp;\u0026le;\u0026thinsp;38 for more than 40% of bases), reads with more than 10% ambiguous bases ('N'), and reads with significant adapter contamination (overlap\u0026thinsp;\u0026gt;\u0026thinsp;15 bp with fewer than 3 mismatches). For samples with potential host contamination, reads were aligned against a host genome database through BLAST [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and removed.\u003c/p\u003e\n\u003ch3\u003eGenome assembly\u003c/h3\u003e\n\u003cp\u003eGenome assembly was carried out using the Canu v.2.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/marbl/canu/\u003c/span\u003e\u003cspan address=\"https://github.com/marbl/canu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], which initially assembled the third-generation reads to produce a draft assembly reflecting the genome's basic structure. The assembly underwent three rounds of error correction using Racon v..1.4.13 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] based on third-generation sequencing data. Subsequently, three additional rounds of polishing were performed with Pilon v.1.22 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] using second-generation reads to achieve the final high-quality assembly. This hybrid assembly strategy effectively leveraged the strengths of both sequencing technologies, ensuring accurate and complete genome assemblies. The completeness of the genomics data was assessed by BUSCO v.5.8.0 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eGenome component prediction and gene function annotation\u003c/h3\u003e\n\u003cp\u003eGenome component prediction encompassed identifying coding genes, repetitive sequences, non-coding RNAs, genomic islands, prophages, and CRISPR sequences. For bacterial genomes, coding genes were predicted using GeneMarkS v.4.28 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Interspersed repetitive sequences were identified with RepeatMasker v.4.1.2 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], while tandem repeats were analyzed using Tandem Repeats Finder (TRF) v.4.10.0 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Transfer RNA (tRNA) genes were predicted using tRNAscan-SE v.2.0.7 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], ribosomal RNA (rRNA) genes were analyzed with RNAmmer v.1.2 [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and small nuclear RNAs (snRNA) were identified via BLAST against the Rfam database [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Genomic islands were predicted with IslandPath-DIMOB [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], prophages with PHAST [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and CRISPR sequences with CRISPRFinder [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGene function annotation involved using eight databases: Gene Ontology (GO) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], Kyoto Encyclopedia of Genes and Genomes (KEGG) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], Clusters of Orthologous Groups (COG) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], Non-Redundant Protein Database (NR) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], Transporter Classification Database (TCDB) [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], Swiss-Prot [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], Carbohydrate-Active enZYmes Database (CAZy) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] and Pfam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pfam.xfam.org/\u003c/span\u003e\u003cspan address=\"http://pfam.xfam.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). A whole-genome BLAST search (E-value\u0026thinsp;\u0026lt;\u0026thinsp;1e-5, minimum alignment length\u0026thinsp;\u0026gt;\u0026thinsp;40%) was conducted against these databases to predict gene functions.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePhylogeny\u003c/h2\u003e \u003cp\u003eTo investigate the origins and evolutionary relationships of the 63 \u003cem\u003eB. pertussis\u003c/em\u003e isolates collected from Yiwu, Zhejiang, we included an additional 14 \u003cem\u003eB. pertussis\u003c/em\u003e isolates from Japan (ID\u0026thinsp;=\u0026thinsp;507 Tohama I), the USA (ID\u0026thinsp;=\u0026thinsp;533 B203, 527 A371, and 566 H617), Sweden (ID\u0026thinsp;=\u0026thinsp;10013 B3582), France (ID\u0026thinsp;=\u0026thinsp;10144 FR4953, 10408 5456 P2M, 10459 FR6115, and 11590 FR6597), Tunisia (ID\u0026thinsp;=\u0026thinsp;10527 TN0006), and other regions of China (ID\u0026thinsp;=\u0026thinsp;2052 L15189, 2076 L13030, 2078 L13055, and 2093 L14260) [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These data were downloaded from the BIGSdb genomic platform (project i.d. 25: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=\u003c/span\u003e\u003cspan address=\"https://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003epubmlst_bordetella_isolates\u0026amp;page\u0026thinsp;=\u0026thinsp;query\u0026amp;project_list\u0026thinsp;=\u0026thinsp;25\u0026amp;submit\u0026thinsp;=\u0026thinsp;1). These isolates were selected to ensure broad geographic coverage and to represent the major phylogenetic lineages described in the global \u003cem\u003eB. pertussis\u003c/em\u003e phylogeny [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In particular, we prioritized isolates from distinct clades in order to provide a comprehensive evolutionary context for the Yiwu strains and to facilitate comparative analyses of genomic diversity, population structure, and international transmission dynamics.\u003c/p\u003e \u003cp\u003eAll 77 isolates were then used to construct the phylogenetic tree. Orthofinder [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] was employed to identify single-copy orthologous genes across these isolates. A concatenated alignment of 839 single-copy orthologous genes was generated using MAFFT v.7.490 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The aligned sequences were then used to construct the phylogenetic tree with RAxML v.8.2.12 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGene typing of vaccine antigen genes\u003c/h3\u003e\n\u003cp\u003eTo explore the genetic diversity of vaccine antigen genes and assess their distribution among circulating \u003cem\u003eB. pertussis\u003c/em\u003e strains, multilocus sequence typing (MLST) of the total of 77 \u003cem\u003eB. pertussis\u003c/em\u003e isolates was performed using the mlst tool, which integrates profiles and allele sequences from the PubMLST database [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Gene typing focused specifically on nine vaccine antigens genes of \u003cem\u003eB. pertussis\u003c/em\u003e, including pertussis toxin promoter (\u003cem\u003eptx\u003c/em\u003eP), pertussis toxin subunit A (\u003cem\u003eptx\u003c/em\u003eA), pertussis toxin subunit B (\u003cem\u003eptx\u003c/em\u003eB), pertussis toxin subunit C (\u003cem\u003eptx\u003c/em\u003eC), pertussis toxin subunit D (\u003cem\u003eptx\u003c/em\u003eD), pertussis toxin subunit E (\u003cem\u003eptx\u003c/em\u003eE), filamentous hemagglutinin precursor (\u003cem\u003efha\u003c/em\u003eB), fimbrial protein 2 (\u003cem\u003efim\u003c/em\u003e2), and fimbrial protein 3 (\u003cem\u003efim\u003c/em\u003e3). Custom allele databases for these loci were downloaded from the BIGSdb-PubMLST \u003cem\u003eBordetella\u003c/em\u003e database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bigsdb.pasteur.fr\u003c/span\u003e\u003cspan address=\"https://bigsdb.pasteur.fr\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and formatted for local use with the mlst software. Draft genome assemblies of all 77 isolates were screened for allele matches based on nucleotide sequence identity.\u003c/p\u003e\n\u003ch3\u003e\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e\u003cb\u003eGenomic variations between macrolide resistant and sensitive isolates\u003c/b\u003e\u003c/div\u003e \u003cp\u003eIn the antimicrobial susceptibility testing of \u003cem\u003eB. pertussis\u003c/em\u003e, we evaluated a range of antibiotics. However, we focused on macrolides (erythromycin, clarithromycin, and azithromycin) in the subsequent genomic analysis due to their critical role as first-line treatments for pertussis and the high levels of resistance observed against them in our data. Most isolates exhibited macrolide resistance, with the exception of isolate YW7, which showed significantly lower MIC values for macrolides (0.064 \u0026micro;g/mL) compared to the other isolates. To investigate the genomic mechanisms underlying macrolide resistance, we classified the isolates into two groups: the sensitive group (YW7) and the resistant group (the remaining 62 isolates). Two complementary approaches were employed to compare genomic differences between these groups. First, we examined the genetic variation between two groups in 23S rRNA, which is a key gene associated with macrolide antibiotic resistance [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Next, to comprehensively identify genome-wide variants distinguishing the two groups, we utilized MUMmer v.3.1 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] to detect sequence variations. A variant was considered highly divergent if it was consistently present in more than 60 resistant isolates. These variants were then mapped to the coding sequence (CDS) regions of specific genes, resulting in the identification of 69 highly divergent genes, which were subsequently annotated and subjected to gene ontology (GO) enrichment analysis.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eFurther screening of macrolide resistance associated genes\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo further refine the set of highly divergent genes potentially associated with macrolide resistance, we performed pathogenicity-related and antibiotic resistance gene annotation as follows: secretory proteins were predicted using the SignalP database [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], while Type I\u0026ndash;VII secretion system proteins in pathogenic bacteria were identified using EffectiveT3 [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Additionally, we analyzed secondary metabolite gene clusters using antiSMASH [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] to investigate biosynthetic potential. Given the pathogenic nature of \u003cem\u003eB. pertussis\u003c/em\u003e, we further assessed pathogenicity and antibiotic resistance by leveraging multiple specialized databases, including PHI (Pathogen-Host Interactions Database) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], VFDB (Virulence Factors of Pathogenic Bacteria) [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], and ARDB (Antibiotic Resistance Genes Database) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. To identify candidate resistance-associated genes, we intersected the annotated genes related to pathogenicity and antibiotic resistance with the 69 highly divergent genes identified in the previous step. This analysis resulted in a final set of five genes, which were considered candidates for involvement in macrolide resistance mechanisms.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eThe drug resistance profiles\u003c/h2\u003e \u003cp\u003eA strikingly high level of resistance was observed against macrolide antibiotics, with over 90% of isolates exhibiting MIC values greater than 256 \u0026micro;g/mL for erythromycin, clarithromycin and azithromycin. Notably, only a single isolate (YW7) remained susceptible to macrolides, with MIC values of 0.064 \u0026micro;g/mL for all three drugs. In contrast, resistance to non-macrolide antibiotics was considerably lower and more variable: approximately 10\u0026ndash;30% of isolates showed resistance to meropenem, trimethoprim-sulfamethoxazole, and amoxicillin-clavulanic acid. Resistance to cephalosporins (ceftriaxone) and fluoroquinolones (levofloxacin and ciprofloxacin) was rare, generally affecting less than 10% of the isolates tested (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eGenome characteristic\u003c/h2\u003e \u003cp\u003eWe analyzed the genomic characteristics of the 63 clinical isolates of \u003cem\u003eB. pertussis\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The genome sizes of these isolates range from 3,531,012 bp to 4,148,800 bp (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The N50 lengths vary between 20,692 bp and 22,720 bp, indicating the quality and contiguity of the assembled genomes. Repeat rates show significant variation among the isolates, with values ranging from 23.22\u0026ndash;53.13%, reflecting differences in genomic repetitiveness. GC content remains consistently high across all isolates, ranging from 67.69\u0026ndash;67.80%, typical for \u003cem\u003eB. pertussis\u003c/em\u003e. Gene counts range from 4,018 to 5,032, with most isolates containing around 4,000 genes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). BUSCO results showed that the final assembly and annotation of \u003cem\u003eB. pertussis\u003c/em\u003e genome was 95.8% (YW74) to 99.0% (YW41) complete, suggesting that most of the recovered genes could be classified as \u0026lsquo;complete and single-copy\u0026rsquo; (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). This genomic data provides a comprehensive overview of the genetic diversity and structural features of these bacterial isolates, contributing valuable insights into their evolutionary and functional dynamics.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenomic characteristics of 63 \u003cem\u003eBordetella pertussis\u003c/em\u003e clinical isolates collected from Yiwu, Zhejiang\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenome size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN50 length (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRepeat rate (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGC content (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGene number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGenome completeness (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,129,568\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,132,002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,133,711\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,094\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,060\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,129,344\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,055\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,781\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,094\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,110,520\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,242\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,135,600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,067\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,128,919\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,041\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,289\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,386\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,148,293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,418\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22,720\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,065\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,148,800\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,098\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,128,123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,148\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,065\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,131,464\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,131,527\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,109,737\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,057\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,399\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,077\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,131,969\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,092\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3,531,012\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e30.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,142,753\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,073\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,129,306\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,114\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,066\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,147,608\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,064\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,359\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,124\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e30.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,055\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,693\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,125,250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,415\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,692\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,083\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,145,416\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,115,814\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22,702\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,110,804\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,036\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,118,889\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,060\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,110,780\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5,032\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,124,320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,239\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e33.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,075\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,129,461\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e96.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,127,586\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,109,743\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,060\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e96.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,132,548\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,124,028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,085\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,130,465\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,819\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,105,135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22,720\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,064\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,139,940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,088\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,107,387\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22,617\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,113,079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,097\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,124,553\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,121,597\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,109,793\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,085\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,109,908\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,115,431\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,062\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,119,634\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,111,949\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20,949\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e95.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,119,063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,239\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,119,841\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,060\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,106,607\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,108,793\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,107,719\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,066\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,108,234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,067\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,107,756\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,046\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,104,271\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,070\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,104,934\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,105,546\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e98.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,107,547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,086\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,073\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,106,795\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,082\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,106,638\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21,144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,061\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYW91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4,104,087\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22,720\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e67.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4,036\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eGenome component\u003c/h2\u003e \u003cp\u003eEach isolate exhibits varying numbers and total lengths of different repetitive elements, including LTRs, DNA, LINEs, SINEs, RC, and unknown sequences. Notably, LTRs consistently comprise the highest number across all isolates, whereas SINEs exhibit the greatest variability in both number and total length (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e presents the distribution of tandem repeats (TR), minisatellite DNA, and microsatellite DNA across 63 \u003cem\u003eB. pertussis\u003c/em\u003e isolates. TRs range from 255 to 333 instances per isolate, with sizes from 1 to 1,178 bp, contributing 0.67\u0026ndash;1.21% of the genome. Minisatellite DNA occurs 216 to 265 times per isolate, comprising 0.23\u0026ndash;0.24% of the genome, and microsatellite DNA ranges from 9 to 22 sequences per isolate, contributing 0.0075\u0026ndash;0.026% of the genome. We also summarized the types and characteristics of identified non-coding RNAs (ncRNAs), including transfer RNAs (tRNAs), 5s rRNA (denovo), 16s rRNA (denovo), and 23s rRNA (denovo). Each isolate consistently exhibited 51 to 86 tRNAs with a consistent length of 78 bp, totaling between 3,994 bp and 6,783 bp. The 5s rRNA, 16s rRNA, and 23s rRNA (denovo) were observed in three to eight copies per isolate, with average lengths ranging from 112 bp to 2,982 bp, contributing to total lengths between 336 bp and 20,877 bp per isolate (Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenomic islands (GIs) were identified in all isolates to assess their prevalence and characteristics across the dataset. Each isolate showed variability in GI number (ranging from 23 to 31) and total length (238,010 bp to 337,219 bp). The average GI length ranged from 9,640 bp to 12,821 bp (Table S5). The number of prophages per isolate varied from 9 to 35, with total lengths ranging from 364,899 bp to 1,636,090 bp. Average prophage lengths varied from 36,490 bp to 55,976 bp. This diversity highlights the presence and variability of prophages within \u003cem\u003eB. pertussis\u003c/em\u003e genomes, potentially contributing to genomic evolution and adaptation (Table S6). Among the accessory proteins, ten CRISPR proteins were found in isolate YW41, two in isolates YW27 and YW25, and one in isolate YW42.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic relationships and vaccine antigen gene variation\u003c/h2\u003e \u003cp\u003eA phylogenetic tree was constructed using 839 single-copy orthologous genes from 77 \u003cem\u003eB. pertussis\u003c/em\u003e isolates, including 63 newly sequenced isolates from Yiwu and 14 representative international isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The resulting tree revealed a clear separation into two major clades, indicating that the Yiwu isolates are derived from at least two distinct evolutionary origins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate potential correlations between phylogenetic structure and vaccine antigen gene profiles, allele typing was performed for nine vaccine-related genes. The results showed that \u003cem\u003eptx\u003c/em\u003eB, \u003cem\u003eptx\u003c/em\u003eD, and \u003cem\u003eptx\u003c/em\u003eE were highly conserved among all 77 isolates (Table S7), whereas the remaining six genes exhibited allelic variation across isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Notably, \u003cem\u003eptx\u003c/em\u003eP, \u003cem\u003eptx\u003c/em\u003eC, and \u003cem\u003efha\u003c/em\u003eB displayed strong phylogenetic structuring. In \u003cem\u003eptx\u003c/em\u003eP, all isolates in Clade I carried allele type 3, including the international reference strains, while all Clade II isolates harbored type 1, except for two international strains (10408 5456 P2M and 533 B203), which retained type 3. A similar pattern of clade-specific allele distribution was observed for \u003cem\u003eptx\u003c/em\u003eC and \u003cem\u003efha\u003c/em\u003eB, supporting the hypothesis of parallel lineage divergence under differential evolutionary pressures.\u003c/p\u003e \u003cp\u003eFurthermore, the international isolates exhibited greater allele diversity across the variable loci compared to the Yiwu isolates. For instance, multiple alleles of \u003cem\u003efim\u003c/em\u003e2, \u003cem\u003efim\u003c/em\u003e3, and \u003cem\u003eptx\u003c/em\u003eA were detected among global strains, whereas the Yiwu isolates predominantly harbored a single allele for each of these genes. This suggests a relatively clonal expansion of specific antigenic types within the local population, possibly driven by vaccine-induced selection or regional transmission dynamics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGenomic variations between macrolide resistant and sensitive isolates\u003c/h2\u003e \u003cp\u003eWe classified the isolates into two groups: the sensitive group (YW7) and the resistant group (the remaining 62 isolates). Comparative analysis of 23S rRNA revealed a nucleotide substitution at position 2037, where all three copies of the 23S rRNA gene in the resistant group carried G, while all three copies in YW7 carried A, which was identical to the reference strain Tohama I and CS. This mutation has been previously reported and is known to be associated with macrolide resistance [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The presence of the same mutation in all copies of the 23S rRNA gene in both YW7 and the other isolates suggests that the mutation may have emerged initially in one copy under selective pressure from antibiotics and subsequently spread to the other two copies via homologous recombination [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. To further explore the evolutionary relationships of this gene among the isolates, we constructed a phylogenetic tree based on the 23S rRNA sequences of all 63 isolates. The tree showed that YW7 clustered more closely with the reference strain Tohama I and appeared to be ancestral to the other isolates, suggesting that the resistant isolates diverged following the acquisition of this mutation (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eComparative genomic variation analysis and functional enrichment\u003c/h2\u003e \u003cp\u003eComparative genomic variation analysis identified 110 highly divergent variations, which were mapped to 69 genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea; Table S8). GO enrichment analysis of these 69 genes classified the enriched GO terms into three major categories: Cellular Component, Molecular Function, and Biological Process (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCellular Component.\u003c/b\u003e Significantly enriched terms included \"intracellular cellular component\" (GO:0005622) and \"membrane cellular component\" (GO:0016020), indicating that variable genes are associated with intracellular and membrane-related functions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular Function\u003c/b\u003e. The Molecular Function category showed significant enrichment in DNA-binding-related activities, including \"DNA binding\" (GO:0003677), \"sequence-specific DNA binding transcription factor activity\" (GO:0003700), and \"sigma factor activity\" (GO:0016987). Additionally, functions linked to genetic mobility, such as \"transposase activity\" (GO:0004803) and \"recombinase activity\" (GO:0000150), were also prominent.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBiological Process\u003c/b\u003e. In the Biological Process category, terms associated with gene regulation and genetic recombination were significantly enriched, including \"DNA integration\" (GO:0015074), \"regulation of transcription, DNA-dependent\" (GO:0006355), \"transcription initiation, DNA-dependent\" (GO:0006352), \"transposition, DNA-mediated\" (GO:0006313), and \"DNA recombination\" (GO:0006310). Additionally, genes involved in transport processes (GO:0006810) were also identified.\u003c/p\u003e \u003cp\u003eThese findings suggest that the highly variable genes distinguishing macrolide resistant and sensitive \u003cem\u003eB. pertussis\u003c/em\u003e strains are primarily involved in transcriptional regulation, genetic recombination, and membrane-associated functions, potentially contributing to the observed phenotypic differences in macrolide resistance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eCandidate genes potentially involved in macrolide resistance mechanisms\u003c/h2\u003e \u003cp\u003eTo further investigate potential genetic factors contributing to macrolide resistance, we annotated the 69 highly divergent genes using multiple databases, including PHI, VFDB, ARDB, CARD, Secretory_Protein, and T3SS. Based on these annotations, we identified five candidate genes that may play a role in macrolide resistance mechanisms (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; Table S8). Further analysis of mutations in these genes revealed that outer membrane protein D (\u003cem\u003eopm\u003c/em\u003eD) and outer membrane protein M (\u003cem\u003eopr\u003c/em\u003eM) contain nonsynonymous mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec), whereas pyruvate kinase (\u003cem\u003epyk)\u003c/em\u003e, filamentous hemagglutinin precursor (\u003cem\u003efha\u003c/em\u003eB), and ApaG domain-containing protein (\u003cem\u003eapa\u003c/em\u003eG) exhibit synonymous mutations, which may not alter protein function directly. \u003cem\u003eopr\u003c/em\u003eM encodes an outer membrane efflux protein that functions as part of a tripartite efflux system, typically associated with resistance to macrolides, β-lactams, and other antimicrobial agents. It belongs to the Resistance-Nodulation-Division (RND) family of efflux pumps, which are known to contribute to multidrug resistance (MDR) in various Gram-negative bacteria [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. \u003cem\u003eopm\u003c/em\u003eD is another outer membrane efflux protein that plays a role in multidrug resistance, although its function is less well-characterized compared to \u003cem\u003eopr\u003c/em\u003eM. It may interact with periplasmic and inner membrane components to form an efflux system capable of exporting toxic compounds, including antibiotics [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. The nonsynonymous mutations identified in \u003cem\u003eopm\u003c/em\u003eD and \u003cem\u003eopr\u003c/em\u003eM may lead to structural or functional modifications, potentially enhancing its drug efflux efficiency or altering substrate specificity, which could impact macrolide resistance in \u003cem\u003eB. pertussis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNonsynonymous and synonymous mutations identified in candidate genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene id\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutation site\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNucleotide acid change (YW7/others)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutation type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAmino acid change (YW7/others)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epyk\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epb7_GM001077\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e960\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003esyn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eopm\u003c/em\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epb7_GM001203\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e211\u0026ndash;240\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-/ATCGGCCTGGCGCTGGCGCGCAACCTCGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003enonsyn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-/IGLALARNLD\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eopr\u003c/em\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epb7_GM001335\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1229\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003enonsyn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eV/A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003efha\u003c/em\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epb7_GM003068\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6081\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003esyn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eapa\u003c/em\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epb7_GM003730\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e285\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA/G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003esyn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study provides a comprehensive genomic analysis of 63 \u003cem\u003eB. pertussis\u003c/em\u003e isolates from Yiwu, China, shedding light on their genetic diversity, antimicrobial resistance profiles, and evolutionary relationships with global strains. The high prevalence of macrolide resistance among the Yiwu isolates is particularly concerning, as it underscores the challenges posed by antibiotic resistance in controlling pertussis. Over 90% of the isolates exhibited high MIC values for macrolides, including erythromycin, clarithromycin, and azithromycin, which aligns with previous reports of increasing macrolide resistance in \u003cem\u003eB. pertussis\u003c/em\u003e strains in China and globally [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This widespread resistance highlights the urgent need for alternative therapeutic strategies and the development of new antibiotics or adjunct therapies to manage pertussis effectively.\u003c/p\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eGenomic diversity, evolutionary insights, and global spread\u003c/h2\u003e \u003cp\u003eThe genomic diversity observed in the Yiwu isolates, particularly in terms of repeat elements, prophages, and genomic islands, suggests a dynamic evolutionary landscape. The variability in repeat elements, such as LTRs, LINEs, and SINEs, as well as the presence of prophages and genomic islands, may contribute to the adaptability and evolution of \u003cem\u003eB. pertussis\u003c/em\u003e. These elements can facilitate horizontal gene transfer and genomic rearrangements, potentially leading to the acquisition of resistance genes or virulence factors. The presence of prophages, in particular, has been linked to bacterial evolution and adaptation, as they can introduce new genetic material into the host genome [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. The high variability in prophage content among the Yiwu isolates suggests that these elements may play a significant role in shaping the genomic landscape of \u003cem\u003eB. pertussis\u003c/em\u003e in this region.\u003c/p\u003e \u003cp\u003eThe phylogenetic analysis based on single-copy othologous genes revealed two genetically distinct clades among the 77 \u003cem\u003eB. pertussis\u003c/em\u003e isolates, suggesting that the Yiwu strains originated from at least two independent lineages. This division was consistent with the distribution of allele types for several vaccine-related antigen genes. Specifically, \u003cem\u003eptx\u003c/em\u003eP, \u003cem\u003eptx\u003c/em\u003eC, and \u003cem\u003efha\u003c/em\u003eB displayed clear clade-specific allelic segregation, with \u003cem\u003eptx\u003c/em\u003eP3 exclusively found in Clade I and \u003cem\u003eptx\u003c/em\u003eP1 in Clade II (except for two international strains). These patterns reflect lineage-specific evolution and may result from regional immune selection or transmission dynamics. Yiwu is a highly internationalized city in eastern China, characterized by intensive domestic and international population movement due to trade and commerce. Such high levels of population mobility may have facilitated the introduction and co-circulation of genetically distinct \u003cem\u003eB. pertussis\u003c/em\u003e lineages, providing opportunities for diversification, local adaptation, and potentially, antigenic convergence under shared vaccine pressure.\u003c/p\u003e \u003cp\u003eMoreover, allele diversity was notably higher among international strains compared to the locally circulating Yiwu isolates, supporting the hypothesis of clonal expansion within the regional population. The limited antigenic diversity observed in Yiwu may reduce the effectiveness of current acellular pertussis vaccines, which are based on fixed antigen formulations. These findings underscore the importance of integrating phylogenetic structure with antigenic profiling to understand pertussis evolution and inform surveillance and vaccine design strategies.\u003c/p\u003e \u003cp\u003eNotably, deletions of vaccine-related genes were observed in isolates YW1 and YW57, with three and two antigen genes missing, respectively. The absence of these antigens may reduce immune recognition, potentially allowing the bacteria to evade vaccine-induced immunity. Similar patterns have been reported globally, particularly with pertactin-deficient strains, supporting the idea that antigen loss can be an adaptive response to vaccine pressure. These findings suggest that antigen deletion may contribute to immune escape and emphasize the importance of monitoring antigenic profiles in circulating strains.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eGenetic basis of macrolide resistance\u003c/h2\u003e \u003cp\u003eOur comparative genomic analysis of macrolide resistant and sensitive \u003cem\u003eB.pertussis\u003c/em\u003e isolates revealed key genetic differences that may contribute to macrolide resistance, pathogenicity, and bacterial adaptation. The highly divergent variations identified between the two groups mapped to genes involved in transcriptional regulation, genetic recombination, and membrane-associated functions, highlighting their potential roles in resistance mechanisms. Notably, the A2037G mutation in the 23S rRNA gene, found in all resistant isolates, likely emerged through homologous recombination under antibiotic selection pressure, consistent with previous studies linking this mutation to macrolide resistance [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBeyond 23S rRNA, our screening identified two outer membrane efflux protein-encoding genes potentially involved in macrolide resistance. Efflux-mediated resistance is a well-established mechanism in bacterial survival under antibiotic stress [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. By actively removing antibiotics from the periplasmic space and cytoplasm, efflux systems not only contribute to intrinsic resistance but also facilitate adaptive responses to antimicrobial pressure [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. The presence of nonsynonymous mutations in \u003cem\u003eopm\u003c/em\u003eD and \u003cem\u003eopr\u003c/em\u003eM suggests that alterations in these efflux proteins may be an important factor in the observed antibiotic resistance among \u003cem\u003eB. pertussis\u003c/em\u003e isolates. In \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, the mexAB-oprM operon has been well characterized as a major efflux system conferring macrolide resistance, and homologous systems have been identified in \u003cem\u003eBordetella parapertussis\u003c/em\u003e and \u003cem\u003eB. bronchiseptica\u003c/em\u003e [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. However, in \u003cem\u003eB. pertussis\u003c/em\u003e, previous studies have reported deletions in the \u003cem\u003emex\u003c/em\u003eAB-\u003cem\u003eopr\u003c/em\u003eM operon, particularly a 646 bp deletion in \u003cem\u003emex\u003c/em\u003eA and an 84 bp in-frame deletion in \u003cem\u003eopr\u003c/em\u003eM, which are associated with reduced efflux activity and increased antibiotic susceptibility [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. In this study, we identified a nonsynonymous mutation (V/A) in \u003cem\u003eopr\u003c/em\u003eM, which may lead to structural or functional modifications of the efflux pump. Given that efflux systems play a critical role in bacterial adaptation to antibiotic pressure, this mutation could potentially alter substrate specificity or efflux efficiency, impacting \u003cem\u003eB. pertussis\u003c/em\u003e resistance to macrolides.\u003c/p\u003e \u003cp\u003eThe other three genes\u0026mdash;\u003cem\u003epyk\u003c/em\u003e (a metabolic enzyme), \u003cem\u003efha\u003c/em\u003eB (a virulence-associated adhesin), and \u003cem\u003eapa\u003c/em\u003eG (a metal ion transporter-related protein)\u0026mdash;harbored only synonymous mutations, indicating that these changes are unlikely to affect their functions or contribute directly to antibiotic resistance. Further experimental validation is necessary to confirm the functional roles of these candidate genes. Understanding the genomic basis of antibiotic resistance and pathogenicity in \u003cem\u003eB. pertussis\u003c/em\u003e is critical for developing effective treatment strategies and monitoring emerging resistant strains.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFuture research directions on antimicrobial resistance in\u003c/b\u003e \u003cb\u003eB. pertussis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study primarily focuses on the resistance mechanisms associated with macrolide antibiotics\u0026mdash;particularly erythromycin, clarithromycin, and azithromycin\u0026mdash;because macrolides are the first-line treatment for \u003cem\u003eB. pertussis\u003c/em\u003e infections, and rising resistance poses a major threat to clinical management and public health. Moreover, our antimicrobial susceptibility testing revealed that macrolide resistance is the most pronounced among the antibiotics tested. The genomic and phenotypic data generated here offer a valuable foundation for broader investigations. While our current analysis centers on macrolide resistance, the antimicrobial susceptibility profiles also include data on β-lactams, fluoroquinolones, and sulfonamides. These data can be further mined in future studies to uncover genetic determinants and mechanisms of resistance to other antibiotic classes, facilitating a deeper understanding of multidrug resistance in \u003cem\u003eB. pertussis\u003c/em\u003e and informing the development of more effective treatment and control strategies.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study provides a comprehensive genomic analysis of \u003cem\u003eB. pertussis\u003c/em\u003e isolates from Yiwu, China, revealing their antimicrobial resistance profiles, genomic diversity, and evolutionary relationships. Over 90% of isolates exhibited high macrolide resistance, underscoring the need for alternative treatment strategies and continued surveillance. Genomic analysis showed considerable diversity in genome size, repeat elements, genomic islands, and prophages, suggesting their role in bacterial adaptation. Phylogenetic and allelic analyses revealed that the Yiwu \u003cem\u003eB. pertussis\u003c/em\u003e isolates originated from two distinct clades, with clade-specific divergence observed in key vaccine antigen genes such as \u003cem\u003eptx\u003c/em\u003eP, \u003cem\u003eptx\u003c/em\u003eC, and \u003cem\u003efha\u003c/em\u003eB. Comparative analysis identified the A2037G mutation in the 23S rRNA gene as the primary determinant of macrolide resistance. Additionally, highly divergent genes \u003cem\u003eopm\u003c/em\u003eD and \u003cem\u003eopr\u003c/em\u003eM may play a potential role in macrolide resistance through efflux-mediated mechanisms. Overall, these findings provide key insights into \u003cem\u003eB. pertussis\u003c/em\u003e evolution and macrolide resistance, emphasizing the need for ongoing genomic surveillance and functional studies to inform treatment strategies and vaccine development.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003ebp: Base pairs; BUSCO: Benchmarking Universal Single-Copy Orthologs; MIC: Minimum Inhibitory Concentration; CLSI: Clinical and Laboratory Standards Institute; SDS: Sodium Dodecyl Sulfate; BAM: Binary Alignment Map; BLAST: Basic Local Alignment Search Tool; GO: Gene Ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes; COG: Clusters of Orthologous Groups; NR: Non-Redundant Protein Database; TCDB: Transporter Classification Database; LTRs: Long Terminal Repeats; LINEs: Long Interspersed Nuclear Elements; SINEs: Short Interspersed Nuclear Elements; RC: Rolling Circle; TR: Tandem Repeats; tRNA: transfer RNA; rRNA: ribosomal RNA; snRNA: small nuclear RNA; GIs: Genomic Islands; CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats; NCBI: National Center for Biotechnology Information; E-value: Expectation value; N50: A statistical measure of the length of contigs in a genome assembly; GC content: Guanine-Cytosine content; ncRNA: non-coding RNA; E-test: Epsilometer test (a method for antimicrobial susceptibility testing); SMZ: Sulfamethoxazole; TRF: Tandem Repeats Finder.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eEthical Approval and Consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Medical Ethics Committee of the Fourth Affiliated Hospital of Zhejiang University School of Medicine (Approval NO.: K2024244). The requirement for informed consent was formally waived by the committee, as the study used anonymized retrospective data and involved no direct contact with participants. This study was conducted in accordance with the principles of the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe draft genomes of 63 \u003cem\u003eB. pertussis\u003c/em\u003e isolates were captured with sequencing reads ranging from approximately 4.9\u0026times;10\u003csup\u003e6\u003c/sup\u003e to 7.6\u0026times;10\u003csup\u003e6\u003c/sup\u003e sequences, with a mean sequencing depth of 135.7\u0026times; per genome. The genome sequences and\u0026nbsp;raw genome sequence data has been uploaded to NCBI with the BioProject accession number PRJNA1133929 (https://www.ncbi.nlm.nih.gov/biosample?LinkName=bioproject_biosample_all\u0026amp;from_uid=1133929). The results of the genome functional annotation were presented in the appendix file.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the \u0026ldquo;Pioneer\u0026rdquo; and \u0026ldquo;Leading Goose\u0026rdquo; R\u0026amp;D Program of Zhejiang (2024SSYS0007); the National Science Foundation of China (grant no. 62376254 and 32341018).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZHX, GYC and WJG conceived and supervised the study. QRW and ZQZ collected the samples and test antibiotic resistance phenotype. WQX performed the analyses. WQX, GYC and WJG wrote the draft. BW and ZHX revised the paper.\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp;\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no acknowledgements to disclose.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eParkhill J, Sebaihia M, Preston A, Murphy LD, Thomson N, Harris DE, et al. Comparative analysis of the genome sequences of \u003cem\u003eBordetella pertussis\u003c/em\u003e, \u003cem\u003eBordetella parapertussis\u003c/em\u003e and \u003cem\u003eBordetella bronchiseptica\u003c/em\u003e. \u003cem\u003eNat Genet.\u003c/em\u003e 2003;35(1):32\u0026ndash;40. https://doi.org/10.1038/ng1227.\u003c/li\u003e\n\u003cli\u003eDecker MD, Edwards KM. Pertussis (whooping cough). \u003cem\u003eJ Infect Dis.\u003c/em\u003e 2021;224(Suppl 6):S310\u0026ndash;S320. https://doi.org/10.1093/infdis/jiaa469.\u003c/li\u003e\n\u003cli\u003eBowden KE, Weigand MR, Peng Y, Cassiday PK, Sammons S, Knipe K, et al. Genome structural diversity among 31 \u003cem\u003eBordetella pertussis\u003c/em\u003e isolates from two recent US whooping cough statewide epidemics. \u003cem\u003emSphere.\u003c/em\u003e 2016;1(3):e00036-16. https://doi.org/10.1128/mSphere.00036-16.\u003c/li\u003e\n\u003cli\u003eCrowcroft NS, Stein C, Duclos P, Birmingham M. How best to estimate the global burden of pertussis? \u003cem\u003eLancet Infect Dis.\u003c/em\u003e 2003;3(7):413\u0026ndash;418.\u003c/li\u003e\n\u003cli\u003eXu Z, Wang J, Zhang L, Wang H, Yang J, Liu X, et al. Genomic epidemiology of erythromycin-resistant \u003cem\u003eBordetella pertussis\u003c/em\u003e in China. \u003cem\u003eEmerg Microbes Infect.\u003c/em\u003e 2019;8(1):461\u0026ndash;470. https://doi.org/10.1080/22221751.2019.1587315.\u003c/li\u003e\n\u003cli\u003ePreston A. The role of \u003cem\u003eB. pertussis\u003c/em\u003e vaccine antigen gene variants in pertussis resurgence and possible consequences for vaccine development. \u003cem\u003eHum Vaccin Immunother.\u003c/em\u003e 2016;12(5):1274\u0026ndash;1276. https://doi.org/10.1080/21645515.2015.1137402.\u003c/li\u003e\n\u003cli\u003eWagner B, Melzer A, Freym\u0026uuml;ller J, Riffelmann M, Wirsing von K\u0026ouml;nig CH. Genetic variation of \u003cem\u003eBordetella pertussis\u003c/em\u003e in Austria. \u003cem\u003ePLoS One.\u003c/em\u003e 2015;10(7):e0132623. https://doi.org/10.1371/journal.pone.0132623.\u003c/li\u003e\n\u003cli\u003eAltunaiji SM, Kukuruzovic RH, Curtis NC, Massie J. Cochrane Review: Antibiotics for whooping cough (pertussis). \u003cem\u003eEvid Based Child Health.\u003c/em\u003e 2012;7(3):893\u0026ndash;956. https://doi.org/10.1002/14651858.CD004404.pub3.\u003c/li\u003e\n\u003cli\u003eBouchez V, Guiso N, Guillot S, Chevalier C, Brun D, Njamkepo E, et al. Genomic sequencing of \u003cem\u003eBordetella pertussis\u003c/em\u003e for epidemiology and global surveillance of whooping cough. \u003cem\u003eEmerg Infect Dis.\u003c/em\u003e 2018;24(6):988\u0026ndash;995. https://doi.org/10.3201/eid2406.171464.\u003c/li\u003e\n\u003cli\u003eClinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. CLSI document M100-S16. Wayne, PA: CLSI; 2006.\u003c/li\u003e\n\u003cli\u003eLim H, Lee EH, Yoon Y, Chua B, Son A. Portable lysis apparatus for rapid single-step DNA extraction of \u003cem\u003eBacillus subtilis\u003c/em\u003e. \u003cem\u003eJ Appl Microbiol.\u003c/em\u003e 2016;120(2):379\u0026ndash;387. https://doi.org/10.1111/jam.13011.\u003c/li\u003e\n\u003cli\u003eYe J, McGinnis S, Madden TL. BLAST: improvements for better sequence analysis. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2006;34(Web Server issue):W6\u0026ndash;W9. https://doi.org/10.1093/nar/gkl164.\u003c/li\u003e\n\u003cli\u003eKoren S, Walenz BP, Berlin K, Miller JR, Bergman NH, Phillippy AM. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. \u003cem\u003eGenome Res.\u003c/em\u003e 2017;27(5):722\u0026ndash;736. https://doi.org/10.1101/gr.215087.116.\u003c/li\u003e\n\u003cli\u003eVaser R, Sovic I, Nagarajan N, \u0026Scaron;ikić M. Fast and accurate de novo genome assembly from long uncorrected reads. \u003cem\u003eGenome Res.\u003c/em\u003e 2017;27(5):737\u0026ndash;746. https://doi.org/10.1101/gr.214270.116.\u003c/li\u003e\n\u003cli\u003eWalker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, et al. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. \u003cem\u003ePLoS One.\u003c/em\u003e 2014;9(11):e112963. https://doi.org/10.1371/journal.pone.0112963.\u003c/li\u003e\n\u003cli\u003eSim\u0026atilde;o FA, Waterhouse RM, Ioannidis P, Kriventseva EV, Zdobnov EM. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. \u003cem\u003eBioinformatics.\u003c/em\u003e 2015;31(19):3210\u0026ndash;3212. https://doi.org/10.1093/bioinformatics/btv351.\u003c/li\u003e\n\u003cli\u003eBesemer J, Lomsadze A, Borodovsky M. GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2001;29(12):2607\u0026ndash;2618. https://doi.org/10.1093/nar/29.12.2607.\u003c/li\u003e\n\u003cli\u003eSaha S, Bridges S, Magbanua ZV, Peterson DG. Empirical comparison of ab initio repeat finding programs. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2008;36(7):2284\u0026ndash;2294. https://doi.org/10.1093/nar/gkn064.\u003c/li\u003e\n\u003cli\u003eBenson G. Tandem repeats finder: a program to analyze DNA sequences. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 1999;27(2):573\u0026ndash;580. https://doi.org/10.1093/nar/27.2.573.\u003c/li\u003e\n\u003cli\u003eChan PP, Lin BY, Mak AJ, Lowe TM. tRNAscan-SE 2.0: improved detection and functional classification of transfer RNA genes. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2021;49(16):9077\u0026ndash;9096. https://doi.org/10.1093/nar/gkab688.\u003c/li\u003e\n\u003cli\u003eLowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 1997;25(5):955\u0026ndash;964. https://doi.org/10.1093/nar/25.5.955.PubMed\u003c/li\u003e\n\u003cli\u003eLagesen K, Hallin P, R\u0026oslash;dland EA, St\u0026aelig;rfeldt HH, Rognes T, Ussery DW. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2007;35(9):3100\u0026ndash;3108. https://doi.org/10.1093/nar/gkm160.\u003c/li\u003e\n\u003cli\u003eGardner PP, Daub J, Tate J, Moore BL, Osuch IH, Griffiths-Jones S, et al. Rfam: updates to the RNA families database. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2009;37(Database issue):D136\u0026ndash;D140. https://doi.org/10.1093/nar/gkn766.\u003c/li\u003e\n\u003cli\u003eNawrocki EP, Kolbe DL, Eddy SR. Infernal 1.0: inference of RNA alignments. \u003cem\u003eBioinformatics.\u003c/em\u003e 2009;25(10):1335\u0026ndash;1337. https://doi.org/10.1093/bioinformatics/btp157.\u003c/li\u003e\n\u003cli\u003eHsiao W, Wan I, Jones SJ, Brinkman FS. IslandPath: aiding detection of genomic islands in prokaryotes. \u003cem\u003eBioinformatics.\u003c/em\u003e 2003;19(3):418\u0026ndash;420. https://doi.org/10.1093/bioinformatics/btg004.\u003c/li\u003e\n\u003cli\u003eZhou Y, Liang Y, Lynch KH, Dennis JJ, Wishart DS. PHAST: a fast phage search tool. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2011;39(Web Server issue):W347\u0026ndash;W352. https://doi.org/10.1093/nar/gkr485.\u003c/li\u003e\n\u003cli\u003eGrissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2007;35(Web Server issue):W52\u0026ndash;W57. https://doi.org/10.1093/nar/gkm360.\u003c/li\u003e\n\u003cli\u003eAshburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, et al. Gene ontology: tool for the unification of biology. \u003cem\u003eNat Genet.\u003c/em\u003e 2000;25(1):25\u0026ndash;29. https://doi.org/10.1038/75556.\u003c/li\u003e\n\u003cli\u003eKanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. From genomics to chemical genomics: new developments in KEGG. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2006;34(Database issue):D354\u0026ndash;D357. https://doi.org/10.1093/nar/gkj102.\u003c/li\u003e\n\u003cli\u003eKanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. The KEGG resource for deciphering the genome. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2004;32(Database issue):D277\u0026ndash;D280. https://doi.org/10.1093/nar/gkh063.\u003c/li\u003e\n\u003cli\u003eGalperin MY, Makarova KS, Wolf YI, Koonin EV. Expanded microbial genome coverage and improved protein family annotation in the COG database. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2015;43:D261\u0026ndash;D269. https://doi.org/10.1093/nar/gku1223.\u003c/li\u003e\n\u003cli\u003eLi W, Jaroszewski L, Godzik A. Tolerating some redundancy significantly speeds up clustering of large protein databases. \u003cem\u003eBioinformatics.\u003c/em\u003e 2002;18:77\u0026ndash;82. https://doi.org/10.1093/bioinformatics/18.1.77.\u003c/li\u003e\n\u003cli\u003eSaier MH Jr, Reddy VS, Tamang DG, V\u0026auml;stermark \u0026Aring;. The transporter classification database. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2014;42:D251\u0026ndash;D258. https://doi.org/10.1093/nar/gkaa1004.\u003c/li\u003e\n\u003cli\u003eBairoch A, Apweiler R. The SWISS-PROT protein sequence database and its supplement TrEMBL in 2000. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2000;28:45\u0026ndash;48. https://doi.org/10.1093/nar/28.1.45.\u003c/li\u003e\n\u003cli\u003eCantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2009;37:D233\u0026ndash;D238. https://doi.org/10.1093/nar/gkn663.\u003c/li\u003e\n\u003cli\u003eBridel S, Bouchez V, Brancotte B, Hauck S, Armatys N, Landier A, et al. A comprehensive resource for Bordetella genomic epidemiology and biodiversity studies. \u003cem\u003eNat Commun.\u003c/em\u003e 2022;13:3807. https://doi.org/10.1038/s41467-022-31517-8.\u003c/li\u003e\n\u003cli\u003eEmms DM, Kelly S. OrthoFinder: solving fundamental biases in whole genome comparisons dramatically improves orthogroup inference accuracy. \u003cem\u003eGenome Biol.\u003c/em\u003e 2015;16:157. https://doi.org/10.1186/s13059-015-0721-2.\u003c/li\u003e\n\u003cli\u003eEmms DM, Kelly S. OrthoFinder: phylogenetic orthology inference for comparative genomics. \u003cem\u003eGenome Biol.\u003c/em\u003e 2019;20:238. https://doi.org/10.1186/s13059-019-1832-y.\u003c/li\u003e\n\u003cli\u003eKatoh K, Misawa K, Kuma K, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2002;30:3059\u0026ndash;3066. https://doi.org/10.1093/nar/gkf436.\u003c/li\u003e\n\u003cli\u003eStamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. \u003cem\u003eBioinformatics.\u003c/em\u003e 2014;30:1312\u0026ndash;1313. https://doi.org/10.1093/bioinformatics/btu033.\u003c/li\u003e\n\u003cli\u003eJolley KA, Maiden MC. BIGSdb: scalable analysis of bacterial genome variation at the population level. \u003cem\u003eBMC Bioinformatics.\u003c/em\u003e 2010;11:595. https://doi.org/10.1186/1471-2105-11-595.\u003c/li\u003e\n\u003cli\u003eVester B, Douthwaite S. Macrolide resistance conferred by base substitutions in 23S rRNA. \u003cem\u003eAntimicrob Agents Chemother.\u003c/em\u003e 2001;45(1):1\u0026ndash;12. https://doi.org/10.1128/AAC.45.1.1-12.2001.\u003c/li\u003e\n\u003cli\u003eKurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, et al. Versatile and open software for comparing large genomes. \u003cem\u003eGenome Biol.\u003c/em\u003e 2004;5(2):R12. https://doi.org/10.1186/gb-2004-5-2-r12.\u003c/li\u003e\n\u003cli\u003ePetersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. \u003cem\u003eNat Methods.\u003c/em\u003e 2011;8(10):785\u0026ndash;786. https://doi.org/10.1038/nmeth.1701.\u003c/li\u003e\n\u003cli\u003eEichinger V, Nussbaumer T, Platzer A, Jehl MA, Arnold R, Rattei T. EffectiveDB\u0026mdash;updates and novel features for a better annotation of bacterial secreted proteins and Type III, IV, VI secretion systems. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2016;44(D1):D669\u0026ndash;D674. https://doi.org/10.1093/nar/gkv1269.\u003c/li\u003e\n\u003cli\u003eMedema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2011;39:W339\u0026ndash;W346. https://doi.org/10.1093/nar/gkr466.\u003c/li\u003e\n\u003cli\u003eUrban M, Pant R, Raghunath A, Irvine AG, Pedro H, Hammond-Kosack KE. The Pathogen-Host Interactions database (PHI-base): additions and future developments. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2015;43(D1):D645\u0026ndash;D655. https://doi.org/10.1093/nar/gku1165.\u003c/li\u003e\n\u003cli\u003eChen L, Zheng D, Liu B, Yang J, Jin Q. VFDB 2012 update: toward the genetic diversity and molecular evolution of bacterial virulence factors. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2012;40(D1):D641\u0026ndash;D645. https://doi.org/10.1093/nar/gkr990.\u003c/li\u003e\n\u003cli\u003eLiu B, Pop M. ARDB\u0026mdash;antibiotic resistance genes database. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 2009;37:D443\u0026ndash;D447. https://doi.org/10.1093/nar/gkn656.\u003c/li\u003e\n\u003cli\u003eRoss JI, Eady EA, Cove JH, Baumberg S, Farrar MD, Ingham E. Clinical resistance to erythromycin and clindamycin in cutaneous propionibacteria isolated from acne patients is associated with mutations in 23S rRNA. \u003cem\u003eAntimicrob Agents Chemother.\u003c/em\u003e 1997;41(5):1162\u0026ndash;1165. https://doi.org/10.1128/AAC.41.5.1162.\u003c/li\u003e\n\u003cli\u003eLi XZ, Pl\u0026eacute;siat P, Nikaido H. The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria. \u003cem\u003eClin Microbiol Rev.\u003c/em\u003e 2015;28(2):337\u0026ndash;418. https://doi.org/10.1128/CMR.00117-14.\u003c/li\u003e\n\u003cli\u003ePhan G, Picard M, Broutin I. Focus on the outer membrane factor OprM, the forgotten player from efflux pumps assemblies. \u003cem\u003eAntibiotics.\u003c/em\u003e 2015;4(4):544\u0026ndash;566. https://doi.org/10.3390/antibiotics4040544.\u003c/li\u003e\n\u003cli\u003eAendekerk S, Ghysels B, Cornelis P, Baysse C. Characterization of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium. \u003cem\u003eMicrobiology.\u003c/em\u003e 2002;148(8):2371\u0026ndash;2381. https://doi.org/10.1099/00221287-148-8-2371.\u003c/li\u003e\n\u003cli\u003eMurata T, Gotoh N, Nishino T. Characterization of outer membrane efflux proteins OpmE, OpmD and OpmB of Pseudomonas aeruginosa: molecular cloning and development of specific antisera. \u003cem\u003eFEMS Microbiol Lett.\u003c/em\u003e 2002;217(1):57\u0026ndash;63. https://doi.org/10.1111/j.1574-6968.2002.tb11456.x.\u003c/li\u003e\n\u003cli\u003eFortier LC, Sekulovic O. Importance of prophages to evolution and virulence of bacterial pathogens. \u003cem\u003eVirulence.\u003c/em\u003e 2013;4(5):354\u0026ndash;365. https://doi.org/10.4161/viru.24498.\u003c/li\u003e\n\u003cli\u003eXu Z, Zhang J, Zhang Y, Wang Q, Wang H, Yang C, et al. Genomic epidemiology of erythromycin-resistant Bordetella pertussis in China. \u003cem\u003eEmerg Microbes Infect.\u003c/em\u003e 2019;8(1):461\u0026ndash;470. https://doi.org/10.1080/22221751.2019.1587316.\u003c/li\u003e\n\u003cli\u003eVan Acker H, Coenye T. The role of efflux and physiological adaptation in biofilm tolerance and resistance. \u003cem\u003eJ Biol Chem.\u003c/em\u003e 2016;291(24):12565\u0026ndash;12572. https://doi.org/10.1074/jbc.R115.707257.\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez L, Hancock RE. Adaptive and mutational resistance: role of porins and efflux pumps in drug resistance. \u003cem\u003eClin Microbiol Rev.\u003c/em\u003e 2012;25(4):661\u0026ndash;681. https://doi.org/10.1128/CMR.00043-12.\u003c/li\u003e\n\u003cli\u003eTian ZX, Yi XX, Cho A, O\u0026rsquo;Gara F, Wang YP. CpxR activates MexAB-OprM efflux pump expression and enhances antibiotic resistance in both laboratory and clinical nalB-type isolates of Pseudomonas aeruginosa. \u003cem\u003ePLoS Pathog.\u003c/em\u003e 2016;12(10):e1005932. https://doi.org/10.1371/journal.ppat.1005932.\u003c/li\u003e\n\u003cli\u003eFong W, Liu Y, Chen Y, Wang X, Li Z, Zhang H, et al. Genomic and transcriptomic variation in Bordetella spp. following induction of erythromycin resistance. \u003cem\u003eJ Antimicrob Chemother.\u003c/em\u003e 2022;77(11):3016\u0026ndash;3025. https://doi.org/10.1093/jac/dkac272.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Bordetella pertussis, Macrolides resistance, Whole genome sequence, Phylogeny, Genomic evolution","lastPublishedDoi":"10.21203/rs.3.rs-6608985/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6608985/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePertussis, caused by \u003cem\u003eBordetella pertussis\u003c/em\u003e, remains a significant public health concern despite widespread vaccination. Recent increases in macrolide-resistant strains present additional challenges for treatment and control. Yiwu, China\u0026mdash;a highly mobile and international city\u0026mdash;offers a unique setting to study the genomic evolution and antimicrobial resistance of \u003cem\u003eB. pertussis\u003c/em\u003e. In this study, 63 clinical isolates from Yiwu underwent whole-genome sequencing. Over 90% of isolates showed high resistance to macrolides. Genome sizes ranged from 3.53 to 4.15 Mb, with high GC content (67.69\u0026ndash;67.80%) and variable repeat rates. Phylogenetic analysis, incorporating 14 international strains, revealed two distinct clades and lineage-specific variations in key vaccine antigen genes, indicating multiple origins and localized evolution. A comparative analysis between resistant and sensitive isolates identified an A2037G substitution in the 23S rRNA gene strongly associated with macrolide resistance. Additionally, 69 highly divergent genes related to transcriptional regulation, recombination, and membrane function were detected. Notably, two outer membrane efflux protein genes, \u003cem\u003eopm\u003c/em\u003eD and \u003cem\u003eopr\u003c/em\u003eM, showed nonsynonymous mutations potentially linked to resistance enhancement. The presence of genomic islands, prophages, and antigenic gene variation further underscores the dynamic evolution of \u003cem\u003eB. pertussis\u003c/em\u003e in the region. This study highlights the urgent need for alternative therapies and improved vaccines, while also demonstrating the value of continued genomic surveillance. Insights into resistance-associated genes offer new targets for functional studies and may guide future strategies in pertussis control.\u003c/p\u003e","manuscriptTitle":"Genomic Insights into Bordetella pertussis Evolution and Macrolide Resistance in Yiwu, China","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-11 08:17:51","doi":"10.21203/rs.3.rs-6608985/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-07-10T05:38:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-20T09:14:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-16T18:22:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"262168850118852974398022784300774214435","date":"2025-06-13T07:10:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"106427080619303892801304210434363545775","date":"2025-06-09T18:36:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-09T05:15:37+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-04T11:43:47+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-05-15T05:27:58+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-15T03:33:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2025-05-15T03:32:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"13f219f3-3330-49bf-935e-412a50536c08","owner":[],"postedDate":"June 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-24T16:01:39+00:00","versionOfRecord":{"articleIdentity":"rs-6608985","link":"https://doi.org/10.1186/s12864-025-12213-5","journal":{"identity":"bmc-genomics","isVorOnly":false,"title":"BMC Genomics"},"publishedOn":"2025-11-17 15:57:48","publishedOnDateReadable":"November 17th, 2025"},"versionCreatedAt":"2025-06-11 08:17:51","video":"","vorDoi":"10.1186/s12864-025-12213-5","vorDoiUrl":"https://doi.org/10.1186/s12864-025-12213-5","workflowStages":[]},"version":"v1","identity":"rs-6608985","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6608985","identity":"rs-6608985","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.