Influenza virus antagonizes self sensing by RIG-I to enhance viral replication

preprint OA: closed
📄 Open PDF Full text JSON View at publisher

Abstract

Summary Innate immune sensors must finely distinguish pathogens from the host to mount a response only during infection. RIG-I is cytoplasmic sensor that surveils for foreign RNAs. When activated, RIG-I triggers a broad antiviral response that is a major regulator of RNA virus infection. Here were show that RIG-I not only bound viral RNAs, but was activated by host RNAs to amplify the antiviral state. These were primarily non-coding RNAs transcribed by RNA polymerase III. They were benign under normal conditions but became immunogenic during influenza virus infection where they signaled via RIG-I to suppress viral replication. This same class of RNAs was bound by influenza virus nucleoprotein (NP), which normally functions to encapsidate the viral genome. NP interacted with RIG-I and cytoplasmic NP antagonized sensing of self RNAs to counter innate immune responses. Overall, these results demonstrate that self sensing is strategically deployed by the cell to amplify the antiviral response and reveal a newly identified viral countermeasure that disrupts RIG-I activation by host RNAs.
Full text 98,171 characters · extracted from preprint-html · click to expand
Influenza virus antagonizes self sensing by RIG-I to enhance viral replication | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Influenza virus antagonizes self sensing by RIG-I to enhance viral replication Mitchell P. Ledwith , Thomas Nipper , Kaitlin A. Davis , Deniz Uresin , Anastassia V. Komarova , View ORCID Profile Andrew Mehle doi: https://doi.org/10.1101/2025.03.12.642847 Mitchell P. Ledwith 1 Medical Microbiology and Immunology, University of Wisconsin Madison , Madison, WI, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Thomas Nipper 1 Medical Microbiology and Immunology, University of Wisconsin Madison , Madison, WI, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kaitlin A. Davis 1 Medical Microbiology and Immunology, University of Wisconsin Madison , Madison, WI, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Deniz Uresin 2 Institut Pasteur, Université Paris Cité, Interactomics, RNA and Immunity laboratory , F- 75015 Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Anastassia V. Komarova 2 Institut Pasteur, Université Paris Cité, Interactomics, RNA and Immunity laboratory , F- 75015 Paris, France 3 Institut Pasteur, Université Paris Cité, Molecular Genetics of RNA Viruses , CNRS UMR- 3569, F-75015 Paris, France 4 Institut Pasteur, Pasteur-Oncovita Joint Laboratory , F-75015 Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andrew Mehle 1 Medical Microbiology and Immunology, University of Wisconsin Madison , Madison, WI, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Andrew Mehle For correspondence: amehle{at}wisc.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Summary Innate immune sensors must finely distinguish pathogens from the host to mount a response only during infection. RIG-I is cytoplasmic sensor that surveils for foreign RNAs. When activated, RIG-I triggers a broad antiviral response that is a major regulator of RNA virus infection. Here were show that RIG-I not only bound viral RNAs, but was activated by host RNAs to amplify the antiviral state. These were primarily non-coding RNAs transcribed by RNA polymerase III. They were benign under normal conditions but became immunogenic during influenza virus infection where they signaled via RIG-I to suppress viral replication. This same class of RNAs was bound by influenza virus nucleoprotein (NP), which normally functions to encapsidate the viral genome. NP interacted with RIG-I and antagonized sensing of self RNAs to counter innate immune responses. Overall, these results demonstrate that self sensing is strategically deployed by the cell to amplify the antiviral response and reveal a newly identified viral countermeasure that disrupts RIG-I activation by host RNAs. I ntroduction Cells employ complex sensing pathways to detect nucleic acids from invading pathogens and initiate innate immune responses 1 – 3 . Foreign nucleic acids exhibit unique molecular features or subcellular localizations that allow nucleic acid sensors to differentiate them from host nucleic acids. Nucleic acid sensors use these features to delicately balance sensitivity and specificity for rapid and robust responses only during infection. Whereas foreign nucleic acid sensing is protective, inappropriate sensing of self nucleic acids can cause chronic inflammation and immunopathology 4 . RIG-I-like receptors (RLRs) are germline encoded RNA sensors composed of RIG-I ( DDX58 ), MDA5 ( IFIH1 ) and LGP2 ( DHX58 ) that surveil the cytoplasm for foreign RNAs 1 , 2 . MDA5 recognizes long dsRNAs (>0.5kb), a common intermediate during RNA virus genome replication and a by-product of bi-directional transcription for certain DNA viruses 5 . RIG-I recognizes shorter dsRNA structures and requires the presence of a 5’ diphosphate (5’ PP) or 5’ triphosphate (5’ PPP) for activation 6 – 8 . The 5’ PP/PPP moieties are products of replication by viral RNA-dependent RNA polymerases. When activated, both RIG-I and MDA5 undergo conformational changes that expose their tandem caspase recruitment domains (CARD) 9 – 12 . The CARDs then oligomerize and signal through MAVS to initiate an anti-pathogen response by expressing type I and type III interferons (IFN) and other proinflammatory cytokines. RIG-I is constitutively expressed to enable detection of the earliest stages of viral infection, including sensing of viral genomes even before their replication or transcription has begun 13 , 14 . RIG-I is the dominant innate immune sensor controlling influenza virus replication where it binds and is activated by viral genomes and aberrant replication products 15 – 19 . However, RIG-I does not exclusively bind to viral RNAs; it samples dsRNAs regardless of their immunogenicity or origin. The total numbers of RNA molecules under surveillance vastly outnumbers the amount of RIG-I, and only a fraction of those are viral RNAs. RIG-I must therefore rapidly recycle off non- immunogenic RNAs so it can continue sampling all available RNAs to detect the rare immunogenic species. Discrimination occurs after RIG-I binds dsRNA where it has a faster off rate and lower affinity for dsRNA lacking a 5’ PPP that promotes translocation along the length of the RNA and rapid recycling 12 , 20 – 22 . Conversely, when RIG-I encounters dsRNA with a 5’ PP/PPP, it assumes a distinct conformation with high-affinity interactions between the RNA and the 5’ PPP 12 . This throttles RIG-I translocation helping to form long-lived complex that promote RIG-I oligomerization and maintain the CARD domains in an exposed state competent to form a signaling platform with MAVS 9 , 11 , 12 , 20 . These subtle differences in RNA binding and occupancy time establish mechanisms that distinguish virus from host while also allowing limiting amounts of RIG-I to patrol vast cytoplasmic RNAs. Aberrant sensing of self RNAs caused by inborn genetic errors in RIG-I or MDA5 is associated with multiple disease states including interferonopathies like Singleton-Merten syndrome and Aicardi–Goutières syndrome 4 . This failure to faithfully differentiate self from non-self leads to chronic interferon signaling and associated inflammation. While self sensing has been generally viewed as pathogenic, new data suggest that it may also amplify antiviral responses 23 – 27 . To define a potential protective role of self sensing during viral infection, we quantitatively characterized RNAs surveilled by RIG-I under sterile conditions and during viral infection. The vast majority of RNAs bound by RIG-I are host RNAs, even during infection. RIG-I-bound host RNAs are dominated by small non-coding RNA polymerase III (Pol III) transcripts, including Y RNAs, vault RNAs (vtRNAs), and U6 RNAs. These RNAs are benign in uninfected cells but become immunogenic during influenza virus infection when they signal via RIG-I to suppress viral replication. This virus:host conflict creates an environment ripe for the emergence of viral countermeasures. We show that influenza virus nucleoprotein (NP), a viral protein whose primary function is to encapsidate the viral genome, binds many of the same host RNAs as RIG-I. NP interacts with RIG-I and antagonizes sensing of self RNAs to counter innate immune responses. RIG-I activation is finely balanced to promote rapid detection of invading pathogens while avoiding self sensing that can cause diseases. Our results show that this balance is intentionally disrupted by cells where RIG-I is activated by both host and viral RNAs to provide parallel mechanisms of innate immune activation during influenza virus infection. Moreover, we reveal a generalizable mechanism by which the nucleoproteins of RNA viruses suppress infection-induced immunogenicity triggered by host non-coding RNAs. R esults RIG-I primarily engages host RNAs even during infection Understanding how the repertoire of RIG-I-bound RNAs changes requires quantitative comparisons across conditions. To achieve this, we developed a spike-in cross-linking immunoprecipitation sequencing (CLIP-Seq) approach. First, accurate quantification and comparisons between immunoprecipitated libraries necessitate equivalent amounts of target protein in each sample, yet this is complicated by the fact that RIG-I expression increases in response to infection 1 . We eliminated this unwanted variable by generating human A549 lung cells that stably express similar amounts of RIG-I in all conditions ( Fig 1A ). Inoculation of these cells with influenza A virus (FLUAV) or vesicular stomatitis virus (VSV) demonstrated that constitutive RIG-I expression restricts replication of both of these RNA viruses ( Fig 1A ), as expected 19 . These cells were used to generate lysates for CLIP-seq to which we then introduced a spike-in control to mitigate biases present in global analyses of immunoprecipitated samples 28 . Spike-in controls were generated by cross-linking RIG-I to RNA in Drosophila S2 cells (Fig S1A). Sequence divergence between Drosophila and humans permitted unique identification and quantification of RNAs derived from the common spike-in control (Fig S1B). This strategy disambiguated >99.5% of sequencing reads (Fig S1C), allowing for internal normalization and differential assessment of RNA-binding across samples. Download figure Open in new tab Figure 1. RIG-I primarily surveils host RNAs even during infection. (A) WT A549 cells or those stably expressing RIG-I were mock-infected, infected with FLUAV (MOI = 0.01, 24h), or infected with VSV-GFP (MOI = 0.001, 24h). Protein expression was detected by western blotting. (B) RIG-I CLIP was performed with a spike-in control in biological duplicate. Fraction of reads mapping to human, FLUAV, and VSV genomes for size-matched input controls or RIG-I CLIP samples. (C) Normalized read coverage for RIG-I-bound and size-matched input control RNAs. Data from independent biological replicates are shown as mean and s.d. using dark and light shades of the same color, respectively. CLIPper-identified peaks are shown. CPM, counts per million. See Supplementary Table 1 for all identified RIG-I CLIP peaks. (D) Gene enrichment in RIG-I binding during infection. Log2 fold-change in read depth of genes captured by RIG-I CLIP versus the size- matched input control plotted as a function of the average counts per million (CPM) in the CLIP and size-matched input libraries. Differential gene binding data can be found in Supplementary Table 2. See also Supplementary Table 3 for differential peak binding. (E) Principle coordinate analysis of genes identified in the spike-in-normalized RIG-I CLIP and size-matched input libraries. (F) Overlap of CLIPper-called RIG-I binding peaks from mock, FLUAV-infected, and VSV- infected A549 cells. (G) Normalized read coverage of RIG-bound RNAs or size-matched input controls from mock, FLUAV-infected, and VSV-infected cells shown as in (C). CLIPper-identified peaks and gene tracks are shown. (H) Log2 fold-change of infection over mock for RIG-I CLIP peak intensity separated by host- or virus-derived RNAs. Associated with Supplementary Table 3. Our quantitative CLIP-Seq approach was used to compare RNAs bound by RIG-I during infection FLUAV, VSV, or mock treatment. As expected, RIG-I bound FLUAV RNAs ( Fig 1B-D , Table S1-3). RIG-I binding was localized to the termini of viral genomes, with binding peaks present on both the negative-sense genome (vRNA) and the positive-sense replication intermediate (cRNA) ( Fig 1C ). This recapitulates prior RIG-I:RNA associations and confirms the known stimulatory role of the double-stranded 5’ PPP panhandle structures that are made by viral genome termini, possibly enriched in defective viral genomes, providing confidence in our approach 16 – 18 . Influenza virus-derived RNAs constituted ∼15% of the total RNA bound by RIG-I, while VSV-derived RNAs were not even enriched relative to their abundance in the input and were less than 5% of the RIG-I bound RNAs ( Fig 1B ). The vast majority of RIG-I-bound RNAs across all conditions were derived from the host. RIG-I bound a discrete population of host non-coding RNAs expressed by Pol III. Non-coding RNAs can be encoded by 1000’s of unique degenerate loci, making them notoriously difficult to quantify and accurately map, especially in CLIP-Seq data 29 – 32 . We addressed this by using two-pass mapping, de novo transcriptome assembly, and re-mapping to quantify these RNA populations (Fig. S1B). Y RNAs ( RNY ), vtRNAs ( vtRNA ), U6 RNAs ( RNU6 ), Alu RNAs, and tRNAs were all bound by RIG-I during FLUAV infection ( Fig 1D and S2A, Table S2). While ribosomal RNA (rRNAs) are the most abundant RNAs in our samples, they are not enriched by RIG- I confirming the specificity of our CLIP-Seq. Similar patterns were observed during VSV infection and mock- treatment, with RNY4 a notable example of a highly enriched host non-coding (Fig S2A). Principle coordinate analysis cleanly separated RIG-I CLIP-Seq samples from size-matched input controls, reinforcing that RIG-I interacts with a restricted pool of RNAs ( Fig 1E ). Peak calling identified RNAs differentially bound between mock and infected conditions. Nearly all peaks that were significantly bound in mock-infected cells were also identified in cells infected with influenza virus or VSV infection ( Fig 1F , Table S1). Similarly, ∼60% of peaks identified in VSV infection were also identified in FLUAV infection. This underestimates the overlap of shared host RNAs bound by RIG-I during infection as approximately half of the peaks absent from VSV-infected samples belonged to the influenza virus genome. This shared binding pattern is reflected in the read densities across the RIG-I- bound U6 and Y4 RNAs where binding intensity is consistent between mock, FLUAV-, and VSV-infected cells ( Fig. 1G ). We extended this analysis to all RNAs bound by RIG-I ( Fig 1H , Table S3). RIG-I peaks on viral RNAs were dramatically increased, as expected given their absence in mock conditions. However, host RNAs displayed little change in binding during infection with either FLUAV or VSV. Analysis at the gene level yielded similar trends, with changes in RIG-I binding occurring mostly on viral RNAs (Fig S2B, Table S2). The host transcripts that appear to change RIG-I occupancy during infection are IFN-stimulated genes that are normally absent in mock cells (Table S2), thus changes in binding largely reflect the absence of these transcripts in uninfected cells. Together, these data show that RIG-I continually binds and surveils cellular RNAs independent of viral infection, especially those expressed by Pol III, and that even during infection the majority of RNAs sampled by RIG-I are host-derived. Influenza virus NP binds host non-coding RNAs Like all negative-strand RNA viruses, FLUAV and VSV package their genomes into large ribonucleoprotein complexes (RNPs) with the viral RNA-dependent RNA polymerase (RdRP) bound to the genome termini while the viral nucleocapsid (N) or nucleoprotein (NP) oligomerizes along the length of the genome 33 . RNPs then serve as templates for both genome replication and gene transcription. As both FLUAV NP and RIG-I bind to the viral genome, we asked whether they interact. Cells expressing RIG-I were infected with the 2009 pH1N1 strain of FLUAV or mock treated. NP co-precipitated with RIG-I, but not the control ( Fig 2A ). This interaction required RNA, as treatment with RNase dramatically reduced co-precipitation of NP by RIG-I ( Fig 2B and S3). These findings are reinforced by similar interactions with RIG-I derived from FLUAV hosts like duck and pig 34 . Download figure Open in new tab Figure 2. FLUAV NP binds human non-coding RNAs during infection. (A-B) NP interacts with RIG-I in an RNA-dependent manner. Cells expressing Strep-tagged RIG-I or an mCherry control were infected with 2009 pH1N1 influenza virus, lysed and subject to enrichment with Strep-tag affinity resin. Proteins in the input lysate and enriched samples were detected by western blot. In (B), samples were subject to RNAse A treatment prior to affinity capture. (C) RNA-immunoprecipitation was performed on lysates prepared from A549 cells infected for 24h with A/WSN/33 (MOI = 0.02) using antibody recognizing NP or an IgG control. RNAs were subject to Bioanalyzer analysis and NP was detected by western blot. (D) Frequency of host- and FLUAV-derived reads in SMInput and NP eCLIP libraries prepared from A549 cells infected with FLUAV for 24h (MOI = 0.02). (E) Identification of NP-bound gene transcripts during infection. Log2 fold-change in read depth of genes captured by NP CLIP versus the size-matched input control plotted as a function of the average counts per million (CPM) in the CLIP and size-matched input libraries. Negative-sense vRNA and positive- sense cRNA viral gene segments and select host genes are indicated. Differential gene binding data can be found in Supplementary Table 4. (F) Normalized read coverage for NP-bound and size-matched input control RNAs. Data from independent biological replicates are shown as mean and s.d. using dark and light shades of the same color, respectively. CLIPper-identified peaks and gene tracks are shown. CPM, counts per million. See Supplementary Table 5 for all identified NP CLIP peaks. (G) Human RNA biotypes of CLIPper-called peaks (left) and further division of non-coding RNAs (ncRNA) into annotated biotypes (right). (H) Read counts in CLIPper-called peak were assigned to host-derived protein-coding or non-coding/repetitive RNAs based on their RNA biotype. (I) Clustering of eCLIP datasets from ENCORE database with uniform manifold approximation and projection based on Jaccard similarity. Dot color denoted by NP eCLIP library (red) or available hierarchical clustering of eCLIP libraries in the ENCORE database. NP binds RNA non-specifically, forming sequence-independent interactions with the phosphate backbone allowing it to coat the entirety of the viral genome 35 – 40 . This raises the possibility that NP interacts with cellular RNAs in addition to the viral genome. NP was immunoprecipitated from infected human A549 lungs cells and sizing analysis of the associated RNA identified species corresponding to viral genomic RNAs (900- 2100nt) ( Fig 2C ). In addition to these larger RNAs, immunoprecipitations also enrich smaller RNA species (100-300nt) that could be aberrant products of genome replication or host-derived RNAs. To unbiasedly profile the full spectrum of RNAs bound by NP, we performed classic CLIP-Seq targeting NP in infected A549 cells. ∼75% of the bound RNAs were derived from the viral genome ( Fig 2D ). Viral RNAs were dramatically enriched relative to their abundance in the infected cells ( Fig 2D-E ), confirming our ability to detect known targets of NP. Similar to previous observations, NP bound the viral genome non-uniformly, with specific regions reproducibly bound at higher levels (Fig S4A-B) 41 – 43 . Surprisingly, ∼25% of bound sequences are host-derived, suggesting that a significant portion of NP engages host RNAs during infection. Gene-level analysis revealed that many of the host RNAs belong to non-coding and repetitive RNA families, especially vault RNAs, Y RNA, Alu RNAs, the spliceosomal small nuclear RNAs (snRNAs) U5, U6, and U6ATAC, 7SK snRNA, and the 7SL signal recognition particle RNA ( Fig 2E-F , Table S4). Bound RNAs were frequently Pol III transcripts. 1575 high-confidence binding peaks were identified, of which ∼150 are annotated as non-coding RNAs ( Fig 2G ). Despite representing only ∼10% of the identified peaks, small non-coding RNAs contributed more than 70% of total reads at NP-bound peaks ( Fig 2H ). Given the binding preference of NP, these regions are presumably single stranded 39 , 44 . No obvious sequence motifs were found in NP binding sites on host RNAs, consistent with how NP binds the viral genome in a sequence-independent fashion. RNA-binding proteins typically have a restricted binding repertoire of one or a few classes of RNAs 31 . Unlike many previously profiled RNA-binding proteins, NP enriched for RNAs spanning several diverse classes and localizing to multiple cellular compartments. To contextualize this unique RNA-binding activity, we compared NP-bound peaks to the publicly available ENCORE database of CLIP datasets 31 . Dimensionality reduction and visualization recapitulated known binding preferences of proteins in the ENCORE database ( Fig 2I ). NP clustered with RNA-binding proteins with disparate roles, consistent with its diverse RNA-binding profile. Proteins in the NP-proximal embedding space act in the processing of non-coding RNAs, such as DCGR8, RMB5, and WDR43, which act in miRNA maturation, splicing, and ribosome biogenesis pathways, respectively. Together, these data demonstrate that NP reproducibly and specifically engages a unique subset of host RNAs during infection, especially non-coding RNAs transcribed by Pol III. Infection regulates the RNA-binding repertoire of NP Approximately 25% of all NP:RNA complexes contained host RNAs. To determine if these complexes are formed intrinsically or if this is an infection-specific phenomenon, we used spike-in normalized CLIP to quantitatively profile NP-bound RNAs in multiple conditions (Fig S1D-E). NP was expressed via infection, induction in a stable cell line, or both prior to quantitative CLIP-Seq ( Fig 3A ). Upon infection, ∼30% of NP CLIP reads were influenza virus-derived in infected cells, whereas ∼20% were influenza virus-derived when NP was pre-expressed before infection ( Fig 3B , Table S6). Principle coordinate analysis revealed that NP binds a distinct collection of RNAs compared to the input, and this population differs when NP is expressed alone compared to infection ( Fig 3C ). Over 40% of the identified peaks overlapped between both infection conditions, but less than 15% overlapped between infected cells and those where NP was only present due to inducible expression ( Fig 3D ). In addition, 3 times more peaks were identified in the absence of infection, suggesting widespread changes in RNA binding dependent on infection. Gene-level analysis of the RNAs bound by NP reflected this differential binding (Table S7). For example, U6 snRNA, one of the most abundant RNAs bound by NP during infection, does not interact with NP outside of infection ( Fig 3E , top). vtRNAs and Y4 RNA were also selectively enriched in infection conditions (Fig S5A). Y1 (RNY1) was bound in all conditions with peak intensity increasing from induced to infection settings ( Fig 3E , middle). In contrast, 7SK RNA was bound similarly in induced and infected settings ( Fig 3E bottom). For both Y1 and 7SK, binding increased and appeared additive when NP was expressed by both infection and induction. Expression of the non-coding RNAs bound by NP remained largely unchanged across all conditions, eliminating the possibility that binding discrepancies are a function of changes in RNA abundance ( Fig 3F ). Altogether, >1400 peaks are differentially bound between induced and infected samples indicating that influenza virus infection reshapes the population of RNAs bound by NP (Table S6). Download figure Open in new tab Figure 3. NP RNA-binding is dynamically controlled by infection. (A) Expression of NP in tetNP-A549 cells via doxycycline induction, infection with FLUAV (MOI = 0.01. 24 h), or both. Proteins were detected by western blotting. PB2 served as a control for successful infection control. (B) NP CLIP was performed for the indicated conditions using a shared spike-in control. Frequency of human- and FLUAV-derived reads was determined for NP CLIP and size- matched input control libraries. (C) Principal coordinate analysis of spike-in- normalized NP CLIP and size-matched input control libraries. (D) Overlap of NP-binding peaks for each condition. (E) Normalized read coverage for NP-bound and size-matched input control RNAs. Data from independent biological replicates are shown as mean and s.d. using dark and light shades of the same color, respectively. CLIPper-identified peaks and gene tracks are shown. CPM, counts per million. Associated with Supplemental Tables 6-7. (F). Log2 CPM of select non-coding RNAs in the size-matched input control. (G) Immunofluorescence microscopy of tetNP-A549s stained for NP 24 h after infection (MOI = 0.01) or doxycycline induction. (H) Read coverage as in (E) over the MALAT1 gene body. The localization of NP is dynamically regulated during infection, beginning in the nucleus early in infection and shifting globally to the cytosol late in infection 45 . Similar patterns are observed when NP is expressed via transfection, although the timing is delayed relative to infection 46 . Immunofluorescence staining confirmed NP follows similar patterns in our cells, with NP globally distributed at the later stages of infection in our experiments while it remains enriched in the nucleus following induced expression ( Fig 3G ). To test whether the subcellular localization dictates the RNAs that are available and bound by NP, we performed CLIP-Seq using cytosolic and nuclear fractions from infected cells (Fig S5B). Differential binding revealed the NP-bound RNAs enriched during infection over mock correlate with those bound by cytoplasmic NP (Fig S5C). Conversely, MALAT1, an exclusively nuclear-localized lncRNA 47 , is preferentially bound by NP when it is expressed via induction ( Fig 3H ). These data suggest that the population of host RNAs bound by NP is regulated in part by the subcellular localization of NP, and that NP:RNA interactions may be dynamically regulated throughout the cycle of infection as NP localization changes or other infection-induced factors impact available RNAs. NP binds host ncRNAs that signal through RIG-I RIG-I and NP bound many of the same host transcripts and interacted with each other in an RNA-dependent manner ( Fig 2B , 4A, S5E). RNA binding sites for RIG-I and NP showed significant overlap, as demonstrated on 7SL2 RNA (RN7SL2), a component of the signal recognition complex ( Fig 4B ). Many of the shared RNAs are produced by Pol III, whose nascent transcripts frequently possess hallmarks of immunogenic RNAs sensed by RIG-I including dsRNA termini with a 5’ PPP, although the 5’ PPP is normally processed to a monophosphate to prevent sensing of host transcripts ( Fig 4C ). Dysregulated sensing of Pol III transcripts is associated with disease 48 . We therefore determined if NP binds immunogenic host RNAs. NP:RNA complexes were immunopurified from infected cells or cells where NP was expressed by transfection. The immunogenicity of RNAs extracted from these complexes was measured in interferon-stimulated response element (ISRE) reporter assays. These were performed by introducing RNA in human A549 lung cells stably encoding an ISRE reporter that we showed responds to IFNβ treatment ( Fig 4D ). NP-bound RNAs isolated from infected cells dramatically upregulated ISRE activity compared to background activity of RNA extracted from control immunoprecipitations ( Fig 4D ). Surprisingly, RNA bound by NP purified from transfected cells did not activate the ISRE ( Fig 4D ). There was significant overlap in the RNAs bound in infected and transfected cells ( Fig 3D ), but we cannot exclude compositional differences in viral or host RNAs that contribute to differences in immunogenicity. Download figure Open in new tab Figure 4. NP-bound non-coding RNAs signal through RIG-I. (A) Overlap of the union of RIG-I CLIP peaks identified in all conditions in in Fig 1 with NP CLIP peaks identified in infected cells in Fig 2E . (B) Read coverage on 7SL RNA of the 5’-mapped base in RIG-I (top) and NP (bottom) CLIP libraries. Coverage was normalized in each library to enable direct comparisons across samples. Data from independent biological replicates are shown as mean and s.d. using dark and light shades of the same color, respectively. CLIPper-identified peaks and gene tracks are shown. (C) Minimum free energy RNA secondary structures predictions from RNAFold for select non-coding RNAs. (D) RNA was isolated from RNA immunoprecipitations (RIPs) performed with the indicated antibodies in cell lysates where NP was expressed by infection (infect) or transfection (tx). ISRE reporter cells were transfected with the recovered RNAs and ISRE activation was measured relative to mock-treated cells. Total eukaryotic RNA or IFN-β were included as controls. Data normalized to an internal Renilla control and plotted relative to mock-treated cells. Red arrowhead = lack of activation by RNAs bound by NP in transfected cells. (E) Eluates of NP RNA-immunoprecipitations from FLUAV infected A549 cells (MOI = 0.02, 24h) were treated with an RNaseH-based depletion targeting influenza RNA or mock treated. Remaining RNAs were transfected into WT or RIG knockout ( DDX58 -/- ) A549 ISRE-reporter cells. ISRE-promoter induction was normalized to an internal Renilla control and shown relative to mock-treated conditions for each cell line. (F) WT, RIG knockout ( DDX58 -/- ) , or MAVS knockout ( MAVS -/- ) A549 ISRE-reporter cells were transfected with decreasing amounts of in vitro transcribed non-coding RNAs, mixed molecular weight poly IC, mock transfected, or treated with IFN-β. ISRE-promoter induction shown relative to mock-treated conditions for each cell line. (G) Poly IC or in vitro transcribed non-coding RNAs were treated with calf-intestinal phosphatase (CIP) or mock treated and transfected into ISRE-reporter cells. Cells were assayed for ISRE-induction and normalized to mock-transfected cells. * P < 0.05, *** P < 0.001, **** P < 0.0001 with one-way ANOVA and Dunnet’s post-hoc correction for (D) and a two-way ANOVA with Tukey’s multiple comparison test in (E-G). NP binds the viral genome and other replication products that are known to activate innate immune responses, explaining some of the observed activation 15 – 19 . To determine if host RNAs also contributed to innate immune activation, we developed an RNaseH-based depletion strategy that selectively degrades viral RNAs and eliminates their immunogenicity (Fig S6A-B). NP was again purified from infected cells and the associated RNAs were mock- or RNaseH-treated prior to performing ISRE activity assays. NP-bound RNAs still activated the ISRE even after removing viral RNAs, indicating that some of the immunogenic RNAs bound by NP are derived from the host cell. ISRE activity assays were repeated in A549 DDX58 -/- cells to determine if RIG-I senses NP-bound RNAs. Innate immune activation was ablated in the absence of RIG-I for all conditions ( Fig 4E ). We tested the immunogenicity of individual RNAs by performing ISRE activity assays with pure RNAs created by in vitro transcription. U6, vtRNA1-1 and Y4 RNAs each activated the ISRE in a dose-dependent manner ( Fig 4F ). This activation was lost in cells lacking RIG-I. We additionally tested the role of MAVS, the adaptor that transmits activating signals from RIG-I to downstream effectors. ISRE activation was also lost in MAVS -/- cells, further implicating RIG-I and its canonical activation pathway in sensing self RNAs. Similar results were obtained when performing activity assays based on the IFNβ promoter (Fig S6C). Y RNA and vault RNAs have structured termini with potentially exposed 5’ PPP ( Fig 4C ). The importance of the 5’ PPP was measured to further establish the role of RIG-I. ISRE activity assays were performed with RNAs treated with calf intestinal phosphatase (CIP) to remove the 5’ PPP. Whereas control samples were highly immunogenic, removal of the 5’ PPP eliminated activation of both the ISRE and IFNβ promoter ( Fig 4G ). Thus, NP binds immunogenic host RNAs that signal via RIG-I to activate innate immunity and a type I interferon response. NP counters the antiviral activity of immunogenic host RNA NP binds a complex mixtures of host RNAs ( Fig 2E , S4C). To rigorously test the immunogenicity of specific RNAs isolated from biologically relevant settings, RNAs were purified from infected cells with antisense oligo (ASO) 24 . This not only purifies specific RNAs, but it retains the molecular features inherent to these RNA during infection. ASO capture was highly specific for the target RNA, but not other RNAs ( Fig 5A ). The amount of RNA captured was indistinguishable between infected and mock-treated cells, with the exception of PB2 RNA that is only present in infected cells. Similar amounts of highly purified RNAs were then introduced into our ISRE reporter cells. Host U6, Y4 and vtRNA1-1 purified from infected cells potently stimulated the ISRE reporter and one driven by the IFNβ promoter ( Fig 5B ). As expected, genomic PB2 RNA also activated the ISRE and IFNβ promoters, whereas non-immunogenic snoRNAs or the scrambled control capture did not. Importantly, the same RNAs captured from mock-infected cells did not activate innate immune sensing, further supporting the hypothesis that infection-specific events change the immunogenicity of select host RNAs. Download figure Open in new tab Figure 5: NP counters the antiviral activity of immunogenic host non-coding RNA (A) Antisense oligos (ASO) were used to purify the indicated RNAs from infected or mock treated cells. Heatmap of qRT-PCR results showing highly specific enrichment of desired RNAs. Enrichment is shown relative to RNA levels in the input from infected cells. (B) A549 ISRE- or IFN-β-reporter cell lines were transfected with ASO-purified RNAs from mock-treated or infected cells described in (A). Induction is relative to mock-transfected cells. There were no significant differences when RNAs were purified from uninfected cells. (C) 5’ PPP RNAs were marked by vaccinia capping enzyme, purified, and quantified by RT-qPCR. RNAs from influenza virus-infected A549 cells were compared to mock-treated cells. (D) NP or the NLS-mutant NP K7A/R8A was expressed in 293T ISRE-firefly reporter cells for 24 h prior to transfection with Y4 RNA or mock-transfection. ISRE induction was measured relative to an internal Renilla luciferase control. (E) WT or RIG-I knockout ( DDX58 -/- ) A549 cells were transfected with the decreasing concentrations of non-coding RNA, poly IC, or mock transfected. Cells were subsequently infected with an A/WSN/33-based reporter virus. Supernatants were recovered 24 hpi and titered on MDCK cells. (F) A model for viral antagonism of self sensing. Under basal conditions, RIG-I rapidly samples and recycles off of non-immunogenic host RNAs maintaining a pool of RIG-I that surveils the entire RNA landscape. During infection, immunogenic features on host RNAs promote RIG-I oligomerization and activation of innate immune pathways that suppress viral infection. Influenza virus NP counters this by binding host RNAs, interfering with RIG-I activation or recycling to promote viral replication. * P<0.05, ** P < 0.01 and **** P < 0.0001 as determined by one-way ANOVA (C) or two-way ANOVA (B, D, E) with post hoc Šídák’s multiple comparisons test. Comparison were made to mock cells in each condition. ns = not significant. Given the importance of the 5’ PPP in activating RIG-I ( Fig 4G ), we measured changes in 5’ end status during infection. We exploited the fact that vaccinia capping enzyme exclusively modifies RNAs with 5’ PP and PPP moieties to mark and purify those species 49 . The change in 5’PP/PPP species for specific RNAs was then quantified by RT-qPCR. Viral infection caused a significant increase in the percentage of vtRNA1-1, Y4 RNA, and 7SK RNA that retained a 5’ PPP relative to mock cells ( Fig 5C ). The smaller change for Y4 compared to vtRNA1-1 and 7SK results from a higher baseline level of 5’ PPP in uninfected cells. This change in the frequency of 5’ PPP likely contributes to the differential immunogenicity of host RNAs in infected cells. NP binds to immunogenic RNAs that are sensed by RIG-I, raising the possibility that NP may interfere with proper monitoring of the RNA pool. We sought to directly test whether NP interferes with RIG-I sensing. This is not possible in infected cells, as NP and its RNA binding capacity are essential for viral replication and any manipulation will have confounding effects. Instead, we performed ISRE activity assays in the presence of NP. We expressed WT NP that localizes to the nucleus mirroring early stages of infection. We also expressed an NP variant K7A/R8A that localizes to the cytoplasm, the same subcellular compartment as RIG-I, mimicking late stages of infection 45 . WT and NP K7A/R8A displayed the expected subcellular localization (Fig S6D). Pre- expressing WT NP had no effect on the sensing of immunogenic Y4 RNA as ISRE activation was similar to control cells without NP ( Fig 5D ). However, NP K7A/R8A completely abolished sensing with ISRE activation remaining at the level of mock-treated cells. Thus, cytoplasmic NP prevented the proper recognition and sensing of immunogenic self RNAs. Sensing self RNAs activates innate immunity. We tested whether this helps establish an antiviral state. Viral replication was measured in A549 lung cells previously transfected with self RNAs or poly IC as a control. Viral replication decreased sharply in cells transfected with self RNA compared to intreated cells ( Fig 5E ). The magnitude of decrease was dependent on the amount of self RNA the cells received. Infections were repeated in cells lacking RIG-I. Not only did viral replication increase in the absence of RIG-I, self RNAs had no impact on viral replication ( Fig 5E ). This contrasts with high levels of poly IC that still suppressed replication, indicating that other innate sensing pathways remained active in these cells, suggesting that self sensing of Pol III transcripts is exclusive to the RIG-I pathway. Together, these data show that self RNAs become immunogenic during infection and contribute to innate immune activation, a process thwarted by NP. D iscussion RIG-I patrols the cytoplasm monitoring the RNA landscape for the presence of immunogenic RNAs. This process requires rapid discrimination between viral and host RNAs. Our newly developed quantitative approaches revealed that the majority of RNAs bound by RIG-I are host ncRNAs, even during infection. These host RNAs are benign under basal conditions, but become immunogenic and signal through RIG-I during infection to amplify innate immune responses that suppress influenza virus replication. While self sensing by RIG-I is frequently associated with interferonopathies and chronic inflammatory diseases 4 , it serves a protective function during influenza virus infection. This antiviral process is countered by influenza virus NP, which binds many of these same RNAs and disrupts RIG-I activation. Together, these data show that self sensing is a key component of the antiviral response to influenza virus and identify a viral countermeasure that directly disrupts sensing of host ncRNAs. RIG-I surveils a vast excess of RNAs as it seeks the rare specimen that is immunogenic. The baseline binding we identified in uninfected cells represents RIG-I actively sampling and recycling. Our quantitative approaches revealed that RIG-I does not preferentially bind viral RNAs, fitting well with kinetic models where RIG-I discriminates immunogenicity not at the association stage, but through altered dissociation rates 12 , 20 , 50 . This allows for rapid recognition of immunogenic RNAs when they are introduced into the system, whether from the virus or the host. For example, host Y4, U6, and vtRNA1-1 all activated RIG-I sensing, but only when purified from infected cells ( Fig 5 ). This suggests that the immunogenicity of small ncRNAs is differentially regulated during infection. Almost all of the host RNAs bound by RIG-I are non-coding RNAs transcribed by RNA Pol III, whose products initially contain a 5’ PPP 51 . Previous work identified the dual-specificity phosphatase 11 (DUSP11) as a regulator of self sensing where it prunes phosphates off of 7SL, RNY4, and vtRNA1-1 to prevent activation of RIG-I 24 , 27 , 52 . Our data show that 5’ end status also changes during FLUAV infection to enable self sensing, implicating retention of 5’ PPP on host RNAs as a common strategy to amplify innate immune activity across divergent viral infections ( Fig 5F ). This reinforces an emerging theme where cells deploy host RNA or DNA during infection to strategically activate self sensing 23 – 26 , 52 . RNA viruses frequently encode proteins that disable RLRs 53 , 54 . This inhibition can be mediated by direct interaction with RLRs, disruption of co-factors that are required for RLR activation, interception of signaling cascades downstream of RLRs, or by directly binding viral RNAs to prevent sensing 54 . The FLUAV protein NS1 is a primary RIG-I antagonist that suppresses antiviral responses by binding viral dsRNA and targeting cellular co-factors needed for RIG-I activation 55 – 57 . NP is also thought to prevent sensing of viral genomic material by encapsidating viral RNAs in RNPs 16 . Our data demonstrate a previously unappreciated role for NP and identify a new strategy to specifically disrupt self sensing by binding host ncRNAs. There are several possible mechanisms by which NP could disrupt RIG-I activation. Given its high expression and non-specific RNA-binding properties 39 , 44 , NP may simply bind and sequester host ncRNAs from RIG-I. NP also melts dsRNA 38 , potentially eliminating key features in the RNAs needed for RIG-I recognition. The outcome of both of these would be lower levels of host RNAs bound by RIG-I. However, this is not seen as the abundance of host ncRNAs on RIG-I is indistinguishable between mock and infected conditions (Fig S2B). Instead, we speculate that NP may retard RIG-I recycling ( Fig 5F ). NP and RIG-I interact in an RNA-dependent manner binding the same RNAs in the same regions ( Fig 2B , 4B). If NP slows RIG-I recycling, whether on benign or immunogenic RNAs, this would rapidly deplete the pool of free RIG-I and prevent formation of activated oligomers, even if RIG-I ultimately bound immunogenic RNAs. This possibility would also mean that RIG-I antagonism is not restricted to interactions on the small number of host RNAs that become immunogenic, but any RNA occupied by both NP and RIG-I. There is precedent for RIG-I interacting with viral proteins during translocation on dsRNA 58 . Whether this results in longer retention times on non-immunogenic RNAs remains to be determined. All negative-strand RNA viruses, and some positive-strand RNA viruses like coronavirus, express NP or an N protein that oligomerizes on viral RNA in a sequence agnostic fashion 33 , 59 , 60 . NP/N is expressed at high levels to facilitate genome replication. These levels far exceed the quantity present in RNPs and thus hint at the existence of additional roles for nucleoproteins 61 – 63 . The shared features of NP/N proteins suggest that the properties we defined here for FLUAV NP may be broadly relevant to a large swath of RNA viruses. Sequence-independent associations between NP/N and host RNAs may provide a universal and remarkably simple strategy to disrupt self sensing by RIG-that tampers innate immune responses to promote replication. M aterials and M ethods Cells Human lung alveolar epithelial (A549) cells (CCL-185), Madin-Darby canine kidney (MDCK) cells (CCL-34), baby hamster kidney-21 (BHK-21) cells (CCL-10), and human embryonic 293T (HEK293T) cells (CRL-3216) were purchased from the American Type Culture Collection (ATCC) and maintained in Dulbecco’s modified Eagle’s medium (DMEM) and 10% fetal bovine serum (FBS) at 37°C and 5% CO2. Drosophila Schneider 2 (S2) cells were maintained in Schneider’s Drosophila medium supplemented with 10% FBS and 1% antibiotic/antimycotic and grown at 25°C without CO2. A549 wildtype, DDX58 -/- , and MAVS -/- A549s were a gift from C. McCormick (Dalhousie University). HEK293 cells stably expressing N-terminally STrEP-tagged RIG-I or mCherry were previously described 64 . Cells were regularly verified to be mycoplasma negative using MycoAlert (Lonza). Virus Influenza virus A/WSN/33 and A/WSN/33-based PA-2A-Nanoluc reporter virus were grown and titered as described befored 65 – 67 . In brief, viral stocks were grown in MDCK cells and titered on MDCK cells with an Avicel overlay. Vesicular stomatitis Indiana virus encoding GFP was grown and titered by plaque assay with agarose overlay using BHK-21 cells. Plasmids and in vitro transcribed RNAs WT and mutant NP (A/WSN/33) expression plasmids were generated by PCR. Doxycycline-inducible NP plasmids were generated by cloning NP into pSBtet-BP (Addgene 60496) to create pSBtet-BP-NP. The constitutively expressed RIG-I plasmid was created by cloning RIG-I with a 2x FLAG tag into pSBtet-BP to replace BFP creating pSB-RIGIP. The copper-inducible Drosophila plasmids pMT-puro-NP and pMT-puro-RIG- I were generated by cloning NP (A/WSN/33) and RIG-I-2xFLAG into pMT-puro (Addgene 17923). The ISRE- and IFN-β-response element plasmids pSB-BB-ISRE-NLuc2AG and pSB-BB-IFNβ-NLuc2AG encode a NanoLuc- 2A-GFP fusion protein driven by an ISRE promoter or IFN-β promoter, respectively, on the pSBbi-BB plasmid backbone (Addgene 60521). The ISRE-response element plasmid pLX304-ISRE-FFLuc was generated by cloning the ISRE-FFLuc cassette into pLX304 (Addgene 25890). Non-coding RNAs were reverse-transcribed from total RNA with gene-specific primers and cloned via Gibson assembly into a plasmid for maintenance. These plasmids were used in PCRs to create templates for T7 RNA polymerase transcription. Non-coding RNA genes were amplified with gene-specific primers that appended a T7 RNA polymerase promoter on the 5’ end. The product was purified and 2 µg DNA template was in vitro transcribed in a 100 μl reaction with 40 mM Tris pH 7.9, 6 mM MgCl2, 10 mM DTT, 2 mM spermidine, 2mM rNTP, 1 μl RNasin(+) (Promega N2611), and 3 μl Hi-T7 RNA polymerase mix (NEB M0658S) for 2h at 37°C. RQ1 DNaseI (Promega M6101) was added and the reaction was incubated for 30 minutes at 37°C. RNA was purified via phenol-chloroform or TRIzol extraction and the resultant product checked for purity and size via TBE denaturing urea polyacrylamide gel electrophoresis and stained with SYBR gold (Invitrogen). The following RNAs were produced: RNY4: ggcugguccgaugguaguggguuaucagaacuuauuaacauuagugucacuaaaguugguauacaaccccccacugcuaaauuugacuggcuuuuu RNU6: gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagaagauuagcauggccccugcgcaaggaugacacgcaaauucgugaagcguuccauauuuuu vtRNA1-1: ggcuggcuuuagcucagcgguuacuucgacaguucuuuaauugaaacaagcaaccugucuggguuguucgagacccgcgggcgcucuccaguccuuuuu To remove the 5’-triphosphate from RNAs, 2 µg of in vitro transcribed RNAs were mock-incubated or treated with calf-intestinal phosphatase. RNA was purified via RNA clean-and-concentrator kits (Zymo Research R1014). Generation of transduced cell lines Vesicular stomatitis Indiana virus (VSIV) glycoprotein G-pseudotyped lentivirus was generated by transfecting 293T cells with the plasmids psPAX2 and pMD2.G, along with pLX304-ISRE-FFLuc. The resultant lentivirus was inoculated on A549 cells to create firefly luciferase ISRE reporter cells. Cells were allowed to recover and selected with 6 µg/mL blasticidin. NanoLuc ISRE- and IFN-β reporter cells were generated with the Sleeping Beauty transposon system by transfecting A549 cells with equal amounts of pSB-ISRE-NLuc2AGFP or pSB- IFNβ-NLuc2AGFP and pCMV(CAT)T7-SB100, a plasmid expressing the Sleeping Beauty transposase (Addgene 34879) 68 . Cells were allowed to recover and selected in 6 µg/mL blasticidin. Doxycycline-inducible NP A549s and stable RIG-I expressing A549s were generated similarly, except pSBtet-BP-NP and pSB-RIG-I were transfected with the transposase and selected in 0.5 µg/mL puromycin. Copper inducible NP and RIG-I S2 cells were generated by transfection of pMT-puro-NP and pMT-puro-RIG-I with Transit-X2 (Mirus) and selection with 2 µg/mL puromycin for 2-4 weeks. ISRE and IFN-β reporter assays Cells were transfected with in vitro transcribed RNA, poly IC, or mock transfected using Transit-X2 (Mirus Bio). Cells were incubated for 24h, lysed in Renilla Luciferase Assay buffer (Promega), and assayed for NanoLuc, firefly luciferase, and/or Renilla luciferase depending on the reporter system used. For NP/RNA co-transfection assays, 293Ts were plated in 96-well plates and transfected using Transit-X2 (Mirus Bio) with 90 ng control plasmid, pEF1-NP-3xFLAG, pEF1-NP-K7AR8A-3xFLAG, and 10 ng pRL-SV40 and incubated for 24 hours. Immunogenic RNA was introduced at 25 ng/well via transfection with Transit-X2 (Mirus Bio). Cells were incubated for 24 h and assayed for firefly and Renilla luciferase expression. Data were normalized to the Renilla control. NP-RNA immunoprecipitations A549 cells were infected with A/WSN/33 (MOI = 0.02, 24h) and lysed in co-immunoprecipitation buffer (50 mM Tris pH 7,5, 150 mM NAaCl, 0.5% NP-40) supplemented with 20 U/mL RNasin (Promega) and protease inhibitor cocktail. Lysates were clarified by centrifugation and pre-cleared with protein-A agarose (Santa Cruz) for 1h. Before immunoprecipitation, RNA was extracted from 20 µL of input lysate with TRIzol. Remaining lysates were incubated with the mouse monoclonal antibodies H16-L10 directed against NP (BioXCell BE0159) or B-2 directed against GFP (Santa Cruz sc9996). Protein-RNA complexes were captured with protein A agarose for 1 h and washed 5-6 times with co-immunoprecipitation buffer. RNA was eluted off of the resin with TRIzol and resuspended in a volume of 10 µL. Equal volumes of RNA were utilized for qRT- PCR or sized on an Agilent 2100 Bioanalyzer RNA pico chip. For qRT-PCR, equivalent volumes of RNA were reverse-transcribed with random-hexamer primed MMLV-RT. The resulting cDNA was diluted 1:10 and used for qPCR with the iTaq Universal SYBR Green Supermix (Bio- rad 1725121) on a Step One Plus RT-PCR instrument (Applied Biosystems) using forward and reverse primers described below. Fold enrichment relative to the input was calculated with the ΔCt method. qPCR primers indicated below. RNU6_F: GCTTCGGCAGCACATATACTAAAAT; RNU6_R: CGCTTCACGAATTTGCGTGTCAT RNY4_F: GTCCGATGGTAGTGGGTTATC; RNY4_R: AAAGCCAGTCAAATTTAGCAGT vtRNA1-1_F: CGACAGTTCTTTAATTGAAACAAGC; vtRNA1-1_R: AAGGACTGGAGAGCGCCC FLUAV_NA_F: ACATCACTTTGCCGGTATCAGGGT; FLUAV_NA_R: ACCATAATGACCGATGGCCCAAGT RNaseH vRNA depletion assay RnaseH depletion of target RNAs was performed essentially as described, with slight modifications 69 . Briefly, 100 ng of in vitro transcribed influenza RNAs or equal volumes of RNAs from NP RNA-immunoprecipitations were combined with 0.5 mM dNTPs, 1.25 µM probe mixture containing gene-specific and universal primers targeting the conserved termini of the flu genome (listed below), and water to 10 µL. Samples were heated at 65°C for 5 minutes, and snap-cooled on ice to anneal the probe mixtures to the RNA. A 10 µL mixture containing 2x First Strand Buffer, 20 U Rnasin(+), 10mM DTT, and 0.5 µL SuperScript III reverse transcriptase (ThermoFisher Scientific 18080044) was added to the RNA and incubated at room temperature for 5 minutes, 42°C for 30 minutes, and 50°C for 30 minutes. To digest DNA:RNA hybrid products, 2.5 U RnaseH (ThermoFisher Scientific EN0202) was added to the reverse transcription reaction with 2 μl First Strand Buffer in a 10 µL volume and allowed to incubate at 37°C for 30 minutes. This reaction was mixed with 2 µL RQ1 DnaseI (Promega M6101) in buffer and allowed to incubate at 37°C for 15 minutes. The reaction was terminated by addition of buffer RLT (Qiagen) and purified with Dynabeads MyOne-silane beads (ThermoFisher Scientific 37002D) and eluted in a 5 µL volume of water. Successful depletion of RNA was confirmed via TBE denaturing urea polyacrylamide gel electrophoresis and staining with SYBR-gold. Primers used were: NS_minu_483-464: CTTCGGTGAAGGCCCTTAGT; NS_plus_440-459: TGACCGGCTGGAGACTCTAA M_minu_514-495: CCTATGAGACCGATGCTGGG; M_plus_462-481: TGGTATGCGCAACCTGTGAA NA_minu_1006-987: TCCGTTTGCTCCATCAGCAG; NA_minu_518-499: CACTTGCTGACCAAGCAACC NA_plus_926-945: AGTGGGGTTTTCGGTGACAA; NA_plus_468-487: CTCCGTCCCCGTACAATTCA NP_minu_1041-1022: TGCCATCCACACCAGTTGAC; NP_minu_528-509: GGGATCCATTCCTGTGCGAA NP_plus_1091-1110: GGACGAAAGTGGTCCCAAGA; NP_plus_536-555: GCTCACTGATGCAGGGTTCA HA_minu_1128-1167: TCATTCTGATGATGATAACC; HA_minu_642-623: GCTCATCACTGCTAGACGGG HA_plus_530-549: GCTGACGAAGAAGGGGGATT; HA_plus_1153-1172: GATCAGGCTATGCAGCGGAT PA_minu_516-497: ATCGAGAGTGTAGTCGGCCT; PA_minu_1152-1133: TGGTGCCATGTTCTCACCAA PA_minu_1697-1678: GACACATGGCCTATGGCACT; PA_plus_1758-1777: GATGGAAATGAGGCGTTGCC PA_plus_1225-1244: AGGTCGCTTGCAAGTTGGAT; PA_plus_660-679: CAAGCTTGCCGACCAAAGTC PB1_minu_415-396: AGTCATAGGTCTGTCGGCCT; PB1_minu_848-829: CCTCCAACTGGCAATCCTGA PB1_minu_1662-1643: CATTTGAGCGGTTGCTGGAC; PB1_plus_1562-1581: GGGTGTCTGGGATCAACGAG PB1_plus_829-848: TCAGGATTGCCAGTTGGAGG; PB1_plus_375-394: ACGAGTGGACAAGCTGACAC PB2_minu_2097-2078: AACTGCGGACTCAACTCCAG; PB2_minu_1217-1198: GCTTCGGCAATCGACTGTTC PB2_minu_676-657: ATCTCGTTTTGCGGACCAGT; PB2_plus_1509-1528: AGTGGTGAGCATTGACCGTT PB2_plus_1053-1072: AGAGGTGCTTACGGGCAATC; PB2_plus_533-552: CTAACGAAGTGGGAGCCAGG uni13: AGTAGAAACAAGG; uni12deg: AGCRAAAGCAGG Generation of biotin-labeled oligos Enzymatic synthesis of biotin-labeled capture probes was performed essentially as described 70 . Briefly, RNA complementary to the designed probes was generated by in vitro transcription reactions with T7 RNA polymerase using templates created by PCR as described above. Primers were: capture_RNU6_F: TAATACGACTCACTATAGGgcccctgcgcaaggatga capture_RNU6_R: ACCAGATCGTTCGAGTCGgaacgcttcacgaatttgcg capture_RNY4_F: TAATACGACTCACTATAGGgtcactaaagttggtatacaa capture_RNY4_R: ACCAGATCGTTCGAGTCgaaGcaaatttagcagtgg capture_vtRNA1-1_F: TAATACGACTCACTATAGGGAAACAAGCAACCTGTCTGGGT capture_vtRNA1-1_R: ACCAGATCGTTCGAGTCGGCCCGCGGGTCTCGAACAA capture_PB2_F: TAATACGACTCACTATAGGGTCTGGCTGTCAGTAAGTATGCT capture_PB2_R: ACCAGATCGTTCGAGTCGAACGGAAACGGAACTCTAGC capture_SNORA73B_F: TAATACGACTCACTATAGGgcttcccagagtcctgtgga capture_SNORA73B_R: ACCAGATCGTTCGAGTCGgtttgtctccccagtcattgt capture_SNORA65_F: TAATACGACTCACTATAGGGTTGTTCTTCATGTGGATGACTC capture_SNORA65_R: ACCAGATCGTTCGAGTCGCCCATGCTTTCGGCACAG The resultant RNA was purified by phenol-chloroform extraction and 10 µg was used in a reverse transcription reaction with MMLV and a biotin-tagged reverse transcription primer: biotin-ACCAGATCGTTCGAGTCG. The reaction was terminated after 3 h by hydrolysis of the RNA via addition of 1N NaOH for 15 minutes at 72°C, neutralization of the NaOH by addition of 1N HCl, and purification with a column-based cleanup. The resulting cDNA was checked for size and purity via TBE denaturing urea polyacrylamide gel electrophoresis with SYBR- gold staining and resulted in the probe sequences: RNU6: biotin-ACCAGATCGTTCGAGTCGgaacgcttcacgaatttgcgtgtcatccttgcgcagggg RNY4: biotin-ACCAGATCGTTCGAGTCGAAgcaaatttagcagtggggggttgtataccaactttagtgac vtRNA1-1: biotin-ACCAGATCGTTCGAGTCGgcccgcgggtctcgaacaacccagacaggttgcttgtttc PB2: biotin-ACCAGATCGTTCGAGTCGaacggaaacggaactctagcatacttactgacagccagac SNORA73B: biotin-ACCAGATCGTTCGAGTCGgtttgtctccccagtcattgtccacaggactctgggaagc SNORA65: biotin-ACCAGATCGTTCGAGTCGcccatgctttcggcacagagtcatccacatgaagaacaac Anti-sense oligonucleotide RNA capture RNA samples for anti-sense oligonucleotide captures (ASOs) were generated by mock-infecting or infecting A549s with A/WSN/33 (MOI = 0.02, 24 h) and extracting total RNA with TRIzol. Ten µg total RNA was mixed with 100 ng DNA probe in binding buffer (10 mM HEPES pH 7.5, 500 mM LiCl, 1 mM EDTA) and incubated at 65°C for 5 m, followed by binding for 15 m at room temperature. Five µL of Dynabead Streptavidin C1 beads (ThermoFisher Scientific 65002) were mixed with oligonucleotide-bound RNAs and incubated with shaking at 25°C for 30 minutes. The beads were magnetically separated three times and washed with low-salt wash buffer (20 mM Tris pH 7.5, 200 mM LiCl, 1 mM EDTA), dried, and resuspended in elution buffer (20 mM Tris pH7.5, 1 mM EDTA). Elution was carried out by heating at 95°C for 1.5 minutes and quickly separating the beads from the supernatant. eCLIP-sequencing Unless noted, CLIP-Seq experiments were performed on two independent biological replicates. The NP enhanced CLIP (eCLIP) protocol was previously adapted from published work and performed as described 71 – 73 . For CLIP-Seq without a spike-in control in Figure 2 , 10 7 A549 cells were infected with A/WSN/33 (MOI = 0.02, 24 h) and washed with PBS immediately before UV- crosslinking with 400 mJ/cm 2 , then 200 mJ/cm 2 254 nM UV light after which cells were scraped, collected, and flash frozen. Cells were lysed in CLIP lysis buffer (50 mM HEPES pH 7.5, 150 mM KCl, 2 mM EDTA, 0.5% v/v NP-40, 1 mM DTT, 0.5% DOC w/v, and EDTA-free protease inhibitor). For subcellular fractionation on NP CLIP samples, cells were infected with A/WSN/33 (MOI = 0.01, 24 h), collected on ice, processed via hypotonic lysis to obtain cytoplasmic extracts (n=1), and followed by a high salt extraction to obtain nuclear extracts (n=1). Fraction purity was verified by blotting for tubulin (cytoplasmic) or lamin (nuclear). Lysates were digested with 0.1 U/µL RNaseT1 (ThermoFisher Scientific EN0542) for 10 minutes at room temperature. Size-matched inputs were taken and NP was immunopurified by adding Dynabeads protein A (Invitrogen 10002D) pre-bound with monoclonal NP H16-L10 (BioXCell BE0159) to the lysates and incubated for 3 h at 4°C. Beads were washed twice in lysis buffer, twice in high-salt buffer (50 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA, 0.1% SDS, 0.5% DOC, 1% NP-40) and twice in lysis buffer followed by labeling the RNA with ψ32P-ATP. Labeled complexes were separated via SDS-PAGE, transferred to a nitrocellulose membrane, visualized by phosphorimaging, NP-bound reagents were cut from the membrane, and complexes were digested off the membrane with proteinase K. RNA was captured by column purification (Zymo Research R1014) and processed for ligation with a pre-adenylated DNA adapter (New England Biolabs S1315) to generate eCLIP libraries as described 72 . Spike-in controls were generated in S2 cells. 6x10 7 copper-inducible NP or RIG-I S2 cells were plated and treated with 500 µM CuCl2 for 48 h. Cells were collected, cross-linked, and lysed before digestion with 0.05 U/uL RNaseI (ThermoFisher Scientific EN0542) for 10 minutes at room temperature. Lysates were aliquoted and flash frozen. A549 eCLIP libraries were prepared with a spike-in control. For A549-tetNP cells, 10 7 cells were either treated with 2.5 µg/mL doxycycline, infected with A/WSN/33 (MOI = 0.01, 24 h), or both infected and treated. For A549- RIG-I cells, 10 7 cells were infected with A/WSN/33 (MOI = 0.01, 24 h), infected with VSV-GFP (MOI = 0.001, 24 h), or mock-infected. In all cases, cells were washed with cold PBS, cross-linked, and flash frozen. Lysates were processed as described above with the following exceptions. Lysates were treated with 0.05 U/uL RNaseI (Ambion) for 10 minutes at room temperature, quenched by transfer to ice, and a shared spike-in control was added by mixing each sample with the same amount of Drosophila lysate at ∼1:1 A260 OD ratio. Lysates were immunoprecipitated with monoclonal NP H16-L10 (BioXCell BE0159) or monoclonal M2 (Sigma F1804) bound to protein A dynabeads, dependent on the target RNA-binding protein. Beads were washed twice with lysis buffer, twice with high salt buffer, and twice with lysis buffer before separation via SDS-PAGE and transfer to a nitrocellulose membrane. RNA samples were processed as above, except samples were ligated with the pre- adenylated DNA linker: AppAGATCGGAAGAGCACACGTCTG-C3 (IDT) and reverse transcribed with the following indexed primers. 1: NNaaccNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 2: NNacaaNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 3: NNattgNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 4: NNaggtNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 5: NNcgccNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 6: NNccggNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 7: NNctaaNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 8: NNcattNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 9: NNgccaNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 10: NNgaccNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 11: NNggttNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 12: NNgtggNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 13: NNtccgNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 14: NNtgccNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 15: NntattNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC 16: NNttaaNNNNNAGATCGGAAGAGCGTCGTGgatcCAGACGTGTGCTCTTC Resulting cDNAs were circularized and linearized, followed by amplification with the following primers and indexing with unique dual indices (IDT). Read_1: ACACTCTTTCCCTACACGACGCTCTTCCGATCT Read_2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT Libraries were processed following the workflow in Figure S1 mapping. Briefly, each library was pooled and sequenced on an Illumina HiSeq4000 ( Figure 2 , Novogene) or Illumina NovaSeq6000 ( Figures 1 and 3 , UW- Madison Biotechnology Center). Summary statistics and accession numbers are in Supplementary Table 8. Data quality control filtering was done with FastQC v0.11.5, de-multiplexed, adapters were trimmed with BBMAP v37.56, and sequences were aligned using HISAT2 v2.2.1 to hg38/FLUAV for NP eCLIP or a custom hg38/dm6/WSN/VSV genome for spike-in normalized NP and RIG-I eCLIP or Bowtie v2.4.5 to map repetitive elements 74 – 76 . Trinity was used for RNA-seq de novo assembly 77 . PCR duplicates were removed by collapsing reads based on UMIs to yield a unique number of RNAs mapping to each position. The results were used as input for CLIPPER 2.0.1 to identify CLIP peaks statistically enriched over the size-matched input controls 78 . A single size-matched input control was used for analysis of NP CLIP from the doxycycline-induced infected cells and RIG-I CLIP from VSV-infected cells. These samples were pseudoreplicated by randomly splitting reads into two pseudoreplicates for all parts of the workflow that are insensitive to the number of replicates. Data were analyzed with Irreproducible Discovery Rate (IDR) 2.0.03 to measure peak reproducibility across replicates. Bedtools v2.26.0 was used for genomic data manipulation and edgeR was used for comparing across libraries 79 , 80 . Custom scripts and workflows are available at: https://github.com/mehlelab/ . Multicycle viral growth Prior to infection, cells were transfected with immunostimulatory RNAs as described above. Viral infections were performed with a A/WSN/33-based reporter virus expressing NanoLuc as self-cleaving polyprotein with PA. Virus was diluted in viral growth medium (DMEM, 0.3% bovine serum albumin, 25 mM HEPES, 1x penicillin- streptomycin, and 0.25 µg/mL TPCK-treated trypsin) at a multiplicity of infection of 0.05 66 , 67 . Infections were allowed to progress for 24 hours at which point the supernatants were harvested and titered by inoculation of MDCK cells. Titers were measured 16 h later by lysing cells in Renilla Luciferase Assay buffer and assaying for NanoLuc expression 81 . Immunofluorescence tetNP-A549 cells were plated in an 8-well glass bottomed slide (Ibidi) and treated with doxycycline or inoculated with A/WSN/33. Cells were allowed to incubate for 24h, washed in PBS, and crosslinked with 4% paraformaldehyde in PBS. Crosslinked cells were permeabilized with 0.2% Triton-100 in PBS, blocked in 50 mM NH4Cl with 4% BSA, and incubated for 1h with 1:1000 dilution anti-RNP (BEI Resources NR-3133). After washing, cells were incubated with 1:1000 donkey anti-goat alexa 568 (ThermoFisher Scientific A11057) and imaged with an EVOS cell imaging system (Thermo Fisher Scientific). Cappable-Seq capture of 5’ PPP RNAs 5’ PPP RNAs were selectively labeled with biotinylated cap structure to enable rigorous purification following the Cappable-seq approach 49 . Briefly, RNA was purified from mock or FLUAV-infected A549 cells, reacted with vaccinia capping enzyme (NEB M2080) in the presence of 3’-Desthiobiotin-GTP (NEB N0761), and column purified to fully remove excess 3’-Desthiobiotin-GTP (Zymo Research R1013). RNAs were fragmented by incubation at 95 °C for 2.5 m in the presence of 2.5 mM MgCl2. Products were buffer exchanged with AMPure beads (Beckman Coulter A63880) into low TE buffer (10 mM Tris pH 8, 0.1 mM EDTA), captured on hydrophilic streptavidin magnetic beads (NEB S1421S), washed twice in 10 mM Tris pH 7.5, 500 mM NaCl, 1 mM EDTA and twice in 10 mM Tris-HCl pH 7.5, 50 mM NaCl, 1 mM EDTA. RNAs were eluted by incubating for 20 m at room temperature in 10 mM Tris pH 7.5, 50 mM NaCl, 1 mM EDTA and 1 mM biotin. Eluates were buffer exchanged with AMPure beads into low TE. The abundance of specific RNAs in the input and purified fractions was measured by RT-qPCR using primers described above. Fold change in the percent recovery for infected cells versus conditions was calculated. Western-blotting Cells were lysed in co-immunoprecipitation buffer supplemented with 0.5% w/v sodium deoxycholate and protease inhibitor cocktail and clarified by centrifugation. Clarified lysates were separated via polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes for blotting. Membranes were blocked and probed with antibodies diluted at the following concentrations: anti-RNP (1:1000, BEI Resources NR-3133), anti-tubulin (1:3000, Sigma T6199), anti-β-actin (1:3000, Proteintech 66009-1-Ig), anti-lamin A/C (Cell Signaling Technologies 2032), or M2 anti-FLAG (1:1000, Sigma A8592). Membranes were imaged on a LiCOR Odyssey Fc with secondary antibodies conjugated to HRP or infrared dyes. Statistics and Reproducibility Unless noted in the figure legend, data represent means ± standard deviations (n=3 or more technical replicates) and are representative of at least three independent biological replicates. Boxplots represent the 25 th -75 th percentile and mean and whiskers are calculated by with the Tukey method. Statsmodels, Scipy, Prism and/or matplotlib were used for graphing and statistical analyses. Pairwise comparisons were made using a Student’s T test and multiple comparisons were made using a one-way ANOVA with the indicated post hoc test. Analyses used for CLIP are indicated in their respective methods. D ata A vailability Raw data are available in Table S9 and uncropped blots are available in Fig S7. Sequencing data have been deposited at BioProject PRJNA1213036, PRJNA1213052, PRJNA1213053. Sequencing statistics and accession numbers are summarized in Table S8. R esource A vailability Lead contact: Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Andrew Mehle ( amehle{at}wisc.edu ). Materials availability: All unique/stable reagents generated in this study are available upon request from the lead contact following completion of a materials transfer agreement. Data and code availability: Raw data are available in Table S9 and uncropped blots are available in Fig S7. Sequencing data have been deposited as BioProject PRJNA1213036, PRJNA1213052, PRJNA1213053. Sequencing statistics and accession numbers are summarized in Table S8. No unique code was generated for this work. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. D isclosures The authors declare no known conflicts of interest. A uthor C ontributions Conceptualization – MPL, AM Data curation – MPL, AM Formal analysis – MPL, AM Funding acquisition – MPL, TN, AM Investigation – MPL, TN, KAD Methodology – MPL, TN, KAD Project administration – AM Resources – MPL, TN, KAD, AM Software – MPL, TN Supervision – AM Validation – MPL, AM Visualization – MPL, AM Writing – original draft – MPL, AM Writing – review & editing – MPL, TN, KAD, AM Acknowledgements This work was supported by the National Institutes of Health R21AI125897 and R01AI125271, the UW2020:WARF Discovery Initiative, and a Shaw scientist award to AM. MPL was supported by a National Science Foundation grant GRFP DGE-1747503 and TN by T32AI007414. AM is an H.I. Romnes Faculty Fellow funded by the Wisconsin Alumni Research Foundation, a Vilas Faculty Mid-Career Investigator, and completed portions of this work as a Burroughs Wellcome Fund Investigator in the Pathogenesis of Infectious Disease. We thank members of the Mehle laboratory for valuable input and M. Harrison and C. McCormick for the gifts of reagents. Footnotes ↵ 5 Lead contact References 1. ↵ Rehwinkel , J. , and Gack , M.U . ( 2020 ). RIG-I-like receptors: their regulation and roles in RNA sensing . Nat Rev Immunol 20 , 537 – 551 . doi: 10.1038/s41577-020-0288-3 . OpenUrl CrossRef PubMed 2. ↵ Hur , S . ( 2019 ). Double-Stranded RNA Sensors and Modulators in Innate Immunity . Annual Review of Immunology 37 , 349 – 375 . doi: 10.1146/annurev-immunol-042718-041356 . OpenUrl CrossRef PubMed 3. ↵ Bartok , E. , and Hartmann , G . ( 2020 ). Immune Sensing Mechanisms that Discriminate Self from Altered Self and Foreign Nucleic Acids . Immunity 53 , 54 – 77 . doi: 10.1016/j.immuni.2020.06.014 . OpenUrl CrossRef PubMed 4. ↵ Crow , Y.J. , and Stetson , D.B . ( 2022 ). The type I interferonopathies: 10 years on . Nat Rev Immunol 22 , 471 – 483 . doi: 10.1038/s41577-021-00633-9 . OpenUrl CrossRef 5. ↵ Kato , H. , Takeuchi , O. , Mikamo-Satoh , E. , Hirai , R. , Kawai , T. , Matsushita , K. , Hiiragi , A. , Dermody , T.S. , Fujita , T. , and Akira , S . ( 2008 ). Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5 . J Exp Med 205 , 1601 – 1610 . doi: 10.1084/jem.20080091 . OpenUrl Abstract / FREE Full Text 6. ↵ Hornung , V. , Ellegast , J. , Kim , S. , Brzózka , K. , Jung , A. , Kato , H. , Poeck , H. , Akira , S. , Conzelmann , K.-K. , Schlee , M. , et al. ( 2006 ). 5’-Triphosphate RNA is the ligand for RIG-I . Science 314 , 994 – 997 . doi: 10.1126/science.1132505 . OpenUrl Abstract / FREE Full Text 7. ↵ Schlee , M. , Roth , A. , Hornung , V. , Hagmann , C.A. , Wimmenauer , V. , Barchet , W. , Coch , C. , Janke , M. , Mihailovic , A. , Wardle , G. , et al. ( 2009 ). Recognition of 5′ Triphosphate by RIG-I Helicase Requires Short Blunt Double-Stranded RNA as Contained in Panhandle of Negative-Strand Virus . Immunity 31 , 25 – 34 . doi: 10.1016/j.immuni.2009.05.008 . OpenUrl CrossRef PubMed Web of Science 8. ↵ 8. Goubau , D. , Schlee , M. , Deddouche , S. , Pruijssers , A.J. , Zillinger , T. , Goldeck , M. , Schuberth , C. , Van der Veen , A.G. , Fujimura , T. , Rehwinkel , J. , et al. ( 2014 ). Antiviral immunity via RIG-I-mediated recognition of RNA bearing 5′-diphosphates . Nature 514 , 372 – 375 . doi: 10.1038/nature13590 . OpenUrl CrossRef PubMed 9. ↵ Peisley , A. , Wu , B. , Yao , H. , Walz , T. , and Hur , S . ( 2013 ). RIG-I Forms Signaling-Competent Filaments in an ATP-Dependent, Ubiquitin-Independent Manner . Molecular Cell 51 , 573 – 583 . doi: 10.1016/j.molcel.2013.07.024 . OpenUrl CrossRef PubMed Web of Science 10. Peisley , A. , Jo , M.H. , Lin , C. , Wu , B. , Orme-Johnson , M. , Walz , T. , Hohng , S. , and Hur , S . ( 2012 ). Kinetic mechanism for viral dsRNA length discrimination by MDA5 filaments . Proc Natl Acad Sci U S A 109 , E3340 – 3349 . doi: 10.1073/pnas.1208618109 . OpenUrl Abstract / FREE Full Text 11. ↵ Peisley , A. , Wu , B. , Xu , H. , Chen , Z.J. , and Hur , S . ( 2014 ). Structural basis for ubiquitin-mediated antiviral signal activation by RIG-I . Nature 509 , 110 – 114 . doi: 10.1038/nature13140 . OpenUrl CrossRef PubMed Web of Science 12. ↵ Wang , W. , and Pyle , A.M . ( 2022 ). The RIG-I receptor adopts two different conformations for distinguishing host from viral RNA ligands . Molecular Cell 82 , 4131 – 4144 .e6. doi: 10.1016/j.molcel.2022.09.029 . OpenUrl CrossRef PubMed 13. ↵ Weber , M. , Sediri , H. , Felgenhauer , U. , Binzen , I. , Bänfer , S. , Jacob , R. , Brunotte , L. , García-Sastre , A. , Schmid-Burgk , J.L. , Schmidt , T. , et al. ( 2015 ). Influenza virus adaptation PB2-627K modulates nucleocapsid inhibition by the pathogen sensor RIG-I . Cell Host Microbe 17 , 309 – 319 . doi: 10.1016/j.chom.2015.01.005 . OpenUrl CrossRef PubMed 14. ↵ Weber , M. , Gawanbacht , A. , Habjan , M. , Rang , A. , Borner , C. , Schmidt , A.M. , Veitinger , S. , Jacob , R. , Devignot , S. , Kochs , G. , et al. ( 2013 ). Incoming RNA virus nucleocapsids containing a 5’-triphosphorylated genome activate RIG-I and antiviral signaling . Cell Host Microbe 13 , 336 – 346 . doi: 10.1016/j.chom.2013.01.012 . OpenUrl CrossRef PubMed Web of Science 15. ↵ te Velthuis , A.J.W. , Long , J.C. , Bauer , D.L.V. , Fan , R.L.Y. , Yen , H.L. , Sharps , J. , Siegers , J.Y. , Killip , M.J. , French , H. , Oliva-Martín , M.J. , et al. ( 2018 ). Mini viral RNAs act as innate immune agonists during influenza virus infection . Nature Microbiology 3 . doi: 10.1038/s41564-018-0240-5 . OpenUrl CrossRef PubMed 16. ↵ Baum , A. , Sachidanandam , R. , and Garcia-Sastre , A . ( 2010 ). Preference of RIG-I for short viral RNA molecules in infected cells revealed by next-generation sequencing . Proceedings of the National Academy of Sciences 107 , 16303 – 16308 . doi: 10.1073/pnas.1005077107 . OpenUrl Abstract / FREE Full Text 17. Rehwinkel , J. , Tan , C.P. , Goubau , D. , Schulz , O. , Pichlmair , A. , Bier , K. , Robb , N. , Vreede , F. , Barclay , W. , Fodor , E. , et al. ( 2010 ). RIG-I Detects Viral Genomic RNA during Negative-Strand RNA Virus Infection . Cell 140 , 397 – 408 . doi: 10.1016/j.cell.2010.01.020 . OpenUrl CrossRef PubMed Web of Science 18. ↵ Liu , G. , Park , H.-S. , Pyo , H.-M. , Liu , Q. , and Zhou , Y . ( 2015 ). Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction . Journal of Virology 89 , 6067 – 6079 . doi: 10.1128/jvi.00232-15 . OpenUrl Abstract / FREE Full Text 19. ↵ Kato , H. , Takeuchi , O. , Sato , S. , Yoneyama , M. , Yamamoto , M. , Matsui , K. , Uematsu , S. , Jung , A. , Kawai , T. , Ishii , K.J. , et al. ( 2006 ). Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses . Nature 441 , 101 – 105 . doi: 10.1038/nature04734 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Devarkar , S.C. , Schweibenz , B. , Wang , C. , Marcotrigiano , J. , and Patel , S.S . ( 2018 ). RIG-I Uses an ATPase-Powered Translocation-Throttling Mechanism for Kinetic Proofreading of RNAs and Oligomerization . Molecular Cell 72 , 355 – 368 .e4. doi: 10.1016/j.molcel.2018.08.021 . OpenUrl CrossRef PubMed 21. Rawling , D.C. , Fitzgerald , M.E. , and Pyle , A.M . ( 2015 ). Establishing the role of ATP for the function of the RIG-I innate immune sensor . eLife 4 , e09391 . doi: 10.7554/eLife.09391 . OpenUrl CrossRef PubMed 22. ↵ Vela , A. , Fedorova , O. , Ding , S.C. , and Pyle , A.M . ( 2012 ). The Thermodynamic Basis for Viral RNA Detection by the RIG-I Innate Immune Sensor . Journal of Biological Chemistry 287 , 42564 – 42573 . doi: 10.1074/jbc.M112.385146 . OpenUrl Abstract / FREE Full Text 23. ↵ 23. Chiang , J.J. , Sparrer , K.M.J. , van Gent , M. , Lässig , C. , Huang , T. , Osterrieder , N. , Hopfner , K.-P. , and Gack , M.U. ( 2018 ). Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity . Nature Immunology 19 , 53 – 62 . doi: 10.1038/s41590-017-0005-y . OpenUrl CrossRef PubMed 24. ↵ Zhao , Y. , Ye , X. , Dunker , W. , Song , Y. , and Karijolich , J . ( 2018 ). RIG-I like receptor sensing of host RNAs facilitates the cell-intrinsic immune response to KSHV infection . Nature Communications 9 , 4841 . doi: 10.1038/s41467-018-07314-7 . OpenUrl CrossRef PubMed 25. Moriyama , M. , Koshiba , T. , and Ichinohe , T . ( 2019 ). Influenza A virus M2 protein triggers mitochondrial DNA-mediated antiviral immune responses . Nature Communications 10 , 4624 . doi: 10.1038/s41467-019-12632-5 . OpenUrl CrossRef PubMed 26. ↵ King , C.R. , Liu , Y. , Amato , K.A. , Schaack , G.A. , Mickelson , C. , Sanders , A.E. , Hu , T. , Gupta , S. , Langlois , R.A. , Smith , J.A. , et al. ( 2023 ). Pathogen-driven CRISPR screens identify TREX1 as a regulator of DNA self-sensing during influenza virus infection . Cell Host & Microbe 31 , 1552 – 1567 .e8. doi: 10.1016/j.chom.2023.08.001 . OpenUrl CrossRef 27. ↵ Vabret , N. , Najburg , V. , Solovyov , A. , Gopal , R. , McClain , C. , Šulc , P. , Balan , S. , Rahou , Y. , Beauclair , G. , Chazal , M. , et al. ( 2022 ). Y RNAs are conserved endogenous RIG-I ligands across RNA virus infection and are targeted by HIV-1 . iScience 25 , 104599 . doi: 10.1016/j.isci.2022.104599 . OpenUrl CrossRef PubMed 28. ↵ Chen , K. , Hu , Z. , Xia , Z. , Zhao , D. , Li , W. , and Tyler , J.K . ( 2015 ). The Overlooked Fact: Fundamental Need for Spike-In Control for Virtually All Genome-Wide Analyses . Mol Cell Biol 36 , 662 – 667 . doi: 10.1128/MCB.00970-14 . OpenUrl Abstract / FREE Full Text 29. ↵ Hoffmann , A. , Fallmann , J. , Vilardo , E. , Mörl , M. , Stadler , P.F. , and Amman , F . ( 2018 ). Accurate mapping of tRNA reads . Bioinformatics 34 , 1116 – 1124 . doi: 10.1093/bioinformatics/btx756 . OpenUrl CrossRef PubMed 30. Palazzo , A.F. , and Lee , E.S . ( 2015 ). Non-coding RNA: what is functional and what is junk? Front Genet 6 , 2 . doi: 10.3389/fgene.2015.00002 . OpenUrl CrossRef PubMed 31. ↵ 31. Van Nostrand , E.L. , Freese , P. , Pratt , G.A. , Wang , X. , Wei , X. , Xiao , R. , Blue , S.M. , Chen , J.-Y. , Cody , N.A.L. , Dominguez , D. , et al. ( 2020 ). A large-scale binding and functional map of human RNA-binding proteins . Nature 583 , 711 – 719 . doi: 10.1038/s41586-020-2077-3 . OpenUrl CrossRef PubMed 32. ↵ 32. Van Nostrand , E.L. , Pratt , G.A. , Yee , B.A. , Wheeler , E.C. , Blue , S.M. , Mueller , J. , Park , S.S. , Garcia , K.E. , Gelboin-Burkhart , C. , Nguyen , T.B. , et al. ( 2020 ). Principles of RNA processing from analysis of enhanced CLIP maps for 150 RNA binding proteins . Genome Biol 21 , 90 . doi: 10.1186/s13059-020-01982-9 . OpenUrl CrossRef PubMed 33. ↵ te Velthuis , A.J.W. , Grimes , J.M. , and Fodor , E . ( 2021 ). Structural insights into RNA polymerases of negative-sense RNA viruses . Nature Reviews Microbiology 19 , 303 – 318 . doi: 10.1038/s41579-020-00501-8 . OpenUrl CrossRef PubMed 34. ↵ Li , W. , Chen , H. , Sutton , T. , Obadan , A. , and Perez , D.R . ( 2014 ). Interactions between the influenza A virus RNA polymerase components and retinoic acid-inducible gene I . Journal of Virology 88 , 10432 – 10447 . doi: 10.1128/jvi.01383-14 . OpenUrl Abstract / FREE Full Text 35. ↵ Tang , Y.-S. , Xu , S. , Chen , Y.-W. , Wang , J.-H. , and Shaw , P.-C . ( 2021 ). Crystal structures of influenza nucleoprotein complexed with nucleic acid provide insights into the mechanism of RNA interaction . Nucleic Acids Research 49 , 4144 – 4154 . doi: 10.1093/nar/gkab203 . OpenUrl CrossRef PubMed 36. Chenavier , F. , Zarkadas , E. , Freslon , L.-L. , Stelfox , A.J. , Schoehn , G. , Ruigrok , R.W.H. , Ballandras-Colas , A. , and Crépin , T . ( 2024 ). Influenza a virus antiparallel helical nucleocapsid-like pseudo-atomic structure. Nucleic Acids Research , gkae 1211 . doi: 10.1093/nar/gkae1211 . OpenUrl CrossRef 37. Yamanaka , K. , Ishihama , A. , and Nagata , K . ( 1990 ). Reconstitution of influenza virus RNA-nucleoprotein complexes structurally resembling native viral ribonucleoprotein cores . Journal of Biological Chemistry 265 , 11151 – 11155 . OpenUrl Abstract / FREE Full Text 38. ↵ Baudin , F. , Bach , C. , Cusack , S. , and Ruigrok , R.W . ( 1994 ). Structure of influenza virus RNP. I. Influenza virus nucleoprotein melts secondary structure in panhandle RNA and exposes the bases to the solvent . EMBO J 13 , 3158 – 3165 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Scholtissek , C. , and Becht , H . ( 1971 ). Binding of ribonucleic acids to the RNP-antigen protein of influenza viruses . J Gen Virol 10 , 11 – 16 . doi: 10.1099/0022-1317-10-1-11 . OpenUrl CrossRef PubMed 40. ↵ Wang , F. , Sheppard , C.M. , Mistry , B. , Staller , E. , Barclay , W.S. , Grimes , J.M. , Fodor , E. , and Fan , H . ( 2022 ). The C-terminal LCAR of host ANP32 proteins interacts with the influenza A virus nucleoprotein to promote the replication of the viral RNA genome . Nucleic Acids Research 50 , 5713 – 5725 . doi: 10.1093/nar/gkac410 . OpenUrl CrossRef PubMed 41. ↵ 41. Lee , N. , Le Sage , V. , Nanni , A.V. , Snyder , D.J. , Cooper , V.S. , and Lakdawala , S.S. ( 2017 ). Genome-wide analysis of influenza viral RNA and nucleoprotein association . Nucleic Acids Research 45 , 8968 – 8977 . doi: 10.1093/nar/gkx584 . OpenUrl CrossRef PubMed 42. 42. Le Sage , V. , Kanarek , J.P. , Snyder , D.J. , Cooper , V.S. , Lakdawala , S.S. , and Lee , N. ( 2020 ). Mapping of Influenza Virus RNA-RNA Interactions Reveals a Flexible Network . Cell Reports 31 , 107823 . doi: 10.1016/j.celrep.2020.107823 . OpenUrl CrossRef 43. ↵ Williams , G.D. , Townsend , D. , Wylie , K.M. , Kim , P.J. , Amarasinghe , G.K. , Kutluay , S.B. , and Boon , A.C.M . ( 2018 ). Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication . Nature Communications 9 , 465 . doi: 10.1038/s41467-018-02886-w . OpenUrl CrossRef PubMed 44. ↵ Kingsbury , D.W. , Jones , I.M. , and Murti , K.G . ( 1987 ). Assembly of influenza ribonucleoprotein in vitro using recombinant nucleoprotein . Virology 156 , 396 – 403 . doi: 10.1016/0042-6822(87)90419-3 . OpenUrl CrossRef PubMed 45. ↵ Whittaker , G. , Bui , M. , and Helenius , A . ( 1996 ). Nuclear trafficking of influenza virus ribonuleoproteins in heterokaryons . Journal of virology 70 , 2743 – 2756 . OpenUrl Abstract / FREE Full Text 46. ↵ Neumann , G. , Castrucci , M.R. , and Kawaoka , Y . ( 1997 ). Nuclear import and export of influenza virus nucleoprotein . Journal of Virology 71 , 9690 – 9700 . OpenUrl Abstract / FREE Full Text 47. ↵ Arun , G. , Aggarwal , D. , and Spector , D.L . ( 2020 ). MALAT1 Long Non-Coding RNA: Functional Implications . Noncoding RNA 6 , 22 . doi: 10.3390/ncrna6020022 . OpenUrl CrossRef PubMed 48. ↵ Naesens , L. , Haerynck , F. , and Gack , M.U . ( 2023 ). The RNA polymerase III–RIG-I axis in antiviral immunity and inflammation . Trends in Immunology 44 , 435 – 449 . doi: 10.1016/j.it.2023.04.002 . OpenUrl CrossRef PubMed 49. ↵ Ettwiller , L. , Buswell , J. , Yigit , E. , and Schildkraut , I . ( 2016 ). A novel enrichment strategy reveals unprecedented number of novel transcription start sites at single base resolution in a model prokaryote and the gut microbiome . BMC Genomics 17 , 199 . doi: 10.1186/s12864-016-2539-z . OpenUrl CrossRef PubMed 50. ↵ 50. Lässig , C. , Matheisl , S. , Sparrer , K.M.J. , de Oliveira Mann , C.C. , Moldt , M. , Patel , J.R. , Goldeck , M. , Hartmann , G. , García-Sastre , A. , Hornung , V. , et al. ( 2015 ). ATP hydrolysis by the viral RNA sensor RIG-I prevents unintentional recognition of self-RNA . eLife 4 . doi: 10.7554/eLife.10859 . OpenUrl CrossRef PubMed 51. ↵ 51. Zhou , S. , and Van Bortle , K. ( 2023 ). The Pol III transcriptome: Basic features, recurrent patterns, and emerging roles in cancer . WIREs RNA 14 , e1782 . doi: 10.1002/wrna.1782 . OpenUrl CrossRef 52. ↵ Choi , J.H. , Burke , J.M. , Szymanik , K.H. , Nepal , U. , Battenhouse , A. , Lau , J.T. , Stark , A. , Lam , V. , and Sullivan , C.S . ( 2020 ). DUSP11-mediated control of 5’-triphosphate RNA regulates RIG-I sensitivity . Genes & Development . doi: 10.1101/gad.340604.120 . OpenUrl Abstract / FREE Full Text 53. ↵ Leung , D.W. , Basler , C.F. , and Amarasinghe , G.K . ( 2012 ). Molecular mechanisms of viral inhibitors of RIG- I-like receptors . Trends Microbiol 20 , 139 – 146 . doi: 10.1016/j.tim.2011.12.005 . OpenUrl CrossRef PubMed Web of Science 54. ↵ Chan , Y.K. , and Gack , M.U . ( 2016 ). Viral evasion of intracellular DNA and RNA sensing . Nature Reviews Microbiology 14 , 360 – 373 . doi: 10.1038/nrmicro.2016.45 . OpenUrl CrossRef PubMed 55. ↵ Gack , M.U. , Albrecht , R.A. , Urano , T. , Inn , K.S. , Huang , I.C. , Carnero , E. , Farzan , M. , Inoue , S. , Jung , J.U. , and Garcia-Sastre , A . ( 2009 ). Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I . Cell Host Microbe 5 , 439 – 449 . doi: 10.1016/j.chom.2009.04.006 . OpenUrl CrossRef PubMed Web of Science 56. Qian , X.Y. , Chien , C.Y. , Lu , Y. , Montelione , G.T. , and Krug , R.M . ( 1995 ). An amino-terminal polypeptide fragment of the influenza virus NS1 protein possesses specific RNA-binding activity and largely helical backbone structure . RNA 1 , 948 – 956 . OpenUrl Abstract 57. ↵ Rajsbaum , R. , Albrecht , R.A. , Wang , M.K. , Maharaj , N.P. , Versteeg , G.A. , Nistal-Villán , E. , García-Sastre , A. , and Gack , M.U . ( 2012 ). Species-specific inhibition of RIG-I ubiquitination and IFN induction by the influenza A virus NS1 protein . PLoS Pathog 8 , e1003059 . doi: 10.1371/journal.ppat.1003059 . OpenUrl CrossRef PubMed 58. ↵ Yao , H. , Dittmann , M. , Peisley , A. , Hoffmann , H.-H. , Gilmore , R.H. , Schmidt , T. , Schmid-Burgk , J.L. , Hornung , V. , Rice , C.M. , and Hur , S . ( 2015 ). ATP-Dependent Effector-like Functions of RIG-I-like Receptors . Molecular Cell 58 , 541 – 548 . doi: 10.1016/j.molcel.2015.03.014 . OpenUrl CrossRef PubMed 59. ↵ Ruigrok , R.W.H. , Crépin , T. , and Kolakofsky , D . ( 2011 ). Nucleoproteins and nucleocapsids of negative- strand RNA viruses . Current opinion in microbiology 14 , 504 – 510 . doi: 10.1016/j.mib.2011.07.011 . OpenUrl CrossRef PubMed 60. ↵ Sabsay , K.R. , and Te Velthuis , A.J.W . ( 2023 ). Negative and ambisense RNA virus ribonucleocapsids: more than protective armor . Microbiol Mol Biol Rev 87 , e0008223 . doi: 10.1128/mmbr.00082-23 . OpenUrl CrossRef PubMed 61. ↵ Curran , J. , Marq , J.B. , and Kolakofsky , D . ( 1995 ). An N-terminal domain of the Sendai paramyxovirus P protein acts as a chaperone for the NP protein during the nascent chain assembly step of genome replication . Journal of Virology 69 , 849 – 855 . OpenUrl Abstract / FREE Full Text 62. 62. Chenavas , S. , Estrozi , L.F. , Slama-Schwok , A. , Delmas , B. , Di Primo , C. , Baudin , F. , Li , X. , Crepin , T. , and Ruigrok , R.W. ( 2013 ). Monomeric nucleoprotein of influenza A virus . PLoS Pathogens 9 , e1003275 . doi: 10.1371/journal.ppat.1003275 . OpenUrl CrossRef PubMed 63. ↵ Mullin , A.E. , Dalton , R.M. , Amorim , M.J. , Elton , D. , and Digard , P . ( 2004 ). Increased amounts of the influenza virus nucleoprotein do not promote higher levels of viral genome replication . J Gen Virol 85 , 3689 – 3698 . doi: 10.1099/vir.0.80518-0 . OpenUrl CrossRef PubMed Web of Science 64. ↵ Sanchez David , R.Y. , Combredet , C. , Sismeiro , O. , Dillies , M.-A. , Jagla , B. , Coppée , J.-Y. , Mura , M. , Guerbois Galla , M. , Despres , P. , Tangy , F ., et al. ( 2016 ). Comparative analysis of viral RNA signatures on different RIG-I-like receptors . eLife 5 , e11275 . doi: 10.7554/eLife.11275 . OpenUrl CrossRef PubMed 65. ↵ Dawson , A.R. , Wilson , G.M. , Freiberger , E.C. , Mondal , A. , Coon , J.J. , and Mehle , A . ( 2020 ). Phosphorylation controls RNA binding and transcription by the influenza virus polymerase . PLOS Pathogens 16 , e1008841 . OpenUrl CrossRef PubMed 66. ↵ Tran , V. , Poole , D.S. , Jeffery , J.J. , Sheahan , T.P. , Creech , D. , Yevtodiyenko , A. , Peat , A.J. , Francis , K.P. , You , S. , and Mehle , A . ( 2015 ). Multi-Modal Imaging with a Toolbox of Influenza A Reporter Viruses . Viruses 7 , 5319 – 5327 . doi: 10.3390/v7102873 . OpenUrl CrossRef PubMed 67. ↵ Tran , V. , Moser , L.A. , Poole , D.S. , and Mehle , A . ( 2013 ). Highly sensitive real-time in vivo imaging of an influenza reporter virus reveals dynamics of replication and spread . Journal of Virology 87 , 13321 – 13329 . doi: 10.1128/JVI.02381-13 . OpenUrl Abstract / FREE Full Text 68. ↵ Kowarz , E. , Löscher , D. , and Marschalek , R . ( 2015 ). Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines . Biotechnol J 10 , 647 – 653 . doi: 10.1002/biot.201400821 . OpenUrl CrossRef PubMed 69. ↵ Fauver , J.R. , Akter , S. , Morales , A.I.O. , Black , W.C. , Rodriguez , A.D. , Stenglein , M.D. , Ebel , G.D. , and Weger-Lucarelli , J . ( 2019 ). A reverse-transcription/RNase H based protocol for depletion of mosquito ribosomal RNA facilitates viral intrahost evolution analysis, transcriptomics and pathogen discovery . Virology 528 , 181 – 197 . doi: 10.1016/j.virol.2018.12.020 . OpenUrl CrossRef PubMed 70. ↵ McHugh , C.A. , Chen , C.-K. , Chow , A. , Surka , C.F. , Tran , C. , McDonel , P. , Pandya-Jones , A. , Blanco , M. , Burghard , C. , Moradian , A. , et al. ( 2015 ). The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3 . Nature 521 , 232 – 236 . doi: 10.1038/nature14443 . OpenUrl CrossRef PubMed 71. ↵ 71. Van Nostrand , E.L. , Pratt , G.A. , Shishkin , A.A. , Gelboin-Burkhart , C. , Fang , M.Y. , Sundararaman , B. , Blue , S.M. , Nguyen , T.B. , Surka , C. , Elkins , K. , et al. ( 2016 ). Robust transcriptome-wide discovery of RNA- binding protein binding sites with enhanced CLIP (eCLIP) . Nature Methods 13 , 508 – 514 . doi: 10.1038/nmeth.3810 . OpenUrl CrossRef PubMed 72. ↵ Tran , V. , Ledwith , M.P. , Thamamongood , T. , Higgins , C.A. , Tripathi , S. , Chang , M.W. , Benner , C. , García- Sastre , A. , Schwemmle , M. , Boon , A.C.M. , et al. ( 2020 ). Influenza virus repurposes the antiviral protein IFIT2 to promote translation of viral mRNAs . Nature Microbiology 5 , 1490 – 1503 . doi: 10.1038/s41564-020-0778-x . OpenUrl CrossRef PubMed 73. ↵ Huppertz , I. , Attig , J. , D’Ambrogio , A. , Easton , L.E. , Sibley , C.R. , Sugimoto , Y. , Tajnik , M. , König , J. , and Ule , J . ( 2014 ). iCLIP: Protein-RNA interactions at nucleotide resolution . Methods 65 , 274 – 287 . doi: 10.1016/j.ymeth.2013.10.011 . OpenUrl CrossRef PubMed 74. ↵ Kim , D. , Langmead , B. , and Salzberg , S.L . ( 2015 ). HISAT: A fast spliced aligner with low memory requirements . Nature Methods 12 , 357 – 360 . doi: 10.1038/nmeth.3317 . OpenUrl CrossRef PubMed 75. Langmead , B. , and Salzberg , S.L . ( 2012 ). Fast gapped-read alignment with Bowtie 2 . Nat Methods 9 , 357 – 359 . doi: 10.1038/nmeth.1923 . OpenUrl CrossRef PubMed Web of Science 76. ↵ 76. Bushnell , B . ( 2015 ). BBMap (version 37.75) [Software]. Available at https://sourceforge.net/projects/bbmap/ . 77. ↵ Grabherr , M.G. , Haas , B.J. , Yassour , M. , Levin , J.Z. , Thompson , D.A. , Amit , I. , Adiconis , X. , Fan , L. , Raychowdhury , R. , Zeng , Q. , et al. ( 2011 ). Full-length transcriptome assembly from RNA-Seq data without a reference genome . Nat Biotechnol 29 , 644 – 652 . doi: 10.1038/nbt.1883 . OpenUrl CrossRef PubMed 78. ↵ Lovci , M.T. , Ghanem , D. , Marr , H. , Arnold , J. , Gee , S. , Parra , M. , Liang , T.Y. , Stark , T.J. , Gehman , L.T. , Hoon , S. , et al. ( 2013 ). Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges . Nature Structural and Molecular Biology . doi: 10.1038/nsmb.2699 . OpenUrl CrossRef PubMed 79. ↵ Robinson , M.D. , McCarthy , D.J. , and Smyth , G.K . ( 2010 ). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics (Oxford , England ) 26 , 139 – 140 . doi: 10.1093/bioinformatics/btp616 . OpenUrl CrossRef PubMed Web of Science 80. ↵ Quinlan , A.R. , and Hall , I.M . ( 2010 ). BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics 26 , 841 – 842 . doi: 10.1093/bioinformatics/btq033 . OpenUrl CrossRef PubMed Web of Science 81. ↵ Karlsson , E.A. , Meliopoulos , V.A. , Tran , V. , Savage , C. , Livingston , B. , Schultz-Cherry , S. , and Mehle , A . ( 2018 ). Measuring Influenza Virus Infection Using Bioluminescent Reporter Viruses for In Vivo Imaging and In Vitro Replication Assays . In Methods in Molecular Biology , pp. 431 – 459 . doi: 10.1007/978-1-4939-8678-1_21 . OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted March 12, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Influenza virus antagonizes self sensing by RIG-I to enhance viral replication Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Influenza virus antagonizes self sensing by RIG-I to enhance viral replication Mitchell P. Ledwith , Thomas Nipper , Kaitlin A. Davis , Deniz Uresin , Anastassia V. Komarova , Andrew Mehle bioRxiv 2025.03.12.642847; doi: https://doi.org/10.1101/2025.03.12.642847 Share This Article: Copy Citation Tools Influenza virus antagonizes self sensing by RIG-I to enhance viral replication Mitchell P. Ledwith , Thomas Nipper , Kaitlin A. Davis , Deniz Uresin , Anastassia V. Komarova , Andrew Mehle bioRxiv 2025.03.12.642847; doi: https://doi.org/10.1101/2025.03.12.642847 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7637) Biochemistry (17705) Bioengineering (13899) Bioinformatics (41968) Biophysics (21460) Cancer Biology (18603) Cell Biology (25526) Clinical Trials (138) Developmental Biology (13385) Ecology (19910) Epidemiology (2067) Evolutionary Biology (24328) Genetics (15614) Genomics (22513) Immunology (17741) Microbiology (40423) Molecular Biology (17193) Neuroscience (88646) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4827) Physiology (7647) Plant Biology (15160) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00