Sex-Specific Disruption in Human Placental miRNAs and mRNAs Involved in IUGR Placental Insufficiency and Capillary Angiogenesis

preprint OA: closed
Full text JSON View at publisher
⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-17 · read from full text ⓘ

This preprint investigates sex-specific disruptions in placental microRNAs and mRNAs associated with intrauterine growth restriction (IUGR) by analyzing term placentas from 12 control and 20 IUGR pregnancies. The researchers found that IUGR is linked to altered expression of genes involved in steroidogenesis, inflammation, and angiogenesis, with distinct miRNA profiles emerging based on fetal sex. Specifically, female IUGR placentas showed upregulation of MIR451A and downregulation of MIR543 alongside reduced CD34 staining, indicating impaired capillary development, while male IUGR placentas exhibited upregulated MIR520G. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Intrauterine growth restriction (IUGR) is one of the most common pregnancy complications culminating in adverse fetal outcome, including preterm birth, neonatal mortality and stillbirth. Compromised placental development and function, especially disruption in angiogenesis and inadequate nutrient supply are contributing factors. Fetal sex also influences placental function. Knowledge of gene expression changes and epigenetic factors contributing to placental dysfunction in IUGR pregnancies will help identify biomarkers and help target interventions. This study tested the hypothesis that IUGR pregnancies are associated with sexually-dimorphic disruptions in miRNA - an epigenetic factor and mRNAs invloving key mediators of angiogenesis and microvessel development. Changes in expression of key genes/proteins involved in placental dysfunction by RT-PCR and immunohistochemistry and miRNA changes by RNA sequencing were undertaken with term placenta from 12 control and 20 IUGR pregnancies. Findings showed sex-dependent changes in expression of genes involved in steroidogenesis, steroid action, IGF family members, inflammatory cytokines and angiogenic factors in IUGR pregnancies. In addition, upregulation of MIR451A and downregulation of MIR543 in placentas from IUGR group with female newborns and upregulation of MIR520G in placentas from IUGR group with male newborns were also noted. MIR451A and MIR543 have been implicated in angiogenesis. Consistent with gene changes, CD34, the microvessel angiogenesis marker, also showed reduced staining only in female IUGR group. These findings provide evidence in support of sexual dimorphism in the capillary development of IUGR manifested at the level of key mediators of placental angiogenesis and placental function that include changes in expression of miRNA with potential to serve as biomarkers.
Full text 228,222 characters · extracted from preprint-html · click to expand
Sex-Specific Disruption in Human Placental miRNAs and mRNAs Involved in IUGR Placental Insufficiency and Capillary Angiogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Article Sex-Specific Disruption in Human Placental miRNAs and mRNAs Involved in IUGR Placental Insufficiency and Capillary Angiogenesis Wenhui Song, Qing Guo, Muraly Puttabyatappa, Venkateswaran Ramamoorthi Elangovan, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2207891/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Intrauterine growth restriction (IUGR) is one of the most common pregnancy complications culminating in adverse fetal outcome, including preterm birth, neonatal mortality and stillbirth. Compromised placental development and function, especially disruption in angiogenesis and inadequate nutrient supply are contributing factors. Fetal sex also influences placental function. Knowledge of gene expression changes and epigenetic factors contributing to placental dysfunction in IUGR pregnancies will help identify biomarkers and help target interventions. This study tested the hypothesis that IUGR pregnancies are associated with sexually-dimorphic disruptions in miRNA - an epigenetic factor and mRNAs invloving key mediators of angiogenesis and microvessel development. Changes in expression of key genes/proteins involved in placental dysfunction by RT-PCR and immunohistochemistry and miRNA changes by RNA sequencing were undertaken with term placenta from 12 control and 20 IUGR pregnancies. Findings showed sex-dependent changes in expression of genes involved in steroidogenesis, steroid action, IGF family members, inflammatory cytokines and angiogenic factors in IUGR pregnancies. In addition, upregulation of MIR451A and downregulation of MIR543 in placentas from IUGR group with female newborns and upregulation of MIR520G in placentas from IUGR group with male newborns were also noted. MIR451A and MIR543 have been implicated in angiogenesis. Consistent with gene changes, CD34, the microvessel angiogenesis marker, also showed reduced staining only in female IUGR group. These findings provide evidence in support of sexual dimorphism in the capillary development of IUGR manifested at the level of key mediators of placental angiogenesis and placental function that include changes in expression of miRNA with potential to serve as biomarkers. Biological sciences/Developmental biology Biological sciences/Genetics Biological sciences/Molecular biology Biological sciences/Structural biology IUGR placenta epigenetics angiogenesis inflammation miRNA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Intrauterine growth restriction (IUGR) is one of the most common pregnancy complications. Approximately 10–15% of pregnancies are affected by IUGR, defined as the failure of the fetus to reach its genetically determined growth potential with fetal weight less than the 10th percentile for gestation age ( 1 ). IUGR can lead to adverse fetal outcomes, including preterm birth, neonatal mortality and even stillbirth with 30% of stillbirth ascribed to IUGR ( 2 ). The incidence of preterm labor and fetal mortality of IUGR offspring is significantly higher than the normal birth weight babies ( 3 – 5 ). The surviving IUGR offspring are also at increased risk of developing cardiometabolic diseases during childhood and adulthood ( 6 – 8 ). Evidence that low birth weight male offsprings are more vulnerable to cardiovascular disease than low birth weight female offsprings ( 9 ), suggests the susceptibility to intrauterine insults and consequent postnatal outcomes may differ by sex of offspring ( 10 ). Relative to mediators of IUGR, it is important to recognize prenatal period, when most tissue and organ differentiation occurs ( 11 , 12 ), is a susceptibility window for insults. Adequate placentation and optimal placental function are required for normal fetal development and successful pregnancy outcome. The birth weight range of male and female was different mediated by the sex-specific placental efficiency ( 13 ). As a conduit between the mother and fetus, placenta is involved in providing nutrients and oxygen, removal of waste products, metabolization of nutrients, and production of hormones - all required to promote fetal growth. Placenta also helps maintain a conductive intrauterine environment by undergoing structural and functional adaptations to accommodate fetal growth in response to changing environmental milieu ( 14 ). While the majority of IUGR cases are idiopathic causes, many involve compromised placental development and function, especially due to impairment of placental angiogenesis and insufficient oxygen and nutrient supply to the fetus ( 15 – 18 ). Placental development involves the differentiation of cytotrophoblasts into extravillous trophoblast cells (EVTs) and syncytiotrophoblast, invasion of EVTs, and remodeling of maternal spiral arteries such that syncytiotrophoblast are in direct contact with maternal blood in a structure called placental terminal villi. Terminal villi in placenta is the basic functional unit for transfer of oxygen and nourishment between mother and the fetus. It is in these smallest branches of placental villous trees through which diffusive transport of oxygen and nutrients occur between the outer surface of the trophoblast layer and the inner surface of the fetal capillary endothelium ( 19 ). As the functional component in terminal villi ( 20 ), the efficiency of terminal villi and of the placenta relies mainly on the microvessel density of capillaries. Since placental size, morphology, and angiogenesis dictates placental function, pregnancies associated with IUGR are often associated with significantly reduced placental size and weight ( 21 ). These changes are also associated with reduction in capillarization of the terminal villi and reduced cytotrophoblast proliferation along with focal syncytiotrophoblast apoptosis and necrosis ( 22 – 25 ). Such changes can contribute to reduction in peripheral vascularity of the placental villi, increase in vascular resistance and decrease in umbilical cord blood flow ( 26 ). Histomorphological changes in capillary in terminal villi exert direct effect on fetal perfusion and fetal growth as shown with hypovascularization in terminal villi of placenta from severe IUGR pregnancies ( 27 , 28 ) and decreased microvessel density associated with small for gestational age placentae ( 29 ). Angiogenic factors, such as vascular endothelial growth factor A (VEGFA) ( 30 ), endocrine gland-derived vascular endothelial growth factor (EG-VEGF) ( 31 ), placenta growth factor (PlGF) ( 32 ), hypoxia inducible factor 1 subunit alpha (HIF1A) ( 33 ), Angiopoietin 1 (ANG1) and ANG2 ( 34 )were reported to be involved in microvessel formation in terminal villi. While aberrant gene expression of associated angiogenic factors may underlie impaired microvessel formation, the factors contributing to this are not fully understood. Other mechanisms linking poor placental function in IUGR pregnancies are the abnormal inflammatory response, both systemically at maternal and locally at the level of placenta ( 35 ), altered steroidogenesis ( 36 ), and impaired insulin-like growth factor (IGF) family signaling ( 37 ). Lipopolysaccharide induced IUGR, has been shown to be associated with increase in tumor necrosis factor alpha (TNF) release and impaired invasion of trophoblast and remodeling of spiral artery ( 38 ) supporting inflammation mediated role in placental angiogenesis and development of IUGR. The expression of proinflammatory cytokines are also regulated by equilibrium between steroid hormones glucocorticoids and progesterone with progesterone stimulating pregnancy protecting T cells ( 39 ) and glucocorticoids promoting proinflammatory cytokine expression ( 40 ) thus supportive of placental steroidogenesis impacting IUGR development. Likewise, decreased expression of placental IGF1 and its receptor (IGF1R) are reported to be linked with IUGR ( 41 ). Even more importantly, fetal sex has been found to influence the manifestation of placental dysfunctions ( 42 ). Morphologic findings from fetoplacental capillary studies both in humans ( 43 , 44 ) and animals ( 45 , 46 ) have provided evidence supportive of sexually-dimorphic effects. Similarly, higher level of proinflammatory factors in preeclamptic placenta and higher risk of poor outcomes were seen in pregnancies with male offspring compared to those with female offspring ( 13 ). With growing evidence pointing to sexually dimorphic changes in placental angiogenic factor ( 47 , 48 ) and inflammatory gene ( 49 , 50 ) expression, it is necessary to gain and understanding of the placental adaptive capability relative to angiogenesis that underlie this sex specific IUGR responses in human. Aberrant expression of genes underlying placental disruptions in turn may be driven by epigenetic alterations mediated by, among others, the microRNA (miRNA). MiRNAs are a class of non-coding RNAs of 18–22 base pair, single nucleotide strand that can regulate gene expression by targeting mRNAs and transiently blocking translation or inducing degradation of the mRNA without altering the gene sequence ( 51 ). In humans, placenta-specific miRNA clusters have been identified on chromosomes 14 and 19 ( 52 ). Placental miRNAs are being actively investigated not only because of their role in the growth and function of the placenta but also due to their evolving role in the pregnancy complications including IUGR ( 18 , 53 ). Additionally, miRNAs are also emerging as diagnostic biomarkers as they are readily detectable in the maternal circulation. Of interest, one study reported sex-specific patterns of circulating maternal miRNAs in IUGR pregnancies that contributed to placental insufficiency through validated targets including angiogenetic factors, insulin-like growth factors and its receptors, apoptosis regulators ( 54 ). These findings raise the possibility for miRNAs to have the potential to serve as non-invasive sex-specific biomarkers for IUGR and emphasize need for further investigations in this regard. Therefore, the goal of this project is to test the hypothesis that IUGR pregnancies are associated with disruption in miRNA and mRNAs involving key regulators of angiogenesis and microvessel development as well as the sex-specificity of such responses. This hypothesis was tested in term placenta collected from primipara with normal and IUGR pregnancies taking into consideration the impact of fetal sex. 2. Results 2.1 Subjects and Placental Characteristics The demographics of the 32 subjects from this study are summarized in Table 1 . This cohort comprised of Asian women with a mean age of 28.18 (range 21–34 years). This homogeneous group consists of only married, non-smoking, primiparous women of similar pre-pregnancy body mass index (BMI) and comparable gestational weight gain. Most women reported to have a college degree and had mostly vaginal birth and were of full term and showed no difference among mothers from control and IUGR group. The placental and fetal characteristics comparing the control and IUGR subjects are shown in the Fig. 1. The placental weight tended ( p = 0.08) to be lower among IUGR patients however this was not evident when IUGR mothers were segregated based on the sex of the newborn. The placental volume showed significant decrease among IUGR mothers with this trend evident by large magnitude effect among the mothers with male newborns. In line with this birth weight was significantly lower for those born to the mothers from the IUGR group and this was evident even when the newborns were segregated based on their sex. Likewise, the placental efficiency calculated as the ratio of birth weight to the placental weight was significantly lower among IUGR subjects and this was also evident among both sexes of the newborn. Table 1 Demographics of the pregnant women (n = 32) N (%) or Median (range min-max) N (%) or Median (range min-max) Mother IUGR Male Female Control Male Female Infant sex 20 7 13 12 9 3 Age (years) 28.45(23–34) 26.71(23–31) 29.38(26–34) 27.67(21–32) 27.89(22–32) 27(21–32) Race Asian 20 7 13 12 9 3 Pre-pregnancy BMI 20.31 20.36 20.38 20.70 20.73 19.73 Pre-pregnancy weight (kg) 53.38(40–70) 52.36(46–62) 53.92(40–70) 54.67(46–65) 55.22(48–65) 53(46–63) Weight near term (kg) 67.90(55–88) 69.29(60–76) 67.15(55–88) 71.50(60–88) 71.33(65–85) 72.00(60–88) Gestational weight gain (kg) 12.63(-4-23) 16.93(8–23) 13.23(-4-21) 16.83(10–25) 16.11(10–23) 19.00(10–25) Parity 0 100% 7 13 100% 9 3 1 - - - - - - 2 - - - - - - 3 - - - - - - 4 - - - - - - Smoking status Never 100% 7 13 100% 9 3 Past smoker - - - - - - Education (n = 32) High school 5 3 2 5 3 2 Some college 1 1 0 1 1 0 ≥ Bachelor’s 14 3 11 6 5 1 Marital status Married 100% 7 13 100% 9 3 Single - - - - - - Infant Route of delivery Cesarean 2 1 1 0 0 0 Vaginal 18 6 12 12 9 3 Gestational age (days) 39.49(38.00-40.43) 39.20(38.00-40.43) 39.65(38.14–40.57) 39.32(38.29–40.43) 39.33(38.57–40.43) 39.29(38.29–40.14) Birth weight (g) 2650.50(2130–2900) 2655.71(2500–2790) 2647.69(2130–2900) 3250.83(3000–3620) 3240.00(3040–3620) 3283.33(3000–3500) 2.2 Placental Apoptosis and Proliferation State Placental apoptosis measured via caspase 3 activity did not show any changes between control and IUGR groups. However, when segregated by the sex of the offspring born the caspase 3 activity tended to be lower in placentas from male newborn (p = 0.07) while in those with female newborns there was a large magnitude increase in caspase 3 activity (Fig. 2). Cellular proliferation marker Ki67 immunostaining showed a significant increase in placentas from the IUGR group. This increase was only evident among the placentas with male newborns when segregated by sex of the newborn (Fig. 2). 2.3 Placental Gene Expression of Steroidogenic Genes Placental gene expression of 17 hydroxy steroid dehydrogenase B ( HSD17B ) and aromatase ( CYP19 ) were significantly lower in the IUGR group (Fig. 3). When segregated by the sex of the newborn, HSD17B tended (p = 0.07) to be lower in placentas with male newborn only. In contrast, CYP19 expression was significantly lower in placentas with female newborns while in the males there was a large magnitude decrease (Fig. 3). While no change in androgen (AR) and progesterone (PR) receptor were evident when examined compositely, when segregated by sex of the newborn AR and PR expression showed a large magnitude increase in placentas with female and male newborns respectively (Fig. 3). No change in expression was observed for HSD3B and ESR1 expression. 2.4 Placental Gene Expression of Insulin like Growth Factor (IGF) Family Members The placental expression of IGF1 and IGF binding protein 3 ( IGFBP3 ) was significantly lower in IUGR placentas (Fig. 4). When segregated by sex of the newborn, both IGF1 and IGFBP3 was significantly lower in females (Fig. 4). The expression of IGF1, IGFBP1 and IGF2 receptor ( IGF2R ) did not show any change between control and IUGR. However, when segregated by sex of the newborn, the expression of IGF2 mRNA tended to be lower with a large magnitude decrease in placentas from female newborns while IGF2R tended to be higher in placentas from male newborns (Fig. 4). The expression of IGFBP1 mRNA showed a large magnitude increase in IUGR placentas with male newborns but no change in expression of IGFBP2 and IGFBP4 expression was observed. 2.5 Placental Gene Expression of Inflammatory Markers The qPCR analysis of the genes associated with inflammation such cytokine TNF, chemokine CCL2 and macrophage infiltration marker CD68 in the placenta from control and IUGR subjects are shown in Fig. 5. No change in the expression of these markers was evident between the control and IUGR groups. However, when placental gene expression was assessed by segregating the newborn sex, the expression of the chemokine CCL2 and macrophage marker CD68 were significantly lower in placentas from pregnancies with female newborn (Fig. 5). 2.6 Placental Gene Expression of Angiogenic Markers The RT-PCR analysis of the genes associated with angiogenesis in the placenta from control and IUGR subjects are shown in Fig. 6. Gene expression analysis showed that the mRNA expression of VEGFA tended to be lower in placenta from IUGR group while the VEGF receptors VEGFR1 and VEGFR2 showed no changes. Similarly, no change in the expression of EGVEGF was observed between the two groups. The expression of HIF1A and PIGF were significantly lower among the placentas from IUGR group. While this trend was not observed among placentas when segregated by newborn sex for HIF1A but was significantly lower in placentas with male pregnancies for PIGF mRNA. While no change in the expression of ANG1 and ANG2 was evident among the placentas from entire group, a trend towards increased expression among placentas with female newborn was observed for ANG1 as opposed to a large magnitude decrease ANG2 expression among the placentas with male newborn. 2.7 The Epigenetic Effect of Fetal Sex on MiRNA Differential Expression in IUGR Placenta 2.7.1 Descriptive Statistics : Post-trimming, microRNA reads exhibited high mean read quality scores, per sequence GC content ranging from 20-80% and sequence duplication levels up to 30% 2.7.2 Sex-specific microRNA expression in Control group : A partial separation in microRNA expression profiles was observed in 2D and 3D PCA plots generated using unsupervised model (Figure 7). Comparison of microRNA expression (FDR 0.5) between female and male controls demonstrated 7 microRNA specific in placentas with female newborns and 3 genes specific in the placentas with male newborns (Supplemental Table 1). In the control group, placentas from female newborns microRNAs MIR490 (log2FC 1.827; p = 0.097), MIR193B (log2FC -1.104; p = 0.00137), and 5 of the MIR941 family MIR941-1 (log2FC -1.5899; p = 0.009), MIR941-2 (log2FC -1.602; p = 0.009), MIR941-3 (log2FC -1.602; p = 0.009) , MIR941-4 (log2FC -1.602; p = 0.009) , and MIR941-5 (log2FC -1.602; p = 0.009) were upregulated compared to placentas from male newborns (Figure 7). On the other hand, MIR451A (log2FC 1.635; p = 0.037), MIR372 (log2FC 1.656; p = 0.097) and MIR136 (log2FC 0.995; p = 0.097) were upregulated in the placentas with male newborns compared to the placentas from female newborns (Figure 7). 2.7.2 Sex-specific effects in IUGR Group: In the IUGR groups comparing the placenta from male and female newborns, only one microRNA MIR518B (log2FC 1.589; p = 0.001) was upregulated in the placentas from female newborns compared to the male newborns (Figure 7; Supplemental Table 2) 2.7.3 Sex-specific effects in Control versus IUGR Group: Among placentas from female newborns, 2D and 3D PCA plots generated by unsupervised clustering microRNA showed overlap between control and IUGR groups (Figure 8). Analysis by DESeq2 for miRNA found 2 dysregulated microRNAs (FDR0.5). MIR451A was upregulated (log2FC 1.962; p = 0.049) whereas MIR543 was downregulated (log2FC -1.331; p = 0.054) in placentas from IUGR group with female newborns (Figure 8, Supplemental Table 3). Among placentas from male newborns, 2D and 3D PCA plots generated by unsupervised clustering showed an overlap between control and IUGR groups. IUGR group modulated one microRNA at FDR 0.5. The sole microRNA observed to be regulated was MIR520G which is upregulated (log2FC 0.820; p = 0.049) in the IUGR group placentas with male newborns (Supplemental Table 4). 2.8 Placental Microvessel Characteristics Endothelial cell marker CD34 expression in placental microvessels immunohistochemically visualized and assessed is summarized in Fig. 9. The relative staining intensity, total stained area and percent total intensity of CD34 immunostaining was not different between control and IUGR placentas. When segregated with sex, the relative placental staining intensity for CD34 showed a large magnitude increase in placentas from IUGR pregnancies with male newborn while the percentage of total intensity of the stain was significantly lower in placentas from IUGR pregnancies with female newborn. Assessment of the microvessel density and the microvessel area did not show any difference between control and IUGR subjects. When segregated by sex, microvessel density was significantly lower in placentas from IUGR pregnancies with female newborns. 3. Discussion Utilizing term placenta from a homogeneous cohort of Asian primiparous pregnant women with and without IUGR, expression levels of coding genes, proteins and miRNA that influence placental angiogenesis and function were assessed taking into account the impact of offspring sex. There is lack of strong evidence that suggesting the placental efficiency and structure dependent on the sex-specific gene and protein expression. Our study provided valuable insight into the way in which fetal sex influences placental capillary morphology. Although the placenta function was impaired both in male and female placenta, the change of microvessel density was only observed in female placenta but not in male, possibly due to the less susceptible on gene and protein expression in males associated with placental enviorment ( 44 ). Our findings showed sex-specific changes in expression of genes involved in steroidogenesis, steroid action, IGF family members, inflammatory cytokines and angiogenic factors in IUGR pregnancies. Most of significant changes were menifested in female placenta. Consistently, sex specific responses were also evidenced at the level of miRNA with upregulation of MIR451A and downregulation of MIR543 in IUGR placentas with female newborns and upregulation of MIR520G in IUGR placentas with male newborns (Supplemental Table 5 ) . The miRNAs that changed in placentas from female pregnancies have been shown to influence angiogenesis ( 55 – 57 ). In keeping with these findings, the microvessel angiogenesis marker CD34 also showed reduced staining in female IUGR placental. The significance of these sex-specific findings and their role in development of IUGR are discussed below. Compromised placental function in Composite and Sex-segeragated IUGR pregnancies Changes in placental morphology and angiogenesis have been shown to underlie placental dysfunction in IUGR pregnancies ( 58 ). Recruitment of primiparous women without pregnancy complication allowed exclusion of maternal parameters and fetal malformation thus enforcing the focus on the main etiology resulting from placenta. Consistent with previous findings, impaired placental function and lower placental efficiency were evident in IUGR pregnancies ( 59 ). Meanwhile, the impaired placental function was evident in both male and female fetal placenta. Sex-dependent Gene expression changes in IUGR placenta Function and Angiogenesis Placenta being a dynamic organ that undergoes significant anatomical and functional changes to keep up the demands of fetal growth requires to be constantly regulated by various processes. In line with this premise, genes that encode steroid synthesis and action, inflammatory process, IGF family members and angiogenic genes were altered in IUGR group in a sex-specific manner. The lower expression of CYP19 , key gene in estradiol biosynthesis, in the placentas with female newborns is in line with lower level of maternal estradiol observed in mothers with IUGR pregnancies ( 36 , 60 ), estrogen-suppressed placenta menifesting an impaired placental angiogenesis in animal study ( 61 ). The lower placental expression of IGF1 and IGFBP3 in IUGR group are also supportive of the role of IGF family members in development of IUGR. IGFs are anabolic hormones that promote proliferation, mitochondrial protection, cell survival, tissue growth and development, anti-inflammatory, antioxidant, antifibrogenic and antiaging activities in the developing fetus ( 62 ). With placenta being a major source of IGFs ( 63 ), the lower expression of IGF is in line with low birth weight and impaired placental efficiency and capillary growth ( 64 ). Consistently, the lower expression of IGF1 and IGFBP3 in the female placenta was observed in liine with the decreased capillary density in terminal villi. Additionally, the anti-inflammatory role is also reduced parallelled with the downregulation of IGF1 and IGFBP3. To be mentioned, chemokine CCL2 and macrophage marker CD68 were lower in placentas from pregnancies with female newborn. It was reported in preeclampsia patients with HELLP that the increased expression of CD68 may be point to an adaptive response of placenta ( 65 ). In contrast, the suppression of CD68 in female placenta may partly underline the impaired growth station of capillary in terminal villi. Continuing with the trend of downregulation – significant downregulation of angiogenic genes HIF1A and PIGF were evident among the placentas from composite IUGR group, while placental expression of VEGF, ANG1, ANG2, and angiopoietin receptor (TIE-2) were found to be higher ( 66 – 68 ). Since HIF1A regulates the expression of VEGF and angiopoietins, it is possible that lower expression of HIF1A in our cohort may have contributed to the lack of change in the expression of other angiogenic markers, consistently with the findings in a PE placenta study with no significant changes in angiogenic factors observed ( 69 ). Though the role of fetal sex plays in the placental perturbations are widely studied ( 69 – 71 ), there was no sex-dependent significant change was shown in female placenta from this cohort. Consistent with the compromised placental phenotype there was an increase in caspase activity in the placenta with female pregnancies. In contrast, in spite of the decreased placental efficiency and a trend for decreased placental volume, paradoxically the placenta from male pregnancies showed an increase in proliferative activity as evidenced by the Ki67 staining and decrease in caspase activity suggestive of an adaptive response to overcome compromise. In keeping with this premise of adaptive response, a trend for an increase in capillary density was evident in placenta of male pregnancies. Adaptive changes in angiogenesis reflective of increased efficiency have been reported with smaller size placenta ( 72 ). The trend for an increase in capillary density in male IUGR placenta as opposed to downregulation in female IUGR placenta is supportive of sexually-dimorphic compensatory responses. Previous studies ( 73 , 74 ) have also shown a trend for increase in capillary in male IUGR placenta. Placental miRNA expression changes and Sex Dependence miRNAs are noncoding RNAs that regulate gene expression through micro-ribonucleoprotein effector complexes and sequence-specific recognition of target sites. Therefore, they have the unique ability to modulate gene expression and influence developmental and cellular processes including angiogenesis ( 75 ). As has been reported before ( 76 ) dimorphic expression of miRNA was observed between pregnancies with male and female newborns in both control and IUGR groups. The significance of these sex-specific findings needs to be further explored. Interestingly, decreased expression of MIR451A expression in hepatocellular carcinoma was reported to play a role in increasing angiogenesis and VEGF expression ( 77 , 78 ). This increase of MIR451A in IUGR pregnancies in the present study was not associated with a change in VEGF expression. However, our finding of reduced staining for CD34, a microvessel endothelial marker is suggestive of reduced angiogenesis in IUGR placentas with female newborns. This is in line with the negative regulation of angiogenesis associated with MIR451A elevation. In contrast to upregulation of MIR451A , downregulation of MIR543 in placentas from IUGR group with female newborns was observed. However, while MIR451A negatively regulates angiogenesis, MIR543 expression positively regulates angiogenesis as demonstrated in cardiac endothelial cells ( 79 ), human retinal endothelial cells ( 80 ), and non-small cell lung cancer ( 81 ). Due to the opposing roles of MIR451A and MIR543 in regulating angiogenesis, the balance of the two may dictate the final impact on angiogenesis. These changes in miRNA in the IUGR associated pregnancies with female fetuses are however indicative that dysregulation of angiogenesis may have epigenetic basis. In contrast in IUGR associated pregnancies with male fetuses upregulation of MIR520G was observed. While a role for angiogenesis for this miRNA is not yet known, elevated expression of MIR520G have been observed in serum from preeclampsia pregnancies ( 82 ). Additionally, this miRNA has been shown to negatively regulate trophoblast migration and invasion ( 82 ) processes essential for placental function. These findings support for the possibility that compromised placental trophoblast migration and invasion may be the basis for the development of IUGR in pregnancies carrying male fetuses. Placental Angiogenesis Medicated in Sex-Dimorphic Pattern CD34 is a cell surface marker that is expressed by a broad range of cells including hematopoietic, stromal, epithelial, and endothelial cells and is now widely regarded as a marker of vascular endothelial progenitor cells ( 83 ). The function of CD34 is still not completely known but evidence to support its role in inhibition or facilitation of adhesion, cell proliferation, and regulation of differentiation are present ( 84 ). CD34 positive endothelial cells under angiogenic stimuli are shown to migrate and from sprouting tip cells, that are present in the leading edge of angiogenesis ( 85 ). Because of this role of CD34 in active angiogenesis the evidence that reduced immunostaining intensity for CD34 in IUGR associated placentas with female pregnancies suggests impaired angiogenesis as a contributory factor for development of IUGR. Evidence that VEGF and CD34 expression correlates with angiogenesis in tumors ( 86 ) is supportive for the evidence that the large magnitude decrease in expression of VEGF receptor VEGFR1 may also contribute to this impeded angiogenesis in IUGR placenta with female offspring. However, the upregulation of CD34 total staining intensity and stained area pointing to the proliferation of endothelial cell in male IUGR placenta may again be reflective of a compensatory response to maintain non-branching angiogenesis in terminal villi of male IUGR placenta. Limitations and Conclusions Although this study provides strong evidence for impaired placental angiogenesis as a contributory factor for development of IUGR in a sex dimorphic manner, the findings from this study should be viewed considering some limitations. The limitations are that this study was carried out in a small set of mothers from a nondiverse cohort. However, the fact that this study is from a nondiverse cohort of Asian women can be viewed as a strength as confounds arising from race can be avoided. Another limitation is the sample size from control female pregnancies were rather low. Nonetheless, statistically significant outcomes achieved in the face of low numbers emphasize the need for large scale investigations to validate the potential miRNA biomarkers identified. The comprehensive analysis of sex-specific gene and key protein expression coupled with use of next generation sequencing to determine differentially expressed miRNA is one of the strengths of this study. However, findings from this study should be viewed as providing proof of concept relative to the influence of fetal sex on IUGR outcomes via impaired placental angiogenesis and function. The role of impaired angiogenesis and trophoblast migration/invasion through epigenetic regulation needs to be explored further in a larger and more diverse cohort. 4. Methods 4.1 Human Subjects: Human subjects were recruited following written informed consent and studies performed following the guidelines approved by the Institutional Ethics Committee at Hebei Medical University Affiliated Obstetrics and Gynecology Hospital (Approval ID: 20210030) and Chinese Clinical Trial Registry (Registration Number: ChiCTR2100043159). Primiparous pregnant women with singleton pregnancies who delivered between 37 and 41 weeks of gestation were recruited from the Fourth Hospital of Shijiazhuang affiliated with Hebei Medical University. Gestational age was determined by the ultrasound assessment. Placentae were collected from enrolled women at term immediately following delivery. Based on offspring birth weight women were classed into two groups, control and IUGR. Pregnancies were designated as IUGR when birth weight was below the 10th percentile for the gestational age as defined by the American College of Obstetricians and Gynecologists ( 87 ). Criteria for exclusion included pregnancy complications, malnutrition, velamentous placenta, severe placental calcification or infarction, congenital malformation, and umbilical cord compromise. The demographic details and birth outcomes such as maternal age, body mass index (BMI), maternal substance abuse or smoking, adverse pregnancy history, maternal weight, weight gain throughout pregnancy, offspring birth weight and gender information were collected from the medical record. Placental samples from 20 IUGR (Male: 7, female 13) and 12 controls (Male: 9, female 3) were used in this study (Table 1 ). 4.2 Placenta Collection: At term, whole placenta was collected immediately after the delivery and fetal membranes and the umbilical cord were removed and the weight and size were recorded. About 0.5-1.0 cm of placental villi from the fetal side was dissected and washed with normal saline to remove maternal blood and placed in a cryogenic vial containing RNAlater ( 88 , 89 ), frozen and stored in -80°C until further analysis. A portion of placental fragments was also collected and fixed overnight at 4°C in 4% paraformaldehyde and embedded in paraffin for histomorphological and immunohistochemical analysis. 4.3 Histological examination Paraffin-embedded tissues were sectioned (4 microns) and stained with hematoxylin and eosin (H&E) following the traditional H&E staining protocol. For examination of CD34 expression, paraffin embedded placenta was sectioned (4 microns) and immunostained with a mouse monoclonal anti-human CD34 antibody (QBEnd 10, Gene Tech (Shanghai) Company Limited, Ch). Immunostaining was performed on VENTANA BenchMark GX@ (Roche, Tucson, AZ USA) automated staining instrument following manufacturer recommended protocol. High-resolution, whole-slide digital scan of both H&E and immuno stained slides was performed at 40× magnification using Aperio CS2 Digital Pathology Scanner and Aperio Imagescope software (Aperio Technologies Inc. San Diego USA). Acquired images were saved as Tagged Image Format File (tiff) for further analysis. From each slide, five equal size regions of interest (ROI; 0.2645 µm2 each) were selected by experienced pathologist. Regions of interest was restricted to the microvessel rich area from different locations. Color deconvolution and microvessel analysis algorithms were employed to qualify the CD34 staining intensity and microvessel-associated parameters, respectively. With color deconvolution algorithm, the parameter settings for the DAB channel were tailored to efficiently identify CD34 staining in placenta villi and the parameter settings were saved as a Macro for the repeat use. Using the macro, average CD34 staining intensity, percentage of stained area, and total stained region was obtained. The procedures for Ki67 staining using the human Ki67 antibody (NO.GM027, Gene Tech (Shanghai) Company Limited, Ch) was similar to that of CD34 immunostaining followed by analysis with Aperio CS2 software. 4.4 Assessment of caspase-3 activity Caspase 3 activity was assessed in cyro-preserved tissues utilizing a colorimetric kit (No.C1116, Beyotime Biotechnology, Shanghai, Ch) following manufacturer’s recommendations. Briefly, 100µl lysis buffer was added to about 10mg of cryo-preserved placental tissue from each subject, homogenized using a cryogenic homogenizer and incubated on ice for 5min. Following this the homogenate was centrifuged at 16,000–20,000r/min for 10-15min and supernatant collected and used to assess the Caspase 3 activity. Total protein was also estimated in homogenate using Bradford Protein Assay Kit (NO.P0006,Beyotime Biotechnology, Shanghai, Ch ) and caspase-3 activity was normalized to mg amount of total protein. 4.5 Real-time reverse transcriptase–polymerase chain reaction (RT-PCR) Frozen placental tissue was lysed using tissue cryogrinder (KZ-III-FP, Wuhan Servicebio Technology Company Limited, CH) and total RNA was isolated using Eastep@Supper Total RNA Extraction kit (Shanghai Promega Biological Products Ltd., Shanghai, CH) following manufacture’s protocol. The concentration and 260/280 ratios were determined using Nanodrop. Subsequently, 1000 ng of total RNA was reverse transcribed to complementary DNA (cDNA) with first-strand complementary synthesis system (Invitrogen, Life Technologies). Gene expression was assessed using SYBRgreen based real time RT-PCR using PowerUpTMSYBRTM Green Master Mix (ThermoFisher). Sequences for the oligonucleotide primers for the genes under study designed using Primer3 or from previous reports ( 90 – 95 ) are shown in Table 2 . The relative amount of each transcript was calculated using the ΔΔCT method and normalized to the endogenous reference gene β-Actin. Table 2 Sequence of primers used Gene ID Forward Primer (5’-3’) Reverse Primer (5’-3’) Accession Number IGF1 GCCCAAGACCCAGAAGTATCAGC TCCAATCTCCCTCCTCTGCTCT NM_001111285.3 IGF2 TTCTCACCTTCTTGGCCTTCG GCGGAAACAGCACTCCTCAA NM_001291862.2 IGFBP1 AGGAGCCCTGCCGAATAGAA CCATGGATGTCTCACACTGTCT NM_000596.4 IGFBP2 CAAAAGCACGCGCTCTTCTCC TCATCGCCATTGTCTCCGC NM_001313992.2 IGFBP3 CATCAAGAAAGGGCATGCTAAA GAGGAGAAGTTCTGGGTATCTG XM_047420325.1 IGFBP4 CCCACGAGGACCTCTACATC ATCCAGAGCTGGGTGACACT NM_001552.3 IGF1R AGTGCTGTATGCCTCTGTGAACC ATAGACCATCCCAAACGACCC XM_011521517.3 IGF2R GAGGGAAGAGGCAGGAAAG TGTGGCAGGCATACTCAG NM_000876.4 VEGF AGGGCAGAATCATCACGAAGT AGGGTCTCGATTGGATGGCA NM_001025366.3 VEGFR1 CAGTGTGAGCGGCTCCCTTATG CACAGTCCGGCACGTAGGTGAT NM_002019.4 VEGFR2 CCAGCAAAAGCAGGGAGTCTGT TGTCTGTGTCATCGGAGTGATATCC NM_002253.4 PIGF CAGAGGTGGAAGTGGTACCCTTCC CGGATCTTTAGGAGCTGCATGGTGAC NM_002632.6 HIF1A GAACGTCGAAAAGAAAAGTCTCG CCTTATCAAGATGCGAACTCACA NM_001243084.2 EGVEGF AGGTCCCCTTCTTCAGGAAACG TCCAGGCTGTGCTCAGGAAAAG NM_032414.3 ANGPT1 CAGACTGCAGAGCAGACCAGAA CTCTAGCTTGTAGGTGGATAATGAATTC NM_001199859.3 ANGPT2 AGGAGGCGGGTGGACAATT CTCCTGAAGGGTTACCAAATCC NM_001118887.2 CCL2 CTCTGCCGCCCTTCTGT CTTCTTTGGGACACTTGCTG NM_002982.4 TNF CCCAGAGGGAAGAGTTCCCCA GGCTTGTCACTCGGGGTTCG NM_000594.4 CD68 GCTACATGGCGGTGGAGTACAA ATGATGAGAGGCAGCAAGATGG NM_001040059.2 ESR1 CAGGAACCAGGGAAAATGTG AACCGAGATGATGTAGCCAGC XM_017010383.2 PGR GGCAGCACAACTACTTATGTGC TCATTTGGAACGCCCACT XM_006718858.4 AR CCTGGCTTCCGCAACTTACAC GGACTTGTGCATGCGGTACTCA NM_000044.6 CYP19 GGCAAGCTCTCCTCATCAAA CAACTCAGTGGCAAAGTCCA NM_001347252.2 HSD3B AGAGGCCTGTGTCCAAGCTA TTTTGCTGTGTGGGTATGGA NM_000862.3 HSD17B ATCCAGAGCCTCATCCATTG AACGCCTTGGAAGCTGAGTA XM_047423304.1 4.6 RNAseq Analysis 4.6.1 Sequencing The total RNA was extracted by using Eastep@Supper Total RNA Extraction kit (Shanghai Promega Biological Products Ltd., Shanghai, CH) following manufacturer’s protocol, then purified by using the Total RNA Purification Kit (LC Sciences, Houston, USA), according to the manufacturer’s protocol. The total RNA quantity and purity were analyzed using Agilent Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, Santa Clara, CA USA) and RNA from subjects with RIN number > 7.0 was used for sequencing. Approximately 1,000ng of total RNA were used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits (Illumina, San Diego, CA USA). The general procedure was as follows: the RNAs were ligated to 3ʹ adapters and the 5′ adapters were ligated to the other end of the RNA molecules. Then the RNAs which were ligated with 3ʹ and 5ʹ adapters were reverse transcribed to create single stranded cDNA. The cDNAs were amplified, gel purified and used to generate libraries. The small RNA library quality was assessed by using Bioanalyzer 2100 (Agilent) with High Sensitivity DNA Chip Kit (Agilent) and single-end sequencing (1x50bp) on an Illumina Hiseq2500 at the LC-BIO (Hangzhou, China) following the vendor’s recommended protocol was performed. 4.6.2 Dimensionality Reduction: Dimensionality reduction modeling was performed using SIMCA 17 (Sartorius Stedim Data Analytics AB, Sweden). Normalized counts for miRNA from placentae from both male and female offspring tissues were imported to SIMCA software for the analysis. Multivariate modeling was performed using unit variance (UV) scaling (mean centered and divided by the standard deviation). To get an overview of the data and identify patterns/groupings unsupervised principal component analysis (PCA) was performed. Specifically two-dimensional and three dimensional (3D) PCA clustering were employed, and the respective plots were explored. The scatter score plot of components 1 and 2 were explored to visualize differences in the two groups (classes). Observations that are close to each other have more similar miRNA expression profiles compared to the observations that are distant from each other. 4.6.3 microRNA trimming : Raw reads from microRNA sequencing were trimmed using cutadapt (v3.2) and specifically trimmed from the 5’ end using the sequence ‘TGGAATTCTCGGGTGCCAAGG’. Sequences were then sub-selected for reads that were less than 17bp. Finally, low-quality reads that did not match the default quality control scores were removed. 4.6.4 Quality control metrics : Fastqc was used to evaluate and multiqc was used to summarize the quality control metrics for both raw and trimmed files. 4.6.5 Alignment and Counts : Trimmed reads were aligned to Genome Reference Consortium Human Build 38 patch release 14 (GRCh38.p14) (GRCh38.p14) using Spliced Transcripts Alignment to a Reference (STAR) aligner (v2.6.0c). FeatureCounts (v1.6.1) was used to count aligned fragments and then differential expression performed. 4.6.6 Differential gene expression testing : DESEq2 (1.24.0) utilizing negative binomial distribution on counts was used for determining the differential expression of microRNA. Sex-specific and treatment (control vs. IUGR) effects in microRNA expression in placental tissue were determined by comparing 1) control male with control female, 2) IUGR male vs. IUGR female, 3) IUGR male vs. control male and 4) IUGR female vs. control female. For microRNA differentially expressed transcripts that met the FDR 0.5 were considered significant. Finally, differentially expressed transcripts were visualized using volcano plots, and heatmaps were generated using the heatmap.2 package. All differential expression testing and plots were processed using R statistical software (v3.5.1). 4.7 Statistical Analysis Demographic, immunohistological and RT-PCR data were examined for homogeneity of variance using Fisher’s test and Student’s t test was employed to compare the quantitative difference of assessed parameters between Control and IUGR groups. Differences among the placentas from male and female newborn between control and IUGR groups were also assessed by Student’s t test. A p value lower than 0.05 was considered significant. As a complementary approach, Cohen’s effect-size was determined to evaluate the magnitude of difference. A Cohen d ≥ 0.8 refers to the large effect-size differences. Declarations Acknowledgements This IUGR cohort is supported by grants from Research reported in this publication was supported by Natural Science Foundation of Hebei Province in China (No.H2021106030), Introduced Intelligence of Foreign Expert Project of Hebei Province in China. Author Contributions Song W performed conceptualization, formal analysis, writing the original draft. Guo Q contributed to the project design, funding Application. Puttabyatappa M analyzed and interpreted the data, writing-original draft. Venkateswaran R Elangovan performed the miRNA expression analysis and related draft. Wu XH, project administrator, supervised the whole process of experiment, funding acquisition, , writing-reviewing & editing. Wang JP, Li F, Liu F, Bi X, Li H, Fu G collected data and samples, performed the experiment. Padmanabhan V contributed to revised the original draft and gave suggestions for experiment. Data availability statement : Raw data was available if required. Please contact the corresponding author. Additional Information Supplementary information : Attached in Supplementary Table 1-5 Competing Interests : Te authors declare that they have no competing interests. Disclosure statement: Authors have nothing to disclose. Funding source: Research reported in this publication was supported by Natural Science Foundation of Hebei Province in China (No.H2021106030), Introduced Intelligence of Foreign Expert Project of Hebei Province in China. References Vayssiere C, Sentilhes L, Ego A, Bernard C, Cambourieu D. Fetal growth restriction and intra-uterine growth restriction: guidelines for clinical practice from the French College of Gynaecologists and Obstetricians. Eur J Obstet Gynecol Reprod Biol. 2015;193:10–18. http://doi.org/10.1016/j.ejogrb.2015.06.021 . Gardosi J, Madurasinghe V, Williams M, Malik A, Francis A. Maternal and fetal risk factors for stillbirth: population based study. BMJ. 2013;346:f108. http://doi.org/10.1136/bmj.f108 . Bukowski R. Stillbirth and fetal growth restriction. Clin Obstet Gynecol. 2010;53(3):673–680. http://doi.org/10.1097/GRF.0b013e3181eba0db . Langmia IM, Kraker K, Weiss SE, Haase N, Schutte T, Herse F, Dechend R. Cardiovascular Programming During and After Diabetic Pregnancy: Role of Placental Dysfunction and IUGR. Front Endocrinol (Lausanne). 2019; 10:215.http://doi.org/10.3389/fendo.2019.00215 . Wang G, Divall S, Radovick S, Paige D, Ning Y, Chen Z, Ji Y, Hong X, Walker SO, Caruso D, Pearson C, Wang MC, Zuckerman B, Cheng TL, Wang X. Preterm birth and random plasma insulin levels at birth and in early childhood. JAMA. 2014;311(6):587–596. http://doi.org/10.1001/jama.2014.1 . Barker DJ. In utero programming of cardiovascular disease. Theriogenology. 2000;53(2):555–574. http://doi.org/10.1016/s0093-691x(99)00258-7 . Barker DJ. Adult consequences of fetal growth restriction. Clin Obstet Gynecol. 2006;49(2):270–283 .http://doi.org/10.1097/00003081-200606000-00009 . Kloskowska M, Chojnacki J, Wojnowski W, Becker B. The first compound with an unusual type of anion, [Li(SR)2]-: bis(mu2-aqua-d2)tetrakis(aqua-d2)dilithium(I) bis[bis(tri-tert-butoxysilanethiolato-kappa2O,S)lithate(I)] dihydrate-d2. Acta Crystallogr C. 2006;62(Pt 11):m541-544. http://doi.org/10.1107/S0108270106041746 . Eriksson JG, Kajantie E, Thornburg KL, Osmond C, Barker DJ. Mother's body size and placental size predict coronary heart disease in men. Eur Heart J. 2011;32(18):2297–2303. http://doi.org/10.1093/eurheartj/ehr147 . Ponsuksili S, Murani E, Hadlich F, Perdomo-Sabogal A, Trakooljul N, Oster M, Reyer H, Wimmers K. Genetic regulation and variation of expression of miRNA and mRNA transcripts in fetal muscle tissue in the context of sex, dam and variable fetal weight. Biol Sex Differ. 2022;13(1):24. http://doi.org/10.1186/s13293-022-00433-3 . Bateson P, Barker D, Clutton-Brock T, Deb D, D'Udine B, Foley RA, Gluckman P, Godfrey K, Kirkwood T, Lahr MM, McNamara J, Metcalfe NB, Monaghan P, Spencer HG, Sultan SE. Developmental plasticity and human health. Nature. 2004;430(6998):419–421. http://doi.org/10.1038/nature02725 . Vyas AK, Veiga-Lopez A, Ye W, Abi Salloum B, Abbott DH, Yang S, Liao C, Kannan K, Padmanabhan V. Developmental programming: Sex-specific programming of growth upon prenatal bisphenol A exposure. J Appl Toxicol. 2019;39(11):1516–1531. http://doi.org/10.1002/jat.3836 . Clifton VL. Review: Sex and the human placenta: mediating differential strategies of fetal growth and survival. Placenta. 2010;31 Suppl:S33-39.http://doi.org/10.1016/j.placenta.2009.11.010 . Turco MY, Moffett A. Development of the human placenta. Development. 2019;146( 22).http://doi.org/10.1242/dev.163428 . Baschat AA, Hecher K. Fetal growth restriction due to placental disease. Semin Perinatol. 2004;28(1):67–80 .http://doi.org/10.1053/j.semperi.2003.10.014 . Barut F, Barut A, Gun BD, Kandemir NO, Harma MI, Harma M, Aktunc E, Ozdamar SO. Intrauterine growth restriction and placental angiogenesis. Diagn Pathol. 2010;5:24. http://doi.org/10.1186/1746-1596-5-24 . Hu C, Yang Y, Deng M, Yang L, Shu G, Jiang Q, Zhang S, Li X, Yin Y, Tan C, Wu G. Placentae for Low Birth Weight Piglets Are Vulnerable to Oxidative Stress, Mitochondrial Dysfunction, and Impaired Angiogenesis. Oxid Med Cell Longev. 2020; 2020:8715412.http://doi.org/10.1155/2020/8715412 . Thamotharan S, Chu A, Kempf K, Janzen C, Grogan T, Elashoff DA, Devaskar SU. Differential microRNA expression in human placentas of term intra-uterine growth restriction that regulates target genes mediating angiogenesis and amino acid transport. PLoS One. 2017;12(5):e0176493. http://doi.org/10.1371/journal.pone.0176493 . Takahashi N, Anan F, Nakagawa M, Yufu K, Ooie T, Nawata T, Shigematsu S, Hara M, Saikawa T, Yoshimatsu H. Microalbuminuria, cardiovascular autonomic dysfunction, and insulin resistance in patients with type 2 diabetes mellitus. Metabolism. 2004;53(10):1359–1364. http://doi.org/10.1016/j.metabol.2004.03.024 . Zigic Z, Markovic S, Grbesa D, Ramic S, Halilovic A. Quantitative research of capillaries in terminal villi of mature placentae. Bosn J Basic Med Sci. 2010;10(2):147–152. http://doi.org/10.17305/bjbms.2010.2714 . Jako M, Suranyi A, Kaizer L, Nemeth G, Bartfai G. Maternal Hematological Parameters and Placental and Umbilical Cord Histopathology in Intrauterine Growth Restriction. Med Princ Pract. 2019;28(2):101–108. http://doi.org/10.1159/000497240 . Fitzgerald B, Levytska K, Kingdom J, Walker M, Baczyk D, Keating S. Villous trophoblast abnormalities in extremely preterm deliveries with elevated second trimester maternal serum hCG or inhibin-A. Placenta. 2011;32(4):339–345. http://doi.org/10.1016/j.placenta.2011.01.018 . Almasry SM, Elfayomy AK. Morphometric analysis of terminal villi and gross morphological changes in the placentae of term idiopathic intrauterine growth restriction. Tissue Cell. 2012;44(4):214–219. http://doi.org/10.1016/j.tice.2012.03.006 . Macara L, Kingdom JC, Kaufmann P, Kohnen G, Hair J, More IA, Lyall F, Greer IA. Structural analysis of placental terminal villi from growth-restricted pregnancies with abnormal umbilical artery Doppler waveforms. Placenta. 1996;17(1):37–48. http://doi.org/10.1016/s0143-4004(05)80642-3 . Monson T, Wright T, Galan HL, Reynolds PR, Arroyo JA. Caspase dependent and independent mechanisms of apoptosis across gestation in a sheep model of placental insufficiency and intrauterine growth restriction. Apoptosis. 2017;22(5):710–718. http://doi.org/10.1007/s10495-017-1343-9 . Kingdom J, Huppertz B, Seaward G, Kaufmann P. Development of the placental villous tree and its consequences for fetal growth. Eur J Obstet Gynecol Reprod Biol. 2000;92(1):35–43. http://doi.org/10.1016/s0301-2115(00)00423-1 . Novac MV, Niculescu M, Manolea MM, Dijmarescu AL, Iliescu DG, Novac MB, Rotaru LT, Stoenescu MF, Tabacu MC, Tudorache S, Busuioc CJ, Gheonea IA. Placental findings in pregnancies complicated with IUGR - histopathological and immunohistochemical analysis. Rom J Morphol Embryol. 2018;59(3):715–720 Junaid TO, Brownbill P, Chalmers N, Johnstone ED, Aplin JD. Fetoplacental vascular alterations associated with fetal growth restriction. Placenta. 2014;35(10):808–815. http://doi.org/10.1016/j.placenta.2014.07.013 . Yu Z, Han Y, Shen R, Huang K, Xu YY, Wang QN, Zhou SS, Xu DX, Tao FB. Gestational di-(2-ethylhexyl) phthalate exposure causes fetal intrauterine growth restriction through disturbing placental thyroid hormone receptor signaling. Toxicol Lett. 2018;294:1–10. http://doi.org/10.1016/j.toxlet.2018.05.013 . Rossi C, Lees M, Mehta V, Heikura T, Martin J, Zachary I, Spencer R, Peebles DM, Shaw R, Karhinen M, Yla-Herttuala S, David AL. Comparison of Efficiency and Function of Vascular Endothelial Growth Factor Adenovirus Vectors in Endothelial Cells for Gene Therapy of Placental Insufficiency. Hum Gene Ther. 2020;31(21–22):1190–1202. http://doi.org/10.1089/hum.2020.006 . Brouillet S, Murthi P, Hoffmann P, Salomon A, Sergent F, De Mazancourt P, Dakouane-Giudicelli M, Dieudonne MN, Rozenberg P, Vaiman D, Barbaux S, Benharouga M, Feige JJ, Alfaidy N. EG-VEGF controls placental growth and survival in normal and pathological pregnancies: case of fetal growth restriction (FGR). Cell Mol Life Sci. 2013;70(3):511–525. http://doi.org/10.1007/s00018-012-1141-z . Vrachnis N, Kalampokas E, Sifakis S, Vitoratos N, Kalampokas T, Botsis D, Iliodromiti Z. Placental growth factor (PlGF): a key to optimizing fetal growth. J Matern Fetal Neonatal Med. 2013;26(10):995–1002. http://doi.org/10.3109/14767058.2013.766694 . Sahay AS, Jadhav AT, Sundrani DP, Wagh GN, Mehendale SS, Chavan-Gautam P, Joshi SR. VEGF and VEGFR1 levels in different regions of the normal and preeclampsia placentae. Mol Cell Biochem. 2018;438(1–2):141–152. http://doi.org/10.1007/s11010-017-3121-y . Mayhew TM. Fetoplacental angiogenesis during gestation is biphasic, longitudinal and occurs by proliferation and remodelling of vascular endothelial cells. Placenta. 2002;23(10):742–750. http://doi.org/10.1016/s0143-4004(02)90865-9 . Cotechini T, Graham CH. Aberrant maternal inflammation as a cause of pregnancy complications: A potential therapeutic target? Placenta. 2015;36(8):960–966. http://doi.org/10.1016/j.placenta.2015.05.016 . Anelli GM, Mando C, Letizia T, Mazzocco MI, Novielli C, Lisso F, Personeni C, Vago T, Cetin I. Placental ESRRG-CYP19A1 Expressions and Circulating 17-Beta Estradiol in IUGR Pregnancies. Front Pediatr. 2019;7:154. http://doi.org/10.3389/fped.2019.00154 . Chassen S, Jansson T. Complex, coordinated and highly regulated changes in placental signaling and nutrient transport capacity in IUGR. Biochim Biophys Acta Mol Basis Dis. 2020;1866(2):165373. http://doi.org/10.1016/j.bbadis.2018.12.024 . Cotechini T, Komisarenko M, Sperou A, Macdonald-Goodfellow S, Adams MA, Graham CH. Inflammation in rat pregnancy inhibits spiral artery remodeling leading to fetal growth restriction and features of preeclampsia. J Exp Med. 2014;211(1):165–179. http://doi.org/10.1084/jem.20130295 . Thiele K, Hierweger AM, Riquelme JIA, Solano ME, Lydon JP, Arck PC. Impaired Progesterone-Responsiveness of CD11c(+) Dendritic Cells Affects the Generation of CD4(+) Regulatory T Cells and Is Associated With Intrauterine Growth Restriction in Mice. Front Endocrinol (Lausanne). 2019;10:96. http://doi.org/10.3389/fendo.2019.00096 . Engler JB, Kursawe N, Solano ME, Patas K, Wehrmann S, Heckmann N, Luhder F, Reichardt HM, Arck PC, Gold SM, Friese MA. Glucocorticoid receptor in T cells mediates protection from autoimmunity in pregnancy. Proc Natl Acad Sci U S A. 2017;114(2):E181-E190. http://doi.org/10.1073/pnas.1617115114 . Calvo MT, Romo A, Gutierrez JJ, Relano E, Barrio E, Ferrandez Longas A. Study of genetic expression of intrauterine growth factors IGF-I and EGFR in placental tissue from pregnancies with intrauterine growth retardation. J Pediatr Endocrinol Metab. 2004;17 Suppl 3:445–450 Rosenfeld CS. Sex-Specific Placental Responses in Fetal Development. Endocrinology. 2015;156(10):3422–3434 .http://doi.org/10.1210/en.2015-1227 . Jackson MR, Mayhew TM, Haas JD. Morphometric studies on villi in human term placentae and the effects of altitude, ethnic grouping and sex of newborn. Placenta. 1987;8(5):487–495. http://doi.org/10.1016/0143-4004(87)90077-4 . Mayhew TM, Jenkins H, Todd B, Clifton VL. Maternal asthma and placental morphometry: effects of severity, treatment and fetal sex. Placenta. 2008;29(4):366–373. http://doi.org/10.1016/j.placenta.2008.01.011 . Hebert JF, Millar JA, Raghavan R, Romney A, Podrabsky JE, Rennie MY, Felker AM, O'Tierney-Ginn P, Morita M, DuPriest EA, Morgan TK. Male fetal sex affects uteroplacental angiogenesis in growth restriction mouse modeldagger. Biol Reprod. 2021;104(4):924–934. http://doi.org/10.1093/biolre/ioab006 . Stenhouse C, Hogg CO, Ashworth CJ. Associations between fetal size, sex and placental angiogenesis in the pig. Biol Reprod. 2019;100(1):239–252. http://doi.org/10.1093/biolre/ioy184 . Kalisch-Smith JI, Simmons DG, Dickinson H, Moritz KM. Review: Sexual dimorphism in the formation, function and adaptation of the placenta. Placenta. 2017;54:10–16. http://doi.org/10.1016/j.placenta.2016.12.008 . Adibi J, Burton GJ, Clifton V, Collins S, Frias AE, Gierman L, Grigsby P, Jones H, Lee C, Maloyan A, Markert UR, Morales-Prieto DM, Murthi P, Myatt L, Pollheimer J, Roberts V, Robinson W, Salafia C, Schabel M, Shah D, Sled J, Vaillancourt C, Weber M, O'Tierney-Ginn PF. IFPA meeting 2016 workshop report II: Placental imaging, placenta and development of other organs, sexual dimorphism in placental function and trophoblast cell lines. Placenta. 2017;60 Suppl 1:S10-S14. http://doi.org/10.1016/j.placenta.2017.02.021 . Ghidini A, Salafia CM. Gender differences of placental dysfunction in severe prematurity. BJOG. 2005;112(2):140–144. http://doi.org/10.1111/j.1471-0528.2004.00308.x . Challis J, Newnham J, Petraglia F, Yeganegi M, Bocking A. Fetal sex and preterm birth. Placenta. 2013;34(2):95–99. http://doi.org/10.1016/j.placenta.2012.11.007 . Younger ST, Corey DR. Transcriptional gene silencing in mammalian cells by miRNA mimics that target gene promoters. Nucleic Acids Res. 2011;39(13):5682–5691. http://doi.org/10.1093/nar/gkr155 . Morales-Prieto DM, Ospina-Prieto S, Chaiwangyen W, Schoenleben M, Markert UR. Pregnancy-associated miRNA-clusters. J Reprod Immunol. 2013;97(1):51–61. http://doi.org/10.1016/j.jri.2012.11.001 . Higashijima A, Miura K, Mishima H, Kinoshita A, Jo O, Abe S, Hasegawa Y, Miura S, Yamasaki K, Yoshida A, Yoshiura K, Masuzaki H. Characterization of placenta-specific microRNAs in fetal growth restriction pregnancy. Prenat Diagn. 2013;33(3):214–222. http://doi.org/10.1002/pd.4045 . Baker BC, Lui S, Lorne I, Heazell AEP, Forbes K, Jones RL. Sexually dimorphic patterns in maternal circulating microRNAs in pregnancies complicated by fetal growth restriction. Biol Sex Differ. 2021;12(1):61. http://doi.org/10.1186/s13293-021-00405-z . Wang LH, Tsai HC, Cheng YC, Lin CY, Huang YL, Tsai CH, Xu GH, Wang SW, Fong YC, Tang CH. CTGF promotes osteosarcoma angiogenesis by regulating miR-543/angiopoietin 2 signaling. Cancer Lett. 2017;391:28–37. http://doi.org/10.1016/j.canlet.2017.01.013 . Gusar V, Ganichkina M, Chagovets V, Kan N, Sukhikh G. MiRNAs Regulating Oxidative Stress: A Correlation with Doppler Sonography of Uteroplacental Complex and Clinical State Assessments of Newborns in Fetal Growth Restriction. J Clin Med. 2020;9(10). http://doi.org/10.3390/jcm9103227 . Mayhew TM, Wijesekara J, Baker PN, Ong SS. Morphometric evidence that villous development and fetoplacental angiogenesis are compromised by intrauterine growth restriction but not by pre-eclampsia. Placenta. 2004;25(10):829–833. http://doi.org/10.1016/j.placenta.2004.04.011 . Burkhardt T, Schaffer L, Schneider C, Zimmermann R, Kurmanavicius J. Reference values for the weight of freshly delivered term placentas and for placental weight-birth weight ratios. Eur J Obstet Gynecol Reprod Biol. 2006;128(1–2):248–252. http://doi.org/10.1016/j.ejogrb.2005.10.032 . Salas SP, Marshall G, Gutierrez BL, Rosso P. Time course of maternal plasma volume and hormonal changes in women with preeclampsia or fetal growth restriction. Hypertension. 2006;47(2):203–208. http://doi.org/10.1161/01.HYP.0000200042.64517.19 . Martin-Estal I, de la Garza RG, Castilla-Cortazar I. Intrauterine Growth Retardation (IUGR) as a Novel Condition of Insulin-Like Growth Factor-1 (IGF-1) Deficiency. Rev Physiol Biochem Pharmacol. 2016;170:1–35. http://doi.org/10.1007/112_2015_5001 . Haneda S, Dini P, Esteller-Vico A, Scoggin KE, Squires EL, Troedsson MH, Daels P, Nambo Y, Ball BA. Estrogens Regulate Placental Angiogenesis in Horses. Int J Mol Sci. 2021;22(22). http://doi.org/10.3390/ijms222212116 . Woods L, Perez-Garcia V, Hemberger M. Regulation of Placental Development and Its Impact on Fetal Growth-New Insights From Mouse Models. Front Endocrinol (Lausanne). 2018;9:570. http://doi.org/10.3389/fendo.2018.00570 . Inoue H, Nishio H, Takada H, Sakai Y, Nanishi E, Ochiai M, Onimaru M, Chen SJ, Matsui T, Hara T. Activation of Nod1 Signaling Induces Fetal Growth Restriction and Death through Fetal and Maternal Vasculopathy. J Immunol. 2016;196(6):2779–2787. http://doi.org/10.4049/jimmunol.1500295 . Hiden U, Glitzner E, Hartmann M, Desoye G. Insulin and the IGF system in the human placenta of normal and diabetic pregnancies. J Anat. 2009;215(1):60–68. http://doi.org/10.1111/j.1469-7580.2008.01035.x . Evsen MS, Kalkanli S, Deveci E, Sak ME, Ozler A, Baran O, Erdem E, Seker U. Human placental macrophages (Hofbauer cells) in severe preeclampsia complicated by HELLP syndrome: immunohistochemistry of chorionic villi. Anal Quant Cytopathol Histpathol. 2013;35(5):283–288 Regnault TR, de Vrijer B, Galan HL, Davidsen ML, Trembler KA, Battaglia FC, Wilkening RB, Anthony RV. The relationship between transplacental O2 diffusion and placental expression of PlGF, VEGF and their receptors in a placental insufficiency model of fetal growth restriction. The Journal of physiology. 2003;550(Pt 2):641–656. http://doi.org/10.1113/jphysiol.2003.039511 . Regnault TR, Orbus RJ, de Vrijer B, Davidsen ML, Galan HL, Wilkening RB, Anthony RV. Placental expression of VEGF, PlGF and their receptors in a model of placental insufficiency-intrauterine growth restriction (PI-IUGR). Placenta. 2002;23(2–3):132–144. http://doi.org/10.1053/plac.2001.0757 . Hagen AS, Orbus RJ, Wilkening RB, Regnault TR, Anthony RV. Placental expression of angiopoietin-1, angiopoietin-2 and tie-2 during placental development in an ovine model of placental insufficiency-fetal growth restriction. Pediatr Res. 2005;58(6):1228–1232. http://doi.org/10.1203/01.pdr.0000185266.23265.87 . Muralimanoharan S, Maloyan A, Myatt L. Evidence of sexual dimorphism in the placental function with severe preeclampsia. Placenta. 2013;34(12):1183–1189. http://doi.org/10.1016/j.placenta.2013.09.015 . Parraguez VH, Mamani S, Cofre E, Castellaro G, Urquieta B, De Los Reyes M, Astiz S, Gonzalez-Bulnes A. Disturbances in Maternal Steroidogenesis and Appearance of Intrauterine Growth Retardation at High-Altitude Environments Are Established from Early Pregnancy. Effects of Treatment with Antioxidant Vitamins. PLoS One. 2015;10(11):e0140902. http://doi.org/10.1371/journal.pone.0140902 . Delahaye F, Wijetunga NA, Heo HJ, Tozour JN, Zhao YM, Greally JM, Einstein FH. Sexual dimorphism in epigenomic responses of stem cells to extreme fetal growth. Nat Commun. 2014;5:5187. http://doi.org/10.1038/ncomms6187 . Sood R, Zehnder JL, Druzin ML, Brown PO. Gene expression patterns in human placenta. Proc Natl Acad Sci U S A. 2006;103(14):5478–5483. http://doi.org/10.1073/pnas.0508035103 . Kaufmann P, Black S, Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod. 2003;69(1):1–7. http://doi.org/10.1095/biolreprod.102.014977 . Kumazaki K, Nakayama M, Suehara N, Wada Y. Expression of vascular endothelial growth factor, placental growth factor, and their receptors Flt-1 and KDR in human placenta under pathologic conditions. Hum Pathol. 2002;33(11):1069–1077. http://doi.org/10.1053/hupa.2002.129420 . Valinezhad Orang A, Safaralizadeh R, Kazemzadeh-Bavili M. Mechanisms of miRNA-Mediated Gene Regulation from Common Downregulation to mRNA-Specific Upregulation. Int J Genomics. 2014;2014:970607 .http://doi.org/10.1155/2014/970607 . Guo L, Zhang Q, Ma X, Wang J, Liang T. miRNA and mRNA expression analysis reveals potential sex-biased miRNA expression. Sci Rep. 2017;7:39812. http://doi.org/10.1038/srep39812 . Liu X, Zhang A, Xiang J, Lv Y, Zhang X. miR-451 acts as a suppressor of angiogenesis in hepatocellular carcinoma by targeting the IL-6R-STAT3 pathway. Oncol Rep. 2016;36(3):1385–1392. http://doi.org/10.3892/or.2016.4971 . Bai H, Wu S. miR-451: A Novel Biomarker and Potential Therapeutic Target for Cancer. Onco Targets Ther. 2019;12:11069–11082. http://doi.org/10.2147/OTT.S230963 . Yang M, Liu X, Jiang M, Li J, Tang Y, Zhou L. miR-543 in human mesenchymal stem cell-derived exosomes promotes cardiac microvascular endothelial cell angiogenesis after myocardial infarction through COL4A1. IUBMB Life. 2021;73(7):927–940. http://doi.org/10.1002/iub.2474 . Ke N, Pi LH, Liu Q, Chen L. Long noncoding RNA SNHG7 inhibits high glucose-induced human retinal endothelial cells angiogenesis by regulating miR-543/SIRT1 axis. Biochem Biophys Res Commun. 2019;514(2):503–509. http://doi.org/10.1016/j.bbrc.2019.04.141 . Wang D, Cai L, Tian X, Li W. MiR-543 promotes tumorigenesis and angiogenesis in non-small cell lung cancer via modulating metastasis associated protein 1. Mol Med. 2020;26(1):44. http://doi.org/10.1186/s10020-020-00175-1 . Jiang L, Long A, Tan L, Hong M, Wu J, Cai L, Li Q. Elevated microRNA-520g in pre-eclampsia inhibits migration and invasion of trophoblasts. Placenta. 2017;51:70–75. http://doi.org/10.1016/j.placenta.2017.02.001 . Sidney LE, Branch MJ, Dunphy SE, Dua HS, Hopkinson A. Concise review: evidence for CD34 as a common marker for diverse progenitors. Stem Cells. 2014;32(6):1380–1389. http://doi.org/10.1002/stem.1661 . Xu XQ, Soo SY, Sun W, Zweigerdt R. Global expression profile of highly enriched cardiomyocytes derived from human embryonic stem cells. Stem Cells. 2009;27(9):2163–2174. http://doi.org/10.1002/stem.166 . Siemerink MJ, Klaassen I, Vogels IM, Griffioen AW, Van Noorden CJ, Schlingemann RO. CD34 marks angiogenic tip cells in human vascular endothelial cell cultures. Angiogenesis. 2012;15(1):151–163. http://doi.org/10.1007/s10456-011-9251-z . Kukreja I, Kapoor P, Deshmukh R, Kulkarni V. VEGF and CD 34: A correlation between tumor angiogenesis and microvessel density-an immunohistochemical study. J Oral Maxillofac Pathol. 2013;17(3):367–373. http://doi.org/10.4103/0973-029X.125200 . American College of O, Gynecologists' Committee on Practice B-O, the Society f-F. ACOG Practice Bulletin No. 204: Fetal Growth Restriction. Obstetrics and gynecology. 2019;133(2):e97-e109. http://doi.org/10.1097/AOG.0000000000003070 . Burton GJ, Sebire NJ, Myatt L, Tannetta D, Wang YL, Sadovsky Y, Staff AC, Redman CW. Optimising sample collection for placental research. Placenta. 2014;35(1):9–22. http://doi.org/10.1016/j.placenta.2013.11.005 . de Alwis N, Beard S, Binder NK, Pritchard N, Kaitu'u-Lino TJ, Walker SP, Stock O, Groom K, Petersen S, Henry A, Said JM, Seeho S, Kane SC, Hui L, Tong S, Hannan NJ. DAAM2 is elevated in the circulation and placenta in pregnancies complicated by fetal growth restriction and is regulated by hypoxia. Sci Rep. 2021;11(1):5540. http://doi.org/10.1038/s41598-021-84785-7 . Yan MS, Turgeon PJ, Man HJ, Dubinsky MK, Ho JJD, El-Rass S, Wang YD, Wen XY, Marsden PA. Histone acetyltransferase 7 (KAT7)-dependent intragenic histone acetylation regulates endothelial cell gene regulation. J Biol Chem. 2018;293(12):4381–4402. http://doi.org/10.1074/jbc.RA117.001383 . Jabbari N, Nawaz M, Rezaie J. Bystander effects of ionizing radiation: conditioned media from X-ray irradiated MCF-7 cells increases the angiogenic ability of endothelial cells. Cell Commun Signal. 2019;17(1):165. http://doi.org/10.1186/s12964-019-0474-8 . Zhao L, Ma R, Zhang L, Yuan X, Wu J, He L, Liu G, Du R. Inhibition of HIF-1a-mediated TLR4 activation decreases apoptosis and promotes angiogenesis of placental microvascular endothelial cells during severe pre-eclampsia pathogenesis. Placenta. 2019;83:8–16. http://doi.org/10.1016/j.placenta.2019.06.375 . Garnier V, Traboulsi W, Salomon A, Brouillet S, Fournier T, Winkler C, Desvergne B, Hoffmann P, Zhou QY, Congiu C, Onnis V, Benharouga M, Feige JJ, Alfaidy N. PPARgamma controls pregnancy outcome through activation of EG-VEGF: new insights into the mechanism of placental development. Am J Physiol Endocrinol Metab. 2015;309(4):E357-369. http://doi.org/10.1152/ajpendo.00093.2015 . Kappou D, Sifakis S, Androutsopoulos V, Konstantinidou A, Spandidos DA, Papantoniou N. Placental mRNA expression of angiopoietins (Ang)-1, Ang-2 and their receptor Tie-2 is altered in pregnancies complicated by preeclampsia. Placenta. 2014;35(9):718–723. http://doi.org/10.1016/j.placenta.2014.07.001 . Bourdiec A, Calvo E, Rao CV, Akoum A. Transcriptome analysis reveals new insights into the modulation of endometrial stromal cell receptive phenotype by embryo-derived signals interleukin-1 and human chorionic gonadotropin: possible involvement in early embryo implantation. PLoS One. 2013;8(5):e64829. http://doi.org/10.1371/journal.pone.0064829 . Additional Declarations No competing interests reported. Supplementary Files SupplementalTable1resultmalevsfemaleControl.vp.xlsx SupplementalTable2resultmalevsfemaleIUGR.vp.xlsx SupplementalTable3resultfemaleIUGRvsControl.vp.xlsx SupplementalTable4resultmaleIUGRvsControl.vp.xlsx SupplementalTable5resultsummaryoffinding.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2207891","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":149296305,"identity":"4088a88b-454e-4dd4-ba98-c245e3750ea9","order_by":0,"name":"Wenhui Song","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wenhui","middleName":"","lastName":"Song","suffix":""},{"id":149296306,"identity":"4f43190d-d982-46b5-b10d-094664592cab","order_by":1,"name":"Qing Guo","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Guo","suffix":""},{"id":149296312,"identity":"f08ffb4d-83cd-4c6f-b6a4-1787d095b332","order_by":2,"name":"Muraly Puttabyatappa","email":"","orcid":"","institution":"University of Michigan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Muraly","middleName":"","lastName":"Puttabyatappa","suffix":""},{"id":149296314,"identity":"82bd8420-3d07-45b9-897c-f46d84aa0802","order_by":3,"name":"Venkateswaran Ramamoorthi Elangovan","email":"","orcid":"","institution":"University of Michigan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Venkateswaran","middleName":"Ramamoorthi","lastName":"Elangovan","suffix":""},{"id":149296318,"identity":"3a2aeb3f-06f7-41af-8125-c723e7c19151","order_by":4,"name":"Jianping Wang","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jianping","middleName":"","lastName":"Wang","suffix":""},{"id":149296322,"identity":"1ef62c1e-f750-4968-9cd1-ad7beef7c9a9","order_by":5,"name":"Fang Li","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Li","suffix":""},{"id":149296324,"identity":"823f0188-ae52-4e94-9a4f-bead9eac066c","order_by":6,"name":"Fangfang Liu","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fangfang","middleName":"","lastName":"Liu","suffix":""},{"id":149296328,"identity":"ce8ee212-fabc-4e9a-af9e-2369cc55ed7f","order_by":7,"name":"Xuejie Bi","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuejie","middleName":"","lastName":"Bi","suffix":""},{"id":149296331,"identity":"efab5875-7bee-4298-b27a-d0ddf4af851f","order_by":8,"name":"Haiying Li","email":"","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haiying","middleName":"","lastName":"Li","suffix":""},{"id":149296333,"identity":"ecad10f7-45af-4000-8c8d-8439e95a0c92","order_by":9,"name":"Guangping Fu","email":"","orcid":"","institution":"Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guangping","middleName":"","lastName":"Fu","suffix":""},{"id":149296335,"identity":"e9103815-71c2-4746-89b9-e5d4bf57bd0e","order_by":10,"name":"Vasantha Padmanabhan","email":"","orcid":"","institution":"University of Michigan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Vasantha","middleName":"","lastName":"Padmanabhan","suffix":""},{"id":149296338,"identity":"6257856a-11b8-42eb-a5a2-d8fc78d0455d","order_by":11,"name":"XiaoHua Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYDACZjACAvb+hw8SKmxI0cJzhtngwZk0oi0CAgkfNsmHbYcIKzc4zvzwcWGbXeKGG7zHKhLYDjDwt3cn4NUi2cxmbDyzLTlxw+2+tBsJPHcYJM6c3YBXCz8zg5k0bxtz7oY7B8xuJEg8YzCQyMWvhY2Z/RtQS33uhhsJZgUJBocJa+Fn5gHZchioJceMISGBCC2SzTzFxjznjtfPPHMsWSLhQBoPQb8YnD++8TFPWbUx3/Hmgx9//rOR42/vxa8FA/CQpnwUjIJRMApGAVYAABnUSXUctA1UAAAAAElFTkSuQmCC","orcid":"","institution":"The Fourth Hospital of Shijiazhuang affiliated to Hebei Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"XiaoHua","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2022-10-27 01:59:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2207891/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2207891/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":28810770,"identity":"7fc02ad0-2aec-4345-9751-b254bae8b6a2","added_by":"auto","created_at":"2022-11-08 15:24:59","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":335346,"visible":true,"origin":"","legend":"\u003cp\u003ePlacental characteristics – weight, volume and efficiency and newborn birth weight from the entire cohort (composite) and segregated by newborn sex are shown. Data are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test and # represents large magnitude change by Cohen’s effect size analysis with Cohen’s d values ≥ 0.8 comparing control and IUGR groups.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/a79913c23ed3ea4539922229.jpg"},{"id":28809384,"identity":"64fadb06-0595-4353-b3ba-035169d87b49","added_by":"auto","created_at":"2022-11-08 15:16:59","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":555568,"visible":true,"origin":"","legend":"\u003cp\u003ePlacental caspase 3 activity and Ki67 immunostaining. Data for caspase activity and number of Ki67 positive/ stained cells are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test and # represents large magnitude change by Cohen’s effect size analysis with Cohen’s d values ≥ 0.8 comparing control and IUGR groups. Photomicrographs of the immunostaining from negative control generated by omitting primary antibody; squamous cell carcinoma as positive controls along with control and IUGR placentae are shown.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/22c847ca6613f8906aff09b0.jpg"},{"id":28809386,"identity":"db616ec2-b731-4d85-b797-ae96b20341d6","added_by":"auto","created_at":"2022-11-08 15:16:59","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":346019,"visible":true,"origin":"","legend":"\u003cp\u003eThe gene expression of steroidogenic genes \u003cem\u003eHSD3B\u003c/em\u003e, \u003cem\u003eHSD17B\u003c/em\u003e and \u003cem\u003eCYP19\u003c/em\u003eand steroid receptors \u003cem\u003eESR1\u003c/em\u003e, \u003cem\u003eAR\u003c/em\u003e and \u003cem\u003ePR\u003c/em\u003e in placentas from entire cohort (composite) and segregated by newborn sex are shown. Data are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test and # represents large magnitude change by Cohen’s effect size analysis with Cohen’s d values ≥ 0.8 comparing control and IUGR groups.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/abf7046f169993100b891603.jpg"},{"id":28809388,"identity":"b712ea5c-5785-4e8c-b02b-4c7c7cced3db","added_by":"auto","created_at":"2022-11-08 15:16:59","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":395197,"visible":true,"origin":"","legend":"\u003cp\u003eThe gene expression of IGF family members \u003cem\u003eIGF1\u003c/em\u003e, \u003cem\u003eIGF2, IGF1R, IGF2R, IGFBP1, IGFFBP2, IGFBP3\u003c/em\u003e and \u003cem\u003eIGFBP4\u003c/em\u003e in placentas from entire cohort (composite) and segregated by newborn sex are shown. Data are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test and # represents large magnitude change by Cohen’s effect size analysis with Cohen’s d values ≥ 0.8 comparing control and IUGR groups.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/47c6daffa5a0b7326d429116.jpg"},{"id":28810775,"identity":"2f8dd19d-68d0-4904-a086-49fe700ee58f","added_by":"auto","created_at":"2022-11-08 15:24:59","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":267885,"visible":true,"origin":"","legend":"\u003cp\u003eThe gene expression of inflammatory cytokine TNF, chemokine CCL2 and macrophage marker CD68 in placentas from entire cohort (composite) and segregated by newborn sex are shown. Data are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test comparing control and IUGR groups.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/fe9434a7995d5f934c6b257d.jpg"},{"id":28809391,"identity":"e36dc824-e7e2-4b76-9571-aaa5ac95e4e2","added_by":"auto","created_at":"2022-11-08 15:16:59","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":382648,"visible":true,"origin":"","legend":"\u003cp\u003eThe gene expression of angiogenic markers \u003cem\u003eVEGFA\u003c/em\u003e and its receptors \u003cem\u003eVEGFR1\u003c/em\u003eand \u003cem\u003eVEGFR2\u003c/em\u003e, \u003cem\u003eEBVEGF\u003c/em\u003e, \u003cem\u003eHIF1A\u003c/em\u003e, \u003cem\u003ePIGF\u003c/em\u003e, \u003cem\u003eANG1\u003c/em\u003e and \u003cem\u003eANG2\u003c/em\u003ein placentas from entire cohort (composite) and segregated by newborn sex are shown. Data are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test and # represents large magnitude change by Cohen’s effect size analysis with Cohen’s d values ≥ 0.8 comparing control and IUGR groups.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/60e4cc9d1d95067f6e2c8786.jpg"},{"id":28811819,"identity":"374b8051-ab5f-4aa3-8e4a-0eb6a9e452b1","added_by":"auto","created_at":"2022-11-08 15:32:59","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":70324,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSex-specific miRNA sample clustering and differential expression in control or IUGR placentas. \u003c/strong\u003ePrincipal Component Analysis (PCA) 2D among placentas from controls or IUGR group with male or female newborns are shown on the left column. Similarly, the 3D PCA plots are shown in the right for similar samples. For the PCA the 2D plots, 3D PCA plots are plotted with principal component 1 on X-axis and principal component 2 on Y-axis showing separation. Each point represents one sample. Volcano plot showing differences in miRNA expression comparing control female vs control male samples (bottom-top) and IUGR female vs IUGR male samples (bottom). miRNA are plotted by log2 fold change and -log10 adjusted p-values. The pink points represent miRNA that have absolute log2 fold change\u0026gt;0.05 and FDR \u0026lt;0.1. Blue dots represent miRNA that met absolute log2 fold change \u0026gt; 0.5 but did not meet FDR cut off 0.1. Black dots represent those miRNAs that did not meet either the log2 fold change or FDR cut off.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/370a8c4e26eb3c7952c012ef.jpg"},{"id":28813139,"identity":"0515bcb8-207f-4451-b068-df917ae15052","added_by":"auto","created_at":"2022-11-08 15:40:59","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":64863,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSex-specific miRNA sample clustering and differential expression between control and IUGR placentas. \u003c/strong\u003ePrincipal Component Analysis (PCA) 2D among placentas from male or female newborns between control and IUGR are shown on the left column. Similarly, the 3D PCA plots are shown in the right for similar samples. For the PCA the 2D plots, 3D PCA plots are plotted with principal component 1 on X-axis and principal component 2 on Y-axis showing separation. Each point represents one sample. Volcano plot showing differences in miRNA expression comparing control vs IUGR among placentas from female newborns (bottom-top) and male newborns (bottom). The pink points represent miRNA that have absolute log2 fold change\u0026gt;0.05 and FDR \u0026lt;0.1. Blue dots represent miRNA that met absolute log2 fold change \u0026gt; 0.5 but did not meet FDR cut off 0.1. Black dots represent those miRNAs that did not meet either the log2 fold change or FDR cut off.\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/5da74a00611897006685d8bb.jpg"},{"id":28810778,"identity":"5df7f843-2a96-4991-8287-1303620e46fd","added_by":"auto","created_at":"2022-11-08 15:24:59","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":920214,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrographs of endothelial cell marker CD34 immunostaining in the control and IUGR placentas along with analysis of the staining intensity, percentage of total stain intensity and area of the stain, and microvessel density and area in placentas from the entire cohort (composite) and segregated by newborn sex are shown. Data for staining and microvessel characteristics are presented as mean ± SEM with open bars representing the controls and solid bars representing the IUGR groups. Asterisk (*) represents p \u0026lt; 0.05 by Student’s t-test and # represents large magnitude change by Cohen’s effect size analysis with Cohen’s d values ≥ 0.8 comparing control and IUGR groups.\u003c/p\u003e","description":"","filename":"Figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/075a0170b87f0c3e461d8f3a.jpg"},{"id":30505812,"identity":"5987ed9b-c257-4f53-970f-f02424a57db4","added_by":"auto","created_at":"2022-12-19 09:14:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1288585,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/63198bbe-b386-481b-b2ac-9f0b43f9136a.pdf"},{"id":28810772,"identity":"9f7d6a4c-c7bc-40f7-af9b-0e19371aabde","added_by":"auto","created_at":"2022-11-08 15:24:59","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":139809,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalTable1resultmalevsfemaleControl.vp.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/5f28ff6abaa3a80a7c5ac682.xlsx"},{"id":28809396,"identity":"dcf7c5b4-2b5c-4a33-a1cb-cc3a291cba31","added_by":"auto","created_at":"2022-11-08 15:16:59","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":138889,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalTable2resultmalevsfemaleIUGR.vp.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/acc1e81336b7e705ee40767a.xlsx"},{"id":28813140,"identity":"87d3d272-04ed-4f2d-bdb6-d037e7ec10d2","added_by":"auto","created_at":"2022-11-08 15:40:59","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":136461,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalTable3resultfemaleIUGRvsControl.vp.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/c0e885fa1fc40068704817f4.xlsx"},{"id":28811822,"identity":"7df16a9c-1b11-44b8-8f16-ea64a0476a64","added_by":"auto","created_at":"2022-11-08 15:32:59","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":138037,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalTable4resultmaleIUGRvsControl.vp.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/9b7bd67c7da68f146ad72850.xlsx"},{"id":28811821,"identity":"b6bfbad8-93ce-4906-b2b1-9d222858b790","added_by":"auto","created_at":"2022-11-08 15:32:59","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":11815,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalTable5resultsummaryoffinding.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2207891/v1/68cb424b689a06bde80f5ec4.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sex-Specific Disruption in Human Placental miRNAs and mRNAs Involved in IUGR Placental Insufficiency and Capillary Angiogenesis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIntrauterine growth restriction (IUGR) is one of the most common pregnancy complications. Approximately 10\u0026ndash;15% of pregnancies are affected by IUGR, defined as the failure of the fetus to reach its genetically determined growth potential with fetal weight less than the 10th percentile for gestation age (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). IUGR can lead to adverse fetal outcomes, including preterm birth, neonatal mortality and even stillbirth with 30% of stillbirth ascribed to IUGR (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). The incidence of preterm labor and fetal mortality of IUGR offspring is significantly higher than the normal birth weight babies (\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). The surviving IUGR offspring are also at increased risk of developing cardiometabolic diseases during childhood and adulthood (\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Evidence that low birth weight male offsprings are more vulnerable to cardiovascular disease than low birth weight female offsprings (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e), suggests the susceptibility to intrauterine insults and consequent postnatal outcomes may differ by sex of offspring (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRelative to mediators of IUGR, it is important to recognize prenatal period, when most tissue and organ differentiation occurs (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e), is a susceptibility window for insults. Adequate placentation and optimal placental function are required for normal fetal development and successful pregnancy outcome. The birth weight range of male and female was different mediated by the sex-specific placental efficiency (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). As a conduit between the mother and fetus, placenta is involved in providing nutrients and oxygen, removal of waste products, metabolization of nutrients, and production of hormones - all required to promote fetal growth. Placenta also helps maintain a conductive intrauterine environment by undergoing structural and functional adaptations to accommodate fetal growth in response to changing environmental milieu (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). While the majority of IUGR cases are idiopathic causes, many involve compromised placental development and function, especially due to impairment of placental angiogenesis and insufficient oxygen and nutrient supply to the fetus (\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Placental development involves the differentiation of cytotrophoblasts into extravillous trophoblast cells (EVTs) and syncytiotrophoblast, invasion of EVTs, and remodeling of maternal spiral arteries such that syncytiotrophoblast are in direct contact with maternal blood in a structure called placental terminal villi. Terminal villi in placenta is the basic functional unit for transfer of oxygen and nourishment between mother and the fetus. It is in these smallest branches of placental villous trees through which diffusive transport of oxygen and nutrients occur between the outer surface of the trophoblast layer and the inner surface of the fetal capillary endothelium (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). As the functional component in terminal villi (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), the efficiency of terminal villi and of the placenta relies mainly on the microvessel density of capillaries. Since placental size, morphology, and angiogenesis dictates placental function, pregnancies associated with IUGR are often associated with significantly reduced placental size and weight (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). These changes are also associated with reduction in capillarization of the terminal villi and reduced cytotrophoblast proliferation along with focal syncytiotrophoblast apoptosis and necrosis (\u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Such changes can contribute to reduction in peripheral vascularity of the placental villi, increase in vascular resistance and decrease in umbilical cord blood flow (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Histomorphological changes in capillary in terminal villi exert direct effect on fetal perfusion and fetal growth as shown with hypovascularization in terminal villi of placenta from severe IUGR pregnancies (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e) and decreased microvessel density associated with small for gestational age placentae (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAngiogenic factors, such as vascular endothelial growth factor A (VEGFA) (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), endocrine gland-derived vascular endothelial growth factor (EG-VEGF) (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e), placenta growth factor (PlGF) (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), hypoxia inducible factor 1 subunit alpha (HIF1A) (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), Angiopoietin 1 (ANG1) and ANG2 (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e)were reported to be involved in microvessel formation in terminal villi. While aberrant gene expression of associated angiogenic factors may underlie impaired microvessel formation, the factors contributing to this are not fully understood. Other mechanisms linking poor placental function in IUGR pregnancies are the abnormal inflammatory response, both systemically at maternal and locally at the level of placenta (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), altered steroidogenesis (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), and impaired insulin-like growth factor (IGF) family signaling (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Lipopolysaccharide induced IUGR, has been shown to be associated with increase in tumor necrosis factor alpha (TNF) release and impaired invasion of trophoblast and remodeling of spiral artery (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e) supporting inflammation mediated role in placental angiogenesis and development of IUGR. The expression of proinflammatory cytokines are also regulated by equilibrium between steroid hormones glucocorticoids and progesterone with progesterone stimulating pregnancy protecting T cells (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e) and glucocorticoids promoting proinflammatory cytokine expression (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e) thus supportive of placental steroidogenesis impacting IUGR development. Likewise, decreased expression of placental IGF1 and its receptor (IGF1R) are reported to be linked with IUGR (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eEven more importantly, fetal sex has been found to influence the manifestation of placental dysfunctions (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Morphologic findings from fetoplacental capillary studies both in humans (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e) and animals (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e) have provided evidence supportive of sexually-dimorphic effects. Similarly, higher level of proinflammatory factors in preeclamptic placenta and higher risk of poor outcomes were seen in pregnancies with male offspring compared to those with female offspring (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). With growing evidence pointing to sexually dimorphic changes in placental angiogenic factor (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e) and inflammatory gene (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e) expression, it is necessary to gain and understanding of the placental adaptive capability relative to angiogenesis that underlie this sex specific IUGR responses in human.\u003c/p\u003e \u003cp\u003eAberrant expression of genes underlying placental disruptions in turn may be driven by epigenetic alterations mediated by, among others, the microRNA (miRNA). MiRNAs are a class of non-coding RNAs of 18\u0026ndash;22 base pair, single nucleotide strand that can regulate gene expression by targeting mRNAs and transiently blocking translation or inducing degradation of the mRNA without altering the gene sequence (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). In humans, placenta-specific miRNA clusters have been identified on chromosomes 14 and 19 (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). Placental miRNAs are being actively investigated not only because of their role in the growth and function of the placenta but also due to their evolving role in the pregnancy complications including IUGR (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Additionally, miRNAs are also emerging as diagnostic biomarkers as they are readily detectable in the maternal circulation. Of interest, one study reported sex-specific patterns of circulating maternal miRNAs in IUGR pregnancies that contributed to placental insufficiency through validated targets including angiogenetic factors, insulin-like growth factors and its receptors, apoptosis regulators (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). These findings raise the possibility for miRNAs to have the potential to serve as non-invasive sex-specific biomarkers for IUGR and emphasize need for further investigations in this regard.\u003c/p\u003e \u003cp\u003eTherefore, the goal of this project is to test the hypothesis that IUGR pregnancies are associated with disruption in miRNA and mRNAs involving key regulators of angiogenesis and microvessel development as well as the sex-specificity of such responses. This hypothesis was tested in term placenta collected from primipara with normal and IUGR pregnancies taking into consideration the impact of fetal sex.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1 Subjects and Placental Characteristics\u003c/h2\u003e\n \u003cp\u003eThe demographics of the 32 subjects from this study are summarized in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. This cohort comprised of Asian women with a mean age of 28.18 (range 21\u0026ndash;34 years). This homogeneous group consists of only married, non-smoking, primiparous women of similar pre-pregnancy body mass index (BMI) and comparable gestational weight gain. Most women reported to have a college degree and had mostly vaginal birth and were of full term and showed no difference among mothers from control and IUGR group. The placental and fetal characteristics comparing the control and IUGR subjects are shown in the Fig.\u0026nbsp;1. The placental weight tended (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.08) to be lower among IUGR patients however this was not evident when IUGR mothers were segregated based on the sex of the newborn. The placental volume showed significant decrease among IUGR mothers with this trend evident by large magnitude effect among the mothers with male newborns. In line with this birth weight was significantly lower for those born to the mothers from the IUGR group and this was evident even when the newborns were segregated based on their sex. Likewise, the placental efficiency calculated as the ratio of birth weight to the placental weight was significantly lower among IUGR subjects and this was also evident among both sexes of the newborn.\u0026nbsp;\u003c/p\u003e\n \u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDemographics of the pregnant women (n\u0026thinsp;=\u0026thinsp;32)\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eN (%) or Median (range min-max)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eN (%) or Median (range min-max)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eMother\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eIUGR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMale\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eFemale\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMale\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eFemale\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eInfant sex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28.45(23\u0026ndash;34)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e26.71(23\u0026ndash;31)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e29.38(26\u0026ndash;34)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e27.67(21\u0026ndash;32)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e27.89(22\u0026ndash;32)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e27(21\u0026ndash;32)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRace\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAsian\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003ePre-pregnancy BMI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.73\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003ePre-pregnancy weight (kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e53.38(40\u0026ndash;70)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e52.36(46\u0026ndash;62)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e53.92(40\u0026ndash;70)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e54.67(46\u0026ndash;65)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e55.22(48\u0026ndash;65)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e53(46\u0026ndash;63)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eWeight near term (kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e67.90(55\u0026ndash;88)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e69.29(60\u0026ndash;76)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e67.15(55\u0026ndash;88)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e71.50(60\u0026ndash;88)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e71.33(65\u0026ndash;85)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e72.00(60\u0026ndash;88)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eGestational weight gain (kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.63(-4-23)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.93(8\u0026ndash;23)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.23(-4-21)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.83(10\u0026ndash;25)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.11(10\u0026ndash;23)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.00(10\u0026ndash;25)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eParity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSmoking status\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNever\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePast smoker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eEducation (n\u0026thinsp;=\u0026thinsp;32)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHigh school\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSome college\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026ge; Bachelor\u0026rsquo;s\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eMarital status\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMarried\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSingle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eInfant\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eRoute of delivery\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCesarean\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVaginal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eGestational age (days)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.49(38.00-40.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.20(38.00-40.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.65(38.14\u0026ndash;40.57)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.32(38.29\u0026ndash;40.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.33(38.57\u0026ndash;40.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.29(38.29\u0026ndash;40.14)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eBirth weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2650.50(2130\u0026ndash;2900)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2655.71(2500\u0026ndash;2790)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2647.69(2130\u0026ndash;2900)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3250.83(3000\u0026ndash;3620)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3240.00(3040\u0026ndash;3620)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3283.33(3000\u0026ndash;3500)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2 Placental Apoptosis and Proliferation State\u003c/h2\u003e\n \u003cp\u003ePlacental apoptosis measured via caspase 3 activity did not show any changes between control and IUGR groups. However, when segregated by the sex of the offspring born the caspase 3 activity tended to be lower in placentas from male newborn (p\u0026thinsp;=\u0026thinsp;0.07) while in those with female newborns there was a large magnitude increase in caspase 3 activity (Fig.\u0026nbsp;2). Cellular proliferation marker Ki67 immunostaining showed a significant increase in placentas from the IUGR group. This increase was only evident among the placentas with male newborns when segregated by sex of the newborn (Fig.\u0026nbsp;2).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3 Placental Gene Expression of Steroidogenic Genes\u003c/h2\u003e\n \u003cp\u003ePlacental gene expression of 17 hydroxy steroid dehydrogenase B (\u003cem\u003eHSD17B\u003c/em\u003e) and aromatase (\u003cem\u003eCYP19\u003c/em\u003e) were significantly lower in the IUGR group (Fig. 3). When segregated by the sex of the newborn, HSD17B tended (p\u0026thinsp;=\u0026thinsp;0.07) to be lower in placentas with male newborn only. In contrast, \u003cem\u003eCYP19\u003c/em\u003e expression was significantly lower in placentas with female newborns while in the males there was a large magnitude decrease (Fig. 3). While no change in androgen (AR) and progesterone (PR) receptor were evident when examined compositely, when segregated by sex of the newborn AR and PR expression showed a large magnitude increase in placentas with female and male newborns respectively (Fig. 3). No change in expression was observed for \u003cem\u003eHSD3B\u003c/em\u003e and \u003cem\u003eESR1\u003c/em\u003e expression.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.4 Placental Gene Expression of Insulin like Growth Factor (IGF) Family Members\u003c/h2\u003e\n \u003cp\u003eThe placental expression of \u003cem\u003eIGF1\u003c/em\u003e and IGF binding protein 3 (\u003cem\u003eIGFBP3\u003c/em\u003e) was significantly lower in IUGR placentas (Fig. 4). When segregated by sex of the newborn, both \u003cem\u003eIGF1\u003c/em\u003e and \u003cem\u003eIGFBP3\u003c/em\u003e was significantly lower in females (Fig. 4). The expression of \u003cem\u003eIGF1, IGFBP1\u003c/em\u003e and IGF2 receptor (\u003cem\u003eIGF2R\u003c/em\u003e) did not show any change between control and IUGR. However, when segregated by sex of the newborn, the expression of \u003cem\u003eIGF2\u003c/em\u003e mRNA tended to be lower with a large magnitude decrease in placentas from female newborns while \u003cem\u003eIGF2R\u003c/em\u003e tended to be higher in placentas from male newborns (Fig. 4). The expression of \u003cem\u003eIGFBP1\u003c/em\u003e mRNA showed a large magnitude increase in IUGR placentas with male newborns but no change in expression of \u003cem\u003eIGFBP2\u003c/em\u003e and \u003cem\u003eIGFBP4\u003c/em\u003e expression was observed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.5 Placental Gene Expression of Inflammatory Markers\u003c/h2\u003e\n \u003cp\u003eThe qPCR analysis of the genes associated with inflammation such cytokine TNF, chemokine CCL2 and macrophage infiltration marker CD68 in the placenta from control and IUGR subjects are shown in Fig. 5. No change in the expression of these markers was evident between the control and IUGR groups. However, when placental gene expression was assessed by segregating the newborn sex, the expression of the chemokine \u003cem\u003eCCL2\u003c/em\u003e and macrophage marker \u003cem\u003eCD68\u003c/em\u003e were significantly lower in placentas from pregnancies with female newborn (Fig. 5).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.6 Placental Gene Expression of Angiogenic Markers\u003c/h2\u003e\n \u003cp\u003eThe RT-PCR analysis of the genes associated with angiogenesis in the placenta from control and IUGR subjects are shown in Fig. 6. Gene expression analysis showed that the mRNA expression of \u003cem\u003eVEGFA\u003c/em\u003e tended to be lower in placenta from IUGR group while the VEGF receptors \u003cem\u003eVEGFR1\u003c/em\u003e and \u003cem\u003eVEGFR2\u003c/em\u003e showed no changes. Similarly, no change in the expression of \u003cem\u003eEGVEGF\u003c/em\u003e was observed between the two groups. The expression of \u003cem\u003eHIF1A\u003c/em\u003e and \u003cem\u003ePIGF\u003c/em\u003e were significantly lower among the placentas from IUGR group. While this trend was not observed among placentas when segregated by newborn sex for \u003cem\u003eHIF1A\u003c/em\u003e but was significantly lower in placentas with male pregnancies for \u003cem\u003ePIGF\u003c/em\u003e mRNA. While no change in the expression of \u003cem\u003eANG1\u003c/em\u003e and \u003cem\u003eANG2\u003c/em\u003e was evident among the placentas from entire group, a trend towards increased expression among placentas with female newborn was observed for \u003cem\u003eANG1\u003c/em\u003e as opposed to a large magnitude decrease \u003cem\u003eANG2\u003c/em\u003e expression among the placentas with male newborn.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.7 The Epigenetic Effect of Fetal Sex on MiRNA Differential Expression in IUGR Placenta\u003c/h2\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.7.1 Descriptive Statistics\u003c/em\u003e\u003c/strong\u003e: Post-trimming, microRNA reads exhibited high mean read quality scores, per sequence GC content ranging from 20-80% and sequence duplication levels up to 30%\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.7.2 Sex-specific microRNA expression in Control group\u003c/em\u003e\u003c/strong\u003e: A partial separation in microRNA expression profiles was observed in 2D and 3D PCA plots generated using unsupervised model (Figure 7). Comparison of microRNA expression (FDR \u0026lt; 0.1 and absolute log2 fold change (abs log2FC \u0026gt; 0.5) between female and male controls demonstrated 7 microRNA specific in placentas with female newborns and 3 genes specific in the placentas with male newborns (Supplemental Table 1). In the control group, placentas from female newborns microRNAs \u003cem\u003eMIR490\u0026nbsp;\u003c/em\u003e(log2FC 1.827; p = 0.097), \u003cem\u003eMIR193B\u0026nbsp;\u003c/em\u003e(log2FC -1.104; p = 0.00137), and 5 of the \u003cem\u003eMIR941\u003c/em\u003e family \u003cem\u003eMIR941-1\u0026nbsp;\u003c/em\u003e(log2FC -1.5899; p = 0.009), \u003cem\u003eMIR941-2\u0026nbsp;\u003c/em\u003e(log2FC -1.602; p = 0.009), \u003cem\u003eMIR941-3\u0026nbsp;\u003c/em\u003e(log2FC -1.602; p = 0.009)\u003cem\u003e, MIR941-4\u0026nbsp;\u003c/em\u003e(log2FC -1.602; p = 0.009)\u003cem\u003e,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;MIR941-5\u0026nbsp;\u003c/em\u003e(log2FC -1.602; p = 0.009) were upregulated compared to placentas from male newborns (Figure 7). On the other hand, \u003cem\u003eMIR451A\u0026nbsp;\u003c/em\u003e(log2FC 1.635; p = 0.037), \u003cem\u003eMIR372\u0026nbsp;\u003c/em\u003e(log2FC 1.656; p = 0.097) and \u003cem\u003eMIR136\u0026nbsp;\u003c/em\u003e(log2FC 0.995; p = 0.097) were upregulated in the placentas with male newborns compared to the placentas from female newborns (Figure 7).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.7.2 Sex-specific effects in IUGR Group:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eIn the IUGR groups comparing the placenta from male and female newborns, only one microRNA \u003cem\u003eMIR518B\u003c/em\u003e (log2FC 1.589; p = 0.001) was upregulated in the placentas from female newborns compared to the male newborns (Figure 7; Supplemental Table 2)\u003c/p\u003e\u003cstrong\u003e\u003cem\u003e2.7.3 Sex-specific effects in Control versus IUGR Group:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eAmong placentas from female newborns,\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e2D and 3D PCA plots generated by unsupervised clustering microRNA showed overlap between control and IUGR groups (Figure 8). Analysis by DESeq2 for miRNA found 2 dysregulated microRNAs (FDR\u0026lt;0.1 and absolute log2FC\u0026gt;0.5). \u003cem\u003eMIR451A\u003c/em\u003e was upregulated (log2FC 1.962; p = 0.049) whereas \u003cem\u003eMIR543\u003c/em\u003e was downregulated (log2FC -1.331; p = 0.054) in placentas from IUGR group with female newborns (Figure 8, Supplemental Table 3). Among placentas from male newborns, 2D and 3D PCA plots generated by unsupervised clustering showed an overlap between control and IUGR groups. IUGR group modulated one microRNA at FDR \u0026lt;0.1 and absolute log2FC\u0026gt;0.5. The sole microRNA observed to be regulated was \u003cem\u003eMIR520G\u003c/em\u003e which is upregulated (log2FC 0.820; p = 0.049) in the IUGR group placentas with male newborns (Supplemental Table 4).\u0026nbsp;\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.8 Placental Microvessel Characteristics\u003c/h2\u003e\n \u003cp\u003eEndothelial cell marker CD34 expression in placental microvessels immunohistochemically visualized and assessed is summarized in Fig.\u0026nbsp;9. The relative staining intensity, total stained area and percent total intensity of CD34 immunostaining was not different between control and IUGR placentas. When segregated with sex, the relative placental staining intensity for CD34 showed a large magnitude increase in placentas from IUGR pregnancies with male newborn while the percentage of total intensity of the stain was significantly lower in placentas from IUGR pregnancies with female newborn. Assessment of the microvessel density and the microvessel area did not show any difference between control and IUGR subjects. When segregated by sex, microvessel density was significantly lower in placentas from IUGR pregnancies with female newborns.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eUtilizing term placenta from a homogeneous cohort of Asian primiparous pregnant women with and without IUGR, expression levels of coding genes, proteins and miRNA that influence placental angiogenesis and function were assessed taking into account the impact of offspring sex. There is lack of strong evidence that suggesting the placental efficiency and structure dependent on the sex-specific gene and protein expression. Our study provided valuable insight into the way in which fetal sex influences placental capillary morphology. Although the placenta function was impaired both in male and female placenta, the change of microvessel density was only observed in female placenta but not in male, possibly due to the less susceptible on gene and protein expression in males associated with placental enviorment (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Our findings showed sex-specific changes in expression of genes involved in steroidogenesis, steroid action, IGF family members, inflammatory cytokines and angiogenic factors in IUGR pregnancies. Most of significant changes were menifested in female placenta. Consistently, sex specific responses were also evidenced at the level of miRNA with upregulation of \u003cem\u003eMIR451A\u003c/em\u003e and downregulation of \u003cem\u003eMIR543\u003c/em\u003e in IUGR placentas with female newborns and upregulation of \u003cem\u003eMIR520G\u003c/em\u003e in IUGR placentas with male newborns (Supplemental Table\u0026nbsp;5\u003cb\u003e)\u003c/b\u003e. The miRNAs that changed in placentas from female pregnancies have been shown to influence angiogenesis (\u003cspan additionalcitationids=\"CR56\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e). In keeping with these findings, the microvessel angiogenesis marker CD34 also showed reduced staining in female IUGR placental. The significance of these sex-specific findings and their role in development of IUGR are discussed below.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCompromised placental function in Composite and Sex-segeragated IUGR pregnancies\u003c/b\u003e \u003c/p\u003e \u003cp\u003eChanges in placental morphology and angiogenesis have been shown to underlie placental dysfunction in IUGR pregnancies (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Recruitment of primiparous women without pregnancy complication allowed exclusion of maternal parameters and fetal malformation thus enforcing the focus on the main etiology resulting from placenta. Consistent with previous findings, impaired placental function and lower placental efficiency were evident in IUGR pregnancies (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). Meanwhile, the impaired placental function was evident in both male and female fetal placenta.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eSex-dependent Gene expression changes in IUGR placenta Function and Angiogenesis\u003c/span\u003e \u003c/p\u003e \u003cp\u003ePlacenta being a dynamic organ that undergoes significant anatomical and functional changes to keep up the demands of fetal growth requires to be constantly regulated by various processes. In line with this premise, genes that encode steroid synthesis and action, inflammatory process, IGF family members and angiogenic genes were altered in IUGR group in a sex-specific manner. The lower expression of \u003cem\u003eCYP19\u003c/em\u003e, key gene in estradiol biosynthesis, in the placentas with female newborns is in line with lower level of maternal estradiol observed in mothers with IUGR pregnancies (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e), estrogen-suppressed placenta menifesting an impaired placental angiogenesis in animal study (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). The lower placental expression of \u003cem\u003eIGF1\u003c/em\u003e and \u003cem\u003eIGFBP3\u003c/em\u003e in IUGR group are also supportive of the role of IGF family members in development of IUGR. IGFs are anabolic hormones that promote proliferation, mitochondrial protection, cell survival, tissue growth and development, anti-inflammatory, antioxidant, antifibrogenic and antiaging activities in the developing fetus (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). With placenta being a major source of IGFs (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e), the lower expression of IGF is in line with low birth weight and impaired placental efficiency and capillary growth (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). Consistently, the lower expression of \u003cem\u003eIGF1\u003c/em\u003e and \u003cem\u003eIGFBP3\u003c/em\u003e in the female placenta was observed in liine with the decreased capillary density in terminal villi. Additionally, the anti-inflammatory role is also reduced parallelled with the downregulation of IGF1 and IGFBP3. To be mentioned, chemokine \u003cem\u003eCCL2\u003c/em\u003e and macrophage marker \u003cem\u003eCD68\u003c/em\u003e were lower in placentas from pregnancies with female newborn. It was reported in preeclampsia patients with HELLP that the increased expression of CD68 may be point to an adaptive response of placenta (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e). In contrast, the suppression of CD68 in female placenta may partly underline the impaired growth station of capillary in terminal villi.\u003c/p\u003e \u003cp\u003eContinuing with the trend of downregulation \u0026ndash; significant downregulation of angiogenic genes \u003cem\u003eHIF1A\u003c/em\u003e and \u003cem\u003ePIGF\u003c/em\u003e were evident among the placentas from composite IUGR group, while placental expression of VEGF, ANG1, ANG2, and angiopoietin receptor (TIE-2) were found to be higher (\u003cspan additionalcitationids=\"CR67\" citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e). Since HIF1A regulates the expression of VEGF and angiopoietins, it is possible that lower expression of \u003cem\u003eHIF1A\u003c/em\u003e in our cohort may have contributed to the lack of change in the expression of other angiogenic markers, consistently with the findings in a PE placenta study with no significant changes in angiogenic factors observed (\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e). Though the role of fetal sex plays in the placental perturbations are widely studied (\u003cspan additionalcitationids=\"CR70\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e), there was no sex-dependent significant change was shown in female placenta from this cohort.\u003c/p\u003e \u003cp\u003eConsistent with the compromised placental phenotype there was an increase in caspase activity in the placenta with female pregnancies. In contrast, in spite of the decreased placental efficiency and a trend for decreased placental volume, paradoxically the placenta from male pregnancies showed an increase in proliferative activity as evidenced by the Ki67 staining and decrease in caspase activity suggestive of an adaptive response to overcome compromise. In keeping with this premise of adaptive response, a trend for an increase in capillary density was evident in placenta of male pregnancies. Adaptive changes in angiogenesis reflective of increased efficiency have been reported with smaller size placenta (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e). The trend for an increase in capillary density in male IUGR placenta as opposed to downregulation in female IUGR placenta is supportive of sexually-dimorphic compensatory responses. Previous studies (\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e, \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e) have also shown a trend for increase in capillary in male IUGR placenta.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePlacental miRNA expression changes and Sex Dependence\u003c/span\u003e \u003c/p\u003e \u003cp\u003emiRNAs are noncoding RNAs that regulate gene expression through micro-ribonucleoprotein effector complexes and sequence-specific recognition of target sites. Therefore, they have the unique ability to modulate gene expression and influence developmental and cellular processes including angiogenesis (\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e). As has been reported before (\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e) dimorphic expression of miRNA was observed between pregnancies with male and female newborns in both control and IUGR groups. The significance of these sex-specific findings needs to be further explored. Interestingly, decreased expression of \u003cem\u003eMIR451A\u003c/em\u003e expression in hepatocellular carcinoma was reported to play a role in increasing angiogenesis and VEGF expression (\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e). This increase of MIR451A in IUGR pregnancies in the present study was not associated with a change in VEGF expression. However, our finding of reduced staining for CD34, a microvessel endothelial marker is suggestive of reduced angiogenesis in IUGR placentas with female newborns. This is in line with the negative regulation of angiogenesis associated with MIR451A elevation. In contrast to upregulation of \u003cem\u003eMIR451A\u003c/em\u003e, downregulation of \u003cem\u003eMIR543\u003c/em\u003e in placentas from IUGR group with female newborns was observed. However, while MIR451A negatively regulates angiogenesis, MIR543 expression positively regulates angiogenesis as demonstrated in cardiac endothelial cells (\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e), human retinal endothelial cells (\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e), and non-small cell lung cancer (\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e). Due to the opposing roles of \u003cem\u003eMIR451A\u003c/em\u003e and \u003cem\u003eMIR543\u003c/em\u003e in regulating angiogenesis, the balance of the two may dictate the final impact on angiogenesis. These changes in miRNA in the IUGR associated pregnancies with female fetuses are however indicative that dysregulation of angiogenesis may have epigenetic basis.\u003c/p\u003e \u003cp\u003eIn contrast in IUGR associated pregnancies with male fetuses upregulation of \u003cem\u003eMIR520G\u003c/em\u003e was observed. While a role for angiogenesis for this miRNA is not yet known, elevated expression of MIR520G have been observed in serum from preeclampsia pregnancies (\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e). Additionally, this miRNA has been shown to negatively regulate trophoblast migration and invasion (\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e) processes essential for placental function. These findings support for the possibility that compromised placental trophoblast migration and invasion may be the basis for the development of IUGR in pregnancies carrying male fetuses.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePlacental Angiogenesis Medicated in Sex-Dimorphic Pattern\u003c/span\u003e \u003c/p\u003e \u003cp\u003eCD34 is a cell surface marker that is expressed by a broad range of cells including hematopoietic, stromal, epithelial, and endothelial cells and is now widely regarded as a marker of vascular endothelial progenitor cells (\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e). The function of CD34 is still not completely known but evidence to support its role in inhibition or facilitation of adhesion, cell proliferation, and regulation of differentiation are present (\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e). CD34 positive endothelial cells under angiogenic stimuli are shown to migrate and from sprouting tip cells, that are present in the leading edge of angiogenesis (\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e). Because of this role of CD34 in active angiogenesis the evidence that reduced immunostaining intensity for CD34 in IUGR associated placentas with female pregnancies suggests impaired angiogenesis as a contributory factor for development of IUGR. Evidence that VEGF and CD34 expression correlates with angiogenesis in tumors (\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e) is supportive for the evidence that the large magnitude decrease in expression of VEGF receptor VEGFR1 may also contribute to this impeded angiogenesis in IUGR placenta with female offspring. However, the upregulation of CD34 total staining intensity and stained area pointing to the proliferation of endothelial cell in male IUGR placenta may again be reflective of a compensatory response to maintain non-branching angiogenesis in terminal villi of male IUGR placenta.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eLimitations and Conclusions\u003c/span\u003e \u003c/p\u003e \u003cp\u003eAlthough this study provides strong evidence for impaired placental angiogenesis as a contributory factor for development of IUGR in a sex dimorphic manner, the findings from this study should be viewed considering some limitations. The limitations are that this study was carried out in a small set of mothers from a nondiverse cohort. However, the fact that this study is from a nondiverse cohort of Asian women can be viewed as a strength as confounds arising from race can be avoided. Another limitation is the sample size from control female pregnancies were rather low. Nonetheless, statistically significant outcomes achieved in the face of low numbers emphasize the need for large scale investigations to validate the potential miRNA biomarkers identified. The comprehensive analysis of sex-specific gene and key protein expression coupled with use of next generation sequencing to determine differentially expressed miRNA is one of the strengths of this study. However, findings from this study should be viewed as providing proof of concept relative to the influence of fetal sex on IUGR outcomes via impaired placental angiogenesis and function. The role of impaired angiogenesis and trophoblast migration/invasion through epigenetic regulation needs to be explored further in a larger and more diverse cohort.\u003c/p\u003e"},{"header":"4. Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec13\"\u003e\n \u003ch2\u003e4.1 Human Subjects:\u003c/h2\u003e\n \u003cp\u003eHuman subjects were recruited following written informed consent and studies performed following the guidelines approved by the Institutional Ethics Committee at Hebei Medical University Affiliated Obstetrics and Gynecology Hospital (Approval ID: 20210030) and Chinese Clinical Trial Registry (Registration Number: ChiCTR2100043159). Primiparous pregnant women with singleton pregnancies who delivered between 37 and 41 weeks of gestation were recruited from the Fourth Hospital of Shijiazhuang affiliated with Hebei Medical University. Gestational age was determined by the ultrasound assessment. Placentae were collected from enrolled women at term immediately following delivery. Based on offspring birth weight women were classed into two groups, control and IUGR. Pregnancies were designated as IUGR when birth weight was below the 10th percentile for the gestational age as defined by the American College of Obstetricians and Gynecologists (\u003cspan class=\"CitationRef\"\u003e87\u003c/span\u003e). Criteria for exclusion included pregnancy complications, malnutrition, velamentous placenta, severe placental calcification or infarction, congenital malformation, and umbilical cord compromise. The demographic details and birth outcomes such as maternal age, body mass index (BMI), maternal substance abuse or smoking, adverse pregnancy history, maternal weight, weight gain throughout pregnancy, offspring birth weight and gender information were collected from the medical record. Placental samples from 20 IUGR (Male: 7, female 13) and 12 controls (Male: 9, female 3) were used in this study (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003e4.2 Placenta Collection:\u003c/h2\u003e\n \u003cp\u003eAt term, whole placenta was collected immediately after the delivery and fetal membranes and the umbilical cord were removed and the weight and size were recorded. About 0.5-1.0 cm of placental villi from the fetal side was dissected and washed with normal saline to remove maternal blood and placed in a cryogenic vial containing RNAlater (\u003cspan class=\"CitationRef\"\u003e88\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e89\u003c/span\u003e), frozen and stored in -80\u0026deg;C until further analysis. A portion of placental fragments was also collected and fixed overnight at 4\u0026deg;C in 4% paraformaldehyde and embedded in paraffin for histomorphological and immunohistochemical analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec15\"\u003e\n \u003ch2\u003e4.3 Histological examination\u003c/h2\u003e\n \u003cp\u003eParaffin-embedded tissues were sectioned (4 microns) and stained with hematoxylin and eosin (H\u0026amp;E) following the traditional H\u0026amp;E staining protocol. For examination of CD34 expression, paraffin embedded placenta was sectioned (4 microns) and immunostained with a mouse monoclonal anti-human CD34 antibody (QBEnd 10, Gene Tech (Shanghai) Company Limited, Ch). Immunostaining was performed on VENTANA BenchMark GX@ (Roche, Tucson, AZ USA) automated staining instrument following manufacturer recommended protocol. High-resolution, whole-slide digital scan of both H\u0026amp;E and immuno stained slides was performed at 40\u0026times; magnification using Aperio CS2 Digital Pathology Scanner and Aperio Imagescope software (Aperio Technologies Inc. San Diego USA). Acquired images were saved as Tagged Image Format File (tiff) for further analysis. From each slide, five equal size regions of interest (ROI; 0.2645 \u0026micro;m2 each) were selected by experienced pathologist. Regions of interest was restricted to the microvessel rich area from different locations. Color deconvolution and microvessel analysis algorithms were employed to qualify the CD34 staining intensity and microvessel-associated parameters, respectively. With color deconvolution algorithm, the parameter settings for the DAB channel were tailored to efficiently identify CD34 staining in placenta villi and the parameter settings were saved as a Macro for the repeat use. Using the macro, average CD34 staining intensity, percentage of stained area, and total stained region was obtained. The procedures for Ki67 staining using the human Ki67 antibody (NO.GM027, Gene Tech (Shanghai) Company Limited, Ch) was similar to that of CD34 immunostaining followed by analysis with Aperio CS2 software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003e4.4 Assessment of caspase-3 activity\u003c/h2\u003e\n \u003cp\u003eCaspase 3 activity was assessed in cyro-preserved tissues utilizing a colorimetric kit (No.C1116, Beyotime Biotechnology, Shanghai, Ch) following manufacturer\u0026rsquo;s recommendations. Briefly, 100\u0026micro;l lysis buffer was added to about 10mg of cryo-preserved placental tissue from each subject, homogenized using a cryogenic homogenizer and incubated on ice for 5min. Following this the homogenate was centrifuged at 16,000\u0026ndash;20,000r/min for 10-15min and supernatant collected and used to assess the Caspase 3 activity. Total protein was also estimated in homogenate using Bradford Protein Assay Kit (NO.P0006,Beyotime Biotechnology, Shanghai, Ch ) and caspase-3 activity was normalized to mg amount of total protein.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec17\"\u003e\n \u003ch2\u003e4.5 Real-time reverse transcriptase\u0026ndash;polymerase chain reaction (RT-PCR)\u003c/h2\u003e\n \u003cp\u003eFrozen placental tissue was lysed using tissue cryogrinder (KZ-III-FP, Wuhan Servicebio Technology Company Limited, CH) and total RNA was isolated using Eastep@Supper Total RNA Extraction kit (Shanghai Promega Biological Products Ltd., Shanghai, CH) following manufacture\u0026rsquo;s protocol. The concentration and 260/280 ratios were determined using Nanodrop.\u003c/p\u003e\n \u003cp\u003eSubsequently, 1000 ng of total RNA was reverse transcribed to complementary DNA (cDNA) with first-strand complementary synthesis system (Invitrogen, Life Technologies). Gene expression was assessed using SYBRgreen based real time RT-PCR using PowerUpTMSYBRTM Green Master Mix (ThermoFisher). Sequences for the oligonucleotide primers for the genes under study designed using Primer3 or from previous reports (\u003cspan class=\"CitationRef\"\u003e90\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e95\u003c/span\u003e) are shown in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The relative amount of each transcript was calculated using the \u0026Delta;\u0026Delta;CT method and normalized to the endogenous reference gene \u0026beta;-Actin.\u0026nbsp;\u003c/p\u003e\n \u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eSequence of primers used\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene ID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward Primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse Primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAccession Number\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCCAAGACCCAGAAGTATCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCAATCTCCCTCCTCTGCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001111285.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCTCACCTTCTTGGCCTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCGGAAACAGCACTCCTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001291862.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGFBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGAGCCCTGCCGAATAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCATGGATGTCTCACACTGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_000596.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGFBP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAAAGCACGCGCTCTTCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCATCGCCATTGTCTCCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001313992.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGFBP3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATCAAGAAAGGGCATGCTAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGGAGAAGTTCTGGGTATCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_047420325.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGFBP4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCCACGAGGACCTCTACATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATCCAGAGCTGGGTGACACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001552.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGF1R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGTGCTGTATGCCTCTGTGAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATAGACCATCCCAAACGACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_011521517.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIGF2R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGGGAAGAGGCAGGAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTGGCAGGCATACTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_000876.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGGCAGAATCATCACGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGGTCTCGATTGGATGGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001025366.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVEGFR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGTGTGAGCGGCTCCCTTATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACAGTCCGGCACGTAGGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_002019.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVEGFR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAGCAAAAGCAGGGAGTCTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTCTGTGTCATCGGAGTGATATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_002253.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePIGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGAGGTGGAAGTGGTACCCTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGATCTTTAGGAGCTGCATGGTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_002632.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHIF1A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAACGTCGAAAAGAAAAGTCTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTTATCAAGATGCGAACTCACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001243084.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEGVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGTCCCCTTCTTCAGGAAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCAGGCTGTGCTCAGGAAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_032414.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eANGPT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGACTGCAGAGCAGACCAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTAGCTTGTAGGTGGATAATGAATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001199859.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eANGPT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGAGGCGGGTGGACAATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCCTGAAGGGTTACCAAATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001118887.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTGCCGCCCTTCTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTCTTTGGGACACTTGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_002982.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTNF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCCAGAGGGAAGAGTTCCCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTTGTCACTCGGGGTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_000594.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTACATGGCGGTGGAGTACAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGATGAGAGGCAGCAAGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001040059.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eESR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGGAACCAGGGAAAATGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAACCGAGATGATGTAGCCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_017010383.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCAGCACAACTACTTATGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCATTTGGAACGCCCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_006718858.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTGGCTTCCGCAACTTACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGACTTGTGCATGCGGTACTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_000044.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCYP19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCAAGCTCTCCTCATCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAACTCAGTGGCAAAGTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001347252.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHSD3B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGAGGCCTGTGTCCAAGCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTTTGCTGTGTGGGTATGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_000862.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHSD17B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATCCAGAGCCTCATCCATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAACGCCTTGGAAGCTGAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_047423304.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec18\"\u003e\n \u003ch2\u003e4.6 RNAseq Analysis\u003c/h2\u003e\n \u003cdiv class=\"Section3\" id=\"Sec19\"\u003e\n \u003ch2\u003e4.6.1 Sequencing\u003c/h2\u003e\n \u003cp\u003eThe total RNA was extracted by using Eastep@Supper Total RNA Extraction kit (Shanghai Promega Biological Products Ltd., Shanghai, CH) following manufacturer\u0026rsquo;s protocol, then purified by using the Total RNA Purification Kit (LC Sciences, Houston, USA), according to the manufacturer\u0026rsquo;s protocol. The total RNA quantity and purity were analyzed using Agilent Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, Santa Clara, CA USA) and RNA from subjects with RIN number\u0026thinsp;\u0026gt;\u0026thinsp;7.0 was used for sequencing. Approximately 1,000ng of total RNA were used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits (Illumina, San Diego, CA USA). The general procedure was as follows: the RNAs were ligated to 3ʹ adapters and the 5\u0026prime; adapters were ligated to the other end of the RNA molecules. Then the RNAs which were ligated with 3ʹ and 5ʹ adapters were reverse transcribed to create single stranded cDNA. The cDNAs were amplified, gel purified and used to generate libraries. The small RNA library quality was assessed by using Bioanalyzer 2100 (Agilent) with High Sensitivity DNA Chip Kit (Agilent) and single-end sequencing (1x50bp) on an Illumina Hiseq2500 at the LC-BIO (Hangzhou, China) following the vendor\u0026rsquo;s recommended protocol was performed.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e4.6.2 Dimensionality Reduction:\u0026nbsp;\u003c/strong\u003eDimensionality reduction modeling was performed using SIMCA 17 (Sartorius Stedim Data Analytics AB, Sweden). Normalized counts for miRNA from placentae from both male and female offspring tissues were imported to SIMCA software for the analysis. Multivariate modeling was performed using unit variance (UV) scaling (mean centered and divided by the standard deviation). To get an overview of the data and identify patterns/groupings unsupervised principal component analysis (PCA) was performed. Specifically two-dimensional and three dimensional (3D) PCA clustering were employed, and the respective plots were explored. The scatter score plot of components 1 and 2 were explored to visualize differences in the two groups (classes). Observations that are close to each other have more similar miRNA expression profiles compared to the observations that are distant from each other.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e4.6.3 microRNA trimming\u003c/strong\u003e: Raw reads from microRNA sequencing were trimmed using cutadapt (v3.2) and specifically trimmed from the 5\u0026rsquo; end using the sequence \u0026lsquo;TGGAATTCTCGGGTGCCAAGG\u0026rsquo;. Sequences were then sub-selected for reads that were less than 17bp. Finally, low-quality reads that did not match the default quality control scores were removed.\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e4.6.4 Quality control metrics\u003c/strong\u003e: Fastqc was used to evaluate and multiqc was used to summarize the quality control metrics for both raw and trimmed files.\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e4.6.5 Alignment and Counts\u003c/strong\u003e: Trimmed reads were aligned to Genome Reference Consortium Human Build 38 patch release 14 (GRCh38.p14) (GRCh38.p14) using Spliced Transcripts Alignment to a Reference (STAR) aligner (v2.6.0c). FeatureCounts (v1.6.1) was used to count aligned fragments and then differential expression performed.\u003c/p\u003e\u003cstrong\u003e4.6.6 Differential gene expression testing\u003c/strong\u003e: DESEq2 (1.24.0) utilizing negative binomial distribution on counts was used for determining the differential expression of microRNA. Sex-specific and treatment (control vs. IUGR) effects in microRNA expression in placental tissue were determined by comparing 1) control male with control female, 2) IUGR male vs. IUGR female, 3) IUGR male vs. control male and 4) IUGR female vs. control female. For microRNA differentially expressed transcripts that met the FDR \u0026lt;0.1 and absolute log2Fold Change \u0026gt; 0.5 were considered significant. Finally, differentially expressed transcripts were visualized using volcano plots, and heatmaps were generated using the heatmap.2 package. All differential expression testing and plots were processed using R statistical software (v3.5.1).\u0026nbsp;\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec20\"\u003e\n \u003ch2\u003e4.7 Statistical Analysis\u003c/h2\u003e\n \u003cp\u003eDemographic, immunohistological and RT-PCR data were examined for homogeneity of variance using Fisher\u0026rsquo;s test and Student\u0026rsquo;s t test was employed to compare the quantitative difference of assessed parameters between Control and IUGR groups. Differences among the placentas from male and female newborn between control and IUGR groups were also assessed by Student\u0026rsquo;s t test. A p value lower than 0.05 was considered significant. As a complementary approach, Cohen\u0026rsquo;s effect-size was determined to evaluate the magnitude of difference. A Cohen d\u0026thinsp;\u0026ge;\u0026thinsp;0.8 refers to the large effect-size differences.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis IUGR cohort is supported by grants from Research reported in this publication was supported by Natural Science Foundation of Hebei Province in China (No.H2021106030), Introduced Intelligence of Foreign Expert Project of Hebei Province in China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSong W performed conceptualization, formal analysis, writing the original draft.\u003c/p\u003e\n\u003cp\u003eGuo Q contributed to the project design, funding Application.\u003c/p\u003e\n\u003cp\u003ePuttabyatappa M analyzed and interpreted the data, writing-original draft.\u003c/p\u003e\n\u003cp\u003eVenkateswaran R Elangovan performed the miRNA expression analysis and related draft.\u003c/p\u003e\n\u003cp\u003eWu XH, project administrator, supervised the whole process of experiment, funding acquisition, , writing-reviewing \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003eWang JP, Li F, Liu F, Bi X, Li H, Fu G collected data and samples, performed the experiment.\u003c/p\u003e\n\u003cp\u003ePadmanabhan V contributed to revised the original draft and gave suggestions for experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement :\u0026nbsp;\u003c/strong\u003eRaw data was available if required. Please contact the corresponding author.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary information : Attached in Supplementary Table 1-5\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e: Te authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement:\u003c/strong\u003e Authors have nothing to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding source:\u003c/strong\u003e Research reported in this publication was supported by Natural Science Foundation of Hebei Province in China (No.H2021106030), Introduced Intelligence of Foreign Expert Project of Hebei Province in China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eVayssiere C, Sentilhes L, Ego A, Bernard C, Cambourieu D. Fetal growth restriction and intra-uterine growth restriction: guidelines for clinical practice from the French College of Gynaecologists and Obstetricians. Eur J Obstet Gynecol Reprod Biol. 2015;193:10\u0026ndash;18.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.ejogrb.2015.06.021\u003c/span\u003e\u003cspan address=\"10.1016/j.ejogrb.2015.06.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGardosi J, Madurasinghe V, Williams M, Malik A, Francis A. Maternal and fetal risk factors for stillbirth: population based study. BMJ. 2013;346:f108.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1136/bmj.f108\u003c/span\u003e\u003cspan address=\"10.1136/bmj.f108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBukowski R. Stillbirth and fetal growth restriction. Clin Obstet Gynecol. 2010;53(3):673\u0026ndash;680.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1097/GRF.0b013e3181eba0db\u003c/span\u003e\u003cspan address=\"10.1097/GRF.0b013e3181eba0db\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangmia IM, Kraker K, Weiss SE, Haase N, Schutte T, Herse F, Dechend R. Cardiovascular Programming During and After Diabetic Pregnancy: Role of Placental Dysfunction and IUGR. Front Endocrinol (Lausanne). 2019;\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10:215.http://doi.org/10.3389/fendo.2019.00215\u003c/span\u003e\u003cspan address=\"10:215.10.3389/fendo.2019.00215\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Divall S, Radovick S, Paige D, Ning Y, Chen Z, Ji Y, Hong X, Walker SO, Caruso D, Pearson C, Wang MC, Zuckerman B, Cheng TL, Wang X. Preterm birth and random plasma insulin levels at birth and in early childhood. JAMA. 2014;311(6):587\u0026ndash;596.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1001/jama.2014.1\u003c/span\u003e\u003cspan address=\"10.1001/jama.2014.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarker DJ. In utero programming of cardiovascular disease. Theriogenology. 2000;53(2):555\u0026ndash;574.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/s0093-691x(99)00258-7\u003c/span\u003e\u003cspan address=\"10.1016/s0093-691x(99)00258-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarker DJ. Adult consequences of fetal growth restriction. Clin Obstet Gynecol. 2006;49(2):270\u0026ndash;283\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.http://doi.org/10.1097/00003081-200606000-00009\u003c/span\u003e\u003cspan address=\".10.1097/00003081-200606000-00009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKloskowska M, Chojnacki J, Wojnowski W, Becker B. The first compound with an unusual type of anion, [Li(SR)2]-: bis(mu2-aqua-d2)tetrakis(aqua-d2)dilithium(I) bis[bis(tri-tert-butoxysilanethiolato-kappa2O,S)lithate(I)] dihydrate-d2. Acta Crystallogr C. 2006;62(Pt 11):m541-544.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1107/S0108270106041746\u003c/span\u003e\u003cspan address=\"10.1107/S0108270106041746\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEriksson JG, Kajantie E, Thornburg KL, Osmond C, Barker DJ. Mother's body size and placental size predict coronary heart disease in men. Eur Heart J. 2011;32(18):2297\u0026ndash;2303.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1093/eurheartj/ehr147\u003c/span\u003e\u003cspan address=\"10.1093/eurheartj/ehr147\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePonsuksili S, Murani E, Hadlich F, Perdomo-Sabogal A, Trakooljul N, Oster M, Reyer H, Wimmers K. Genetic regulation and variation of expression of miRNA and mRNA transcripts in fetal muscle tissue in the context of sex, dam and variable fetal weight. Biol Sex Differ. 2022;13(1):24.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1186/s13293-022-00433-3\u003c/span\u003e\u003cspan address=\"10.1186/s13293-022-00433-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBateson P, Barker D, Clutton-Brock T, Deb D, D'Udine B, Foley RA, Gluckman P, Godfrey K, Kirkwood T, Lahr MM, McNamara J, Metcalfe NB, Monaghan P, Spencer HG, Sultan SE. Developmental plasticity and human health. Nature. 2004;430(6998):419\u0026ndash;421.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1038/nature02725\u003c/span\u003e\u003cspan address=\"10.1038/nature02725\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVyas AK, Veiga-Lopez A, Ye W, Abi Salloum B, Abbott DH, Yang S, Liao C, Kannan K, Padmanabhan V. Developmental programming: Sex-specific programming of growth upon prenatal bisphenol A exposure. J Appl Toxicol. 2019;39(11):1516\u0026ndash;1531.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1002/jat.3836\u003c/span\u003e\u003cspan address=\"10.1002/jat.3836\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClifton VL. Review: Sex and the human placenta: mediating differential strategies of fetal growth and survival. Placenta. 2010;31 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eSuppl:S33-39.http://doi.org/10.1016/j.placenta.2009.11.010\u003c/span\u003e\u003cspan address=\"Suppl:S33-39.10.1016/j.placenta.2009.11.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurco MY, Moffett A. Development of the human placenta. Development. 2019;146(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e22).http://doi.org/10.1242/dev.163428\u003c/span\u003e\u003cspan address=\"22).10.1242/dev.163428\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaschat AA, Hecher K. Fetal growth restriction due to placental disease. Semin Perinatol. 2004;28(1):67\u0026ndash;80\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.http://doi.org/10.1053/j.semperi.2003.10.014\u003c/span\u003e\u003cspan address=\".10.1053/j.semperi.2003.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarut F, Barut A, Gun BD, Kandemir NO, Harma MI, Harma M, Aktunc E, Ozdamar SO. Intrauterine growth restriction and placental angiogenesis. Diagn Pathol. 2010;5:24.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1186/1746-1596-5-24\u003c/span\u003e\u003cspan address=\"10.1186/1746-1596-5-24\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu C, Yang Y, Deng M, Yang L, Shu G, Jiang Q, Zhang S, Li X, Yin Y, Tan C, Wu G. Placentae for Low Birth Weight Piglets Are Vulnerable to Oxidative Stress, Mitochondrial Dysfunction, and Impaired Angiogenesis. Oxid Med Cell Longev. 2020;\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e2020:8715412.http://doi.org/10.1155/2020/8715412\u003c/span\u003e\u003cspan address=\"2020:8715412.10.1155/2020/8715412\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThamotharan S, Chu A, Kempf K, Janzen C, Grogan T, Elashoff DA, Devaskar SU. Differential microRNA expression in human placentas of term intra-uterine growth restriction that regulates target genes mediating angiogenesis and amino acid transport. PLoS One. 2017;12(5):e0176493.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1371/journal.pone.0176493\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0176493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahashi N, Anan F, Nakagawa M, Yufu K, Ooie T, Nawata T, Shigematsu S, Hara M, Saikawa T, Yoshimatsu H. Microalbuminuria, cardiovascular autonomic dysfunction, and insulin resistance in patients with type 2 diabetes mellitus. Metabolism. 2004;53(10):1359\u0026ndash;1364.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.metabol.2004.03.024\u003c/span\u003e\u003cspan address=\"10.1016/j.metabol.2004.03.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZigic Z, Markovic S, Grbesa D, Ramic S, Halilovic A. Quantitative research of capillaries in terminal villi of mature placentae. Bosn J Basic Med Sci. 2010;10(2):147\u0026ndash;152.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.17305/bjbms.2010.2714\u003c/span\u003e\u003cspan address=\"10.17305/bjbms.2010.2714\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJako M, Suranyi A, Kaizer L, Nemeth G, Bartfai G. Maternal Hematological Parameters and Placental and Umbilical Cord Histopathology in Intrauterine Growth Restriction. Med Princ Pract. 2019;28(2):101\u0026ndash;108.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1159/000497240\u003c/span\u003e\u003cspan address=\"10.1159/000497240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFitzgerald B, Levytska K, Kingdom J, Walker M, Baczyk D, Keating S. Villous trophoblast abnormalities in extremely preterm deliveries with elevated second trimester maternal serum hCG or inhibin-A. Placenta. 2011;32(4):339\u0026ndash;345.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2011.01.018\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2011.01.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmasry SM, Elfayomy AK. Morphometric analysis of terminal villi and gross morphological changes in the placentae of term idiopathic intrauterine growth restriction. Tissue Cell. 2012;44(4):214\u0026ndash;219.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.tice.2012.03.006\u003c/span\u003e\u003cspan address=\"10.1016/j.tice.2012.03.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacara L, Kingdom JC, Kaufmann P, Kohnen G, Hair J, More IA, Lyall F, Greer IA. Structural analysis of placental terminal villi from growth-restricted pregnancies with abnormal umbilical artery Doppler waveforms. Placenta. 1996;17(1):37\u0026ndash;48.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/s0143-4004(05)80642-3\u003c/span\u003e\u003cspan address=\"10.1016/s0143-4004(05)80642-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonson T, Wright T, Galan HL, Reynolds PR, Arroyo JA. Caspase dependent and independent mechanisms of apoptosis across gestation in a sheep model of placental insufficiency and intrauterine growth restriction. Apoptosis. 2017;22(5):710\u0026ndash;718.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1007/s10495-017-1343-9\u003c/span\u003e\u003cspan address=\"10.1007/s10495-017-1343-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKingdom J, Huppertz B, Seaward G, Kaufmann P. Development of the placental villous tree and its consequences for fetal growth. Eur J Obstet Gynecol Reprod Biol. 2000;92(1):35\u0026ndash;43.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/s0301-2115(00)00423-1\u003c/span\u003e\u003cspan address=\"10.1016/s0301-2115(00)00423-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNovac MV, Niculescu M, Manolea MM, Dijmarescu AL, Iliescu DG, Novac MB, Rotaru LT, Stoenescu MF, Tabacu MC, Tudorache S, Busuioc CJ, Gheonea IA. Placental findings in pregnancies complicated with IUGR - histopathological and immunohistochemical analysis. Rom J Morphol Embryol. 2018;59(3):715\u0026ndash;720\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJunaid TO, Brownbill P, Chalmers N, Johnstone ED, Aplin JD. Fetoplacental vascular alterations associated with fetal growth restriction. Placenta. 2014;35(10):808\u0026ndash;815.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2014.07.013\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2014.07.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu Z, Han Y, Shen R, Huang K, Xu YY, Wang QN, Zhou SS, Xu DX, Tao FB. Gestational di-(2-ethylhexyl) phthalate exposure causes fetal intrauterine growth restriction through disturbing placental thyroid hormone receptor signaling. Toxicol Lett. 2018;294:1\u0026ndash;10.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.toxlet.2018.05.013\u003c/span\u003e\u003cspan address=\"10.1016/j.toxlet.2018.05.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRossi C, Lees M, Mehta V, Heikura T, Martin J, Zachary I, Spencer R, Peebles DM, Shaw R, Karhinen M, Yla-Herttuala S, David AL. Comparison of Efficiency and Function of Vascular Endothelial Growth Factor Adenovirus Vectors in Endothelial Cells for Gene Therapy of Placental Insufficiency. Hum Gene Ther. 2020;31(21\u0026ndash;22):1190\u0026ndash;1202.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1089/hum.2020.006\u003c/span\u003e\u003cspan address=\"10.1089/hum.2020.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrouillet S, Murthi P, Hoffmann P, Salomon A, Sergent F, De Mazancourt P, Dakouane-Giudicelli M, Dieudonne MN, Rozenberg P, Vaiman D, Barbaux S, Benharouga M, Feige JJ, Alfaidy N. EG-VEGF controls placental growth and survival in normal and pathological pregnancies: case of fetal growth restriction (FGR). Cell Mol Life Sci. 2013;70(3):511\u0026ndash;525.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1007/s00018-012-1141-z\u003c/span\u003e\u003cspan address=\"10.1007/s00018-012-1141-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVrachnis N, Kalampokas E, Sifakis S, Vitoratos N, Kalampokas T, Botsis D, Iliodromiti Z. Placental growth factor (PlGF): a key to optimizing fetal growth. J Matern Fetal Neonatal Med. 2013;26(10):995\u0026ndash;1002.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3109/14767058.2013.766694\u003c/span\u003e\u003cspan address=\"10.3109/14767058.2013.766694\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahay AS, Jadhav AT, Sundrani DP, Wagh GN, Mehendale SS, Chavan-Gautam P, Joshi SR. VEGF and VEGFR1 levels in different regions of the normal and preeclampsia placentae. Mol Cell Biochem. 2018;438(1\u0026ndash;2):141\u0026ndash;152.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1007/s11010-017-3121-y\u003c/span\u003e\u003cspan address=\"10.1007/s11010-017-3121-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayhew TM. Fetoplacental angiogenesis during gestation is biphasic, longitudinal and occurs by proliferation and remodelling of vascular endothelial cells. Placenta. 2002;23(10):742\u0026ndash;750.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/s0143-4004(02)90865-9\u003c/span\u003e\u003cspan address=\"10.1016/s0143-4004(02)90865-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCotechini T, Graham CH. Aberrant maternal inflammation as a cause of pregnancy complications: A potential therapeutic target? Placenta. 2015;36(8):960\u0026ndash;966.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2015.05.016\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2015.05.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnelli GM, Mando C, Letizia T, Mazzocco MI, Novielli C, Lisso F, Personeni C, Vago T, Cetin I. Placental ESRRG-CYP19A1 Expressions and Circulating 17-Beta Estradiol in IUGR Pregnancies. Front Pediatr. 2019;7:154.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3389/fped.2019.00154\u003c/span\u003e\u003cspan address=\"10.3389/fped.2019.00154\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChassen S, Jansson T. Complex, coordinated and highly regulated changes in placental signaling and nutrient transport capacity in IUGR. Biochim Biophys Acta Mol Basis Dis. 2020;1866(2):165373.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.bbadis.2018.12.024\u003c/span\u003e\u003cspan address=\"10.1016/j.bbadis.2018.12.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCotechini T, Komisarenko M, Sperou A, Macdonald-Goodfellow S, Adams MA, Graham CH. Inflammation in rat pregnancy inhibits spiral artery remodeling leading to fetal growth restriction and features of preeclampsia. J Exp Med. 2014;211(1):165\u0026ndash;179.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1084/jem.20130295\u003c/span\u003e\u003cspan address=\"10.1084/jem.20130295\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThiele K, Hierweger AM, Riquelme JIA, Solano ME, Lydon JP, Arck PC. Impaired Progesterone-Responsiveness of CD11c(+) Dendritic Cells Affects the Generation of CD4(+) Regulatory T Cells and Is Associated With Intrauterine Growth Restriction in Mice. Front Endocrinol (Lausanne). 2019;10:96.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3389/fendo.2019.00096\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2019.00096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngler JB, Kursawe N, Solano ME, Patas K, Wehrmann S, Heckmann N, Luhder F, Reichardt HM, Arck PC, Gold SM, Friese MA. Glucocorticoid receptor in T cells mediates protection from autoimmunity in pregnancy. Proc Natl Acad Sci U S A. 2017;114(2):E181-E190.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1073/pnas.1617115114\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1617115114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalvo MT, Romo A, Gutierrez JJ, Relano E, Barrio E, Ferrandez Longas A. Study of genetic expression of intrauterine growth factors IGF-I and EGFR in placental tissue from pregnancies with intrauterine growth retardation. J Pediatr Endocrinol Metab. 2004;17 Suppl 3:445\u0026ndash;450\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosenfeld CS. Sex-Specific Placental Responses in Fetal Development. Endocrinology. 2015;156(10):3422\u0026ndash;3434\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.http://doi.org/10.1210/en.2015-1227\u003c/span\u003e\u003cspan address=\".10.1210/en.2015-1227\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackson MR, Mayhew TM, Haas JD. Morphometric studies on villi in human term placentae and the effects of altitude, ethnic grouping and sex of newborn. Placenta. 1987;8(5):487\u0026ndash;495.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/0143-4004(87)90077-4\u003c/span\u003e\u003cspan address=\"10.1016/0143-4004(87)90077-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayhew TM, Jenkins H, Todd B, Clifton VL. Maternal asthma and placental morphometry: effects of severity, treatment and fetal sex. Placenta. 2008;29(4):366\u0026ndash;373.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2008.01.011\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2008.01.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHebert JF, Millar JA, Raghavan R, Romney A, Podrabsky JE, Rennie MY, Felker AM, O'Tierney-Ginn P, Morita M, DuPriest EA, Morgan TK. Male fetal sex affects uteroplacental angiogenesis in growth restriction mouse modeldagger. Biol Reprod. 2021;104(4):924\u0026ndash;934.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1093/biolre/ioab006\u003c/span\u003e\u003cspan address=\"10.1093/biolre/ioab006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStenhouse C, Hogg CO, Ashworth CJ. Associations between fetal size, sex and placental angiogenesis in the pig. Biol Reprod. 2019;100(1):239\u0026ndash;252.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1093/biolre/ioy184\u003c/span\u003e\u003cspan address=\"10.1093/biolre/ioy184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalisch-Smith JI, Simmons DG, Dickinson H, Moritz KM. Review: Sexual dimorphism in the formation, function and adaptation of the placenta. Placenta. 2017;54:10\u0026ndash;16.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2016.12.008\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2016.12.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdibi J, Burton GJ, Clifton V, Collins S, Frias AE, Gierman L, Grigsby P, Jones H, Lee C, Maloyan A, Markert UR, Morales-Prieto DM, Murthi P, Myatt L, Pollheimer J, Roberts V, Robinson W, Salafia C, Schabel M, Shah D, Sled J, Vaillancourt C, Weber M, O'Tierney-Ginn PF. IFPA meeting 2016 workshop report II: Placental imaging, placenta and development of other organs, sexual dimorphism in placental function and trophoblast cell lines. Placenta. 2017;60 Suppl 1:S10-S14.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2017.02.021\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2017.02.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhidini A, Salafia CM. Gender differences of placental dysfunction in severe prematurity. BJOG. 2005;112(2):140\u0026ndash;144.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1111/j.1471-0528.2004.00308.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1471-0528.2004.00308.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChallis J, Newnham J, Petraglia F, Yeganegi M, Bocking A. Fetal sex and preterm birth. Placenta. 2013;34(2):95\u0026ndash;99.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2012.11.007\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2012.11.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYounger ST, Corey DR. Transcriptional gene silencing in mammalian cells by miRNA mimics that target gene promoters. Nucleic Acids Res. 2011;39(13):5682\u0026ndash;5691.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1093/nar/gkr155\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkr155\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorales-Prieto DM, Ospina-Prieto S, Chaiwangyen W, Schoenleben M, Markert UR. Pregnancy-associated miRNA-clusters. J Reprod Immunol. 2013;97(1):51\u0026ndash;61.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.jri.2012.11.001\u003c/span\u003e\u003cspan address=\"10.1016/j.jri.2012.11.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHigashijima A, Miura K, Mishima H, Kinoshita A, Jo O, Abe S, Hasegawa Y, Miura S, Yamasaki K, Yoshida A, Yoshiura K, Masuzaki H. Characterization of placenta-specific microRNAs in fetal growth restriction pregnancy. Prenat Diagn. 2013;33(3):214\u0026ndash;222.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1002/pd.4045\u003c/span\u003e\u003cspan address=\"10.1002/pd.4045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaker BC, Lui S, Lorne I, Heazell AEP, Forbes K, Jones RL. Sexually dimorphic patterns in maternal circulating microRNAs in pregnancies complicated by fetal growth restriction. Biol Sex Differ. 2021;12(1):61.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1186/s13293-021-00405-z\u003c/span\u003e\u003cspan address=\"10.1186/s13293-021-00405-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang LH, Tsai HC, Cheng YC, Lin CY, Huang YL, Tsai CH, Xu GH, Wang SW, Fong YC, Tang CH. CTGF promotes osteosarcoma angiogenesis by regulating miR-543/angiopoietin 2 signaling. Cancer Lett. 2017;391:28\u0026ndash;37.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.canlet.2017.01.013\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2017.01.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGusar V, Ganichkina M, Chagovets V, Kan N, Sukhikh G. MiRNAs Regulating Oxidative Stress: A Correlation with Doppler Sonography of Uteroplacental Complex and Clinical State Assessments of Newborns in Fetal Growth Restriction. J Clin Med. 2020;9(10).\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3390/jcm9103227\u003c/span\u003e\u003cspan address=\"10.3390/jcm9103227\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayhew TM, Wijesekara J, Baker PN, Ong SS. Morphometric evidence that villous development and fetoplacental angiogenesis are compromised by intrauterine growth restriction but not by pre-eclampsia. Placenta. 2004;25(10):829\u0026ndash;833.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2004.04.011\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2004.04.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurkhardt T, Schaffer L, Schneider C, Zimmermann R, Kurmanavicius J. Reference values for the weight of freshly delivered term placentas and for placental weight-birth weight ratios. Eur J Obstet Gynecol Reprod Biol. 2006;128(1\u0026ndash;2):248\u0026ndash;252.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.ejogrb.2005.10.032\u003c/span\u003e\u003cspan address=\"10.1016/j.ejogrb.2005.10.032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalas SP, Marshall G, Gutierrez BL, Rosso P. Time course of maternal plasma volume and hormonal changes in women with preeclampsia or fetal growth restriction. Hypertension. 2006;47(2):203\u0026ndash;208.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1161/01.HYP.0000200042.64517.19\u003c/span\u003e\u003cspan address=\"10.1161/01.HYP.0000200042.64517.19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin-Estal I, de la Garza RG, Castilla-Cortazar I. Intrauterine Growth Retardation (IUGR) as a Novel Condition of Insulin-Like Growth Factor-1 (IGF-1) Deficiency. Rev Physiol Biochem Pharmacol. 2016;170:1\u0026ndash;35.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1007/112_2015_5001\u003c/span\u003e\u003cspan address=\"10.1007/112_2015_5001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaneda S, Dini P, Esteller-Vico A, Scoggin KE, Squires EL, Troedsson MH, Daels P, Nambo Y, Ball BA. Estrogens Regulate Placental Angiogenesis in Horses. Int J Mol Sci. 2021;22(22).\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3390/ijms222212116\u003c/span\u003e\u003cspan address=\"10.3390/ijms222212116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoods L, Perez-Garcia V, Hemberger M. Regulation of Placental Development and Its Impact on Fetal Growth-New Insights From Mouse Models. Front Endocrinol (Lausanne). 2018;9:570.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3389/fendo.2018.00570\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2018.00570\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInoue H, Nishio H, Takada H, Sakai Y, Nanishi E, Ochiai M, Onimaru M, Chen SJ, Matsui T, Hara T. Activation of Nod1 Signaling Induces Fetal Growth Restriction and Death through Fetal and Maternal Vasculopathy. J Immunol. 2016;196(6):2779\u0026ndash;2787.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.4049/jimmunol.1500295\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.1500295\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiden U, Glitzner E, Hartmann M, Desoye G. Insulin and the IGF system in the human placenta of normal and diabetic pregnancies. J Anat. 2009;215(1):60\u0026ndash;68.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1111/j.1469-7580.2008.01035.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-7580.2008.01035.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvsen MS, Kalkanli S, Deveci E, Sak ME, Ozler A, Baran O, Erdem E, Seker U. Human placental macrophages (Hofbauer cells) in severe preeclampsia complicated by HELLP syndrome: immunohistochemistry of chorionic villi. Anal Quant Cytopathol Histpathol. 2013;35(5):283\u0026ndash;288\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRegnault TR, de Vrijer B, Galan HL, Davidsen ML, Trembler KA, Battaglia FC, Wilkening RB, Anthony RV. The relationship between transplacental O2 diffusion and placental expression of PlGF, VEGF and their receptors in a placental insufficiency model of fetal growth restriction. The Journal of physiology. 2003;550(Pt 2):641\u0026ndash;656.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1113/jphysiol.2003.039511\u003c/span\u003e\u003cspan address=\"10.1113/jphysiol.2003.039511\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRegnault TR, Orbus RJ, de Vrijer B, Davidsen ML, Galan HL, Wilkening RB, Anthony RV. Placental expression of VEGF, PlGF and their receptors in a model of placental insufficiency-intrauterine growth restriction (PI-IUGR). Placenta. 2002;23(2\u0026ndash;3):132\u0026ndash;144.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1053/plac.2001.0757\u003c/span\u003e\u003cspan address=\"10.1053/plac.2001.0757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHagen AS, Orbus RJ, Wilkening RB, Regnault TR, Anthony RV. Placental expression of angiopoietin-1, angiopoietin-2 and tie-2 during placental development in an ovine model of placental insufficiency-fetal growth restriction. Pediatr Res. 2005;58(6):1228\u0026ndash;1232.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1203/01.pdr.0000185266.23265.87\u003c/span\u003e\u003cspan address=\"10.1203/01.pdr.0000185266.23265.87\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuralimanoharan S, Maloyan A, Myatt L. Evidence of sexual dimorphism in the placental function with severe preeclampsia. Placenta. 2013;34(12):1183\u0026ndash;1189.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2013.09.015\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2013.09.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParraguez VH, Mamani S, Cofre E, Castellaro G, Urquieta B, De Los Reyes M, Astiz S, Gonzalez-Bulnes A. Disturbances in Maternal Steroidogenesis and Appearance of Intrauterine Growth Retardation at High-Altitude Environments Are Established from Early Pregnancy. Effects of Treatment with Antioxidant Vitamins. PLoS One. 2015;10(11):e0140902.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1371/journal.pone.0140902\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0140902\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelahaye F, Wijetunga NA, Heo HJ, Tozour JN, Zhao YM, Greally JM, Einstein FH. Sexual dimorphism in epigenomic responses of stem cells to extreme fetal growth. Nat Commun. 2014;5:5187.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1038/ncomms6187\u003c/span\u003e\u003cspan address=\"10.1038/ncomms6187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSood R, Zehnder JL, Druzin ML, Brown PO. Gene expression patterns in human placenta. Proc Natl Acad Sci U S A. 2006;103(14):5478\u0026ndash;5483.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1073/pnas.0508035103\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0508035103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaufmann P, Black S, Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod. 2003;69(1):1\u0026ndash;7.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1095/biolreprod.102.014977\u003c/span\u003e\u003cspan address=\"10.1095/biolreprod.102.014977\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumazaki K, Nakayama M, Suehara N, Wada Y. Expression of vascular endothelial growth factor, placental growth factor, and their receptors Flt-1 and KDR in human placenta under pathologic conditions. Hum Pathol. 2002;33(11):1069\u0026ndash;1077.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1053/hupa.2002.129420\u003c/span\u003e\u003cspan address=\"10.1053/hupa.2002.129420\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValinezhad Orang A, Safaralizadeh R, Kazemzadeh-Bavili M. Mechanisms of miRNA-Mediated Gene Regulation from Common Downregulation to mRNA-Specific Upregulation. Int J Genomics. 2014;2014:970607\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.http://doi.org/10.1155/2014/970607\u003c/span\u003e\u003cspan address=\".10.1155/2014/970607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo L, Zhang Q, Ma X, Wang J, Liang T. miRNA and mRNA expression analysis reveals potential sex-biased miRNA expression. Sci Rep. 2017;7:39812.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1038/srep39812\u003c/span\u003e\u003cspan address=\"10.1038/srep39812\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Zhang A, Xiang J, Lv Y, Zhang X. miR-451 acts as a suppressor of angiogenesis in hepatocellular carcinoma by targeting the IL-6R-STAT3 pathway. Oncol Rep. 2016;36(3):1385\u0026ndash;1392.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.3892/or.2016.4971\u003c/span\u003e\u003cspan address=\"10.3892/or.2016.4971\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai H, Wu S. miR-451: A Novel Biomarker and Potential Therapeutic Target for Cancer. Onco Targets Ther. 2019;12:11069\u0026ndash;11082.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.2147/OTT.S230963\u003c/span\u003e\u003cspan address=\"10.2147/OTT.S230963\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Liu X, Jiang M, Li J, Tang Y, Zhou L. miR-543 in human mesenchymal stem cell-derived exosomes promotes cardiac microvascular endothelial cell angiogenesis after myocardial infarction through COL4A1. IUBMB Life. 2021;73(7):927\u0026ndash;940.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1002/iub.2474\u003c/span\u003e\u003cspan address=\"10.1002/iub.2474\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKe N, Pi LH, Liu Q, Chen L. Long noncoding RNA SNHG7 inhibits high glucose-induced human retinal endothelial cells angiogenesis by regulating miR-543/SIRT1 axis. Biochem Biophys Res Commun. 2019;514(2):503\u0026ndash;509.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.bbrc.2019.04.141\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2019.04.141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Cai L, Tian X, Li W. MiR-543 promotes tumorigenesis and angiogenesis in non-small cell lung cancer via modulating metastasis associated protein 1. Mol Med. 2020;26(1):44.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1186/s10020-020-00175-1\u003c/span\u003e\u003cspan address=\"10.1186/s10020-020-00175-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang L, Long A, Tan L, Hong M, Wu J, Cai L, Li Q. Elevated microRNA-520g in pre-eclampsia inhibits migration and invasion of trophoblasts. Placenta. 2017;51:70\u0026ndash;75.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2017.02.001\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2017.02.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSidney LE, Branch MJ, Dunphy SE, Dua HS, Hopkinson A. Concise review: evidence for CD34 as a common marker for diverse progenitors. Stem Cells. 2014;32(6):1380\u0026ndash;1389.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1002/stem.1661\u003c/span\u003e\u003cspan address=\"10.1002/stem.1661\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu XQ, Soo SY, Sun W, Zweigerdt R. Global expression profile of highly enriched cardiomyocytes derived from human embryonic stem cells. Stem Cells. 2009;27(9):2163\u0026ndash;2174.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1002/stem.166\u003c/span\u003e\u003cspan address=\"10.1002/stem.166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiemerink MJ, Klaassen I, Vogels IM, Griffioen AW, Van Noorden CJ, Schlingemann RO. CD34 marks angiogenic tip cells in human vascular endothelial cell cultures. Angiogenesis. 2012;15(1):151\u0026ndash;163.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1007/s10456-011-9251-z\u003c/span\u003e\u003cspan address=\"10.1007/s10456-011-9251-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKukreja I, Kapoor P, Deshmukh R, Kulkarni V. VEGF and CD 34: A correlation between tumor angiogenesis and microvessel density-an immunohistochemical study. J Oral Maxillofac Pathol. 2013;17(3):367\u0026ndash;373.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.4103/0973-029X.125200\u003c/span\u003e\u003cspan address=\"10.4103/0973-029X.125200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmerican College of O, Gynecologists' Committee on Practice B-O, the Society f-F. ACOG Practice Bulletin No. 204: Fetal Growth Restriction. Obstetrics and gynecology. 2019;133(2):e97-e109.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1097/AOG.0000000000003070\u003c/span\u003e\u003cspan address=\"10.1097/AOG.0000000000003070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurton GJ, Sebire NJ, Myatt L, Tannetta D, Wang YL, Sadovsky Y, Staff AC, Redman CW. Optimising sample collection for placental research. Placenta. 2014;35(1):9\u0026ndash;22.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2013.11.005\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2013.11.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Alwis N, Beard S, Binder NK, Pritchard N, Kaitu'u-Lino TJ, Walker SP, Stock O, Groom K, Petersen S, Henry A, Said JM, Seeho S, Kane SC, Hui L, Tong S, Hannan NJ. DAAM2 is elevated in the circulation and placenta in pregnancies complicated by fetal growth restriction and is regulated by hypoxia. Sci Rep. 2021;11(1):5540.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1038/s41598-021-84785-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-84785-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan MS, Turgeon PJ, Man HJ, Dubinsky MK, Ho JJD, El-Rass S, Wang YD, Wen XY, Marsden PA. Histone acetyltransferase 7 (KAT7)-dependent intragenic histone acetylation regulates endothelial cell gene regulation. J Biol Chem. 2018;293(12):4381\u0026ndash;4402.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1074/jbc.RA117.001383\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA117.001383\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJabbari N, Nawaz M, Rezaie J. Bystander effects of ionizing radiation: conditioned media from X-ray irradiated MCF-7 cells increases the angiogenic ability of endothelial cells. Cell Commun Signal. 2019;17(1):165.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1186/s12964-019-0474-8\u003c/span\u003e\u003cspan address=\"10.1186/s12964-019-0474-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao L, Ma R, Zhang L, Yuan X, Wu J, He L, Liu G, Du R. Inhibition of HIF-1a-mediated TLR4 activation decreases apoptosis and promotes angiogenesis of placental microvascular endothelial cells during severe pre-eclampsia pathogenesis. Placenta. 2019;83:8\u0026ndash;16.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2019.06.375\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2019.06.375\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarnier V, Traboulsi W, Salomon A, Brouillet S, Fournier T, Winkler C, Desvergne B, Hoffmann P, Zhou QY, Congiu C, Onnis V, Benharouga M, Feige JJ, Alfaidy N. PPARgamma controls pregnancy outcome through activation of EG-VEGF: new insights into the mechanism of placental development. Am J Physiol Endocrinol Metab. 2015;309(4):E357-369.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1152/ajpendo.00093.2015\u003c/span\u003e\u003cspan address=\"10.1152/ajpendo.00093.2015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKappou D, Sifakis S, Androutsopoulos V, Konstantinidou A, Spandidos DA, Papantoniou N. Placental mRNA expression of angiopoietins (Ang)-1, Ang-2 and their receptor Tie-2 is altered in pregnancies complicated by preeclampsia. Placenta. 2014;35(9):718\u0026ndash;723.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1016/j.placenta.2014.07.001\u003c/span\u003e\u003cspan address=\"10.1016/j.placenta.2014.07.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBourdiec A, Calvo E, Rao CV, Akoum A. Transcriptome analysis reveals new insights into the modulation of endometrial stromal cell receptive phenotype by embryo-derived signals interleukin-1 and human chorionic gonadotropin: possible involvement in early embryo implantation. PLoS One. 2013;8(5):e64829.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1371/journal.pone.0064829\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0064829\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"IUGR, placenta, epigenetics, angiogenesis, inflammation, miRNA","lastPublishedDoi":"10.21203/rs.3.rs-2207891/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2207891/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntrauterine growth restriction (IUGR) is one of the most common pregnancy complications culminating in adverse fetal outcome, including preterm birth, neonatal mortality and stillbirth. Compromised placental development and function, especially disruption in angiogenesis and inadequate nutrient supply are contributing factors. Fetal sex also influences placental function. Knowledge of gene expression changes and epigenetic factors contributing to placental dysfunction in IUGR pregnancies will help identify biomarkers and help target interventions. This study tested the hypothesis that IUGR pregnancies are associated with sexually-dimorphic disruptions in miRNA - an epigenetic factor and mRNAs invloving key mediators of angiogenesis and microvessel development. Changes in expression of key genes/proteins involved in placental dysfunction by RT-PCR and immunohistochemistry and miRNA changes by RNA sequencing were undertaken with term placenta from 12 control and 20 IUGR pregnancies. Findings showed sex-dependent changes in expression of genes involved in steroidogenesis, steroid action, IGF family members, inflammatory cytokines and angiogenic factors in IUGR pregnancies. In addition, upregulation of \u003cem\u003eMIR451A\u003c/em\u003e and downregulation of \u003cem\u003eMIR543\u003c/em\u003e in placentas from IUGR group with female newborns and upregulation of \u003cem\u003eMIR520G\u003c/em\u003e in placentas from IUGR group with male newborns were also noted. \u003cem\u003eMIR451A\u003c/em\u003e and \u003cem\u003eMIR543\u003c/em\u003e have been implicated in angiogenesis. Consistent with gene changes, CD34, the microvessel angiogenesis marker, also showed reduced staining only in female IUGR group. These findings provide evidence in support of sexual dimorphism in the capillary development of IUGR manifested at the level of key mediators of placental angiogenesis and placental function that include changes in expression of miRNA with potential to serve as biomarkers.\u003c/p\u003e","manuscriptTitle":"Sex-Specific Disruption in Human Placental miRNAs and mRNAs Involved in IUGR Placental Insufficiency and Capillary Angiogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-11-08 15:16:53","doi":"10.21203/rs.3.rs-2207891/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2880eaa3-efc8-4565-b062-e2dbd57bfbdb","owner":[],"postedDate":"November 8th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":16708180,"name":"Biological sciences/Developmental biology"},{"id":16708181,"name":"Biological sciences/Genetics"},{"id":16708182,"name":"Biological sciences/Molecular biology"},{"id":16708183,"name":"Biological sciences/Structural biology"}],"tags":[],"updatedAt":"2022-12-19T09:14:20+00:00","versionOfRecord":[],"versionCreatedAt":"2022-11-08 15:16:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2207891","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2207891","identity":"rs-2207891","version":["v1"]},"buildId":"369fNeqWncA4NS6XSWjrt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00