Mechanism of Jiangan Jiangzhi Pill NRF2 pathway in the treatment of steatohepatitis in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanism of Jiangan Jiangzhi Pill NRF2 pathway in the treatment of steatohepatitis in mice Xue Jiao, Li Wang, Yinglun Li, Jing Liu, Qian Wei, Yuqiang Mi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5709043/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective observe the healthy liver cholesterol-lowering pills for methionine choline lack of feed (Methionine-choline deficient,MCD) diet induced nonalcoholic fatty hepatitis (Nonalcoholic steatohepatitis,NASH) mechanism of lipid metabolism and inflammation in mice. Methods The mice were randomly divided into control group, model group, positive drug group, low, medium and high dose groups of Jianganjiangzhi pills, 10 mice in each group.The control group ate normal diet, and the other experimental groups ate MCD diet.The positive drug group was intritoneally injected with 150mg/kg polyene phosphatidylcholine, the low, medium and high dose groups of Jiangan Jiangzhi pills were administrated with 100 mg/kg, 200 mg/kg and 400 mg/kg respectively, once a day, and the control group and model group were given equal volume of normal saline in parallel.Weigh and record every 7 days.It lasts six weeks.The histopathological changes of liver were observed by HE staining.Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected by biochemical kit,The levels of total cholesterol (TC), triglyceride (TG), superoxide dismutase (SOD), malondialdehyde (MDA) and glutathione peroxidase (GSH-Px) in liver homogenate were detected by BCA kit.The mRNA expression levels ofNrf2, Ho1, Gclc and Nqo1 in mouse liver tissues were detected by PCR,The expression level ofNRF2 pathway related protein in mouse liver was detected by Western blot . Results Compared with the normal group, the model group had serious liver pathological injury, severe destruction of liver cell structure, widening of cell interval, collapse and infiltration of a large number of inflammatory cells.In the model group, ALT, AST, TG and TC (P<0.01) levels were significantly increased, SOD activity was decreased, MDA level was increased, and GSH-Px activity was decreased. PCR results showed that mRNA expression levels ofNrf2, Ho1, Gclc and Nqo1 in mouse liver tissues were decreased.Westernblot results showed that the relative expression levels ofNRF2, HO-1,GCLC and NQO1 proteins in mice were significantly decreased. Compared with the model group, the liver cell structure of mice in positive drug group (polyene phosphatidylcholine) and Jianggan Jiangzhiwan low-dose, medium-dose and high-dose groups was more clear, with a shorter cell interval and a small amount of inflammatory cell infiltration,ALT, AST,TG and TC levels decreased significantly, SOD activity increased, MDA level decreased, GSH-Px activity increased. The mRNA expression levels ofNrf2, Ho1, Gclc and Nqo1 in liver tissues were increased, and the protein expression levels of NRF2 pathway related proteins were significantly increased. Conclusion Jiangan Jiangzhi pills(健肝降脂丸) can regulate NRF2 pathway to enhance antioxidant capacity and reduce liver steatosis and inflammation in mice with NASH Jiangan Jiangzhi Pill NRF2 pathway Nonalcoholic steatohepatitis Antioxidation Lipid metabolism Inflammatory mechanism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Nonalcoholic steatohepatitis (Nonalcoholic steatohepatitis,NASH) is a liver disease developed from nonalcoholic fatty liver disease (Nonalcoholic fatty liver disease NAFLD). Its histological manifestations are steatosis, inflammation and fibrosis [1] . At present, the incidence of this disease is getting higher and higher, posing a major burden on global health [2] Metabolic syndrome, obesity and liver insulin resistance are considered to be closely related to the pathogenesis of NASH [3, 4] Lipogenesis is a key factor in the early progression of NASH. Free fatty acids (free fatty acids FFA) in hepatocytes may induce hepatocyte injury through oxidative stress and participate in the occurrence and progression of NASH [5, 6] . Modern studies have shown that NRF2 signal pathway can regulate lipid peroxidation and free radical damage in liver tissue, enhance the antioxidant capacity of the body, and protect damaged liver tissue [7, 8] . Jiangan Jiangzhi Pill is composed of 11 traditional Chinese medicines such as Polygonum multiflorum, Salvia miltiorrhiza, semen Cassiae, Hawthorn, alisma, lotus leaf and so on according to the traditional Chinese medicine theory in Tianjin second people's Hospital. It has the effect of soothing the liver and invigorating the spleen, promoting blood circulation and removing blood stasis, eliminating fat and guiding stagnation. Suitable for fatty liver, alcoholic hepatitis, hyperlipidemia and so on. It has the medicinal properties of nourishing yin, nourishing the liver and spleen, invigorating the spleen and lowering blood fat, hence the name [9] . Studies have shown that Jiangan Jiangzhi pills can reduce blood lipids, improve liver function, reduce the course of fatty liver, and treat non-alcoholic fatty liver [10-12] . In this study, the model of non-NASH mice was established by methionine choline deficiency diet, and then different doses of Jiangan Jiangzhi Pill were given to NASH mice. Firstly, the therapeutic effect of Jiangan Jiangzhi Pill on NASH mice was evaluated. Secondly, the effect of Jiangan Jiangzhi Pill on liver oxidative stress in NASH mice was studied. Finally, Western blot and qPCR were used to detect the effects of Jiangan Jiangzhi Pill on the expression of proteins and genes related to NRF2 signal pathway in NASH mice. 1 Experimental Materials 1.1 Experimental Animals 60 adult male 8-week-old C57BL/6 mice, weighing 20 ±2 g, were provided by Beijing Huafukang Biotechnology Co., Ltd. The mice were raised in SPF clean environment and ate freely. This experiment was approved by the Animal Ethics Committee of Nankai University (approval No. 2021-SYDWLL-000003) and raised in the Experimental Animal Center of Nankai University. The experimental research strictly abides by the regulations of the people's Republic of China on the Administration of Experimental Animals and the relevant ethical principles. 1.2 Experimental drug methionine choline deficiency feed (Methionine-choline deficient,MCD, item number: SBF081722, Beijing Sibeifu Biotechnology Co., Ltd.); Polyene phosphatidylcholine (batch number: CBJD106, Sanofi (Beijing) Pharmaceutical Co., Ltd.); TG detection kit (item number: A110-1-1, Nanjing Institute of Biology) TC test kit (number: A111-1-1, Nanjing Institute of Biology) ALT test kit (item number: C009-1-1, Nanjing Institute of Biology); AST kit (number: C0101-2-1, Nanjing Institute of Biology); SOD kit (number: A111-1-1, Nanjing Institute of Biology); MDA kit (number: C009-1-1, Nanjing Institute of Biology) GSH-Px detection kit (Ref.: C0101-2-1, Nanjing Institute of Biology); NRF2 Antibody (Ref.: 16396-1 quotient Proteintech); HO-1 Antibody (Ref.: 10701-1 lichene Proteintech); GCLC Antibody (Ref.: 12601-1Mube APP Proteintech); NQO1 Antibody (Ref.: 67240-1Mutual IgM Proteintech); β-actin Antibody (Ref.: 20536-1fAPP Proteintech) Total protein quantitative determination kit (item number: A045-4-2, Nanjing Institute of Biology) BCA protein concentration determination kit (item number: PC0020,Solarbio) 1.3Experimental instruments: high performance universal desktop freezing centrifuge (ThermoFisher Seymour Fischer Sorvall ST 16R); Multifunctional enzyme labeling instrument (Thermo Company, USA); Optical microscope (Nikon ECLIPSE TS100); fluorescence quantitative PCR instrument (Bio-RAD iQTM5); Electrophoresis instrument (Beijing Junyi Oriental Electrophoretic equipment Co., Ltd.); Electrophoretic trough (Beijing Junyi Oriental Electrophoretic equipment Co., Ltd.) Transfer slot (Beijing Junyi Oriental Electrophoresis equipment Co., Ltd.); Shaker (Tianjin Oonuo instrument Co., Ltd.) 2 Experimental methods 2.1 Experimental grouping and administration regimen 2.1.1Construction and grouping of NASH mouse model After a week of routine feeding, 60 male C57BL/6 mice were randomly divided into 6 groups: normal group, model group, positive drug group, low dose group, middle dose group and high dose group, with 10 mice in each group. The normal group was fed with normal diet, and the other groups were fed with MCD feed to establish NASH model for 6 weeks. 2.1.2 configuration of gastric solution of Jiangan Jiangzhi Pill Put the honey pills of the required quality into a mortar and grind them into powder. 0.1ml-0.4 ml saline per 10 g body weight. Add the powder to the corresponding mass of saline and stir gently with a glass rod to make the drug fully dissolve. As honey pills contain honey sticky substances, the dissolution process can be lengthened until it is completely dissolved. 2.1.3 Animal administration Six weeks later, the model was successfully administered, and the normal group and the model group were given the same volume of normal saline every day, and the positive drug group was given 150 mg/kg; of Polyene phosphatidylcholine capsule every day in the Jiangan Jiangan Jiangzhi low dose group. Jiangan Jiangan Jiangzhi 100 mg/kg; Jiangan Jiangzhi middle dose group was gavaged with Jiangan Jiangzhi 200 mg/kg; Jiangan Jiangzhi high dose group. Each group was administered continuously for 6 weeks, and the general conditions of mice in each group were observed and compared in the course of the experiment. The gastric administration dose of the above groups (converted according to the equivalent dose ratio table of human (70kg) and animal surface area) was 10 times of that of clinical adults per kilogram body weight, and the gastric administration dose of mice was 0.1 ml per 10g body weight. 2.2 Index observation: after the beginning of administration, the body weight of mice in each group was weighed every week, and after modeling and administration, the weight of liver was weighed and the liver index was calculated. The liver index formula is: liver index (%) = liver weight (g) / body weight (g) × 100%. 2.3Detection of serum liver function index After modeling and administration, the blood was taken from the medial canthus of the mouse, placed at room temperature for 30 min, centrifuged at 4 ℃ (3000 r/min) for 15 min, and the supernatant was stored at-80 ℃ for testing. The contents of ALT and AST in serum of mice in each group were determined by biochemical kit. 2.4 Detection of biochemical indexes in liver tissue 100 mg liver tissue was added to 900 μ L normal saline, homogenized by ultrasound and centrifuged at low temperature (3000 r/min) for 15 min. The supernatant was collected. The protein level in tissue homogenate was homogenized with BCA kit, and the levels of TC, TG, SOD, MDA and GSH-Px in liver tissue were detected according to the kit. The specific method is completed according to the steps of the kit. 2.5 pathological observation After modeling and administration, the liver tissues of mice in each group were collected, fixed with formalin solution, embedded in paraffin, made into 3 μ m sections, routine HE staining, and the pathological changes of liver tissue in each group were observed under light microscope. In addition, the fresh liver tissue was frozen in liquid nitrogen, frozen sections were made and stained with oil red O. And then immediately observe it under an optical microscope. 2.6 PCR detection The total RNA of mouse liver tissue was extracted by Trizol method, and the quantity and purity of RNA were detected. RNA was inversely transcribed into cDNA by reverse transcription kit, and real-time fluorescence quantitative PCR detection was carried out by PCR reaction system. The PCR reaction conditions were as follows: pre-denaturation at 94 ℃ 120 s at 94 ℃, denaturation at 94 ℃ for 30 s, annealing at 52 ℃ for 30 s, 60 ℃ extension at 60 ℃ for 40 cycles. The relative expressions of Nrf2, Ho1, Gclc and Nqo1 were calculated with Actb as the internal reference, and the results were processed by 2-dimensional CT method. The sequence of primers is shown in Table 1. Table 1 Genes Primer sequence (5’-3’) Nrf2 Forward: CAGAGTGATGGTTGCCCACT Reverse: CACACACTTTCTGCGTGCTC Ho1 Forward: GAAATCATCCCTTGCACGCC Reverse: CCTGAGAGGTCACCCAGGTA Gclc Forward: AAGGACGTGCTCAAGTGGG Reverse: AGGCGTTCCTTCGATCATGT Nqo1 Forward: CATTGCAGTGGTTTGGGGTG Reverse: TCTGGAAAGGACCGTTGTCG Actb Forward: GATATCGCTGCGCTGGTCG Reverse: CATTCCCACCATCACACCCT 2.7 Western blot The obtained mouse liver tissue was added to the RIPA cleavage buffer, and the protein was retained after homogenate centrifugation. BCA protein assay kit was used to determine the concentration of total protein. The protein separated from each sample was transferred to PVDF membrane after 8%-12%SDS-PAGE electrophoresis (the membrane was sealed with 5% skimmed milk powder at room temperature for 2 hours, and then different first antibody NRF2 (dilution ratio 1NRF2 2000), HO-1 (dilution ratio 1vv2000), GCLC (dilution ratio 1vv8000), NQO1 (dilution ratio 110000) and β-actin (dilution ratio 110,000) were added respectively, and incubated overnight at 4 ℃. After washing the membrane, the corresponding secondary antibody (diluted ratio 1 / 10 000) was added and incubated at room temperature for 2 hours. After washing the membrane with TBST, ECL reagent was added to develop the image. The strip is analyzed quantitatively by using image pro plus 6.0software. 2.8 Statistical processing The experimental results were analyzed by SPSS Statistics 20.0 statistical software. the measurement data were expressed as X ±S, t-test was used, and single factor analysis of variance was used to compare the mean among groups. P < 0.05 was statistically significant. 3 Results 3.1 body weight and liver index The results of body weight showed that the body weight of mice in the model group was lower than that in the normal group (P < 0.01). Compared with the model group, the body weight of positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01, P < 0.01). (fig. 1- a) the results of liver index showed that the liver index of model group was higher than that of normal group (P < 0.01). Compared with the model group, the liver index decreased in positive medicine group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P < 0.01, P < 0.05, P < 0.01). (figure 1-b) 3.2 biochemical index level The results of biochemical indexes showed that the ALT of the model group was higher than that of the normal group. Compared with the model group, ALT decreased in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P < 0.01). (figure 1-c) Compared with the normal group, the value of AST in the model group increased (P < 0.01). Compared with the model group, AST decreased in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P < 0.05, P < 0.05). (figure 1 -d) Compared with the normal group, TC in the model group increased (P < 0.01). Compared with the model group, the TC in the positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group decreased (P < 0.01). (figure 1-e) Compared with the normal group, TG in the model group increased (P < 0.01). Compared with the model group, TG decreased in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P < 0.01). (figure 1-f) 3.3 pathological staining The results of liver HE staining showed that in the normal group, the liver structure was spaced normally, there was no interstitial edema, and there was no obvious inflammatory cell exudation. In the model group, the liver structure was seriously damaged, interstitial edema, and a large number of inflammatory cell infiltration. In the positive drug group and Jiangan Jiangzhi high dose group, the liver structure of mice was relatively clear, the wall thickened slightly, with a small amount of inflammatory cell infiltration.(figure 2) Oil red O staining showed that the nucleus was blue and fat droplets were red. The results showed that there were no obvious fat droplets in the normal group. A large number of fat droplets appeared in the model group. Fat droplets decreased in positive drug group and Jiangan Jiangzhi high high dose group.(figure3) 3.4 Antioxidant level The results of biochemical indexes showed that the activity of SOD in the model group was lower than that in the normal group. Compared with the model group, the activity of SOD in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01). (fig. 4-a) compared with the normal group, the level of MDA in the model group was higher than that in the normal group. Compared with the model group, the level of MDA in positive medicine group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group decreased (P < 0.01). (fig. 4-b) compared with the normal group, the activity of GSH-Px in the model group was lower than that in the normal group (P < 0.01). Compared with the model group, the activity of GSH-Px in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01, P < 0.05). (figure 4-c) 3.5 expression level of genes related to NRF2 pathway The results of PCR showed that the relative expression of Nrf2 mRNA in the model group was significantly lower than that in the normal group. Compared with the model group, the expression of Nrf2 mRNA in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01, P < 0.05, P < 0.01). (figure 5 -a) Compared with the normal group, the relative expression of Ho1 mRNA in the model group was significantly decreased (P < 0.01). Compared with the model group, the expression of Ho1 mRNA in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01, P < 0.05). (figure 5-b) Compared with the normal group, the relative expression of Gclc mRNA in the model group was significantly decreased (P < 0.01). Compared with the model group, the expression of Gclc mRNA in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01, P < 0.05, P < 0.05). (figure 5 -c) Compared with the normal group, the relative expression of Nqo1 mRNA in the model group was significantly decreased (P < 0.01). Compared with the model group, the expression of Nqo1 mRNA in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01, P < 0.05). (figure 5-d) 3.6 expression level of proteins related to NRF2 pathway The results of Western blot showed that the relative expression of NRF2 protein in the model group was significantly lower than that in the normal group. Compared with the model group, the relative expression of Nrf2 protein in the positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01). Compared with the normal group, the relative expression of HO-1 protein in the model group was significantly decreased (P < 0.01). Compared with the model group, the relative expression of HO-1 protein in the positive drug group and Jiangan Jiangzhi high dose group increased (P < 0.01). Compared with the normal group, the relative expression of GCLC protein in the model group was significantly decreased (P < 0.01). Compared with the model group, the relative expression of GCLC protein in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P < 0.01). Compared with the normal group, the relative expression of NQO1 protein in the model group was significantly decreased (P < 0.01). Compared with the model group, the relative expression of NQO1 protein in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group was significantly higher than that in model group (P < 0.01). (figure 6) Discussion NASH is considered to be a liver manifestation of metabolic syndrome, and the incidence of obesity, hyperlipidemia and type 2 diabetes is on the rise worldwide [13, 14] . Animal models can not only clarify the pathogenesis of NASH, but also detect the therapeutic effects of various drugs. At present, one of the most widely used NASH models is to feed animals with MCD feed [15] . In this study, the results of liver HE staining showed that the structure of hepatocytes in the model group was seriously damaged, the fine cell septum widened, collapsed, and there were a large number of inflammatory cell infiltration, indicating the success of the model. The liver fine cell structure of mice in the positive medicine group and Jiangan Jiangzhi pill low, middle and high dose groups was relatively clear, the cell interval was shortened, with a small amount of inflammatory cell infiltration, indicating that the pathological damage of liver tissue in each dose group of Jiangan Jiangzhi pill was significantly improved, suggesting that Jiangan Jiangzhi pill has an obvious protective effect on liver injury of NASH. ALT and AST are the main enzymes reflecting liver parenchyma damage [16] . Clinically, liver function damage is closely related to the increase of AST and ALT levels [11] . Hepatocyte lipid accumulation and very low density lipoprotein (VLDL) synthesis decreased, resulting in triglycerides can not be transported out of the liver, thus aggravating intracellular fat accumulation, oxidative stress, resulting in hepatocyte death [17, 18] . Compared with the normal group, the levels of AST, ALT, TG and TC in the model group were significantly higher. Compared with the model group, the levels of ALT and TG in the positive drug group, middle and high dose groups of Jiangan Jiangzhi pills were significantly lower than those in the model group. Compared with the model group, the levels of AST and TC in the positive drug group and all dose groups of Jiangan Jiangzhi pills were significantly lower. The above experimental results show that Jiangan Jiangzhi Pill has a therapeutic effect on liver injury induced by MCD. NASH is a common chronic liver disease, the pathogenesis is very complex, oxidative stress is one of its important pathogenesis [19] . SOD and GSH-Px are important antioxidant enzymes in vivo, and the level of MDA reflects the degree of oxidative stress injury in vivo [20] . The results showed that Jiangan Jiangzhi Pill could increase the activities of SOD and GSH-Px and decrease the level of MDA in liver tissue of mice. It has been recently confirmed that Nrf2 is one of the important regulators of cellular antioxidant stress response [21] , maintaining the balance between oxidation and antioxidation in the body. When there is more severe or continuous oxidative stimulation or injury, cells can re-enter the nucleus of extranuclear Nrf2 to deal with oxidative damage and improve NASH inflammation by increasing the synthesis of Nrf2, reducing the ubiquitin of extranuclear Nrf2 and slowing down the degradation of Nrf2. It helps to inhibit the progression of liver injury [22-24] , while the absence of Nrf2 aggravates inflammation and steatosis induced by high-fat diet in mice [25] . The results of this study showed that the PCR results showed that the mRNA expression levels of Nrf2, Ho1, Gclc and Nqo1 in mouse liver tissue decreased. Western blot results showed that the relative expressions of NRF2, HO-1, GCLC and NQO1 proteins in mice were significantly decreased. Compared with the model group, the liver cell structure of mice in the positive drug group (Polyene phosphatidylcholine) and Jiangan Jiangzhi pill groups were clearer and the cell interval was shortened. In the positive drug group with a small amount of inflammatory cell infiltration, the levels of ALT, AST, TG and TC decreased significantly, while the activity of SOD increased and the level of MDA decreased. Increase of GSH-Px activity The mRNA expression of Nrf2, Ho1, Gclc and Nqo1 in liver tissue increased, and the expression of proteins related to NRF2 pathway increased significantly. To sum up, Jiangan Jiangzhi Pill can reduce the pathological changes of liver tissue, apoptosis and inhibit oxidative stress in mice, and its mechanism may be related to the activation of NRF2 signal pathway and the increase of antioxidant capacity. Based on the previous animal experimental study and clinical observation, this experiment takes the NRF2 signal pathway as the main line to explain the molecular mechanism of Jiangan Jiangzhi Pill in improving NASH, so as to provide a new theoretical basis for Jiangan Jiangzhi Pill in anti-inflammation and liver protection. To investigate the effect of Jiangan Jiangzhi Pill on the occurrence and development of NASH inflammation from proteomics, so as to judge the possible biological effect of this traditional Chinese medicine preparation. This project can give a new connotation to the treatment of NASH and is expected to open up a new train of thought for the treatment of clinical NASH. Declarations Author Contribution X.J:Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Experimental operation and analysis,Writing- original draftL.W:Experimental operation and analysis,Writing- original draftYL.L:Formal analysis, InvestigationJ.L:Formal analysis, InvestigationQ.W:Formal analysis, Investigation YQ.M:Writing-review & editingP.L:Methodology, Project administration Supervision, Writing-review & editing References Liu X, Luo Y, Xu M X, et al. Research progress on inflammation-related targets and treatment of nonalcoholic steatohepatitis[J]. Chinese Journal of Pharmacy. 2024, 59(13): 1173-1185. Liu X, Luo Y, Xu M X, et al. Exploring inflammation-related targets: research progress in the treatment of nonalcoholic steatohepatitis[J]. Chinese Journal of Pharmacy.: 1-28. Xu X, Poulsen K L, Wu L, et al. Targeted therapeutics and novel signaling pathways in non-alcohol-associated fatty liver/steatohepatitis (NAFL/NASH)[J]. Signal Transduct Target Ther. 2022, 7(1): 287. Chen M Q,Fan J G. A brief introduction to the American Clinical practice Guide for the diagnosis and treatment of Nonalcoholic Fatty liver Disease[J]. Practical Journal of liver Diseases. 2022, 25(05): 776-778. Gao Z Q, Lu F E. Free fatty acids, insulin resistance and nonalcoholic steatohepatitis[J].World Journal of Chinese digestion. 2003, 11(7): 1043-1045. Tilg H, Moschen A R, Roden M. NAFLD and diabetes mellitus[J]. Nat Rev Gastroenterol Hepatol. 2017, 14(1): 32-42. Ulasov A V, Rosenkranz A A, Georgiev G P, et al. Nrf2/Keap1/ARE signaling: Towards specific regulation[J]. Life Sci. 2022, 291: 120111. Xu L, Yu Y, Sang R, et al. Protective Effects of Taraxasterol against Ethanol-Induced Liver Injury by Regulating CYP2E1/Nrf2/HO-1 and NF-kappaB Signaling Pathways in Mice[J]. Oxid Med Cell Longev. 2018, 2018: 8284107. Zhang Y J, Xu L, Fu Y Q. Clinical observation of combination of traditional Chinese and Western Medicine in the treatment of non-alcoholic Fatty liver with liver stagnation and spleen deficiency Syndrome[J]. Hunan Journal of traditional Chinese Medicine. 2014, 30(08): 58-60. Han Y X, Liu G W Qian J, et al. Clinical observation of Jiangan Jiangzhi Pill combined with Interferon in the treatment of chronic Hepatitis B with non-alcoholic Fatty liver[J]. Tianjin medicine. 2014, 42(06): 610-612. Xue L, Mi Y Q. Jiangan Jiangzhi Pill in the treatment of non-alcoholic Fatty liver[J].Henan traditional Chinese medicine. 2013, 33(04): 525. Bian J, Pan Z H, Bi L P, et al. Preparation and quality Control of Jiangan Jiangzhi Pill[J]. Tianjin Pharmacy. 2010, 22(04): 22-24. Ledford H. First US drug approved for a liver disease surging around the world[J]. Nature. 2024. Velliou R I, Legaki A I, Nikolakopoulou P, et al. Liver endothelial cells in NAFLD and transition to NASH and HCC[J]. Cell Mol Life Sci. 2023, 80(11): 314. Parlati L, Regnier M, Guillou H, et al. New targets for NAFLD[J]. JHEP Rep. 2021, 3(6): 100346. Shao L N, Zhang S T, Duan Y, et al. Study on the relationship between HCV RNA virus load, liver function and albumin[J]. . Journal of Clinical Hematology. 2018, 31(08): 596-599. Huang C Q, Liu Y H, Wang X X. Effect of Lipid autophagy on liver Lipid Metabolism and its Mechanism[J]. Life science. 2023, 35(09): 1147-1159. Gao Wen, Wang Jianhua. Research progress on the role of non-parenchymal cells in non-alcoholic steatohepatitis[J]. Pharmaceutical progress. 2020, 44(03): 179-193. Loomba R, Friedman S L, Shulman G I. Mechanisms and disease consequences of nonalcoholic fatty liver disease[J]. Cell. 2021, 184(10): 2537-2564. Lu X L, Jiang Y Y, Cao Q. The role of oxidative stress and nuclear factor E2 related factor 2 in non-alcoholic fatty liver disease[J].Journal of Clinical Hepatobiliary Diseases. 2020, 36(04): 924-927. He F, Ru X, Wen T. NRF2, a Transcription Factor for Stress Response and Beyond[J]. Int J Mol Sci. 2020, 21(13). Baird L, Yamamoto M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway[J]. Mol Cell Biol. 2020, 40(13). Li H, Yang L. Molecular Regulation Mechanism of antioxidation of Nrf2[J]. Bioinformatics. 2018, 16(01): 1-6. Li J, Wang T, Liu P, et al. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD[J]. Food Funct. 2021, 12(9): 3898-3918. Du D, Lv W, Su R, et al. Hydrolyzed camel whey protein alleviated heat stress-induced hepatocyte damage by activated Nrf2/HO-1 signaling pathway and inhibited NF-kappaB/NLRP3 axis[J]. Cell Stress Chaperones. 2021, 26(2): 387-401. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5709043","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":399957150,"identity":"d09d7d3d-0979-4558-a62d-0542bbd91d38","order_by":0,"name":"Xue Jiao","email":"","orcid":"","institution":"Tianjin University of traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Jiao","suffix":""},{"id":399957151,"identity":"eebbd414-7018-4461-a56e-ab0639b8d1f0","order_by":1,"name":"Li Wang","email":"","orcid":"","institution":"Tianjin second people's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Wang","suffix":""},{"id":399957152,"identity":"00e6bd29-8b41-4fd5-9abb-57e60a584ca3","order_by":2,"name":"Yinglun Li","email":"","orcid":"","institution":"Tianjin second people's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yinglun","middleName":"","lastName":"Li","suffix":""},{"id":399957153,"identity":"5654d564-6b1c-48bc-977d-e1de0040af44","order_by":3,"name":"Jing Liu","email":"","orcid":"","institution":"Tianjin second people's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Liu","suffix":""},{"id":399957154,"identity":"00a83714-5a2b-4ab0-ab3c-32ba920fb345","order_by":4,"name":"Qian Wei","email":"","orcid":"","institution":"Tianjin second people's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Wei","suffix":""},{"id":399957155,"identity":"fff90626-99e3-419c-8c9a-dc11df8fbd9f","order_by":5,"name":"Yuqiang Mi","email":"","orcid":"","institution":"Tianjin second people's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yuqiang","middleName":"","lastName":"Mi","suffix":""},{"id":399957156,"identity":"0badd719-469b-4154-87ac-1f773030bcd6","order_by":6,"name":"Ping Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIie3QPQqDMBTA8YRAukRd49YjRApOYg/SJUVw6+7gECjEsavHEHqByAMnoVcI9AIeoNCPqaNvLDS/LfD+kPcICYKfBIYsqigTxsCjAkFGQ/umrtKO1wqZUMPEDHS4ia1EJXs6Wh9ZxnYgiCJtccB8rFOp5XEOkfNkqk8GkViZWcFyiLWiBpDJ0Up6PQsl8YmbFR0YOnFjl5lGVxLeR9aYXTY9TPeHepbJBcAvbbGeEOn496FXxz8Sw9eHgiAI/tsL5NhAcu077D8AAAAASUVORK5CYII=","orcid":"","institution":"Tianjin second people's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Ping","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-12-25 04:38:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5709043/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5709043/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":73659960,"identity":"c12fee88-b7fc-402a-b789-7e26d0526488","added_by":"auto","created_at":"2025-01-13 10:58:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":292395,"visible":true,"origin":"","legend":"\u003cp\u003eeffect of Jiangan Jiangzhi Pill on body weight, liver index and biochemical indexes of NASH mice induced by MCD (x ±s, n = 10)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/42cf292978a253c13e319866.png"},{"id":73660389,"identity":"8ee43ec3-5749-474f-921d-99ba43072117","added_by":"auto","created_at":"2025-01-13 11:06:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":438417,"visible":true,"origin":"","legend":"\u003cp\u003eeffect of Jiangan Jiangzhi Pill on pathological changes of NASH mice induced by MCD (HE staining, HE × 100 ~ 10)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/dbc2a1b3d5f2015f156616c5.png"},{"id":73660390,"identity":"422bc02c-5638-46c8-b45e-51457d5d03fc","added_by":"auto","created_at":"2025-01-13 11:06:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":543318,"visible":true,"origin":"","legend":"\u003cp\u003eeffect of Jiangan Jiangzhi Pill on pathological changes of NASH mice induced by MCD (Oil Red O staining, HE × 100 ~ (th))\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/b6ea3cbadf368e87038198c0.png"},{"id":73661441,"identity":"f01f0cc9-f5f1-4dde-98c6-fb71d5a8f926","added_by":"auto","created_at":"2025-01-13 11:14:50","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":212118,"visible":true,"origin":"","legend":"\u003cp\u003eeffect of Jiangan Jiangzhi Pill on antioxidation in NASH mice induced by MCD (x ±s, n = 10)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/9ceadf058c79f59b00b822e8.png"},{"id":73659965,"identity":"fee4239a-add3-4ed7-9aff-d5e1589cbbe5","added_by":"auto","created_at":"2025-01-13 10:58:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":233967,"visible":true,"origin":"","legend":"\u003cp\u003eeffect of Jiangan Jiangzhi Pill on the expression of genes related to NRF2 pathway induced by MCD in NASH mice (x ±s, n = 10)\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/26df6457c124578c53cad399.png"},{"id":73659976,"identity":"1de8b063-dba0-4b4c-80e4-fe575e351238","added_by":"auto","created_at":"2025-01-13 10:58:50","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":296773,"visible":true,"origin":"","legend":"\u003cp\u003eeffect of Jiangan Jiangzhi Pill on protein expression of NRF2 signal pathway induced by MCD in NASH mice (x ±s, n = 10)\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/2ff7b7ce9f6fe870f2c0cf52.png"},{"id":74364143,"identity":"a459d90e-b398-49c7-a412-6e259751e1f9","added_by":"auto","created_at":"2025-01-21 13:40:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2410686,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5709043/v1/49536c38-f9be-497d-aa89-d0b08b7617cd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanism of Jiangan Jiangzhi Pill NRF2 pathway in the treatment of steatohepatitis in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNonalcoholic steatohepatitis (Nonalcoholic steatohepatitis,NASH) is a liver disease developed from nonalcoholic fatty liver disease (Nonalcoholic fatty liver disease NAFLD). Its histological manifestations are steatosis, inflammation and fibrosis\u003csup\u003e[1]\u003c/sup\u003e. At present, the incidence of this disease is getting higher and higher, posing a major burden on global health\u0026nbsp;\u003csup\u003e[2]\u003c/sup\u003e Metabolic syndrome, obesity and liver insulin resistance are considered to be closely related to the pathogenesis of NASH\u003csup\u003e[3, 4]\u003c/sup\u003e Lipogenesis is a key factor in the early progression of NASH. Free fatty acids (free fatty acids FFA) in hepatocytes may induce hepatocyte injury through oxidative stress and participate in the occurrence and progression of NASH\u0026nbsp;\u003csup\u003e[5, 6]\u003c/sup\u003e. Modern studies have shown that NRF2 signal pathway can regulate lipid peroxidation and free radical damage in liver tissue, enhance the antioxidant capacity of the body, and protect damaged liver tissue\u003csup\u003e[7, 8]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eJiangan Jiangzhi Pill is composed of 11 traditional Chinese medicines such as Polygonum multiflorum, Salvia miltiorrhiza, semen Cassiae, Hawthorn, alisma, lotus leaf and so on according to the traditional Chinese medicine theory in Tianjin second people's Hospital. It has the effect of soothing the liver and invigorating the spleen, promoting blood circulation and removing blood stasis, eliminating fat and guiding stagnation. Suitable for fatty liver, alcoholic hepatitis, hyperlipidemia and so on. It has the medicinal properties of nourishing yin, nourishing the liver and spleen, invigorating the spleen and lowering blood fat, hence the name\u003csup\u003e[9]\u003c/sup\u003e. Studies have shown that Jiangan Jiangzhi pills can reduce blood lipids, improve liver function, reduce the course of fatty liver, and treat non-alcoholic fatty liver\u003csup\u003e[10-12]\u003c/sup\u003e. In this study, the model of non-NASH mice was established by methionine choline deficiency diet, and then different doses of Jiangan Jiangzhi Pill were given to NASH mice. Firstly, the therapeutic effect of Jiangan Jiangzhi Pill on NASH mice was evaluated. Secondly, the effect of Jiangan Jiangzhi Pill on liver oxidative stress in NASH mice was studied. Finally, Western blot and qPCR were used to detect the effects of Jiangan Jiangzhi Pill on the expression of proteins and genes related to NRF2 signal pathway in NASH mice.\u003c/p\u003e"},{"header":"1 Experimental Materials","content":"\u003cp\u003e\u003cstrong\u003e1.1 Experimental Animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e60 adult male 8-week-old C57BL/6 mice, weighing 20 ±2 g, were provided by Beijing Huafukang Biotechnology Co., Ltd. The mice were raised in SPF clean environment and ate freely. This experiment was approved by the Animal Ethics Committee of Nankai University (approval No. 2021-SYDWLL-000003) and raised in the Experimental Animal Center of Nankai University. The experimental research strictly abides by the regulations of the people's Republic of China on the Administration of Experimental Animals and the relevant ethical principles.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2 Experimental drug\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;methionine choline deficiency feed (Methionine-choline deficient,MCD, item number: SBF081722, Beijing Sibeifu Biotechnology Co., Ltd.); Polyene phosphatidylcholine (batch number: CBJD106, Sanofi (Beijing) Pharmaceutical Co., Ltd.); TG detection kit (item number: A110-1-1, Nanjing Institute of Biology) TC test kit (number: A111-1-1, Nanjing Institute of Biology) ALT test kit (item number: C009-1-1, Nanjing Institute of Biology); AST kit (number: C0101-2-1, Nanjing Institute of Biology); SOD kit (number: A111-1-1, Nanjing Institute of Biology); MDA kit (number: C009-1-1, Nanjing Institute of Biology) GSH-Px detection kit (Ref.: C0101-2-1, Nanjing Institute of Biology); NRF2 Antibody (Ref.: 16396-1 quotient Proteintech); HO-1 Antibody (Ref.: 10701-1 lichene Proteintech); GCLC Antibody (Ref.: 12601-1Mube APP Proteintech); NQO1 Antibody (Ref.: 67240-1Mutual IgM Proteintech); β-actin Antibody (Ref.: 20536-1fAPP Proteintech) Total protein quantitative determination kit (item number: A045-4-2, Nanjing Institute of Biology) BCA protein concentration determination kit (item number: PC0020,Solarbio)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.3Experimental instruments:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ehigh performance universal desktop freezing centrifuge (ThermoFisher Seymour Fischer Sorvall ST 16R); Multifunctional enzyme labeling instrument (Thermo Company, USA); Optical microscope (Nikon ECLIPSE TS100); fluorescence quantitative PCR instrument (Bio-RAD iQTM5); Electrophoresis instrument (Beijing Junyi Oriental Electrophoretic equipment Co., Ltd.); Electrophoretic trough (Beijing Junyi Oriental Electrophoretic equipment Co., Ltd.) Transfer slot (Beijing Junyi Oriental Electrophoresis equipment Co., Ltd.); Shaker (Tianjin Oonuo instrument Co., Ltd.)\u003c/p\u003e"},{"header":"2 Experimental methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Experimental grouping and administration regimen\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.1Construction and grouping of NASH mouse model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter a week of routine feeding, 60 male C57BL/6 mice were randomly divided into 6 groups: normal group, model group, positive drug group, low dose group, middle dose group and high dose group, with 10 mice in each group. The normal group was fed with normal diet, and the other groups were fed with MCD feed to establish NASH model for 6 weeks.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.2 configuration of gastric solution of Jiangan Jiangzhi Pill\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePut the honey pills of the required quality into a mortar and grind them into powder. 0.1ml-0.4 ml saline per 10 g body weight. Add the powder to the corresponding mass of saline and stir gently with a glass rod to make the drug fully dissolve. As honey pills contain honey sticky substances, the dissolution process can be lengthened until it is completely dissolved.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1.3 Animal administration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSix weeks later, the model was successfully administered, and the normal group and the model group were given the same volume of normal saline every day, and the positive drug group was given 150 mg/kg; of Polyene phosphatidylcholine capsule every day in the Jiangan Jiangan Jiangzhi low dose group. Jiangan Jiangan Jiangzhi 100 mg/kg; Jiangan Jiangzhi middle dose group was gavaged with Jiangan Jiangzhi 200 mg/kg; Jiangan Jiangzhi high dose group. Each group was administered continuously for 6 weeks, and the general conditions of mice in each group were observed and compared in the course of the experiment. The gastric administration dose of the above groups (converted according to the equivalent dose ratio table of human (70kg) and animal surface area) was 10 times of that of clinical adults per kilogram body weight, and the gastric administration dose of mice was 0.1 ml per 10g body weight.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Index observation:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;after the beginning of administration, the body weight of mice in each group was weighed every week, and after modeling and administration, the weight of liver was weighed and the liver index was calculated. The liver index formula is: liver index (%) = liver weight (g) / body weight (g) \u0026times; 100%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3Detection of serum liver function index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter modeling and administration, the blood was taken from the medial canthus of the mouse, placed at room temperature for 30 min, centrifuged at 4 ℃ (3000 r/min) for 15 min, and the supernatant was stored at-80 ℃ for testing. The contents of ALT and AST in serum of mice in each group were determined by biochemical kit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Detection of biochemical indexes in liver tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e100 mg liver tissue was added to 900 \u0026mu; L normal saline, homogenized by ultrasound and centrifuged at low temperature (3000 r/min) for 15 min. The supernatant was collected. The protein level in tissue homogenate was homogenized with BCA kit, and the levels of TC, TG, SOD, MDA and GSH-Px in liver tissue were detected according to the kit. The specific method is completed according to the steps of the kit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 pathological observation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter modeling and administration, the liver tissues of mice in each group were collected, fixed with formalin solution, embedded in paraffin, made into 3 \u0026mu; m sections, routine HE staining, and the pathological changes of liver tissue in each group were observed under light microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn addition, the fresh liver tissue was frozen in liquid nitrogen, frozen sections were made and stained with oil red O. And then immediately observe it under an optical microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 PCR detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total RNA of mouse liver tissue was extracted by Trizol method, and the quantity and purity of RNA were detected. RNA was inversely transcribed into cDNA by reverse transcription kit, and real-time fluorescence quantitative PCR detection was carried out by PCR reaction system. The PCR reaction conditions were as follows: pre-denaturation at 94 ℃ 120 s at 94 ℃, denaturation at 94 ℃ for 30 s, annealing at 52 ℃ for 30 s, 60 ℃ extension at 60 ℃ for 40 cycles. The relative expressions of Nrf2, Ho1, Gclc and Nqo1 were calculated with Actb as the internal reference, and the results were processed by 2-dimensional CT method. The sequence of primers is shown in Table 1.\u003c/p\u003e\n\u003cp\u003eTable 1\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"401\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003eNrf2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eForward: CAGAGTGATGGTTGCCCACT\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eReverse: CACACACTTTCTGCGTGCTC\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003eHo1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eForward:\u0026nbsp;GAAATCATCCCTTGCACGCC\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eReverse: CCTGAGAGGTCACCCAGGTA\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003eGclc\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eForward: AAGGACGTGCTCAAGTGGG\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eReverse: AGGCGTTCCTTCGATCATGT\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003eNqo1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eForward:\u0026nbsp;CATTGCAGTGGTTTGGGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eReverse:\u0026nbsp;TCTGGAAAGGACCGTTGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003eActb\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eForward: GATATCGCTGCGCTGGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 329px;\"\u003e\n \u003cp\u003eReverse: CATTCCCACCATCACACCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Western blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe obtained mouse liver tissue was added to the RIPA cleavage buffer, and the protein was retained after homogenate centrifugation. BCA protein assay kit was used to determine the concentration of total protein. The protein separated from each sample was transferred to PVDF membrane after 8%-12%SDS-PAGE electrophoresis (the membrane was sealed with 5% skimmed milk powder at room temperature for 2 hours, and then different first antibody NRF2 (dilution ratio 1NRF2 2000), HO-1 (dilution ratio 1vv2000), GCLC (dilution ratio 1vv8000), NQO1 (dilution ratio 110000) and \u0026beta;-actin (dilution ratio 110,000) were added respectively, and incubated overnight at 4 ℃. After washing the membrane, the corresponding secondary antibody (diluted ratio 1 / 10 000) was added and incubated at room temperature for 2 hours. After washing the membrane with TBST, ECL reagent was added to develop the image. The strip is analyzed quantitatively by using image pro plus 6.0software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 Statistical processing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental results were analyzed by SPSS Statistics 20.0 statistical software. the measurement data were expressed as X \u0026plusmn;S, t-test was used, and single factor analysis of variance was used to compare the mean among groups. P \u0026lt; 0.05 was statistically significant.\u003c/p\u003e"},{"header":"3 Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 body weight and liver index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of body weight showed that the body weight of mice in the model group was lower than that in the normal group (P \u0026lt; 0.01). Compared with the model group, the body weight of positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01, P \u0026lt; 0.01). (fig. 1- a)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;the results of liver index showed that the liver index of model group was higher than that of normal group (P \u0026lt; 0.01). Compared with the model group, the liver index decreased in positive medicine group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P \u0026lt; 0.01, P \u0026lt; 0.05, P \u0026lt; 0.01). (figure 1-b)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 biochemical index level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of biochemical indexes showed that the ALT of the model group was higher than that of the normal group. Compared with the model group, ALT decreased in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P \u0026lt; 0.01). (figure 1-c)\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the value of AST in the model group increased (P \u0026lt; 0.01). Compared with the model group, AST decreased in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P \u0026lt; 0.05, P \u0026lt; 0.05). (figure 1 -d)\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, TC in the model group increased (P \u0026lt; 0.01). Compared with the model group, the TC in the positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group decreased (P \u0026lt; 0.01). (figure 1-e)\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, TG in the model group increased (P \u0026lt; 0.01). Compared with the model group, TG decreased in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group (P \u0026lt; 0.01). (figure 1-f)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 pathological staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of liver HE staining showed that in the normal group, the liver structure was spaced normally, there was no interstitial edema, and there was no obvious inflammatory cell exudation. In the model group, the liver structure was seriously damaged, interstitial edema, and a large number of inflammatory cell infiltration. In the positive drug group and Jiangan Jiangzhi high dose group, the liver structure of mice was relatively clear, the wall thickened slightly, with a small amount of inflammatory cell infiltration.(figure 2)\u003c/p\u003e\n\u003cp\u003eOil red O staining showed that the nucleus was blue and fat droplets were red. The results showed that there were no obvious fat droplets in the normal group. A large number of fat droplets appeared in the model group. Fat droplets decreased in positive drug group and Jiangan Jiangzhi high high dose group.(figure3)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Antioxidant level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of biochemical indexes showed that the activity of SOD in the model group was lower than that in the normal group. Compared with the model group, the activity of SOD in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01). (fig. 4-a)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;compared with the normal group, the level of MDA in the model group was higher than that in the normal group. Compared with the model group, the level of MDA in positive medicine group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group decreased (P \u0026lt; 0.01). (fig. 4-b)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;compared with the normal group, the activity of GSH-Px in the model group was lower than that in the normal group (P \u0026lt; 0.01). Compared with the model group, the activity of GSH-Px in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01, P \u0026lt; 0.05). (figure 4-c)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 expression level of genes related to NRF2 pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of PCR showed that the relative expression of Nrf2 mRNA in the model group was significantly lower than that in the normal group. Compared with the model group, the expression of Nrf2 mRNA in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01, P \u0026lt; 0.05, P \u0026lt; 0.01). (figure 5 -a)\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the relative expression of Ho1 mRNA in the model group was significantly decreased (P \u0026lt; 0.01). Compared with the model group, the expression of Ho1 mRNA in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01, P \u0026lt; 0.05). (figure 5-b)\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the relative expression of Gclc mRNA in the model group was significantly decreased (P \u0026lt; 0.01). Compared with the model group, the expression of Gclc mRNA in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01, P \u0026lt; 0.05, P \u0026lt; 0.05). (figure 5 -c)\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the relative expression of Nqo1 mRNA in the model group was significantly decreased (P \u0026lt; 0.01). Compared with the model group, the expression of Nqo1 mRNA in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01, P \u0026lt; 0.05). (figure 5-d)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 expression level of proteins related to NRF2 pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of Western blot showed that the relative expression of NRF2 protein in the model group was significantly lower than that in the normal group. Compared with the model group, the relative expression of Nrf2 protein in the positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the relative expression of HO-1 protein in the model group was significantly decreased (P \u0026lt; 0.01). Compared with the model group, the relative expression of HO-1 protein in the positive drug group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the relative expression of GCLC protein in the model group was significantly decreased (P \u0026lt; 0.01). Compared with the model group, the relative expression of GCLC protein in positive drug group, Jiangan Jiangzhi low dose group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group increased (P \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the relative expression of NQO1 protein in the model group was significantly decreased (P \u0026lt; 0.01). Compared with the model group, the relative expression of NQO1 protein in positive drug group, Jiangan Jiangzhi middle dose group and Jiangan Jiangzhi high dose group was significantly higher than that in model group (P \u0026lt; 0.01). (figure 6)\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eNASH is considered to be a liver manifestation of metabolic syndrome, and the incidence of obesity, hyperlipidemia and type 2 diabetes is on the rise worldwide\u003csup\u003e[13, 14]\u003c/sup\u003e. Animal models can not only clarify the pathogenesis of NASH, but also detect the therapeutic effects of various drugs. At present, one of the most widely used NASH models is to feed animals with MCD feed\u003csup\u003e[15]\u003c/sup\u003e. In this study, the results of liver HE staining showed that the structure of hepatocytes in the model group was seriously damaged, the fine cell septum widened, collapsed, and there were a large number of inflammatory cell infiltration, indicating the success of the model. The liver fine cell structure of mice in the positive medicine group and Jiangan Jiangzhi pill low, middle and high dose groups was relatively clear, the cell interval was shortened, with a small amount of inflammatory cell infiltration, indicating that the pathological damage of liver tissue in each dose group of Jiangan Jiangzhi pill was significantly improved, suggesting that Jiangan Jiangzhi pill has an obvious protective effect on liver injury of NASH. ALT and AST are the main enzymes reflecting liver parenchyma damage\u003csup\u003e[16]\u003c/sup\u003e. Clinically, liver function damage is closely related to the increase of AST and ALT levels\u003csup\u003e[11]\u003c/sup\u003e. Hepatocyte lipid accumulation and very low density lipoprotein (VLDL) synthesis decreased, resulting in triglycerides can not be transported out of the liver, thus aggravating intracellular fat accumulation, oxidative stress, resulting in hepatocyte death\u0026nbsp;\u003csup\u003e[17, 18]\u003c/sup\u003e. Compared with the normal group, the levels of AST, ALT, TG and TC in the model group were significantly higher. Compared with the model group, the levels of ALT and TG in the positive drug group, middle and high dose groups of Jiangan Jiangzhi pills were significantly lower than those in the model group. Compared with the model group, the levels of AST and TC in the positive drug group and all dose groups of Jiangan Jiangzhi pills were significantly lower. The above experimental results show that Jiangan Jiangzhi Pill has a therapeutic effect on liver injury induced by MCD.\u003c/p\u003e\n\u003cp\u003eNASH is a common chronic liver disease, the pathogenesis is very complex, oxidative stress is one of its important pathogenesis\u003csup\u003e[19]\u003c/sup\u003e. SOD and GSH-Px are important antioxidant enzymes in vivo, and the level of MDA reflects the degree of oxidative stress injury in vivo\u0026nbsp;\u003csup\u003e[20]\u003c/sup\u003e. The results showed that Jiangan Jiangzhi Pill could increase the activities of SOD and GSH-Px and decrease the level of MDA in liver tissue of mice. It has been recently confirmed that Nrf2 is one of the important regulators of cellular antioxidant stress response\u0026nbsp;\u003csup\u003e[21]\u003c/sup\u003e, maintaining the balance between oxidation and antioxidation in the body. When there is more severe or continuous oxidative stimulation or injury, cells can re-enter the nucleus of extranuclear Nrf2 to deal with oxidative damage and improve NASH inflammation by increasing the synthesis of Nrf2, reducing the ubiquitin of extranuclear Nrf2 and slowing down the degradation of Nrf2. It helps to inhibit the progression of liver injury\u003csup\u003e[22-24]\u003c/sup\u003e , while the absence of Nrf2 aggravates inflammation and steatosis induced by high-fat diet in mice\u003csup\u003e[25]\u003c/sup\u003e. The results of this study showed that the PCR results showed that the mRNA expression levels of Nrf2, Ho1, Gclc and Nqo1 in mouse liver tissue decreased. Western blot results showed that the relative expressions of NRF2, HO-1, GCLC and NQO1 proteins in mice were significantly decreased. Compared with the model group, the liver cell structure of mice in the positive drug group (Polyene phosphatidylcholine) and Jiangan Jiangzhi pill groups were clearer and the cell interval was shortened. In the positive drug group with a small amount of inflammatory cell infiltration, the levels of ALT, AST, TG and TC decreased significantly, while the activity of SOD increased and the level of MDA decreased. Increase of GSH-Px activity The mRNA expression of Nrf2, Ho1, Gclc and Nqo1 in liver tissue increased, and the expression of proteins related to NRF2 pathway increased significantly.\u003c/p\u003e\n\u003cp\u003eTo sum up, Jiangan Jiangzhi Pill can reduce the pathological changes of liver tissue, apoptosis and inhibit oxidative stress in mice, and its mechanism may be related to the activation of NRF2 signal pathway and the increase of antioxidant capacity.\u003c/p\u003e\n\u003cp\u003eBased on the previous animal experimental study and clinical observation, this experiment takes the NRF2 signal pathway as the main line to explain the molecular mechanism of Jiangan Jiangzhi Pill in improving NASH, so as to provide a new theoretical basis for Jiangan Jiangzhi Pill in anti-inflammation and liver protection. To investigate the effect of Jiangan Jiangzhi Pill on the occurrence and development of NASH inflammation from proteomics, so as to judge the possible biological effect of this traditional Chinese medicine preparation. This project can give a new connotation to the treatment of NASH and is expected to open up a new train of thought for the treatment of clinical NASH.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eX.J:Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Experimental operation and analysis,Writing- original draftL.W:Experimental operation and analysis,Writing- original draftYL.L:Formal analysis, InvestigationJ.L:Formal analysis, InvestigationQ.W:Formal analysis, Investigation YQ.M:Writing-review \u0026amp; editingP.L:Methodology, Project administration Supervision, Writing-review \u0026amp; editing\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLiu X, Luo Y, Xu M X, et al. Research progress on inflammation-related targets and treatment of nonalcoholic steatohepatitis[J]. Chinese Journal of Pharmacy. 2024, 59(13): 1173-1185.\u003c/li\u003e\n\u003cli\u003eLiu X, Luo Y, Xu M X, et al. Exploring inflammation-related targets: research progress in the treatment of nonalcoholic steatohepatitis[J]. Chinese Journal of Pharmacy.: 1-28.\u003c/li\u003e\n\u003cli\u003eXu X, Poulsen K L, Wu L, et al. Targeted therapeutics and novel signaling pathways in non-alcohol-associated fatty liver/steatohepatitis (NAFL/NASH)[J]. Signal Transduct Target Ther. 2022, 7(1): 287.\u003c/li\u003e\n\u003cli\u003eChen M Q,Fan J G. A brief introduction to the American Clinical practice Guide for the diagnosis and treatment of Nonalcoholic Fatty liver Disease[J]. Practical Journal of liver Diseases. 2022, 25(05): 776-778.\u003c/li\u003e\n\u003cli\u003eGao Z Q, Lu F E. Free fatty acids, insulin resistance and nonalcoholic steatohepatitis[J].World Journal of Chinese digestion. 2003, 11(7): 1043-1045.\u003c/li\u003e\n\u003cli\u003eTilg H, Moschen A R, Roden M. NAFLD and diabetes mellitus[J]. Nat Rev Gastroenterol Hepatol. 2017, 14(1): 32-42.\u003c/li\u003e\n\u003cli\u003eUlasov A V, Rosenkranz A A, Georgiev G P, et al. Nrf2/Keap1/ARE signaling: Towards specific regulation[J]. Life Sci. 2022, 291: 120111.\u003c/li\u003e\n\u003cli\u003eXu L, Yu Y, Sang R, et al. Protective Effects of Taraxasterol against Ethanol-Induced Liver Injury by Regulating CYP2E1/Nrf2/HO-1 and NF-kappaB Signaling Pathways in Mice[J]. Oxid Med Cell Longev. 2018, 2018: 8284107.\u003c/li\u003e\n\u003cli\u003eZhang Y J, Xu L, Fu Y Q. Clinical observation of combination of traditional Chinese and Western Medicine in the treatment of non-alcoholic Fatty liver with liver stagnation and spleen deficiency Syndrome[J]. Hunan Journal of traditional Chinese Medicine. 2014, 30(08): 58-60.\u003c/li\u003e\n\u003cli\u003eHan Y X, Liu G W Qian J, et al. Clinical observation of Jiangan Jiangzhi Pill combined with Interferon in the treatment of chronic Hepatitis B with non-alcoholic Fatty liver[J]. Tianjin medicine. 2014, 42(06): 610-612.\u003c/li\u003e\n\u003cli\u003eXue L, Mi Y Q. Jiangan Jiangzhi Pill in the treatment of non-alcoholic Fatty liver[J].Henan traditional Chinese medicine. 2013, 33(04): 525.\u003c/li\u003e\n\u003cli\u003eBian J, Pan Z H, Bi L P, et al. Preparation and quality Control of Jiangan Jiangzhi Pill[J]. Tianjin Pharmacy. 2010, 22(04): 22-24.\u003c/li\u003e\n\u003cli\u003eLedford H. First US drug approved for a liver disease surging around the world[J]. Nature. 2024.\u003c/li\u003e\n\u003cli\u003eVelliou R I, Legaki A I, Nikolakopoulou P, et al. Liver endothelial cells in NAFLD and transition to NASH and HCC[J]. Cell Mol Life Sci. 2023, 80(11): 314.\u003c/li\u003e\n\u003cli\u003eParlati L, Regnier M, Guillou H, et al. New targets for NAFLD[J]. JHEP Rep. 2021, 3(6): 100346.\u003c/li\u003e\n\u003cli\u003eShao L N, Zhang S T, Duan Y, et al. Study on the relationship between HCV RNA virus load, liver function and albumin[J]. . Journal of Clinical Hematology. 2018, 31(08): 596-599.\u003c/li\u003e\n\u003cli\u003eHuang C Q, Liu Y H, Wang X X. Effect of Lipid autophagy on liver Lipid Metabolism and its Mechanism[J]. Life science. 2023, 35(09): 1147-1159.\u003c/li\u003e\n\u003cli\u003eGao Wen, Wang Jianhua. Research progress on the role of non-parenchymal cells in non-alcoholic steatohepatitis[J]. Pharmaceutical progress. 2020, 44(03): 179-193.\u003c/li\u003e\n\u003cli\u003eLoomba R, Friedman S L, Shulman G I. Mechanisms and disease consequences of nonalcoholic fatty liver disease[J]. Cell. 2021, 184(10): 2537-2564.\u003c/li\u003e\n\u003cli\u003eLu X L, Jiang Y Y, Cao Q. The role of oxidative stress and nuclear factor E2 related factor 2 in non-alcoholic fatty liver disease[J].Journal of Clinical Hepatobiliary Diseases. 2020, 36(04): 924-927.\u003c/li\u003e\n\u003cli\u003eHe F, Ru X, Wen T. NRF2, a Transcription Factor for Stress Response and Beyond[J]. Int J Mol Sci. 2020, 21(13).\u003c/li\u003e\n\u003cli\u003eBaird L, Yamamoto M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway[J]. Mol Cell Biol. 2020, 40(13).\u003c/li\u003e\n\u003cli\u003eLi H, Yang L. Molecular Regulation Mechanism of antioxidation of Nrf2[J]. Bioinformatics. 2018, 16(01): 1-6.\u003c/li\u003e\n\u003cli\u003eLi J, Wang T, Liu P, et al. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD[J]. Food Funct. 2021, 12(9): 3898-3918.\u003c/li\u003e\n\u003cli\u003eDu D, Lv W, Su R, et al. Hydrolyzed camel whey protein alleviated heat stress-induced hepatocyte damage by activated Nrf2/HO-1 signaling pathway and inhibited NF-kappaB/NLRP3 axis[J]. Cell Stress Chaperones. 2021, 26(2): 387-401.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Jiangan Jiangzhi Pill, NRF2 pathway, Nonalcoholic steatohepatitis, Antioxidation, Lipid metabolism, Inflammatory mechanism","lastPublishedDoi":"10.21203/rs.3.rs-5709043/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5709043/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective\u003c/strong\u003e observe the healthy liver cholesterol-lowering pills for methionine choline lack of feed (Methionine-choline deficient,MCD) diet induced nonalcoholic fatty hepatitis (Nonalcoholic steatohepatitis,NASH) mechanism of lipid metabolism and inflammation in mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003eThe mice were randomly divided into control group, model group, positive drug group, low, medium and high dose groups of Jianganjiangzhi pills, 10 mice in each group.The control group ate normal diet, and the other experimental groups ate MCD diet.The positive drug group was intritoneally injected with 150mg/kg polyene phosphatidylcholine, the low, medium and high dose groups of Jiangan Jiangzhi pills were administrated with 100 mg/kg, 200 mg/kg and 400 mg/kg respectively, once a day, and the control group and model group were given equal volume of normal saline in parallel.Weigh and record every 7 days.It lasts six weeks.The histopathological changes of liver were observed by HE staining.Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected by biochemical kit,The levels of total cholesterol (TC), triglyceride (TG), superoxide dismutase (SOD), malondialdehyde (MDA) and glutathione peroxidase (GSH-Px) in liver homogenate were detected by BCA kit.The mRNA expression levels ofNrf2, Ho1, Gclc and Nqo1 in mouse liver tissues were detected by PCR,The expression level ofNRF2 pathway related protein in mouse liver was detected by Western blot .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e Compared with the normal group, the model group had serious liver pathological injury, severe destruction of liver cell structure, widening of cell interval, collapse and infiltration of a large number of inflammatory cells.In the model group, ALT, AST, TG and TC (P\u0026lt;0.01) levels were significantly increased, SOD activity was decreased, MDA level was increased, and GSH-Px activity was decreased. PCR results showed that mRNA expression levels ofNrf2, Ho1, Gclc and\u003c/p\u003e\n\u003cp\u003eNqo1 in mouse liver tissues were decreased.Westernblot results showed that the relative expression levels ofNRF2, HO-1,GCLC and NQO1 proteins in mice were significantly decreased. Compared with the model group, the liver cell structure of mice in positive drug group (polyene phosphatidylcholine) and Jianggan Jiangzhiwan low-dose, medium-dose and high-dose groups was more clear, with a shorter cell interval and a small amount of inflammatory cell infiltration,ALT, AST,TG and TC levels decreased significantly, SOD activity increased, MDA level decreased, GSH-Px activity increased. The mRNA expression levels ofNrf2, Ho1, Gclc and Nqo1 in liver tissues were increased, and the protein expression levels of NRF2 pathway related proteins were significantly increased.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e Jiangan Jiangzhi pills(健肝降脂丸) can regulate NRF2 pathway to enhance antioxidant capacity and reduce liver steatosis and inflammation in mice with NASH\u003c/p\u003e","manuscriptTitle":"Mechanism of Jiangan Jiangzhi Pill NRF2 pathway in the treatment of steatohepatitis in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-13 10:58:45","doi":"10.21203/rs.3.rs-5709043/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"415c15fb-6c73-406b-86ad-8d4a900b8c65","owner":[],"postedDate":"January 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-21T13:40:26+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-13 10:58:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5709043","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5709043","identity":"rs-5709043","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.