Curcumin protects against CCl4-induced primary and advanced liver fibrosis in C57/BL6J mice

Curcumin protects against CCl4-induced primary and advanced liver fibrosis in C57/BL6J mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Curcumin protects against CCl4-induced primary and advanced liver fibrosis in C57/BL6J mice Mahtab Hatami Araghi, Pouria Sobhi, Abbas Sahebghadam Lotfi, Lotfollah Rezagholizadeh, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8801501/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction: Liver fibrosis is the result of damage to hepatic tissue that may advance to cirrhosis and,consequently, hepatocellular carcinoma. Currently, there are no definitive treatments for reversing advanced liver fibrosis, and as a result, early detection and prevention are of critical importance. Curcumin is a widely recognized spice, categorized as a phytochemical with potential anti-inflammatory and antioxidant properties. In this study, the inhibitory effect of curcumin administration against carbon tetrachloride-induced hepatic fibrosis was investigated in vivo. Materials and methods: 48 C57/BL6J male mice were divided into 6 groups consisting of Control 4W, P/F C1, Curcumin I, Control 6W, Advanced/F, and Curcumin II. After treatment, rats were euthanized, and serum and liver tissues were collected. For histological analysis, serum ALT/AST, albumin, and hepatic histomorphology were analyzed accordingly. Additionally, expression levels of EIF6 , COL1A1 , ITGB8 , CEBPB , YY1 , LUM , and CCN2 were measured using real-time PCR. Results: Curcumin administration significantly attenuated CCl₄-induced elevations in serum AST and ALT levels, while restoring albumin and total protein concentrations. Expression of key pro-fibrotic genes was significantly upregulated in both early and advanced fibrosis models and effectively suppressed by curcumin treatment. Histological examinations demonstrated reduced inflammatory infiltration, hepatocyte degeneration, and collagen accumulation, with greater improvement in advanced-stage fibrosis. Conclusion: Curcumin displays protective effects against primary and advanced liver fibrosis, suggesting potential clinical application. Curcumin Primary liver fibrosis Advanced liver fibrosis C57/BL6J mice Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1 Introduction Liver fibrosis is the result of prolonged chronic liver disease and is characterized by a dynamic wound-healing process in response to hepatocyte injury [ 1 ]. The most recent screening studies show a global upward trend in cases of advanced liver fibrosis and cirrhosis [ 2 ], highlighting the need for early biomarkers and preventive treatment strategies. Fibrosis can stem from various sources, including nonalcoholic fatty liver disease, viruses, cholestatic liver disease, toxins, medications, alcohol, and hypoxia [ 3 ]. Liver fibrosis encompasses the interplay of a variety of signaling pathways, such as TGF-β, hedgehog, NLRP-3 inflammasome, PDGF signaling pathways, and cells, including hepatocytes, hepatic stellate cells (HSCs), and Kupffer cells, consequently leading to inflammation, oxidative stress, and metabolic reprogramming [ 4 ]. As a result of injury, HSCs are activated, transform into myofibroblasts, and become the primary source of extracellular matrix proteins, particularly fibrillar collagen [ 5 ]. Liver fibrosis is characterized by excessive extracellular matrix (ECM) accumulation, including collagen type IV, procollagen type I and III, alpha-smooth muscle actin (α-SMA), and laminin [ 6 ]. The consequence of fibrotic response and increased collagen synthesis is dysregulated ECM degradation. Matrix metalloproteinases (MMPs) are a family of enzymes responsible for the breakdown of the ECM. While MMPs are crucial for normal tissue turnover, their activity is often overwhelmed by the excessive collagen production in fibrosis. Additionally, tissue inhibitors of metalloproteinases (TIMPs) further dampen MMP activity, tipping the balance toward fibrosis [ 7 ]. Based on the abovementioned information, several proteins can develop and perpetuate liver fibrosis by altering signaling cascades. One of these proteins is eukaryotic translation initiation factor 6 (EIF6), a multifunctional ribosome biogenesis and translation initiation factor. EIF6 is the first EIF associated with the large 60S ribosomal subunit in the nucleus. It binds to the 60S subunit to prevent premature association with the 40S subunit, thereby regulating translation initiation and also playing an essential role in ribosome biogenesis [ 8 ]. EIF6 has been extensively studied in the pathophysiology of fibrotic diseases. EIF6 regulates fibrosis by affecting the TGF-β pathway [ 9 ], MMP-2/TIMP-2 balance, external mechanical stretch-mediated fibrosis, myofibroblast development, and liver disease progression [ 10 ]. These findings imply that EIF6 may be a therapeutic target in liver fibrosis. CCAAT/enhancer-binding protein β (CEBPβ) transcription factor is known to be important in liver disease and fibrosis, although its role remains controversial. While some studies suggest that CEBPβ inhibits hepatocyte apoptosis and that its levels decrease during fibrosis, others report that CEBPβ can promote HSC activation by upregulating COL1A1 expression and can dampen FAS-induced apoptosis [ 11 ]. In a recent study, CEBPβ upregulation promoted alcoholic liver disease-associated fibrosis development in vivo. As confirmed by additional CEBPβ knockout mouse models, the absence of CEBPβ rescued fibrosis by regulating macrophage-hepatocyte crosstalk, inhibiting a pro-inflammatory phenotype, reducing HSC activation, and restoring lipid metabolism by targeting APOA1 and APOM levels [ 12 ]. Additionally, elevated CEBPβ hindered alcohol-induced fibrosis resolution by dysregulating glucose and lipid metabolism and collagen degradation following macrophage-hepatocyte crosstalk, lowering MMPs, and increasing TIMP and COL1A1 expression [ 13 ]. Lumican (LUM) is a proteoglycan in the ECM important for cell proliferation and several signaling pathways, and has been implicated for its potential pro-tumorigenic role in a variety of cancers [ 14 ]. Evidence suggests that this protein is increased during ECM remodeling associated with liver fibrosis [ 15 ]. As demonstrated by in vivo knockout studies, LUM can participate in fibrosis progression by regulating MMP levels, fibroblast activation, and collagen production [ 16 ]. Further, bioinformatic analyses have identified LUM to be a hub gene for ECM, metabolic pathways, cell proliferation, and inflammation [ 17 ]. Connective tissue growth factor (CTGF, CCN2) is a master regulator of various axes, including proliferation, apoptosis, and ECM dynamics [ 18 ]. CTGF can promote fibrosis via TGF-β signaling, IL-6 secretion, and increased COL1A1 deposition, a-SMA and slit-2 expression, and activation of HSCs [ 19 , 20 ]. Ying yang 1 (YY1) is another transcription factor important in liver disease, primarily because of its role in regulating lipid and glucose metabolism [ 21 ]. Previous studies indicate that YY1 can contribute to fibrosis by inducing TGF-β signaling, TNF-α, IL-6, PDGF, α-SMA, and Col1A1 deposition, as well as myofibroblast proliferation [ 22 ]. Also, YY1 is associated with increased ALT, AST, HDL, and GGT in NAFLD [ 23 ]. These genes represent a compelling network, spanning from master transcriptional regulators (YY1, CEBPβ) and core translational machinery (EIF6) to key effectors of the extracellular matrix (LUM, CTGF, COL1A1). Investigating curcumin’s effect on this entire axis provides a more holistic view of its mechanism than previously understood. Clinical studies have demonstrated curcumin's beneficial effects in treating liver fibrosis [ 24 ]. In addition to its hepatoprotective [ 25 ] properties, curcumin has anti-inflammatory [ 26 ] and Antioxidant [ 27 ] properties. The antioxidant and anti-inflammatory properties of curcumin are particularly significant in its hepatoprotective effects, as they help reduce oxidative stress and inflammation in the liver, thereby mitigating liver damage and disease [ 28 ]. Despite the available literature, the effect of curcumin on EIF6, CEBPβ, LUM, CTGF, and YY1 and their association with fibrosis remains to be elucidated. 2 Materials and methods 2.1- Chemicals and kits Carbon tetrachloride (CCl4) and curcumin were purchased from the Merck company (Germany). Ketamine was purchased from the Alphasan company (Netherlands). Commercial kits of AST and ALT were purchased from the Delta.DP Company (Iran). Albumin and total protein were purchased from Roche (ALB, Switzerland). RNA Extraction Kit, RealQ Plus 2x RT Master Mix, and cDNA synthase were purchased from Ampliqon (Denmark). All primers were synthesized by Metabion International AG (Germany). 2.2- Animals 48 male C57/BL6J mice weighing 21 plus or minus g (6–8 weeks old) were purchased from the Pasteur Institute (Iran) and acclimated for 1 week in a 12-hour light-dark cycle at a temperature of 20–25 degrees Celsius, 50% humidity, with unlimited food and water access. 2.3- Study design 48 C57/BL6J mice were randomly assigned in to 6 groups consisting of: Control 4W (n = 4): 50 µL of olive oil twice a week for 4 weeks via i.p injection; P/F C1 (n = 10): 50 µL (1:4, v/v) of olive oil & CCl4 (0.5 µL /g) solution twice a week for 4 weeks via i.p injection; Curcumin I (n = 10): 50 µL (1:4, v/v) of olive oil & CCl4 (0.5 µL /g) solution via i.p injection for 4 weeks + 100 mg/kg curcumin & olive oil solution (1:1, v/v) once every 2 days via gavage for consecutive 2 weeks; Control 6W (n = 4): 50 µL of olive oil twice a week for 6 weeks via i.p injection; A/F C2 (n = 10): 50 µL (1:4, v/v) of olive oil & CCl4 (0.5 µL /g) solution twice a week for 6 weeks via i.p injection; Curcumin II (n = 10): 50 µL(1:4, v/v) of olive oil & CCl4 (0.5 µL /g) solution via i.p injection for 6 weeks + 100 mg/kg curcumin & olive oil solution (1:1, v/v) once every 2 days via gavage for consecutive 2 weeks. 48 hours after the last treatment, mice were weighed and then euthanized using a ketamine (65 mg/kg), xylazine (13 mg/kg), and acepromazine (1.5 mg/kg) mixture [ 29 ]. Blood samples were taken from the heart and allowed to complete coagulation at room temperature. The serum was then separated via centrifuging at 3000 rpm for 15 minutes and kept at -80 degrees Celsius for further analysis. The mouse livers were collected and kept at -80 degrees Celsius for gene expression, and 10% formalin was utilized for preserving liver tissue for histopathological examinations. 2.5- Biochemical assays To assay liver function, liver enzymes’ activities, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), along with total proteins and albumin levels in serum were measured (with Rayro Auto Analyzer and cobas c311) using colorimetric optical methods according to the commercial kit manufacturer’s guidelines. 2.6- Quantitative real-time PCR Expression levels of EIF6 , COL1A1 , ITGB8 , CEBPB , YY1 , LUM , and CCN2 were measured by real-time quantitative PCR according to the manufacturer’s guidelines. For this purpose, total RNA was extracted from liver tissue, and its purity and concentration were determined using a Nanodrop. cDNA synthesis was performed, and cDNA samples were amplified using the ABI (Step One Plus v2.3) Sequence Detection system (Applied Biosystems, Massachusetts, United States) for 40 cycles (95°C for 15–30 s, 60°C for 30 s, 72°C for 30 s) with oligonucleotide primers (Table 1 ). Each sample was analyzed in triplicate, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) used for normalization. Quantification of target genes was performed using the 2 −ΔΔCT methodology. Table 1 Primer sequences of the genes used for qPCR are shown below. Gene Direction Sequence (5’ to 3’) Amplicon length (bp) EIF6 Forward Reverse ACTTGGACAGGGAGACAGAAG ACACAGCAATCGTTCACCACC 253 CTGF Forward Reverse GGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA 150 YY1 Forward Reverse CAGACCCTAAGCAACTGGCA TGCAGCCTTTATGAGGGCAA 99 CEBPβ Forward Reverse GCCCGTTGCCAGGCG GGTGCATGAACGCGGG 114 LUM Forward Reverse GGATTCTTGTTCACAGTGTGCC CATTCATTTTCAGCAAGTCCTCT 89 COL1A1 Forward Reverse CCTCAGGGTATTGCTGGACAAC CAGAAGGACCTTGTTTGCCAGG 115 ITGB8 Forward Reverse TGCCTTAAAGACAGAAGCTTGG TCTCACAACAATCTACAGTGTCA 133 GAPDH Forward Reverse GAGAGTGTTTCCTCGTCCCGTA TGCCGTGAGTGGAGTCATACT 185 2.7- Histopathology analysis For histopathological tests, liver tissue slices were fixed in 10% formalin and subsequently dehydrated in increasing ethanol concentrations, followed by incubation in xylene to improve tissue transparency. Afterwards, the tissues were embedded in paraffin wax and cut into 5–6 micron-thick slices, followed by hematoxylin (H) & eosin (E) and Trichrome-Masson staining [ 30 – 32 ]. The severity of liver fibrosis was graded using the Metavir and Ishak System [ 33 ](Table 2 ). Table 2 A summary of the histopathological index for the Metavir and Ishak System are shown below. Description METAVIR(F) ISHAK(S) No fibrosis 0 0 Portal fibrosis without septa 1 1–2 Portal fibrosis with few septa 2 3 Septal fibrosis without cirrhosis 3 4 Cirrhosis 4 5–6 2.8- Bioinformatic analysis GEO dataset The Gene Expression Omnibus (GEO) database is a repository containing high-throughput expression sequencing data that could be used for transcriptome analysis [ 34 ]. The data with the accession number GSE149508, with the following link, was used for analysis: ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE149508 )[ 35 ]. For heatmap visualization, the pheatmap version 1.0.13 package was used. Liver bulk tissue transcriptome analysis The Genotype-Tissue Expression (GTEx) Project is a tissue bank database containing cell and tissue-specific gene expression datasets [ 36 ]. In this study, the liver bulk tissue RNA expression dataset was used for Pearson Correlation analysis. Scatter plot visualization was obtained using the ggplot2 version 4.0.0 package. Interaction visualization The STRING Database offers protein-protein visualization and functional enrichment analysis for an input set of biomolecules [ 37 ]. The interaction of EIF6 , LUM , CTGF , CEBPβ , YY1 , ITGB8 , and COL1A1 was visualized using STRING. 2.9- Statistical analysis For this study, students’ t-test and One-way ANOVA were used for analyzing data. All Statistical analyses were performed using R version 4.3.1 software and GraphPad Prism 9.0. All data with P < 0.05 were considered significant. 3 Results 3.1- Curcumin reverses CCl4-induced higher liver weight Mice in P/F C1 and A/F C2 had significantly lower body weight and higher liver weight in comparison to CW4 and CW6 (Table 3 ). Treatment with curcumin caused a significant decrease in liver weight compared to P/F C1(p < 0.01) and A/F C2 (p < 0.001), while no significant alterations were observed for body weight (Fig. 1 ). Table 3. Body and liver weights of the study groups are shown below. Data are represented as mean SD. ⁕: P<0.05; ⁕⁕: P<0.01; ⁕⁕⁕: P<0.001; ⁕⁕⁕⁕: P<0.0001. Group Average body weight Average liver weight CW4 (n=4) CW6 (n=4) 24.14 0.30 25.13 0.40 1.27 0.03 1.33 0.04 P/F C1 (n=10) 21.53 0.93 1.51 0.11 Curcumin I (n=10) 21.46 0.76 1.36 0.12 A/F C2 (n=10) 22.09 0.64 1.66 0.06 Curcumin II (n=10) 21.78 0.59 1.48 0.08 3.2- Curcumin restores serum levels of liver function biomarkers to normal levels Our findings show that levels of AST and ALT, enzymatic indicators of liver function, significantly increase in exposure to CCl4 in primary and Advanced liver fibrosis groups compared to the control groups (p < 0.05). Curcumin significantly reduces enzyme levels in the treatment groups (p < 0.05). Additionally, in liver fibrosis groups, CCl4 significantly reduces liver protein levels, such as Albumin, while curcumin treatment significantly increases its level. We also examined the total protein levels. An increase in total protein level is seen in both treatment groups, although this increase is significant only in the curcumin II group (Table 4 ) (Fig. A-D). Table 4 Serum levels of AST, ALT, albumin, and total protein are shown in different study groups below. Data are represented as mean \(\:\pm\:\:\) SD. Group AST ALT Albumin Total protein CW4 (n = 4) 75 \(\:\pm\:\) 1.141 29.5 \(\:\pm\:\) 0.70 3.75 \(\:\pm\:\:0.07\) 5.1 \(\:\pm\:\) 0.14 CW6 (n = 4) 78 \(\:\pm\:\) 1.141 30.5 \(\:\pm\:\) 0.70 3.85 \(\:\pm\:\:0.07\) 4.95 \(\:\pm\:\) 0.07 P/F C1 (n = 10) 287.57 \(\:\pm\:\) 13.07 89.85 \(\:\pm\:\) 8.15 3.28 \(\:\pm\:\:0.16\) 4.51 \(\:\pm\:\) 0.14 Curcumin I (n = 10) 136.85 \(\:\pm\:\) 10.89 39.71 \(\:\pm\:\) 8.03 3.67 \(\:\pm\:\:0.13\) 4.81 \(\:\pm\:\) 0.13 A/F C2 (n = 10) 466.42 \(\:\pm\:\) 71.92 138.71 \(\:\pm\:\) 15.89 2.9 \(\:\pm\:\:0.23\) 4.00 \(\:\pm\:\) 0.27 Curcumin II (n = 10) 189.16 \(\:\pm\:\) 25.43 46.83 \(\:\pm\:\) 7.49 3.66 \(\:\pm\:\:0.18\) 4.73 \(\:\pm\:\) 0.39 3.3 Bioinformatic Analysis Predicts a Pro-Fibrotic Gene Network, which is Reversed by Curcumin in vivo To establish a molecular basis for our investigation, we first performed a bioinformatic analysis of our target genes using public datasets. An examination of the GEO dataset (GSE149508), comparing activated versus quiescent hepatic stellate cells (HSCs), revealed that the transcript levels of LUM , YY1 , ITGB8 , and COL1A1 were elevated in activated HSCs. In contrast, EIF6 , CEBPβ , and CTGF showed a trend of higher expression in quiescent HSCs, although these differences did not reach statistical significance (Fig. 3 A, 3 B). Protein-protein interaction analysis via the STRING database suggested a functional network among these factors (Fig. 3 C). Furthermore, Pearson correlation analysis using the GTEx liver transcriptome database demonstrated a strong positive correlation between LUM and ITGB8 and moderate correlations between other gene pairs, including LUM-COL1A1 , CTGF-COL1A1 , and EIF6-COL1A1 (Fig. 3 D), supporting their potential co-regulation in hepatic tissue. Building on this bioinformatic framework, we next quantified the mRNA expression of these genes in our CCl₄-induced liver fibrosis models. In both the primary (P/F C1) and advanced (A/F C2) fibrosis groups, CCl₄ exposure induced a significant upregulation in the hepatic expression of all seven target genes: EIF6 , LUM , CEBPβ , YY1 , CTGF , ITGB8 , and COL1A1 , relative to their respective time-matched controls (Fig. 4 ). Critically, the administration of curcumin effectively counteracted this induction. Treatment with curcumin resulted in a significant downregulation of all seven genes in both the primary (Curcumin I vs. P/F C1) and advanced (Curcumin II vs. A/F C2) stages of fibrosis, demonstrating a potent suppressive effect on this entire gene expression signature (Fig. 4 A-G). 3.4- Curcumin ameliorates liver injury and histomorphology Histological examinations demonstrate the therapeutic effects of Curcumin on CCl4-induced liver fibrosis at both early and advanced stages. CCl4 injection causes severe liver injury, as evident by large areas of liver cell degeneration, loss of liver structure, and infiltration of inflammatory cells around blood vessels. In Masson’s trichrome staining, CCl4 complications appear as collagen fiber deposition in blue color. However, treatment with Curcumin reduces liver injuries, cell degeneration, infiltration of inflammatory cells, and collagen fiber deposition (Fig. 5 ). Additionally, according to the Metavir score, the curcumin II group shows significant improvement compared with A/F C2; however, no significant effect is observed with curcumin I. Discussion Liver fibrosis is the result of chronic liver diseases, including chronic viral liver disease (HBV and HCV(, alcoholic steatohepatitis (ASH), non-alcoholic steatohepatitis (NASH), and other causes such as toxins and metabolic diseases, which lead to an increase in ROS, inflammatory cytokines, and damage to hepatocytes [ 38 ]. Liver fibrosis is a stage of liver damage that is reported to be reversible due to the regenerative capacity of the liver. Therefore, developing anti-fibrosis drugs to treat liver fibrosis is of utmost importance [ 4 ]. Previously, clinical trials and meta-analyses have researched the effects of curcumin in treating fibrosis [ 26 , 39 ]. Curcumin participates in the processes of liver disease by influencing different cellular pathways, including NF-κB, PI3K/Akt, and TGF-β. In our study, curcumin administration led to significantly lower serum ALT and AST levels and to increased albumin and total protein levels compared with fibrosis groups. This finding coincided with previous results [ 40 , 41 ]. Also, our results indicate that CCl4 injection causes severe liver injury, cell degeneration, infiltration of inflammatory cells, and collagen fiber deposition, whereas curcumin administration improves these parameters, similar to findings from other studies [ 42 ]. These observations highlight curcumin's protective effect on liver tissue structure and function. A central and novel finding of this study is the identification of Eukaryotic Initiation Factor 6 (EIF6) as a pivotal molecular target in the anti-fibrotic action of curcumin. EIF6 functions as a critical gatekeeper of protein synthesis, primarily by binding the 60S ribosomal subunit to prevent its premature association with the 40S subunit, thereby controlling the overall rate of translation initiation [ 8 , 43 ]. The pathological activation of hepatic stellate cells (HSCs), the principal drivers of fibrosis, imposes an extraordinary burden on the cells’ translational machinery to accommodate the massive synthesis and secretion of extracellular matrix proteins. Congruent with this requirement, our data demonstrate a marked upregulation of EIF6 expression in both primary and advanced stages of CCl₄-induced fibrosis, an effect that was potently reversed by curcumin administration. EIF6 has been extensively studied in the pathophysiology of liver diseases, including NAFLD and hepatocellular carcinoma [ 44 , 45 ]. This observation positions EIF6 as a critical bottleneck in the fibrotic cascade and resonates strongly with emerging evidence from other chronic liver pathologies. Indeed, a work by Scagliola and colleagues [ 46 ] has shown that during the progression from NAFLD to HCC, EIF6 expression is uniquely sustained to support pathological progress through lipid metabolism via the CEBPβ and YY1 axes—a finding of particular relevance to our own study, as both CEBPβ and YY1 were also identified as targets of curcumin-mediated suppression. Furthermore, in vivo studies have established a causal role for EIF6 as a pro-fibrotic driver, where its overexpression in murine models is sufficient to exacerbate the formation of fibrotic regions [ 45 , 47 ]. Collectively, these data strongly suggest a previously underappreciated hepatoprotective mechanism for curcumin. Beyond its well-documented ability to modulate transcriptional programs, our findings indicate that curcumin can throttle the fibrotic engine at the fundamental level of translational capacity. By suppressing EIF6 , curcumin may directly limit the ability of activated HSCs to sustain the high-flux protein synthesis required for pathological ECM deposition, offering a powerful mechanism for the amelioration of liver fibrosis. On the contrary, EIF6 overexpression was reported to suppress CTGF levels via the Wnt/β-catenin/SP1 signaling and inhibit the development of chronic kidney disease and fibrosis [ 48 ]. Similarly, another study reported higher COL1A1 levels in EIF6-deficient dermal fibroblasts, which dampened the granulation tissue formation and consequent healing [ 49 ]. However, GTEx results indicated a weak-positive and moderate-positive correlation between CTGF-EIF6 and COL1A1-EIF6, respectively. The expression levels of all three genes were higher in the liver fibrosis groups. These findings suggest that EIF6 could be a potential target for treating liver fibrosis, and the contradictory results necessitate further investigation into possible tissue-specific molecular mechanisms. YY1 facilitates the progression of fibrosis by participating in the activation of HSCs, inflammation, and increased ECM production. Treatment with curcumin reduced fibrosis by lowering YY1 expression levels, and this result is consistent with previous findings [ 23 , 49 ]. Similarly, the expression of LUM and CTGF was increased in the fibrosis groups, and curcumin treatment mitigated fibrosis by targeting these genes, which are proven to be essential in fibrosis pathophysiology [ 16 , 50 ]. We acknowledge this study’s limitations. Our findings were derived from a single CCl₄ toxicant model, and their relevance to other fibrotic etiologies, such as NASH, requires further validation. As a preclinical investigation, these murine results provide a strong rationale for—but must await—clinical translation to confirm human efficacy. Furthermore, future studies should incorporate pharmacokinetic analysis to address curcumin’s known bioavailability challenges and correlate hepatic drug concentrations with the observed therapeutic effects. Conclusion Curcumin effectively attenuated CCl₄-induced liver fibrosis in mice at both primary and advanced stages through restoration of liver function, downregulation of key pro-fibrotic genes ( EIF6 , LUM , YY1 , CEBPβ , CTGF , ITGB8 , and COL1A1 ), and marked histopathological improvement. Its greater efficacy in advanced fibrosis highlights curcumin as a promising candidate for the treatment of established liver fibrosis, warranting further clinical evaluation. Abbreviations HSC Hepatic stellate cell ECM Extracellular matrix a-SMA Alpha-smooth muscle actin MMP Matrix metalloproteinase TIMP Tissue inhibitor of matrix metalloproteinase EIF6 Eukaryotic initiation factor 6 CEBPβ CCAAT/enhancer-binding proteinβ LUM Lumican CTGF Connective tissue growth factor YY1 Ying yang 1 Declarations Declaration of competing interests The authors declare no competing interests Author contributions All authors contributed to the study’s conception and design. M.H.A. and A.A.F. carried out the experiments and data collection. All authors participated in the writing of the manuscript. M.H.A., P.S., and A.A.F. carried out statistical analyses. P.S. carried out bioinformatic analysis. A.S.L., L.R., and A.A.F. took care of editing and revision. All authors read and approved the final version of the manuscript. Funding This work received funding from Ardabil University of Medical Sciences with the grant number IR.ARUMS.AEC.1402.012. Data availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethics approval This study and animal treatments were approved by the ethical committee of the Ardabil University of Medical Sciences. References Sun M, Kisseleva T (2015) Reversibility of liver fibrosis. Clin Res Hepatol Gastroenterol 39:S60–S63 Zamani M et al (2025) Global Prevalence of Advanced Liver Fibrosis and Cirrhosis in the General Population: A Systematic Review and Meta-analysis. Clin Gastroenterol Hepatol 23(7):1123–1134 Schuppan D et al (2018) Liver fibrosis: Direct antifibrotic agents and targeted therapies. Matrix Biol, 68–69: p. 435–451 Pei Q, Yi Q, Tang L (2023) Liver Fibrosis Resolution: From Molecular Mechanisms to Therapeutic Opportunities. Int J Mol Sci, 24(11) Roy S et al (2015) miR-30c and miR-193 are a part of the TGF-β-dependent regulatory network controlling extracellular matrix genes in liver fibrosis. J Dig Dis 16(9):513–524 Roehlen N, Crouchet E, Baumert TF (2020) Liver Fibrosis: Mechanistic Concepts and Therapeutic Perspectives. Cells, 9(4) Fingleton B (2008) MMPs as therapeutic targets—still a viable option? in Seminars in cell & developmental biology . Elsevier Jaako P et al (2022) eIF6 rebinding dynamically couples ribosome maturation and translation. Nat Commun 13(1):1562 Yang SS et al (2015) Eukaryotic initiation factor 6 modulates myofibroblast differentiation at transforming growth factor-β1 transcription level via H2A.Z occupancy and Sp1 recruitment. J Cell Sci 128(21):3977–3989 Shu Q et al (2016) Involvement of eIF6 in external mechanical stretch-mediated murine dermal fibroblast function via TGF-β1 pathway. Sci Rep 6:36075 Wang L et al (2022) CCAAT/Enhancer-Binding Proteins in Fibrosis: Complex Roles Beyond Conventional Understanding. Research (Wash D C), 2022. : p. 9891689 Schonfeld M et al (2025) C/EBPbeta transcription factor promotes alcohol-induced liver fibrosis in males via HDL remodeling. Hepatol Commun, 9(3) Schonfeld M et al (2025) Continuous Activation of C/EBPbeta Transcription Factor Prevents Fibrosis Resolution After Alcohol Cessation. Cell Mol Gastroenterol Hepatol 19(9):101525 Appunni S et al (2021) Lumican, pro-tumorigenic or anti-tumorigenic: A conundrum. Clin Chim Acta 514:1–7 Baiocchini A et al (2016) Extracellular Matrix Molecular Remodeling in Human Liver Fibrosis Evolution. PLoS ONE 11(3):e0151736 Krishnan A et al (2012) Lumican, an extracellular matrix proteoglycan, is a novel requisite for hepatic fibrosis. Lab Invest 92(12):1712–1725 Chang Y et al (2021) LUM is the hub gene of advanced fibrosis in nonalcoholic fatty liver disease patients. Clin Res Hepatol Gastroenterol 45(1):101435 Zaykov V, Chaqour B (2021) The CCN2/CTGF interactome: an approach to understanding the versatility of CCN2/CTGF molecular activities. J Cell Commun Signal 15(4):567–580 Pi L et al (2023) CCN2/CTGF promotes liver fibrosis through crosstalk with the Slit2/Robo signaling. J Cell Commun Signal 17(1):137–150 Trampuz SR et al (2023) The Role of CTGF in Liver Fibrosis Induced in 3D Human Liver Spheroids. Cells, 12(2) Zhang M et al (2017) Multifunctional YY1 in Liver Diseases. Semin Liver Dis 37(4):363–376 Liu H et al (2019) Myofibroblast-specific YY1 promotes liver fibrosis. Biochem Biophys Res Commun 514(3):913–918 Yuan X et al (2018) Hepatic expression of Yin Yang 1 (YY1) is associated with the non-alcoholic fatty liver disease (NAFLD) progression in patients undergoing bariatric surgery. BMC Gastroenterol 18(1):147 Chu Y-H et al (2024) The intervention of curcumin on rodent models of hepatic fibrosis: A systematic review and meta-analysis. PLoS ONE 19(5):e0304176 Cianciulli A et al (2016) PI3k/Akt signalling pathway plays a crucial role in the anti-inflammatory effects of curcumin in LPS-activated microglia. Int Immunopharmacol 36:282–290 Chu YH et al (2024) The intervention of curcumin on rodent models of hepatic fibrosis: A systematic review and meta-analysis. PLoS ONE 19(5):e0304176 Sharifi-Rad J et al (2020) Turmeric and Its Major Compound Curcumin on Health: Bioactive Effects and Safety Profiles for Food, Pharmaceutical, Biotechnological and Medicinal Applications. Front Pharmacol 11:01021 Khan H et al (2019) Mechanistic insights of hepatoprotective effects of curcumin: Therapeutic updates and future prospects. 124:182–191 He S et al (2010) Ketamine–xylazine–acepromazine compared with isoflurane for anesthesia during liver transplantation in rodents. J Am Assoc Lab Anim Sci 49(1):45–51 Naglah A et al (2022) Conditional GANs based system for fibrosis detection and quantification in Hematoxylin and Eosin whole slide images. Med Image Anal 81:102537 Nilsson J et al (2020) NKT cells promote both type 1 and type 2 inflammatory responses in a mouse model of liver fibrosis. Sci Rep 10(1):21778 Sridharan D et al (2022) A one-stop protocol to assess myocardial fibrosis in frozen and paraffin sections. Methods Protocols 5(1):13 Sebastiani G (2009) Non-invasive assessment of liver fibrosis in chronic liver diseases: implementation in clinical practice and decisional algorithms. World J gastroenterology: WJG 15(18):2190 Cui HK et al (2023) An integrative analysis of single-cell and bulk transcriptome and bidirectional mendelian randomization analysis identified C1Q as a novel stimulated risk gene for Atherosclerosis. Front Immunol 14:1289223 He L et al (2020) Expression of hepatic stellate cell activation-related genes in HBV-, HCV-, and nonalcoholic fatty liver disease-associated fibrosis. PLoS ONE 15(5):e0233702 Consortium GT (2013) The Genotype-Tissue Expression (GTEx) project. Nat Genet 45(6):580–585 Szklarczyk D et al (2023) The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res 51(D1):D638–D646 Berumen J et al (2021) Liver fibrosis: Pathophysiology and clinical implications. WIREs Mech Dis 13(1):e1499 Gerami H et al (2025) Effect of nano-curcumin supplementation on liver fibrosis in patients with NAFLD-associated fibrosis: a double-blind randomized controlled trial. Sci Rep 15(1):38043 Murugan P, Pari L (2007) Influence of tetrahydrocurcumin on hepatic and renal functional markers and protein levels in experimental type 2 diabetic rats. Basic Clin Pharmacol Toxicol 101(4):241–245 Vajdi M et al (2025) Curcumin supplementation effect on liver enzymes in patients with nonalcoholic fatty liver disease: a GRADE-assessed systematic review and dose-response meta-analysis of randomized controlled trials. Nutr Rev 83(1):1–12 Embaby A, Abdel-Kawi S (2021) Histological Study on the Effect of Curcumin and Curcumin Nanoparticles on Cadmium-Induced Liver Damage in Adult male Albino Rats. J Med Histol 5(2):119–133 Weis F et al (2015) Mechanism of eIF6 release from the nascent 60S ribosomal subunit. Nat Struct Mol Biol 22(11):914–919 Sun L et al (2021) eIF6 promotes the malignant progression of human hepatocellular carcinoma via the mTOR signaling pathway. J Transl Med 19(1):216 Scagliola A et al (2021) Targeting of eIF6-driven translation induces a metabolic rewiring that reduces NAFLD and the consequent evolution to hepatocellular carcinoma. Nat Commun 12(1):4878 Scagliola A et al (2021) Targeting of eIF6-driven translation induces a metabolic rewiring that reduces NAFLD and the consequent evolution to hepatocellular carcinoma. Nat Commun 12(1):4878 Brina D et al (2015) eIF6 coordinates insulin sensitivity and lipid metabolism by coupling translation to transcription. Nat Commun 6(1):8261 Li X et al (2025) PRDM16 acts as a homeostasis regulation factor to suppress the transition of AKI to CKD via upregulation of eukaryotic initiation factor 6. Cell Mol Life Sci 82(1):252 Shu Q et al (2016) Involvement of eIF6 in external mechanical stretch-mediated murine dermal fibroblast function via TGF-beta1 pathway. Sci Rep 6:36075 Lipson KE et al (2012) CTGF is a central mediator of tissue remodeling and fibrosis and its inhibition can reverse the process of fibrosis. Fibrogenesis Tissue Repair 5(Suppl 1):S24 Additional Declarations No competing interests reported. Supplementary Files floatimage1.png Graphical abstract. The illustration was prepared using BioRender Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8801501","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":591972524,"identity":"4ce5edbe-94fb-4ed1-86ac-1e506c96904c","order_by":0,"name":"Mahtab Hatami Araghi","email":"","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mahtab","middleName":"Hatami","lastName":"Araghi","suffix":""},{"id":591972525,"identity":"d2aa0ebe-1b16-4d26-923f-a063a4039d59","order_by":1,"name":"Pouria Sobhi","email":"","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Pouria","middleName":"","lastName":"Sobhi","suffix":""},{"id":591972526,"identity":"1ce6ccb7-9974-437c-96b7-7ecde654bff7","order_by":2,"name":"Abbas Sahebghadam Lotfi","email":"","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":false,"prefix":"","firstName":"Abbas","middleName":"Sahebghadam","lastName":"Lotfi","suffix":""},{"id":591972527,"identity":"3c04ed8a-84a2-4260-bd2a-26b6ad9c12f3","order_by":3,"name":"Lotfollah Rezagholizadeh","email":"","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Lotfollah","middleName":"","lastName":"Rezagholizadeh","suffix":""},{"id":591972528,"identity":"1a61a1c2-b2d9-4009-b8ba-6e556c3eb811","order_by":4,"name":"Ali Akbar Fazaeli","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYFACxgcgUoaBvQFIGVgQo4XZAETyMPAcAGmRIEWLRAKIJkILf/thxo8/amx4DG4+v7rhR4EEUKQ7Aa8WiTPJzBISx9J4DG7nlN3sATpM4szZDfitOZB/QMKA7TBIS9oNHqAWA4lc/Frkzz9m/pHw7z/QYWfSbv4hRovBjWQ2iYNtB3gMbrAfu02ULYY3HrNZNvYl80ieyWG7LWMgwUPQL3Lnk5lv/vhmJ8d3/Pizm2/+2Mjxt/cS8D4MKADdBqJ5iFMOAvIN7A+IVz0KRsEoGAUjCgAAzXpI6usCQzgAAAAASUVORK5CYII=","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Ali","middleName":"Akbar","lastName":"Fazaeli","suffix":""}],"badges":[],"createdAt":"2026-02-06 01:23:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8801501/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8801501/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102924127,"identity":"71558d0b-ccce-4449-9e16-8a6d027f25fb","added_by":"auto","created_at":"2026-02-18 13:26:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":90965,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of Curcumin treatment on liver fibrosis is shown above. (A) CCl4 significantly decreases body weight in early and advanced liver fibrosis groups (p\u0026lt;0.0001). Curcumin results in a slight weight loss in treatment groups in comparison to the fibrotic groups; although, this reduction is not significant. (B) CCl4 injection significantly increases liver weight in both early (p\u0026lt;0.001) and advanced liver fibrosis groups (p\u0026lt;0.0001), whereas Curcumin treatment significantly decreases liver weight in treatment groups. data are represented as mean ± SD. ⁕: P\u0026lt;0.05; ⁕⁕: P\u0026lt;0.01; ⁕⁕⁕: P\u0026lt;0.001; ⁕⁕⁕⁕: P\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/9f3fa9f351c906b5262fa257.png"},{"id":102924141,"identity":"c29687e6-3b85-45be-9a13-c1b664908cb9","added_by":"auto","created_at":"2026-02-18 13:26:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":98322,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of curcumin on serum biomarker levels of fibrotic models is shown above. (A to D) Fibrotic groups, P/F C1 and A/F C2, have significantly higher levels of AST and ALT compared to their control groups (p\u0026lt;0.001), and treatment with curcumin leads to considerably lower levels of AST and ALT (p\u0026lt;0.0001). (C); Albumin is significantly decreased in fibrosis groups as opposed to CW4 and CW6 (p\u0026lt;0.001). Curcumin alleviates this effect and restores albumin level (p\u0026lt;0.0001). (D); Serum total protein is similarly decreased in P/F C1 and A/F C2 fibrosis groups (p\u0026lt;0.0001), and curcumin displays a significant effect in restoring total protein levels.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/a1064573bc11e7be994ae92e.png"},{"id":102924143,"identity":"8dbc2909-e702-4bb3-a55a-0999fe721b1d","added_by":"auto","created_at":"2026-02-18 13:26:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":201914,"visible":true,"origin":"","legend":"\u003cp\u003eResult of the bioinformatic analysis is demonstrated above. (A, B), gene expression analysis from GEO dataset indicates a higher expression of LUM, YY1, ITGB8, COL1A1 in active HSCs as opposed to quiescent HSCs, although, only the difference for LUM and COL1A1 is significant. Further, EIF6, CEBPβ, and CTGF levels are higher in quiescent HSCs, but no significant difference is seen. (C), Protein-Protein interactions of the input genes are visualized using STRING. (D), Pearson correlation analysis of the GTEx liver data indicates a strong correlation for LUM-ITGB8, and moderate association for LUM-COL1A1, CTGF-COL1A1, EIF6-COL1A1, ITGB8-CTGF, and LUM-CTGF.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/c6154e765fd0c43bb3c78a1f.png"},{"id":102924154,"identity":"162b5482-2816-4cbb-aa60-2f99edd3fedc","added_by":"auto","created_at":"2026-02-18 13:26:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":121347,"visible":true,"origin":"","legend":"\u003cp\u003eThe impact of Curcumin on the gene expression levels of EIF6 (A), LUM (B), CEBPβ (C), YY1 (D), CTGF (E), ITGB8 (F), and COL1A1 (G) is shown. Although curcumin treatment could significantly decrease the expression levels of all of the genes, a number of genes showed a dose-dependent manner in respect to the significance of the ameliorative effect of curcumin.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/ef6112438df939c8514c8497.png"},{"id":102924138,"identity":"6b9e08e4-ddcb-4e80-acf8-7eadb3ebd502","added_by":"auto","created_at":"2026-02-18 13:26:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":426739,"visible":true,"origin":"","legend":"\u003cp\u003eHistopathological tissue slides stained with H\u0026amp;E (left column) and trichrome (right column) are shown. (A, B) Control groups show no evidence of degeneration, lesions, or fibrosis; (C, D) Slides of P/F C1 display vacuolar degeneration, immune cell infiltration around the vessels and liver parenchyma, and fibrosis foci in portal areas (Ishak = S1-2 and Metavir = F1); (E, F) Tissue slides of A/F C2 reveal severe vacuolar degeneration and increased infiltration of immune cells around the vessels, as well as fibrosis from portal to portal and portal to central areas (Ishak = S4 and Metavir = F3); (G, H) In the Curcumin I group, lower degeneration, immune infiltration, and collagen deposition are observed (Ishak = S0-1 and Metavir = F0-1); (I, J) In the Curcumin II group, vacuolar degeneration and inflammatory cell accumulation are significantly reduced compared to A/F, with collagen fiber deposition almost minimal and visible only in scattered areas.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/def1b93b30746a22eebb9d8f.png"},{"id":106905036,"identity":"4428fcc5-1f6e-4c03-8b96-9127ca0cf88a","added_by":"auto","created_at":"2026-04-14 15:26:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1711686,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/b061613a-7fd9-4889-b58d-e7d63c2ac071.pdf"},{"id":102924137,"identity":"27ae305e-b81b-4e33-a400-cf27299525c2","added_by":"auto","created_at":"2026-02-18 13:26:27","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":222083,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract. \u003c/strong\u003eThe illustration was prepared using BioRender\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8801501/v1/42ca05385a9987d5ea19db5a.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Curcumin protects against CCl4-induced primary and advanced liver fibrosis in C57/BL6J mice","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eLiver fibrosis is the result of prolonged chronic liver disease and is characterized by a dynamic wound-healing process in response to hepatocyte injury [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The most recent screening studies show a global upward trend in cases of advanced liver fibrosis and cirrhosis [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], highlighting the need for early biomarkers and preventive treatment strategies. Fibrosis can stem from various sources, including nonalcoholic fatty liver disease, viruses, cholestatic liver disease, toxins, medications, alcohol, and hypoxia [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Liver fibrosis encompasses the interplay of a variety of signaling pathways, such as TGF-β, hedgehog, NLRP-3 inflammasome, PDGF signaling pathways, and cells, including hepatocytes, hepatic stellate cells (HSCs), and Kupffer cells, consequently leading to inflammation, oxidative stress, and metabolic reprogramming [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. As a result of injury, HSCs are activated, transform into myofibroblasts, and become the primary source of extracellular matrix proteins, particularly fibrillar collagen [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Liver fibrosis is characterized by excessive extracellular matrix (ECM) accumulation, including collagen type IV, procollagen type I and III, alpha-smooth muscle actin (α-SMA), and laminin [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The consequence of fibrotic response and increased collagen synthesis is dysregulated ECM degradation. Matrix metalloproteinases (MMPs) are a family of enzymes responsible for the breakdown of the ECM. While MMPs are crucial for normal tissue turnover, their activity is often overwhelmed by the excessive collagen production in fibrosis. Additionally, tissue inhibitors of metalloproteinases (TIMPs) further dampen MMP activity, tipping the balance toward fibrosis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBased on the abovementioned information, several proteins can develop and perpetuate liver fibrosis by altering signaling cascades. One of these proteins is eukaryotic translation initiation factor 6 (EIF6), a multifunctional ribosome biogenesis and translation initiation factor. EIF6 is the first EIF associated with the large 60S ribosomal subunit in the nucleus. It binds to the 60S subunit to prevent premature association with the 40S subunit, thereby regulating translation initiation and also playing an essential role in ribosome biogenesis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. EIF6 has been extensively studied in the pathophysiology of fibrotic diseases. EIF6 regulates fibrosis by affecting the TGF-β pathway [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], MMP-2/TIMP-2 balance, external mechanical stretch-mediated fibrosis, myofibroblast development, and liver disease progression [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These findings imply that EIF6 may be a therapeutic target in liver fibrosis.\u003c/p\u003e \u003cp\u003eCCAAT/enhancer-binding protein β (CEBPβ) transcription factor is known to be important in liver disease and fibrosis, although its role remains controversial. While some studies suggest that CEBPβ inhibits hepatocyte apoptosis and that its levels decrease during fibrosis, others report that CEBPβ can promote HSC activation by upregulating COL1A1 expression and can dampen FAS-induced apoptosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In a recent study, CEBPβ upregulation promoted alcoholic liver disease-associated fibrosis development in vivo. As confirmed by additional CEBPβ knockout mouse models, the absence of CEBPβ rescued fibrosis by regulating macrophage-hepatocyte crosstalk, inhibiting a pro-inflammatory phenotype, reducing HSC activation, and restoring lipid metabolism by targeting APOA1 and APOM levels [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Additionally, elevated CEBPβ hindered alcohol-induced fibrosis resolution by dysregulating glucose and lipid metabolism and collagen degradation following macrophage-hepatocyte crosstalk, lowering MMPs, and increasing TIMP and COL1A1 expression [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLumican (LUM) is a proteoglycan in the ECM important for cell proliferation and several signaling pathways, and has been implicated for its potential pro-tumorigenic role in a variety of cancers [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Evidence suggests that this protein is increased during ECM remodeling associated with liver fibrosis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. As demonstrated by in vivo knockout studies, LUM can participate in fibrosis progression by regulating MMP levels, fibroblast activation, and collagen production [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Further, bioinformatic analyses have identified LUM to be a hub gene for ECM, metabolic pathways, cell proliferation, and inflammation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConnective tissue growth factor (CTGF, CCN2) is a master regulator of various axes, including proliferation, apoptosis, and ECM dynamics [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. CTGF can promote fibrosis via TGF-β signaling, IL-6 secretion, and increased COL1A1 deposition, a-SMA and slit-2 expression, and activation of HSCs [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eYing yang 1 (YY1) is another transcription factor important in liver disease, primarily because of its role in regulating lipid and glucose metabolism [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Previous studies indicate that YY1 can contribute to fibrosis by inducing TGF-β signaling, TNF-α, IL-6, PDGF, α-SMA, and Col1A1 deposition, as well as myofibroblast proliferation [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Also, YY1 is associated with increased ALT, AST, HDL, and GGT in NAFLD [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThese genes represent a compelling network, spanning from master transcriptional regulators (YY1, CEBPβ) and core translational machinery (EIF6) to key effectors of the extracellular matrix (LUM, CTGF, COL1A1). Investigating curcumin\u0026rsquo;s effect on this entire axis provides a more holistic view of its mechanism than previously understood.\u003c/p\u003e \u003cp\u003eClinical studies have demonstrated curcumin's beneficial effects in treating liver fibrosis [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In addition to its hepatoprotective [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] properties, curcumin has anti-inflammatory [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] and Antioxidant [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] properties. The antioxidant and anti-inflammatory properties of curcumin are particularly significant in its hepatoprotective effects, as they help reduce oxidative stress and inflammation in the liver, thereby mitigating liver damage and disease [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Despite the available literature, the effect of curcumin on EIF6, CEBPβ, LUM, CTGF, and YY1 and their association with fibrosis remains to be elucidated.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1- Chemicals and kits\u003c/h2\u003e \u003cp\u003eCarbon tetrachloride (CCl4) and curcumin were purchased from the Merck company (Germany). Ketamine was purchased from the Alphasan company (Netherlands). Commercial kits of AST and ALT were purchased from the Delta.DP Company (Iran). Albumin and total protein were purchased from Roche (ALB, Switzerland). RNA Extraction Kit, RealQ Plus 2x RT Master Mix, and cDNA synthase were purchased from Ampliqon (Denmark). All primers were synthesized by Metabion International AG (Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2- Animals\u003c/h2\u003e \u003cp\u003e48 male C57/BL6J mice weighing 21 plus or minus g (6\u0026ndash;8 weeks old) were purchased from the Pasteur Institute (Iran) and acclimated for 1 week in a 12-hour light-dark cycle at a temperature of 20\u0026ndash;25 degrees Celsius, 50% humidity, with unlimited food and water access.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3- Study design\u003c/h2\u003e \u003cp\u003e48 C57/BL6J mice were randomly assigned in to 6 groups consisting of: Control 4W (n\u0026thinsp;=\u0026thinsp;4): 50 \u0026micro;L of olive oil twice a week for 4 weeks via i.p injection; P/F C1 (n\u0026thinsp;=\u0026thinsp;10): 50 \u0026micro;L (1:4, v/v) of olive oil \u0026amp; CCl4 (0.5 \u0026micro;L /g) solution twice a week for 4 weeks via i.p injection; Curcumin I (n\u0026thinsp;=\u0026thinsp;10): 50 \u0026micro;L (1:4, v/v) of olive oil \u0026amp; CCl4 (0.5 \u0026micro;L /g) solution via i.p injection for 4 weeks\u0026thinsp;+\u0026thinsp;100 mg/kg curcumin \u0026amp; olive oil solution (1:1, v/v) once every 2 days via gavage for consecutive 2 weeks; Control 6W (n\u0026thinsp;=\u0026thinsp;4): 50 \u0026micro;L of olive oil twice a week for 6 weeks via i.p injection; A/F C2 (n\u0026thinsp;=\u0026thinsp;10): 50 \u0026micro;L (1:4, v/v) of olive oil \u0026amp; CCl4 (0.5 \u0026micro;L /g) solution twice a week for 6 weeks via i.p injection; Curcumin II (n\u0026thinsp;=\u0026thinsp;10): 50 \u0026micro;L(1:4, v/v) of olive oil \u0026amp; CCl4 (0.5 \u0026micro;L /g) solution via i.p injection for 6 weeks\u0026thinsp;+\u0026thinsp;100 mg/kg curcumin \u0026amp; olive oil solution (1:1, v/v) once every 2 days via gavage for consecutive 2 weeks. 48 hours after the last treatment, mice were weighed and then euthanized using a ketamine (65 mg/kg), xylazine (13 mg/kg), and acepromazine (1.5 mg/kg) mixture [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Blood samples were taken from the heart and allowed to complete coagulation at room temperature. The serum was then separated via centrifuging at 3000 rpm for 15 minutes and kept at -80 degrees Celsius for further analysis. The mouse livers were collected and kept at -80 degrees Celsius for gene expression, and 10% formalin was utilized for preserving liver tissue for histopathological examinations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.5- Biochemical assays\u003c/b\u003e\u003c/h2\u003e \u003cp\u003e To assay liver function, liver enzymes\u0026rsquo; activities, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), along with total proteins and albumin levels in serum were measured (with Rayro Auto Analyzer and cobas c311) using colorimetric optical methods according to the commercial kit manufacturer\u0026rsquo;s guidelines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.6- Quantitative real-time PCR\u003c/h2\u003e \u003cp\u003eExpression levels of \u003cem\u003eEIF6\u003c/em\u003e, \u003cem\u003eCOL1A1\u003c/em\u003e, \u003cem\u003eITGB8\u003c/em\u003e, \u003cem\u003eCEBPB\u003c/em\u003e, \u003cem\u003eYY1\u003c/em\u003e, \u003cem\u003eLUM\u003c/em\u003e, and \u003cem\u003eCCN2\u003c/em\u003e were measured by real-time quantitative PCR according to the manufacturer\u0026rsquo;s guidelines. For this purpose, total RNA was extracted from liver tissue, and its purity and concentration were determined using a Nanodrop. cDNA synthesis was performed, and cDNA samples were amplified using the ABI (Step One Plus v2.3) Sequence Detection system (Applied Biosystems, Massachusetts, United States) for 40 cycles (95\u0026deg;C for 15\u0026ndash;30 s, 60\u0026deg;C for 30 s, 72\u0026deg;C for 30 s) with oligonucleotide primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Each sample was analyzed in triplicate, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) used for normalization. Quantification of target genes was performed using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e methodology.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences of the genes used for qPCR are shown below.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDirection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplicon length (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEIF6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTGGACAGGGAGACAGAAG\u003c/p\u003e \u003cp\u003eACACAGCAATCGTTCACCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e253\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCTGF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCTCTTCTGCGATTTC\u003c/p\u003e \u003cp\u003eATCCAGGCAAGTGCATTGGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYY1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGACCCTAAGCAACTGGCA\u003c/p\u003e \u003cp\u003eTGCAGCCTTTATGAGGGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCEBPβ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCCGTTGCCAGGCG\u003c/p\u003e \u003cp\u003eGGTGCATGAACGCGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e114\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLUM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATTCTTGTTCACAGTGTGCC\u003c/p\u003e \u003cp\u003eCATTCATTTTCAGCAAGTCCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL1A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCAGGGTATTGCTGGACAAC\u003c/p\u003e \u003cp\u003eCAGAAGGACCTTGTTTGCCAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e115\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITGB8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCTTAAAGACAGAAGCTTGG\u003c/p\u003e \u003cp\u003eTCTCACAACAATCTACAGTGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGAGTGTTTCCTCGTCCCGTA\u003c/p\u003e \u003cp\u003eTGCCGTGAGTGGAGTCATACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.7- Histopathology analysis\u003c/h2\u003e \u003cp\u003eFor histopathological tests, liver tissue slices were fixed in 10% formalin and subsequently dehydrated in increasing ethanol concentrations, followed by incubation in xylene to improve tissue transparency. Afterwards, the tissues were embedded in paraffin wax and cut into 5\u0026ndash;6 micron-thick slices, followed by hematoxylin (H) \u0026amp; eosin (E) and Trichrome-Masson staining [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The severity of liver fibrosis was graded using the Metavir and Ishak System [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e](Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eA summary of the histopathological index for the Metavir and Ishak System are shown below.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDescription\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMETAVIR(F)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eISHAK(S)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo fibrosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePortal fibrosis without septa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u0026ndash;2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePortal fibrosis with few septa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSeptal fibrosis without cirrhosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCirrhosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026ndash;6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.8- Bioinformatic analysis\u003c/h2\u003e \u003cp\u003e \u003cem\u003eGEO dataset\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe Gene Expression Omnibus (GEO) database is a repository containing high-throughput expression sequencing data that could be used for transcriptome analysis [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The data with the accession number GSE149508, with the following link, was used for analysis: (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE149508\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE149508\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. For heatmap visualization, the pheatmap version 1.0.13 package was used.\u003c/p\u003e \u003cp\u003e \u003cem\u003eLiver bulk tissue transcriptome analysis\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe Genotype-Tissue Expression (GTEx) Project is a tissue bank database containing cell and tissue-specific gene expression datasets [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In this study, the liver bulk tissue RNA expression dataset was used for Pearson Correlation analysis. Scatter plot visualization was obtained using the ggplot2 version 4.0.0 package.\u003c/p\u003e \u003cp\u003e \u003cem\u003eInteraction visualization\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe STRING Database offers protein-protein visualization and functional enrichment analysis for an input set of biomolecules [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The interaction of \u003cem\u003eEIF6\u003c/em\u003e, \u003cem\u003eLUM\u003c/em\u003e, \u003cem\u003eCTGF\u003c/em\u003e, \u003cem\u003eCEBPβ\u003c/em\u003e, \u003cem\u003eYY1\u003c/em\u003e, \u003cem\u003eITGB8\u003c/em\u003e, and \u003cem\u003eCOL1A1\u003c/em\u003e was visualized using STRING.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.9- Statistical analysis\u003c/h2\u003e \u003cp\u003eFor this study, students\u0026rsquo; t-test and One-way ANOVA were used for analyzing data. All Statistical analyses were performed using R version 4.3.1 software and GraphPad Prism 9.0. All data with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1- Curcumin reverses CCl4-induced higher liver weight\u003c/h2\u003e \u003cp\u003eMice in P/F C1 and A/F C2 had significantly lower body weight and higher liver weight in comparison to CW4 and CW6 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Treatment with curcumin caused a significant decrease in liver weight compared to P/F C1(p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and A/F C2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while no significant alterations were observed for body weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e Body and liver weights of the study groups are shown below. Data are represented as mean\u0026nbsp;\u0026nbsp;SD. ⁕: P\u0026lt;0.05; ⁕⁕: P\u0026lt;0.01; ⁕⁕⁕: P\u0026lt;0.001; ⁕⁕⁕⁕: P\u0026lt;0.0001.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" class=\"fr-table-selection-hover\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAverage body weight\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAverage liver weight\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003eCW4\u0026nbsp;\u003cbr\u003e\u0026nbsp;(n=4)\u003c/p\u003e\n \u003cp\u003eCW6\u0026nbsp;\u003cbr\u003e\u0026nbsp;(n=4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e24.14\u0026nbsp;\u0026nbsp; 0.30\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e25.13\u0026nbsp;\u0026nbsp; 0.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e1.27\u0026nbsp;\u0026nbsp;0.03\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.33\u0026nbsp;\u0026nbsp;\u0026nbsp;0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u0026nbsp;P/F C1\u0026nbsp;\u003cbr\u003e\u0026nbsp;(n=10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u0026nbsp;21.53\u0026nbsp;0.93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u0026nbsp;1.51\u0026nbsp;\u0026nbsp;\u0026nbsp;0.11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003eCurcumin I\u0026nbsp;\u003cbr\u003e\u0026nbsp;(n=10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e21.46\u0026nbsp;\u0026nbsp;0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e1.36\u0026nbsp;\u0026nbsp;\u0026nbsp;0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003eA/F C2\u003cbr\u003e\u0026nbsp;(n=10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e22.09\u0026nbsp;\u0026nbsp;0.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e1.66\u0026nbsp;\u0026nbsp;\u0026nbsp;0.06\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003eCurcumin II\u003cbr\u003e\u0026nbsp;(n=10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e21.78\u0026nbsp;\u0026nbsp;0.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 208px;\"\u003e\n \u003cp\u003e1.48 \u0026nbsp; 0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2- Curcumin restores serum levels of liver function biomarkers to normal levels\u003c/h2\u003e \u003cp\u003eOur findings show that levels of AST and ALT, enzymatic indicators of liver function, significantly increase in exposure to CCl4 in primary and Advanced liver fibrosis groups compared to the control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Curcumin significantly reduces enzyme levels in the treatment groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, in liver fibrosis groups, CCl4 significantly reduces liver protein levels, such as Albumin, while curcumin treatment significantly increases its level. We also examined the total protein levels. An increase in total protein level is seen in both treatment groups, although this increase is significant only in the curcumin II group (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) (Fig. A-D).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSerum levels of AST, ALT, albumin, and total protein are shown in different study groups below. Data are represented as mean \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:\\)\u003c/span\u003e\u003c/span\u003eSD.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAST\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eALT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAlbumin\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal protein\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCW4\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e75 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 1.141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29.5 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.75 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:0.07\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.1 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCW6\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e78 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 1.141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.5 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.85 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:0.07\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.95 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP/F C1\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e287.57 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 13.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e89.85 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 8.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.28 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:0.16\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.51 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCurcumin I\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e136.85 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 10.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39.71 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 8.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.67 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:0.13\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.81 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA/F C2\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e466.42 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 71.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e138.71 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 15.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.9 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:0.23\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.00\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.27\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCurcumin II\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e189.16 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 25.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46.83 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 7.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.66 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\:0.18\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.73 \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e 0.39\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Bioinformatic Analysis Predicts a Pro-Fibrotic Gene Network, which is Reversed by Curcumin in vivo\u003c/h2\u003e \u003cp\u003eTo establish a molecular basis for our investigation, we first performed a bioinformatic analysis of our target genes using public datasets. An examination of the GEO dataset (GSE149508), comparing activated versus quiescent hepatic stellate cells (HSCs), revealed that the transcript levels of \u003cem\u003eLUM\u003c/em\u003e, \u003cem\u003eYY1\u003c/em\u003e, \u003cem\u003eITGB8\u003c/em\u003e, and \u003cem\u003eCOL1A1\u003c/em\u003e were elevated in activated HSCs. In contrast, \u003cem\u003eEIF6\u003c/em\u003e, \u003cem\u003eCEBPβ\u003c/em\u003e, and \u003cem\u003eCTGF\u003c/em\u003e showed a trend of higher expression in quiescent HSCs, although these differences did not reach statistical significance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Protein-protein interaction analysis via the STRING database suggested a functional network among these factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Furthermore, Pearson correlation analysis using the GTEx liver transcriptome database demonstrated a strong positive correlation between \u003cem\u003eLUM\u003c/em\u003e and \u003cem\u003eITGB8\u003c/em\u003e and moderate correlations between other gene pairs, including \u003cem\u003eLUM-COL1A1\u003c/em\u003e, \u003cem\u003eCTGF-COL1A1\u003c/em\u003e, and \u003cem\u003eEIF6-COL1A1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), supporting their potential co-regulation in hepatic tissue.\u003c/p\u003e \u003cp\u003eBuilding on this bioinformatic framework, we next quantified the mRNA expression of these genes in our CCl₄-induced liver fibrosis models. In both the primary (P/F C1) and advanced (A/F C2) fibrosis groups, CCl₄ exposure induced a significant upregulation in the hepatic expression of all seven target genes: \u003cem\u003eEIF6\u003c/em\u003e, \u003cem\u003eLUM\u003c/em\u003e, \u003cem\u003eCEBPβ\u003c/em\u003e, \u003cem\u003eYY1\u003c/em\u003e, \u003cem\u003eCTGF\u003c/em\u003e, \u003cem\u003eITGB8\u003c/em\u003e, and \u003cem\u003eCOL1A1\u003c/em\u003e, relative to their respective time-matched controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Critically, the administration of curcumin effectively counteracted this induction. Treatment with curcumin resulted in a significant downregulation of all seven genes in both the primary (Curcumin I vs. P/F C1) and advanced (Curcumin II vs. A/F C2) stages of fibrosis, demonstrating a potent suppressive effect on this entire gene expression signature (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4- Curcumin ameliorates liver injury and histomorphology\u003c/h2\u003e \u003cp\u003eHistological examinations demonstrate the therapeutic effects of Curcumin on CCl4-induced liver fibrosis at both early and advanced stages. CCl4 injection causes severe liver injury, as evident by large areas of liver cell degeneration, loss of liver structure, and infiltration of inflammatory cells around blood vessels. In Masson\u0026rsquo;s trichrome staining, CCl4 complications appear as collagen fiber deposition in blue color. However, treatment with Curcumin reduces liver injuries, cell degeneration, infiltration of inflammatory cells, and collagen fiber deposition (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Additionally, according to the Metavir score, the curcumin II group shows significant improvement compared with A/F C2; however, no significant effect is observed with curcumin I.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLiver fibrosis is the result of chronic liver diseases, including chronic viral liver disease (HBV and HCV(, alcoholic steatohepatitis (ASH), non-alcoholic steatohepatitis (NASH), and other causes such as toxins and metabolic diseases, which lead to an increase in ROS, inflammatory cytokines, and damage to hepatocytes [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Liver fibrosis is a stage of liver damage that is reported to be reversible due to the regenerative capacity of the liver. Therefore, developing anti-fibrosis drugs to treat liver fibrosis is of utmost importance [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Previously, clinical trials and meta-analyses have researched the effects of curcumin in treating fibrosis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Curcumin participates in the processes of liver disease by influencing different cellular pathways, including NF-κB, PI3K/Akt, and TGF-β.\u003c/p\u003e \u003cp\u003eIn our study, curcumin administration led to significantly lower serum ALT and AST levels and to increased albumin and total protein levels compared with fibrosis groups. This finding coincided with previous results [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Also, our results indicate that CCl4 injection causes severe liver injury, cell degeneration, infiltration of inflammatory cells, and collagen fiber deposition, whereas curcumin administration improves these parameters, similar to findings from other studies [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. These observations highlight curcumin's protective effect on liver tissue structure and function.\u003c/p\u003e \u003cp\u003eA central and novel finding of this study is the identification of Eukaryotic Initiation Factor 6 (EIF6) as a pivotal molecular target in the anti-fibrotic action of curcumin. EIF6 functions as a critical gatekeeper of protein synthesis, primarily by binding the 60S ribosomal subunit to prevent its premature association with the 40S subunit, thereby controlling the overall rate of translation initiation [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The pathological activation of hepatic stellate cells (HSCs), the principal drivers of fibrosis, imposes an extraordinary burden on the cells\u0026rsquo; translational machinery to accommodate the massive synthesis and secretion of extracellular matrix proteins. Congruent with this requirement, our data demonstrate a marked upregulation of EIF6 expression in both primary and advanced stages of CCl₄-induced fibrosis, an effect that was potently reversed by curcumin administration.\u003c/p\u003e \u003cp\u003eEIF6 has been extensively studied in the pathophysiology of liver diseases, including NAFLD and hepatocellular carcinoma [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. This observation positions EIF6 as a critical bottleneck in the fibrotic cascade and resonates strongly with emerging evidence from other chronic liver pathologies. Indeed, a work by Scagliola and colleagues [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] has shown that during the progression from NAFLD to HCC, EIF6 expression is uniquely sustained to support pathological progress through lipid metabolism via the CEBPβ and YY1 axes\u0026mdash;a finding of particular relevance to our own study, as both CEBPβ and YY1 were also identified as targets of curcumin-mediated suppression. Furthermore, in vivo studies have established a causal role for EIF6 as a pro-fibrotic driver, where its overexpression in murine models is sufficient to exacerbate the formation of fibrotic regions [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Collectively, these data strongly suggest a previously underappreciated hepatoprotective mechanism for curcumin. Beyond its well-documented ability to modulate transcriptional programs, our findings indicate that curcumin can throttle the fibrotic engine at the fundamental level of translational capacity. By suppressing \u003cem\u003eEIF6\u003c/em\u003e, curcumin may directly limit the ability of activated HSCs to sustain the high-flux protein synthesis required for pathological ECM deposition, offering a powerful mechanism for the amelioration of liver fibrosis.\u003c/p\u003e \u003cp\u003eOn the contrary, EIF6 overexpression was reported to suppress CTGF levels via the Wnt/β-catenin/SP1 signaling and inhibit the development of chronic kidney disease and fibrosis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Similarly, another study reported higher COL1A1 levels in EIF6-deficient dermal fibroblasts, which dampened the granulation tissue formation and consequent healing [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. However, GTEx results indicated a weak-positive and moderate-positive correlation between CTGF-EIF6 and COL1A1-EIF6, respectively. The expression levels of all three genes were higher in the liver fibrosis groups. These findings suggest that EIF6 could be a potential target for treating liver fibrosis, and the contradictory results necessitate further investigation into possible tissue-specific molecular mechanisms.\u003c/p\u003e \u003cp\u003eYY1 facilitates the progression of fibrosis by participating in the activation of HSCs, inflammation, and increased ECM production. Treatment with curcumin reduced fibrosis by lowering YY1 expression levels, and this result is consistent with previous findings [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Similarly, the expression of LUM and CTGF was increased in the fibrosis groups, and curcumin treatment mitigated fibrosis by targeting these genes, which are proven to be essential in fibrosis pathophysiology [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe acknowledge this study\u0026rsquo;s limitations. Our findings were derived from a single CCl₄ toxicant model, and their relevance to other fibrotic etiologies, such as NASH, requires further validation. As a preclinical investigation, these murine results provide a strong rationale for\u0026mdash;but must await\u0026mdash;clinical translation to confirm human efficacy. Furthermore, future studies should incorporate pharmacokinetic analysis to address curcumin\u0026rsquo;s known bioavailability challenges and correlate hepatic drug concentrations with the observed therapeutic effects.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eCurcumin effectively attenuated CCl₄-induced liver fibrosis in mice at both primary and advanced stages through restoration of liver function, downregulation of key pro-fibrotic genes (\u003cem\u003eEIF6\u003c/em\u003e, \u003cem\u003eLUM\u003c/em\u003e, \u003cem\u003eYY1\u003c/em\u003e, \u003cem\u003eCEBPβ\u003c/em\u003e, \u003cem\u003eCTGF\u003c/em\u003e, \u003cem\u003eITGB8\u003c/em\u003e, and \u003cem\u003eCOL1A1\u003c/em\u003e), and marked histopathological improvement. Its greater efficacy in advanced fibrosis highlights curcumin as a promising candidate for the treatment of established liver fibrosis, warranting further clinical evaluation.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHSC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHepatic stellate cell\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eECM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eExtracellular matrix\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ea-SMA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAlpha-smooth muscle actin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMMP\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMatrix metalloproteinase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTIMP\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTissue inhibitor of matrix metalloproteinase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eEIF6\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEukaryotic initiation factor 6\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCEBPβ\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCCAAT/enhancer-binding proteinβ\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eLUM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLumican\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCTGF\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eConnective tissue growth factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eYY1\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eYing yang 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study\u0026rsquo;s conception and design. M.H.A. and A.A.F. carried out the experiments and data collection. All authors participated in the writing of the manuscript. M.H.A., P.S., and A.A.F. carried out statistical analyses. P.S. carried out bioinformatic analysis. A.S.L., L.R., and A.A.F. took care of editing and revision. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work received funding from Ardabil University of Medical Sciences with the grant number IR.ARUMS.AEC.1402.012.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study and animal treatments were approved by the ethical committee of the Ardabil University of Medical Sciences.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSun M, Kisseleva T (2015) Reversibility of liver fibrosis. Clin Res Hepatol Gastroenterol 39:S60\u0026ndash;S63\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZamani M et al (2025) Global Prevalence of Advanced Liver Fibrosis and Cirrhosis in the General Population: A Systematic Review and Meta-analysis. Clin Gastroenterol Hepatol 23(7):1123\u0026ndash;1134\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchuppan D et al (2018) Liver fibrosis: Direct antifibrotic agents and targeted therapies. Matrix Biol, 68\u0026ndash;69: p. 435\u0026ndash;451\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePei Q, Yi Q, Tang L (2023) Liver Fibrosis Resolution: From Molecular Mechanisms to Therapeutic Opportunities. Int J Mol Sci, 24(11)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoy S et al (2015) miR-30c and miR-193 are a part of the TGF-β-dependent regulatory network controlling extracellular matrix genes in liver fibrosis. J Dig Dis 16(9):513\u0026ndash;524\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoehlen N, Crouchet E, Baumert TF (2020) Liver Fibrosis: Mechanistic Concepts and Therapeutic Perspectives. Cells, 9(4)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFingleton B (2008) \u003cem\u003eMMPs as therapeutic targets\u0026mdash;still a viable option?\u003c/em\u003e in \u003cem\u003eSeminars in cell \u0026amp; developmental biology\u003c/em\u003e. Elsevier\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaako P et al (2022) eIF6 rebinding dynamically couples ribosome maturation and translation. Nat Commun 13(1):1562\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang SS et al (2015) Eukaryotic initiation factor 6 modulates myofibroblast differentiation at transforming growth factor-β1 transcription level via H2A.Z occupancy and Sp1 recruitment. J Cell Sci 128(21):3977\u0026ndash;3989\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShu Q et al (2016) Involvement of eIF6 in external mechanical stretch-mediated murine dermal fibroblast function via TGF-β1 pathway. Sci Rep 6:36075\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L et al (2022) \u003cem\u003eCCAAT/Enhancer-Binding Proteins in Fibrosis: Complex Roles Beyond Conventional Understanding.\u003c/em\u003e Research (Wash D C), 2022. : p. 9891689\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchonfeld M et al (2025) C/EBPbeta transcription factor promotes alcohol-induced liver fibrosis in males via HDL remodeling. Hepatol Commun, 9(3)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchonfeld M et al (2025) Continuous Activation of C/EBPbeta Transcription Factor Prevents Fibrosis Resolution After Alcohol Cessation. Cell Mol Gastroenterol Hepatol 19(9):101525\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAppunni S et al (2021) Lumican, pro-tumorigenic or anti-tumorigenic: A conundrum. Clin Chim Acta 514:1\u0026ndash;7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaiocchini A et al (2016) Extracellular Matrix Molecular Remodeling in Human Liver Fibrosis Evolution. PLoS ONE 11(3):e0151736\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnan A et al (2012) Lumican, an extracellular matrix proteoglycan, is a novel requisite for hepatic fibrosis. Lab Invest 92(12):1712\u0026ndash;1725\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang Y et al (2021) LUM is the hub gene of advanced fibrosis in nonalcoholic fatty liver disease patients. Clin Res Hepatol Gastroenterol 45(1):101435\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZaykov V, Chaqour B (2021) The CCN2/CTGF interactome: an approach to understanding the versatility of CCN2/CTGF molecular activities. J Cell Commun Signal 15(4):567\u0026ndash;580\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePi L et al (2023) CCN2/CTGF promotes liver fibrosis through crosstalk with the Slit2/Robo signaling. J Cell Commun Signal 17(1):137\u0026ndash;150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrampuz SR et al (2023) The Role of CTGF in Liver Fibrosis Induced in 3D Human Liver Spheroids. Cells, 12(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M et al (2017) Multifunctional YY1 in Liver Diseases. Semin Liver Dis 37(4):363\u0026ndash;376\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H et al (2019) Myofibroblast-specific YY1 promotes liver fibrosis. Biochem Biophys Res Commun 514(3):913\u0026ndash;918\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan X et al (2018) Hepatic expression of Yin Yang 1 (YY1) is associated with the non-alcoholic fatty liver disease (NAFLD) progression in patients undergoing bariatric surgery. BMC Gastroenterol 18(1):147\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu Y-H et al (2024) The intervention of curcumin on rodent models of hepatic fibrosis: A systematic review and meta-analysis. PLoS ONE 19(5):e0304176\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCianciulli A et al (2016) PI3k/Akt signalling pathway plays a crucial role in the anti-inflammatory effects of curcumin in LPS-activated microglia. Int Immunopharmacol 36:282\u0026ndash;290\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu YH et al (2024) The intervention of curcumin on rodent models of hepatic fibrosis: A systematic review and meta-analysis. PLoS ONE 19(5):e0304176\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharifi-Rad J et al (2020) Turmeric and Its Major Compound Curcumin on Health: Bioactive Effects and Safety Profiles for Food, Pharmaceutical, Biotechnological and Medicinal Applications. Front Pharmacol 11:01021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan H et al (2019) Mechanistic insights of hepatoprotective effects of curcumin: Therapeutic updates and future prospects. 124:182\u0026ndash;191\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe S et al (2010) Ketamine\u0026ndash;xylazine\u0026ndash;acepromazine compared with isoflurane for anesthesia during liver transplantation in rodents. J Am Assoc Lab Anim Sci 49(1):45\u0026ndash;51\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaglah A et al (2022) Conditional GANs based system for fibrosis detection and quantification in Hematoxylin and Eosin whole slide images. Med Image Anal 81:102537\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNilsson J et al (2020) NKT cells promote both type 1 and type 2 inflammatory responses in a mouse model of liver fibrosis. Sci Rep 10(1):21778\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSridharan D et al (2022) A one-stop protocol to assess myocardial fibrosis in frozen and paraffin sections. Methods Protocols 5(1):13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSebastiani G (2009) Non-invasive assessment of liver fibrosis in chronic liver diseases: implementation in clinical practice and decisional algorithms. World J gastroenterology: WJG 15(18):2190\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui HK et al (2023) An integrative analysis of single-cell and bulk transcriptome and bidirectional mendelian randomization analysis identified C1Q as a novel stimulated risk gene for Atherosclerosis. Front Immunol 14:1289223\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe L et al (2020) Expression of hepatic stellate cell activation-related genes in HBV-, HCV-, and nonalcoholic fatty liver disease-associated fibrosis. PLoS ONE 15(5):e0233702\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConsortium GT (2013) The Genotype-Tissue Expression (GTEx) project. Nat Genet 45(6):580\u0026ndash;585\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzklarczyk D et al (2023) The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res 51(D1):D638\u0026ndash;D646\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerumen J et al (2021) Liver fibrosis: Pathophysiology and clinical implications. WIREs Mech Dis 13(1):e1499\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGerami H et al (2025) Effect of nano-curcumin supplementation on liver fibrosis in patients with NAFLD-associated fibrosis: a double-blind randomized controlled trial. Sci Rep 15(1):38043\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurugan P, Pari L (2007) Influence of tetrahydrocurcumin on hepatic and renal functional markers and protein levels in experimental type 2 diabetic rats. Basic Clin Pharmacol Toxicol 101(4):241\u0026ndash;245\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVajdi M et al (2025) Curcumin supplementation effect on liver enzymes in patients with nonalcoholic fatty liver disease: a GRADE-assessed systematic review and dose-response meta-analysis of randomized controlled trials. Nutr Rev 83(1):1\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmbaby A, Abdel-Kawi S (2021) Histological Study on the Effect of Curcumin and Curcumin Nanoparticles on Cadmium-Induced Liver Damage in Adult male Albino Rats. J Med Histol 5(2):119\u0026ndash;133\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeis F et al (2015) Mechanism of eIF6 release from the nascent 60S ribosomal subunit. Nat Struct Mol Biol 22(11):914\u0026ndash;919\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun L et al (2021) eIF6 promotes the malignant progression of human hepatocellular carcinoma via the mTOR signaling pathway. J Transl Med 19(1):216\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScagliola A et al (2021) Targeting of eIF6-driven translation induces a metabolic rewiring that reduces NAFLD and the consequent evolution to hepatocellular carcinoma. Nat Commun 12(1):4878\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScagliola A et al (2021) Targeting of eIF6-driven translation induces a metabolic rewiring that reduces NAFLD and the consequent evolution to hepatocellular carcinoma. Nat Commun 12(1):4878\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrina D et al (2015) eIF6 coordinates insulin sensitivity and lipid metabolism by coupling translation to transcription. Nat Commun 6(1):8261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X et al (2025) PRDM16 acts as a homeostasis regulation factor to suppress the transition of AKI to CKD via upregulation of eukaryotic initiation factor 6. Cell Mol Life Sci 82(1):252\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShu Q et al (2016) Involvement of eIF6 in external mechanical stretch-mediated murine dermal fibroblast function via TGF-beta1 pathway. Sci Rep 6:36075\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLipson KE et al (2012) CTGF is a central mediator of tissue remodeling and fibrosis and its inhibition can reverse the process of fibrosis. Fibrogenesis Tissue Repair 5(Suppl 1):S24\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Curcumin, Primary liver fibrosis, Advanced liver fibrosis, C57/BL6J mice","lastPublishedDoi":"10.21203/rs.3.rs-8801501/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8801501/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eIntroduction:\u003c/strong\u003e Liver fibrosis is the result of damage to hepatic tissue that may advance to cirrhosis and,consequently, hepatocellular carcinoma. Currently, there are no definitive treatments for reversing advanced liver fibrosis, and as a result, early detection and prevention are of critical importance. Curcumin is a widely recognized spice, categorized as a phytochemical with potential anti-inflammatory and antioxidant properties. In this study, the inhibitory effect of curcumin administration against carbon tetrachloride-induced hepatic fibrosis was investigated in vivo.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and methods:\u003c/strong\u003e48 C57/BL6J male mice were divided into 6 groups consisting of Control 4W, P/F C1, Curcumin I, Control 6W, Advanced/F, and Curcumin II. After treatment, rats were euthanized, and serum and liver tissues were collected. For histological analysis, serum ALT/AST, albumin, and hepatic histomorphology were analyzed accordingly. Additionally, expression levels of \u003cem\u003eEIF6\u003c/em\u003e, \u003cem\u003eCOL1A1\u003c/em\u003e, \u003cem\u003eITGB8\u003c/em\u003e, \u003cem\u003eCEBPB\u003c/em\u003e, \u003cem\u003eYY1\u003c/em\u003e, \u003cem\u003eLUM\u003c/em\u003e, and \u003cem\u003eCCN2\u003c/em\u003ewere measured using real-time PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Curcumin administration significantly attenuated CCl₄-induced elevations in serum AST and ALT levels, while restoring albumin and total protein concentrations. Expression of key pro-fibrotic genes was significantly upregulated in both early and advanced fibrosis models and effectively suppressed by curcumin treatment. Histological examinations demonstrated reduced inflammatory infiltration, hepatocyte degeneration, and collagen accumulation, with greater improvement in advanced-stage fibrosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Curcumin displays protective effects against primary and advanced liver fibrosis, suggesting potential clinical application.\u003c/p\u003e","manuscriptTitle":"Curcumin protects against CCl4-induced primary and advanced liver fibrosis in C57/BL6J mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-18 13:25:12","doi":"10.21203/rs.3.rs-8801501/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9c23e25b-f4da-47fd-aac4-aa857cc54730","owner":[],"postedDate":"February 18th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-14T15:25:55+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-18 13:25:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8801501","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8801501","identity":"rs-8801501","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}