CD70 drives cSCC growth by linking DNA damage response, inflammation, and tumor–stromal signaling

CD70 drives cSCC growth by linking DNA damage response, inflammation, and tumor–stromal signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article CD70 drives cSCC growth by linking DNA damage response, inflammation, and tumor–stromal signaling Tianshun Zhang, Qiushi Wang, Asad Khan, Chengcheng Hu, Emanuel Petricoin, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8206807/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Chronic ultraviolet (UV) exposure drives the development of non-melanoma skin cancers (NMSCs), particularly cutaneous squamous cell carcinoma (cSCC), through persistent DNA damage and inflammation. However, the molecular mediators that link genotoxic stress to tumor-promoting signaling and stromal activation remain poorly defined. Here, we identify CD70, a TNF superfamily member, as a UV- and DNA damage–inducible regulator that coordinates epithelial and stromal responses to promote skin carcinogenesis. Integrative analyses of transcriptomic (GTEx, GSE2503, GSE42677), proteomic (RPPA), and immunostaining datasets revealed marked upregulation of CD70 in sun-exposed skin, actinic keratoses, and cSCC lesions. Functionally, CD70 silencing suppressed cSCC proliferation and xenograft growth, whereas solar UV or DMBA exposure induced CD70 expression. Mechanistically, E2F1 directly bound and activated the CD70 promoter, establishing a transcriptional axis linking the DNA damage response to CD70 upregulation. CD70 depletion disrupted cytokine–receptor and MAPK/NF-κB signaling and altered inflammatory gene expression in UV-irradiated keratinocytes. In dermal fibroblasts, TGF-β–induced CD70 enhanced NF-κB activation and secretion of IL-6 and MCP3, thereby reinforcing paracrine inflammatory loops that supported cSCC spheroid expansion and tumor progression. CD70 knockdown in fibroblasts abrogated these effects and reduced tumor proliferation and cytokine expression in vivo. Collectively, our findings identify CD70 as a stress-inducible signaling hub that links DNA damage, inflammation, and tumor–stromal communication in skin carcinogenesis. Targeting CD70 may disrupt this feed-forward inflammatory circuit and provide a therapeutic strategy for inflammation-driven skin cancer. Biological sciences/Cancer/Skin cancer/Squamous cell carcinoma Biological sciences/Immunology/Cytokines/Chemokines Biological sciences/Cell biology/Cell growth Biological sciences/Molecular biology/Transcription/Transcriptional regulatory elements CD70 non-melanoma skin cancer UV-induced DNA damage Inflammatory signaling E2F1 keratinocytes fibroblasts Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Non-melanoma skin cancers (NMSCs), including actinic keratosis (AK) and cutaneous squamous cell carcinoma (cSCC), are the most common human malignancies, with rising incidence due to cumulative ultraviolet (UV) exposure and aging ( 1 , 2 ). Chronic UV irradiation induces persistent DNA damage, oxidative stress, and inflammation, which are hallmarks of skin carcinogenesis ( 3 , 4 ). Although mutations in oncogenic drivers such as TP53, RAS , and NOTCH have been well characterized ( 5 – 9 ), the molecular regulators that integrate DNA damage signaling, inflammation, and tumor–stroma interactions in NMSC remain poorly understood. CD70, a type II transmembrane protein of the tumor necrosis factor (TNF) superfamily, is classically known for its role in adaptive immunity through CD27-mediated T-cell activation, proliferation, and differentiation ( 10 – 13 ). Aberrant CD70 expression has been reported in hematologic and solid malignancies, where it can contribute to immune evasion and tumor progression ( 10 – 13 ). Emerging evidence also indicates that CD70 can transmit tumor-intrinsic signals, engaging pathways such as PI3K/AKT and MAPK to promote proliferation, invasion, and epithelial–mesenchymal transition ( 10 , 14 – 16 ). In these contexts, CD70 expression can be rapidly induced by inflammatory cytokines ( 12 , 17 ), viral infections ( 18 , 19 ), hypoxia ( 10 , 20 , 21 ), or genotoxic stress ( 22 ), despite its minimal expression in normal resting tissues ( 13 ). This inducible behavior suggests that CD70 may act as a stress-responsive integrator linking environmental insults to oncogenic, inflammatory, and stromal signaling. However, its mechanistic role in UV-driven epithelial carcinogenesis remains largely unexplored. Tumor progression is increasingly recognized as a product of interactions between malignant epithelial cells and the tumor microenvironment (TME) ( 23 – 25 ). Cancer-associated fibroblasts (CAFs), through secretion of cytokines, chemokines, and growth factors, can reinforce malignant signaling and promote tumor initiation, progression, and therapy resistance ( 26 – 29 ). Whether CD70 expression extends beyond epithelial cells to modulate fibroblast activation and tumor–stroma crosstalk in UV-induced skin cancer is unknown. In this study, we identify CD70 as a UV-inducible, DNA damage–responsive molecule upregulated in sun-exposed skin, AK, and cSCC. Functional analyses demonstrate that CD70 promotes keratinocyte and fibroblast proliferation, activates MAPK and NF-κB signaling, and enhances pro-inflammatory cytokine expression. Mechanistically, CD70 is directly regulated by the DNA damage–associated transcription factor E2F1. In vivo and in vitro models reveal that fibroblast CD70 supports tumor growth and establishes a pro-tumorigenic TME. We hypothesize that UV-induced DNA damage activates CD70 via E2F1, linking genotoxic stress with pro-inflammatory and stromal remodeling pathways in NMSC. Materials and Methods Transcriptomic data collection and analysis RNA-seq data from sun-exposed and sun-protected human skin were obtained from the GTEx database, and GEO datasets (GSE2503, GSE42677) were merged and normalized using the inSilicoMerging and limma packages in R (v4.3.3). Differentially expressed genes (DEGs) were identified using empirical Bayes moderation with FDR < 0.05 and |log₂FC| ≥ 1. RNA-seq profiling of HaCaT cells 24 h post solar-simulated light (SSL; 60 kJ/m² UVA, 2.9 kJ/m² UVB) exposure was performed, and DEGs were analyzed using the same pipeline. All analyses and visualizations were performed in R (v4.3.3) by using the tidyverse (v2.0.0), ggplot2 (v3.5.1), ggpubr (v0.6.0), pheatmap, dplyr (v1.1.4), and limma (v3.58.1) packages. All bioinformatic details are provided in Supplementary Materials and Methods . Reverse phase microarray analysis (RPPA) RPPA was performed as described previously ( 30 – 32 ). Cell lysates were printed on nitrocellulose slides, probed with validated antibodies, and visualized using a tyramide-based amplification system. Data were quantified using MicroVigene software, normalized to total protein, and expressed as net signal intensity. Plasmid construction, cell culture, transfection, and lentiviral infection Human E2F1, the pGL3 promoter vector, and packaging vectors (pMD2.0G and psPAX) were obtained from Addgene (Watertown, MA) The human CD70-pGL3 promoter vector was purchased from Thermo Fisher Scientific (Waltham, MA). Site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Cat. No. 200518-5; Agilent Technologies, anta Clara, CA) with primers for the human CD70 promoter: Forward: 5’-TGCCCAGGCTGGATGCGCTGCTGCCGCACAGCTCACAGCAGC-3’ Reverse: 5’-GCTGCTGTGAGCTGTGCGGCAGCAGCGCATCCAGCCTGGGCA-3’ Lentiviral plasmids shCD70 (#1, TRCN0000007840; #2, TRCN0000007841) were purchased from the University of Minnesota Genomics Center (Minneapolis, MN). ShE2F1 constructs (VB900040-4032wtd, VB900040-4039muj) were obtained from Vector Builder Inc. (Chicago, IL). The pLKO.1-puro Non-Target shRNA Control Plasmid (shCon) was purchased from Sigma-Aldrich (Burlington, MA). All constructs were verified by restriction enzyme mapping, DNA sequencing, and BLAST analysis. HaCaT and HEK 293T cells were from ATCC (Manassas, VA); A431 and SCC-12 cells from Thermo Fisher Scientific (Waltham, MA); NHDF from Lonza (Walkersville, MD). Cells were used within 10 passages. HaCaT and A431 were cultured in DMEM with 10% FBS and 1% antibiotics; SCC-12 in RPMI 1640 with L-glutamine, 10% FBS, 1% antibiotics, and 1% MEM non-essential amino acids; NHDF in DMEM with 1X MEM, 10% FBS, and 1% antibiotics. CM was collected from serum-starved cells (48 h) and stored at − 80°C. NHDF were treated with TGF-β (PeproTech, Rocky Hill, NJ) for 2 weeks to generate NHDF-TGF-β. Transient transfection was performed using iMFectin DNA Transfection Reagent (GenDEPOT, Katy, TX) at 60–70% confluence for 36–48 h. For stable knockdown, lentiviral plasmids (shCD70, shE2F1, or shCon) with packaging vectors were transfected into HEK 293T cells using iMFectin Poly DNA Transfection Reagent (GenDEPOT). Viral supernatants were collected at 48 h, filtered (0.45 µm; MilliporeSigma, Burlington, MA), and used to infect target cells with 8 µg/mL polybrene (Sigma-Aldrich). Infected cells were selected with puromycin (1.2 µg/mL; Sigma-Aldrich) for 48 h. Mutated CD70 promoter constructs were generated using the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) and confirmed by Genewiz (South Plainfield, NJ). Western blot analysis Western blot analysis Western blotting was performed following previously established protocols( 33 ). Primary antibodies were diluted 1:1000 and incubated overnight at 4°C, followed by incubation with HRP-conjugated secondary antibodies at a 1:5000 dilution. Protein bands were visualized using a chemiluminescent substrate (GE Healthcare Biosciences, Piscataway, NJ). Detailed information is provided in Supplementary Materials and Methods . Spheroid 3D cell culture Vitrogel Hydrogel Matrix (VHM01, TheWell Bioscience, North Brunswick, NJ) was used for spheroid 3D cell culture according to the manufacturer’s instructions. A431 and SCC12 cells (shCon or shCD70) were suspended in culture medium, and 1 mL of Vitrogel was mixed with 500 µL of the cell suspension. A total of 300 µL of the hydrogel–cell mixture was dispensed into a 24-well plate at a density of 1 × 10⁵ cells per well and allowed to gel at room temperature for 15 min. After gelation, 300 µL of medium were gently added to cover the hydrogel. Cultures were maintained at 37°C with medium changes every 48 h. After 10 days, cells were harvested for immunofluorescence analysis. For co-culture experiments, NHDF (shCon) or NHDF-TGF-β (shCon or shCD70) were combined with A431 or SCC12 cells and processed using the same Vitrogel-based procedure described above. Chromatin immunoprecipitation (ChIP) and qPCR ChIP was performed using the Magna ChIP A/G kit (MilliporeSigma, Burlington, MA, MAGNA0017) following the manufacturer’s instructions with minor optimizations. A431 cells (1 × 10⁷ per IP) were cross-linked in 18.5% formaldehyde for 10 min and quenched with 10X glycine for 5 min. Cells were washed with ice-cold PBS, lysed sequentially with Cell Lysis Buffer and Nuclear Lysis Buffer supplemented with protease inhibitor, and chromatin was sheared by sonication into ~ 200–1000 bp fragments. Equal amounts of chromatin were incubated with ChIP-grade antibody (E2F1) or rabbit IgG (1 µg per IP) and captured with Protein A/G magnetic beads overnight at 4°C. Beads were washed with Low Salt, High Salt, LiCl, and TE buffers. Chromatin was eluted with ChIP Elution Buffer containing Proteinase K, and cross-links were reversed at 62°C for 2 h followed by 95°C for 10 min. DNA was purified using the kit spin columns and eluted in 50 µL. Enrichment at target loci was quantified by qPCR using primers (F: AGTAACACCCTATCCTCTACCCC; R: GCGCCCGGCCTAAATTAATATT) R: GTGCAGTTCAGTGATCGTACAGG). Reactions contained 2 µL DNA, 12.5 µL SYBR Green master mix, and 1 µL primer mix. Cycling: 94°C for 10 min; 50 cycles of 94°C for 20 s and 60°C for 1 min. Data are presented as fold enrichment over IgG control. Xenograft mouse models All animal studies were conducted in accordance with protocols approved by the University of Minnesota Institutional Animal Care and Use Committee (IACUC, Minneapolis, MN; Protocol ID 2404-42009A). Xenograft experiments were performed to evaluate the effects of CD70 knockdown in A431 or NHDF cells. For the first experiment, six-week-old athymic nude mice (Charles River Laboratories, Wilmington, MA) were subcutaneously injected in the right flank with 4 × 10⁶ A431 cells expressing either shCon or shCD70 (n = 6 per group). In the second experiment, a mixture of 4 × 10⁶ A431 cells with 1.67 × 10⁶ NHDF or NHDF-TGF-β cells, expressing either shCon or shCD70, resuspended in 150 µL of a 1:1 PBS:Matrigel solution and injected subcutaneously into nude mice (n = 6 per group). This design allowed comparison of tumors formed by A431 cells alone, A431 cells co-injected with NHDF-TGF-β cells expressing shCon, and A431 cells co-injected with NHDF-TGF-β cells expressing shCD70. Tumor size and body weight were measured weekly. Tumor volume was calculated using the formula: tumor volume (mm³) = length × width 2 × 0.52. The detailed information of reagents and antibodies, RNA extraction (PureLink™ RNA Mini Kit, Invitrogen, Carlsbad, CA), sequencing library, and bioinformatic analysis, Western blot analysis, cell viability (MTT) assay, immunofluorescence analysis, real-time PCR, Luciferase Assay and Human cytokine antibody array are described in Supplementary Materials and Methods . Statistical analysis Quantitative data are presented as means ± standard deviation (SD) or standard error (SE), based on at least 3 independent experiments or samples. Differences in gene expression among groups from GEO or GTEx datasets were assessed using the Wilcoxon rank-sum test. For RPPA data, Logarithmic transformation with base 2 (log2) was applied to expression levels of the RPPA analytes to achieve approximate normality. Box-and-whisker plots and waterfall plots were used to visually contrast distribution of expression levels across different groups. Expression levels were compared between groups by using generalized estimating equations (GEE), which adjusted for within-patient correlation (multiple patients contributed both sun protected and sun damaged skin samples to this study). The analysis was conducted using R (version 4.3.1). For experimental data, statistical significance was evaluated using either a Student’s t -test or one-way ANOVA, followed by post hoc multiple comparisons with Tukey’s HSD tests as appropriate. All analyses were conducted using SPSS software (version 23, IBM Corp., Armonk, NY) or R (v4.3.3). A p -value < 0.05 was considered statistically significant. Results CD70 is highly expressed in sun exposed skin and non-melanoma skin cancers To identify immune genes dysregulated in UV-exposed skin and NMSC, we analyzed GTEx transcriptomic data (sun exposed vs. sun protected skin) and merged GEO datasets GSE2503 and GSE42677 (AK, cSCC, and normal skin). Significant genes (FDR < 0.05, ≥ 2-fold change) overlapping with immune signature genes ( 34 , 35 ) identified CD70 and CXCL13 as linked to sun exposure, immune responses, and skin carcinogenesis (Fig. 1 A). CD70 was significantly upregulated in sun-exposed skin versus protected sites and markedly elevated in AK and cSCC compared with normal skin (Fig. 1 B). CXCL13 was reduced in sun-exposed skin but increased in AK and cSCC ( Supplementary Fig. 1 ). Based on these results, we focused on CD70 for mechanistic studies in UV-induced skin damage and carcinogenesis. Consistently, Reverse-phase protein array (RPPA) showed higher CD70 expression in both epidermis (Fig. 1 C) and dermis (Fig. 1 D) of sun-damaged skin (mild to severe) versus protected skin. Immunofluorescence of human skin confirmed CD70 upregulation in AK and cSCC specimens (Fig. 1 E; University of Arizona, HSC #03–65; IRB #11-0212-04, #12-0229-04). Immunofluorescence also showed elevated CD70 in SCC and BCC, with the strongest induction in SCC (SK801c, TissueArray.Com LLC, Derwood, MD) (Fig. 1 F). These findings indicate that CD70 is a UV-inducible gene activated early in skin carcinogenesis and maintained through disease progression. CD70 promotes growth of cSCC cells in vitro and in vivo To evaluate the functional significance of CD70 in skin cancer cells, we knocked down CD70 expression by using specific shRNAs in human cSCC cell lines (A431 and SCC12). Knockdown efficiency in A431 and SCC12 cells was confirmed by Western blotting (Fig. 2 A). Knockdown of CD70 significantly reduced cell proliferation, as measured by MTS assays (Fig. 2 B, C); and suppressed spheroid formation in a 3D culture system (Fig. 2 D, E), indicating impaired tumorigenic capacity. To extend these findings in vivo , A431 cells stably expressing CD70 shRNA or scrambled control were subcutaneously implanted into immunodeficient nude mice. Tumors derived from CD70-silenced cells exhibited significantly reduced tumor size (representative images , Fig. 2 F ) , weight ( Fig. 2 G ) , and volume ( Fig. 2 H ) compared with controls but had no significant overall effect on body weight (Fig. 2 I). Histological analysis (IF) further revealed decreased proliferation in CD70 knockdown tumors, as evidenced by reduced proliferating cell nuclear antigen (PCNA) staining (Fig. 2 J). Together, these results support a pro-proliferative role for CD70 in cSCC progression. CD70 is UV- and DNA damage–inducible in keratinocytes Solar UV irradiation induces persistent DNA damage, a key driver of skin carcinogenesis ( 3 , 4 ). We found that solar simulated light (SSL) markedly increased CD70 expression in keratinocytes. Similarly, the chemical carcinogen 7,12-dimethylbenz[a]anthracene (DMBA), a classical DNA-damaging initiator, elevated CD70 levels (Fig. 3 A). Other genotoxic agents, including camptothecin (CPT), etoposide (ETP), and aphidicolin (APH), also enhanced CD70 expression ( Supplementary Fig. 2A ), indicating that CD70 is a DNA damage–inducible gene and may function as a downstream effector of UV-driven genotoxic stress. To identify transcription factors mediating CD70 induction, we queried JASPAR, PROMO, and HumanTFDB databases and overlapped predicted CD70-binding factors with the GOBP_DNA damage response gene set. E2F1 and TP53 emerged as top candidates (Fig. 3 B). Meta-analysis of GSE2503 and GSE42677 datasets revealed a strong positive correlation between CD70 and E2F1 expression (R = 0.66, p = 2.9 × 10⁻⁶) (Fig. 3 C), and a negative correlation with TP53 (R = − 0.49, p = 0.0014) ( Supplementary Fig. 2B ). E2F1 expression was also significantly elevated in AK and cSCC compared with normal skin ( Supplementary Fig. 2C ). Functionally, E2F1 knockdown markedly reduced CD70 expression in A431 and SCC12 cells ( Supplementary Fig. 2D ) and inhibited cSCC cell proliferation (Supplementary Fig. 2E). SSL treatment increased both E2F1 and CD70 expression, whereas E2F1 silencing diminished CD70 levels, as confirmed by Western blot (Fig. 3 D) and immunofluorescence (Fig. 3 E, Supplementary Fig. S3 ). Conversely, E2F1 overexpression elevated CD70 in HaCaT, A431, and SCC12 cells (Fig. 3 F), a result further verified by immunofluorescence showing robust CD70 induction (Fig. 3 G). Mechanistically, luciferase reporter assays demonstrated that E2F1 overexpression activated the CD70 promoter in HaCaT (Fig. 3 H) and A431 (Fig. 3 I) cells. ChIP-qPCR confirmed direct E2F1 binding to predicted motifs within the CD70 promoter (Fig. 3 J). Motif analyses (JASPAR, MEME) identified a canonical E2F1 binding site (–879 to − 890 bp relative to the transcription start site; Fig. 3 K), and site-directed mutagenesis (TGTGGCGCCACT → TGCGGCAGCAGC; Fig. 3 L) significantly attenuated E2F1-driven promoter activity (Fig. 3 M). Together, these results establish E2F1 as a direct transcriptional activator of CD70 downstream of UV-induced DNA damage, linking genotoxic stress to oncogenic and inflammatory signaling in skin epithelial cells. CD70 knockdown alters pro-tumorigenic signaling pathways To examine pathways regulated by CD70, we performed RNA-seq of HaCaT keratinocytes exposed to solar-simulated light (SSL) with or without CD70 knockdown. Differential expression analysis identified 1,275 upregulated and 2,333 downregulated genes (fold change ≥ 2, p < 0.05) Fig. 4 A, B). KEGG enrichment highlighted cytokine–cytokine receptor interaction and MAPK signaling as the most affected pathways (Fig. 4 C). Heatmap visualization showed that CD70 knockdown led to reduced expression of pro-inflammatory mediators (e.g., IL1B, CCL20, CXCR2, CCL2, TNFRSF1A) and MAPK pathway components (e.g., IL1B, MAPK3, MAP2K6, MAPK13, JUND, FOS) ( Supplementary Fig. 4A, B ). These results indicate that CD70 regulates keratinocyte pro-inflammatory mediators and MAPK signaling, likely via NF-κB–mediated transcriptional control of cytokines and chemokines( 26 , 36 – 38 ). RT-PCR analysis confirmed that knockdown of CD70 decreased IL1B expression, a gene involved in both cytokine–cytokine receptor interactions and MAPK signaling, in HaCaT and A431 cells ( Supplementary Fig. 4C, D ). MAPK signaling (ERK, p38, JNK) is rapidly activated by UV and mediates keratinocyte stress responses, proliferation, and pathways driving SCC initiation and progression ( 39 ). Genetic inhibition of MAPK signaling suppresses UV-induced skin carcinogenesis in preclinical models ( 40 , 41 ). SSL exposure induced phosphorylation of ERK, p38, and JNK and nuclear translocation of NF-κB p65 in HaCaT cells; CD70 knockdown markedly attenuated these responses, as shown by Western blotting (Fig. 4 D ) , luciferase assays (Fig. 4 E ) , and immunofluorescence (Fig. 4 F, Supplementary Fig. 5A ). Similar results were observed in A431 and SCC12 cells, where CD70 knockdown reduced ERK, p38, and JNK phosphorylation (Fig. 4 G) and NF-κB transcriptional activity (Fig. 4 H). Immunofluorescence confirmed impaired NF-κB nuclear translocation (Fig. 4 I; Supplementary Fig. 5B ). Together, these data indicate that CD70 amplifies NF-κB and MAPK signaling in response to UV, promoting cSCC cell growth. CD70 expression in fibroblasts promotes tumor–stroma crosstalk and cSCC growth Our previous results demonstrate that CD70 is not only expressed in epidermis but also detected in dermis (Fig. 1 C, D) Among stromal elements, CAFs drive drive tumor progression primarily through secretion of pro-inflammatory cytokines and growth factors ( 26 – 29 ). To model CAF activation, normal human dermal fibroblasts (NHDF1) were chronically treated with TGF-β to generate NHDF1-TGFβ cells ( 26 ). Stable shCD70 and shCon NHDF1-TGFβ lines were established (Fig. 5 A). Conditioned media (CM) from NHDF1-TGFβ fibroblasts enhanced A431 and SCC12 cell growth compared with CM from normal NHDF1 cells, whereas CM from shCD70 NHDF1-TGFβ cells markedly suppressed growth (Supplementary Fig. 6A, B) . In contrast, CM from shCD70 NHDF1-TGFβ cells significantly suppressed A431 and SCC12 growth relative to CM from shCon NHDF1-TGFβ cells ( Supplementary Fig. 6A, B, respectively ). In 3D spheroid co-cultures, A431 cells co-cultured with NHDF1-TGFβ fibroblasts formed more compact spheroids than with normal fibroblasts, and CD70 knockdown in NHDF1-TGFβ cells significantly reduced spheroid formation ( Fig. 5 B, C). Mechanistically, CD70 knockdown in NHDF1-TGFβ fibroblasts suppressed TPA-induced NF-κB nuclear translocation (Fig. 5 D) and and reduced secretion of IL6 and MCP3, as confirmed by Cytokine Array and Western blot (Fig. 5 E, F; Supplementary Fig. 7 ). Notably, NF-κB is a well-established regulator of IL6 and MCP3 expression ( 42 – 45 ) and therefore its decreased activation and translocation induced by decreased CD70 correspond well. These results suggest that CD70 mediates fibroblast-derived cytokine production through the NF-κB pathway. In vivo , co-injection of A431 cells with fibroblasts into nude mice enhanced tumor growth. Compared with co-injection of A431 cells with shCon NHDF1 fibroblasts, co-injection with NHDF1-TGFβ shCon fibroblasts further accelerated tumor growth. In contrast, knockdown of CD70 in NHDF1-TGFβ fibroblasts significantly suppressed tumor size (representative images , Fig. 6 A ) , weight ( Fig. 6 B ) , and volume ( Fig. 6 C ) compared with the shCon group. Tumors from the CD70 knockdown group also exhibited reduced expression of PCNA and cytokines IL6, and MCP3 (Fig. 6 D). Discussion Our study identifies CD70 as a UV-inducible, DNA damage–responsive mediator in NMSC, linking genotoxic stress, inflammatory signaling, and crosstalk between cSCC cells and fibroblasts. CD70 is upregulated in sun-exposed skin, AK, and cSCC, indicating its potential as an early molecular marker of UV-driven carcinogenesis. This extends prior work connecting UV-induced DNA damage and inflammation to skin cancer ( 4 ) and positions CD70 as a direct effector linking these processes. We demonstrate that UV-induced DNA damage induces CD70 in keratinocytes, revealing a previously unrecognized connection between environmental genotoxic stress and CD70 signaling. While CD70 is classically studied in immune activation through CD27 ( 10 – 13 ), its role as a stress-responsive molecule in epithelial cells has been largely unexplored. This induction is directly mediated by E2F1, a DNA damage–associated transcription factor ( 46 , 47 ), which binds the CD70 promoter and activates transcription following UV or genotoxic treatment. E2F1 is a central mediator of DNA damage responses and oncogenic processes, regulating cell cycle progression, apoptosis, and DNA repair ( 48 , 49 ). Our findings suggest that E2F1 promotes cSCC not only through cell growth but also via direct CD70 induction, consistent with reports of genotoxic stress–driven CD70 expression ( 22 , 50 ) revealing a novel E2F1–CD70 axis connecting UV-induced DNA damage to oncogenic and inflammatory signaling. Functionally, CD70 amplifies pro-tumorigenic signaling by engaging MAPK and NF-κB pathways, shaping a cytokine-rich microenvironment that promotes keratinocyte proliferation and cSCC growth. Consistent with our findings, CD70 clustering can initiate reverse signaling through its cytoplasmic tail, engaging PI3K/AKT, MAPK and NF-κB pathways that promote proliferation, EMT, invasion, and immune-evasive phenotypes in tumor models ( 10 , 14 – 16 ) ( 51 – 53 ). Activation of MAPK and NF-κB converges on inflammatory mediators and tumor-promoting genes such as IL1B, which facilitate tumor initiation, fibroblast activation, angiogenesis, EMT, and immune suppression ( 54 – 58 ). Our RNA-seq and cytokine array analyses support CD70 as an upstream regulator of a feed-forward inflammatory module driving oncogenesis. The role of CD70 in stromal signaling represents a previously unrecognized mechanism in skin carcinogenesis, although previous studies have shown that CAFs form a distinct stromal subset that promotes tumor cell migration, drives regulatory T cell accumulation, and correlates with poor survival ( 59 – 61 ). Our findings reveal that fibroblast-derived CD70 amplifies cytokine production via NF-κB, thereby enhancing keratinocyte proliferation and 3D tumor spheroid formation. In vivo , co-injection of CD70-expressing fibroblasts with cSCC cells accelerates tumor growth, whereas CD70 knockdown impairs tumor progression and reduces PCNA, IL6, and MCP3 expression, confirming its functional relevance in the tumor microenvironment. Beyond its direct effects on epithelial proliferation, CD70 shapes the tumor immune microenvironment by modulating the cytokine and chemokine milieu. Inflammatory mediators such as IL1β, IL6, and MCP-3 (CCL7) not only drive SCC cell growth but also recruit and condition myeloid populations, including monocytes, tumor-associated macrophages, and MDSCs, thereby promoting a suppressive, tumor-permissive niche ( 62 – 66 ). CD70 in epithelial cells and fibroblasts may thus coordinate tumor progression by directly activating MAPK and NF-κB in tumor cells while indirectly sustaining immune evasion. Limitations include reliance on in vitro and murine models, incomplete demonstration of causal roles in vivo, and lack of human longitudinal or preclinical pharmacologic data, emphasizing the need for further validation. CD70 functions as a dual-role node regulating epithelial proliferation, inflammatory signaling, and stromal crosstalk. Its rapid induction by UV-induced DNA damage, coupled with low basal expression in normal tissues, underscores its potential as a selective therapeutic target. Anti-CD70 therapies under investigation in hematologic malignancies and solid tumors ( 10 – 13 ). Our data suggest that CD70-targeted strategies could be repurposed for NMSC to disrupt both epithelial and stromal oncogenic programs. Future studies should investigate CD70/CD27 interactions across immune populations and assess CD70-targeted antibodies, antibody–drug conjugates, and small-molecule inhibitors for preventing or treating UV-induced cSCC. In conclusion, we identify CD70 as a central integrator of DNA damage, inflammatory signaling, and tumor–stroma interactions in UV-driven NMSC. Solar UV–induced DNA damage robustly induces CD70 expression via E2F1, which in turn mediates keratinocyte and cSCC cell proliferation through MAPK and NF-κB signaling, driving the expression of inflammatory mediators and tumor-promoting factors such as IL1B. In addition, CD70 expressed in fibroblasts amplifies cytokine and chemokine production, including IL6 and MCP-3, which not only support cSCC growth, but also modulate the tumor microenvironment (Fig. 7 ). Together, our findings reveal a previously unrecognized mechanism linking environmental genotoxic stress to pro-tumorigenic signaling and provide a compelling rationale for developing CD70-targeted strategies for skin cancer prevention and therapy. Declarations Data Availability Statement The RNA-seq datasets generated during this study are available from the corresponding author upon reasonable request. Financial Support This work was supported by The Hormel Foundation and National Institutes of Health grant 1P01CA229112-01A1. Conflicts of Interest: The authors declare no potential conflicts of interest. Financial Support This work was supported by The Hormel Foundation and National Institutes of Health grant 1P01CA229112-01A1. Author contribution Conceptualization: QW, TZ; Data Curation: QW, TZ; Formal Analysis: QW, AK, CH, TZ; Investigation: QW, AK, CC, TZ; Methodology: QW, RM, EFP, TZ; Resources: AMB, CC, TZ; Visualization: QW, CH, EFP, TZ; Writing, Original Draft Preparation: QW, TZ; Writing, Review and Editing: SD, GTW, AMB, CC, TZ. Supervision: TZ Acknowledgments This work was supported by The Hormel Foundation and National Institutes of Health grant 1P01CA229112-01A1. References Apalla Z, Nashan D, Weller RB, Castellsagué X. Skin cancer: epidemiology, disease burden, pathophysiology, diagnosis, and therapeutic approaches. Dermatology and therapy 2017;7:5–19 Leiter U, Keim U, Garbe C. Epidemiology of skin cancer: update 2019. Sunlight, vitamin D and skin cancer 2020:123 – 39 Narayanan DL, Saladi RN, Fox JL. Ultraviolet radiation and skin cancer. International journal of dermatology 2010;49:978–86 Wei M, He X, Liu N, Deng H. Role of reactive oxygen species in ultraviolet-induced photodamage of the skin. Cell division 2024;19:1 Bailey P, Ridgway RA, Cammareri P, Treanor-Taylor M, Bailey U-M, Schoenherr C, et al. Driver gene combinations dictate cutaneous squamous cell carcinoma disease continuum progression. Nature Communications 2023;14:5211 Hosseini TM, Park SJ, Guo T. The mutational and microenvironmental landscape of cutaneous squamous cell carcinoma: a review. Cancers 2024;16:2904 Li Z, Lu F, Zhou F, Song D, Chang L, Liu W, et al. From actinic keratosis to cutaneous squamous cell carcinoma: the key pathogenesis and treatments. Frontiers in Immunology 2025;16:1518633 Pickering CR, Zhou JH, Lee JJ, Drummond JA, Peng SA, Saade RE, et al. Mutational landscape of aggressive cutaneous squamous cell carcinoma. Clinical cancer research 2014;20:6582–92 Wang NJ, Sanborn Z, Arnett KL, Bayston LJ, Liao W, Proby CM, et al. Loss-of-function mutations in Notch receptors in cutaneous and lung squamous cell carcinoma. Proceedings of the National Academy of Sciences 2011;108:17761-6 Flieswasser T, Van den Eynde A, Van Audenaerde J, De Waele J, Lardon F, Riether C, et al. The CD70-CD27 axis in oncology: the new kids on the block. Journal of experimental & clinical cancer research 2022;41:12 Kumar S, Mahendiran S, Nair RS, Vyas H, Singh SK, Srivastava P, et al. A mechanistic, functional, and clinical perspective on targeting CD70 in cancer. Cancer Letters 2025;611:217428 O’Neill RE, Du W, Mohammadpour H, Alqassim E, Qiu J, Chen G, et al. T cell–derived CD70 delivers an immune checkpoint function in inflammatory T cell responses. The Journal of Immunology 2017;199:3700–10 Sam I, Ben Hamouda N, Alkatrib M, Gonnin C, Siska PJ, Oudard S, et al. The CD70–CD27 Axis in Cancer Immunotherapy: Predictive Biomarker and Therapeutic Target. Clinical Cancer Research 2025:OF1-OF10 Al Sayed MF, Ruckstuhl CA, Hilmenyuk T, Claus C, Bourquin J-P, Bornhauser BC, et al. CD70 reverse signaling enhances NK cell function and immunosurveillance in CD27-expressing B-cell malignancies. Blood, The Journal of the American Society of Hematology 2017;130:297–309 Nilsson MB, Yang Y, Heeke S, Patel SA, Poteete A, Udagawa H, et al. CD70 is a therapeutic target upregulated in EMT-associated EGFR tyrosine kinase inhibitor resistance. Cancer Cell 2023;41:340–55. e6 Reinhardt C, Ochsenbein AF. Immune checkpoints regulate acute myeloid leukemia stem cells. Leukemia 2025:1–17 Wolf K, Schulz C, Riegger G, Pfeifer M. Tumour necrosis factor-α induced CD70 and interleukin‐7R mRNA expression in BEAS‐2B cells. European Respiratory Journal 2002;20:369–75 Izawa K, Martin E, Soudais C, Bruneau J, Boutboul D, Rodriguez R, et al. Inherited CD70 deficiency in humans reveals a critical role for the CD70–CD27 pathway in immunity to Epstein-Barr virus infection. Journal of Experimental Medicine 2017;214:73–89 Zhang Q, Xu M. EBV-induced T-cell responses in EBV-specific and nonspecific cancers. Frontiers in immunology 2023;14:1250946 Kitajima S, Lee KL, Fujioka M, Sun W, You J, Chia GS, et al. Hypoxia-inducible factor-2 alpha up-regulates CD70 under hypoxia and enhances anchorage-independent growth and aggressiveness in cancer cells. Oncotarget 2018;9:19123 Ruf M, Mittmann C, Nowicka AM, Hartmann A, Hermanns T, Poyet C, et al. pVHL/HIF-regulated CD70 expression is associated with infiltration of CD27 + lymphocytes and increased serum levels of soluble CD27 in clear cell renal cell carcinoma. Clinical Cancer Research 2015;21:889–98 Sinitsky M, Sinitskaya A, Shishkova D, Tupikin A, Asanov M, Khutornaya M, et al. Identification of key genes and pathways in genotoxic stress induced endothelial dysfunction: results of whole transcriptome sequencing. Biomedicines 2022;10:2067 Desai SA, Patel VP, Bhosle KP, Nagare SD, Thombare KC. The tumor microenvironment: shaping cancer progression and treatment response. Journal of Chemotherapy 2025;37:15–44 Thiruvalluvan M, Bhowmick NA. Stromal–Epithelial Interactions in Cancer Progression and Therapy Response. Volume 15: MDPI; 2023. p 3014. Wilczyński B, Dąbrowska A, Kulbacka J, Baczyńska D. Chemoresistance and the tumor microenvironment: the critical role of cell–cell communication. Cell Communication and Signaling 2024;22:486 Khan AU, Wang Q, Roh E, Dickinson SE, Wondrak GT, Curiel-Lewandowski C, et al. TOPK Drives IL19-Mediated Crosstalk Between Cancer Cells and Fibroblasts to Promote Solar UV-Induced Skin Damage and Carcinogenesis. Cancers 2025;17:2067 Mao X, Xu J, Wang W, Liang C, Hua J, Liu J, et al. Crosstalk between cancer-associated fibroblasts and immune cells in the tumor microenvironment: new findings and future perspectives. Molecular cancer 2021;20:131 Sahai E, Astsaturov I, Cukierman E, DeNardo DG, Egeblad M, Evans RM, et al. A framework for advancing our understanding of cancer-associated fibroblasts. Nature Reviews Cancer 2020;20:174–86 Wu X, Tao P, Zhou Q, Li J, Yu Z, Wang X, et al. IL-6 secreted by cancer-associated fibroblasts promotes epithelial-mesenchymal transition and metastasis of gastric cancer via JAK2/STAT3 signaling pathway. Oncotarget 2017;8:20741 Einspahr JG, Curiel-Lewandrowski C, Calvert VS, Stratton SP, Alberts DS, Warneke J, et al. Protein activation mapping of human sun-protected epidermis after an acute dose of erythemic solar simulated light. NPJ precision oncology 2017;1:34 Wolf DM, Yau C, Wulfkuhle J, Brown-Swigart L, Gallagher RI, Lee PRE, et al. Redefining breast cancer subtypes to guide treatment prioritization and maximize response: Predictive biomarkers across 10 cancer therapies. Cancer cell 2022;40:609 – 23. e6 Dickinson SE, Vaishampayan P, Jandova J, Ai YE, Kirschnerova V, Zhang T, et al. Inhibition of UV-Induced Stress Signaling and Inflammatory Responses in SKH-1 Mouse Skin by Topical Small-Molecule PD-L1 Blockade. JID Innovations 2024;4:100255 Wang Q, Zhang T, Chang X, Lim DY, Wang K, Bai R, et al. ARC is a critical protector against inflammatory bowel disease (IBD) and IBD-associated colorectal tumorigenesis. Cancer research 2020;80:4158–71 Bindea G, Mlecnik B, Tosolini M, Kirilovsky A, Waldner M, Obenauf AC, et al. Spatiotemporal dynamics of intratumoral immune cells reveal the immune landscape in human cancer. Immunity 2013;39:782–95 Liu Z, Li M, Jiang Z, Wang X. A comprehensive immunologic portrait of triple-negative breast cancer. Translational oncology 2018;11:311–29 Guo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, et al. NF-κB in biology and targeted therapy: new insights and translational implications. Signal transduction and targeted therapy 2024;9:53 Roberti A, Chaffey LE, Greaves DR. NF-κB signaling and inflammation—drug repurposing to treat inflammatory disorders? Biology 2022;11:372 Yu H, Lin L, Zhang Z, Zhang H, Hu H. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Signal transduction and targeted therapy 2020;5:209 Tang X, Yang T, Yu D, Xiong H, Zhang S. Current insights and future perspectives of ultraviolet radiation (UV) exposure: Friends and foes to the skin and beyond the skin. Environment international 2024;185:108535 Gao G, Zhang T, Wang Q, Reddy K, Chen H, Yao K, et al. ADA-07 suppresses solar ultraviolet–induced skin carcinogenesis by directly inhibiting TOPK. Molecular cancer therapeutics 2017;16:1843–54 Roh E, Kim J-E, Zhang T, Shin SH, Kim B-G, Li J, et al. Orobol, 3′-hydroxy-genistein, suppresses the development and regrowth of cutaneous SCC. Biochemical Pharmacology 2023;209:115415 Libermann TA, Baltimore D. Activation of interleukin-6 gene expression through the NF-κB transcription factor. Molecular and cellular biology 1990;10:2327–34 Matsusaka T, Fujikawa K, Nishio Y, Mukaida N, Matsushima K, Kishimoto T, et al. Transcription factors NF-IL6 and NF-kappa B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proceedings of the National Academy of Sciences 1993;90:10193-7 Thompson WL, Van Eldik LJ. Inflammatory cytokines stimulate the chemokines CCL2/MCP-1 and CCL7/MCP-7 through NFκB and MAPK dependent pathways in rat astrocytes. Brain research 2009;1287:47–57 Zhao Y, Fu Y, Hu J, Liu Y, Yin X. The effect of tissue factor pathway inhibitor on the expression of monocyte chemotactic protein-3 and IκB-α stimulated by tumour necrosis factor-α in cultured vascular smooth muscle cells. Archives of Cardiovascular Diseases 2013;106:4–11 Biswas AK, Mitchell DL, Johnson DG. E2F1 responds to ultraviolet radiation by directly stimulating DNA repair and suppressing carcinogenesis. Cancer research 2014;74:3369–77 Singh RK. Regulation of E2F1 in Keratinocytes During UV-Damage and Differentiation: The University of Western Ontario (Canada); 2016. Kent LN, Leone G. The broken cycle: E2F dysfunction in cancer. Nature Reviews Cancer 2019;19:326–38 Yamazaki K, Hasegawa M, Ohoka I, Hanami K, Asoh A, Nagao T, et al. Increased E2F-1 expression via tumour cell proliferation and decreased apoptosis are correlated with adverse prognosis in patients with squamous cell carcinoma of the oesophagus. Journal of clinical pathology 2005;58:904–10 Jacobs J, Deschoolmeester V, Rolfo C, Zwaenepoel K, Van den Bossche J, Deben C, et al. Preclinical data on the combination of cisplatin and anti-CD70 therapy in non-small cell lung cancer as an excellent match in the era of combination therapy. Oncotarget 2017;8:74058 Pich C, Sarrabayrouse G, Teiti I, Mariamé B, Rochaix P, Lamant L, et al. Melanoma-expressed CD70 is involved in invasion and metastasis. British journal of cancer 2016;114:63–70 Pich C, Teiti I, Sarrabayrouse G, Gallardo F, Gence R, Tilkin-Mariamé A-F. Melanoma expressed-CD70 is regulated by RhoA and MAPK pathways without affecting vemurafenib treatment activity. PLoS One 2016;11:e0148095 Wu R, Chen J, Wang G, Han L. CD70 as a target in cancer immunotherapy: advances, challenges, and future directions. Frontiers in Oncology 2025;15:1609840 Arai KY, Ono M, Kudo C, Fujioka A, Okamura R, Nomura Y, et al. IL-1β stimulates activin βA mRNA expression in human skin fibroblasts through the MAPK pathways, the nuclear factor-κB pathway, and prostaglandin E2. Endocrinology 2011;152:3779-90 Gelfo V, Romaniello D, Mazzeschi M, Sgarzi M, Grilli G, Morselli A, et al. Roles of IL-1 in cancer: from tumor progression to resistance to targeted therapies. International journal of molecular sciences 2020;21:6009 Kiss M, Vande Walle L, Saavedra PH, Lebegge E, Van Damme H, Murgaski A, et al. IL1β promotes immune suppression in the tumor microenvironment independent of the inflammasome and gasdermin D. Cancer immunology research 2021;9:309 – 23 Tulotta C, Lefley DV, Moore CK, Amariutei AE, Spicer-Hadlington AR, Quayle LA, et al. IL-1B drives opposing responses in primary tumours and bone metastases; harnessing combination therapies to improve outcome in breast cancer. NPJ Breast Cancer 2021;7:95 Zhang J, Fu L, Yasuda-Yoshihara N, Yonemura A, Wei F, Bu L, et al. IL-1β derived from mixed-polarized macrophages activates fibroblasts and synergistically forms a cancer-promoting microenvironment. Gastric Cancer 2023;26:187–202 Jacobs J, Deschoolmeester V, Zwaenepoel K, Flieswasser T, Deben C, Van den Bossche J, et al. Unveiling a CD70-positive subset of cancer-associated fibroblasts marked by pro-migratory activity and thriving regulatory T cell accumulation. Oncoimmunology 2018;7:e1440167 Inoue S, Ito H, Tsunoda T, Murakami H, Ebi M, Ogasawara N, et al. CD70 expression in tumor-associated fibroblasts predicts worse survival in colorectal cancer patients. Virchows Archiv 2019;475:425–34 Komura M, Wang C, Ito S, Kato S, Ueki A, Ebi M, et al. Simultaneous expression of CD70 and POSTN in cancer-associated fibroblasts predicts worse survival of colorectal cancer patients. International Journal of Molecular Sciences 2024;25:2537 Schafer ZT, Brugge JS. IL-6 involvement in epithelial cancers. The Journal of clinical investigation 2007;117:3660–3 Liu Y, Cai Y, Liu L, Wu Y, Xiong X. Crucial biological functions of CCL7 in cancer. PeerJ 2018;6:e4928 Lee YS, Cho YB. CCL7 signaling in the tumor microenvironment. Tumor Microenvironment: The Role of Chemokines–Part A 2020:33–43 Rébé C, Ghiringhelli F. Interleukin-1β and cancer. Cancers 2020;12:1791 Hirano T. IL-6 in inflammation, autoimmunity and cancer. International immunology 2021;33:127–48 Additional Declarations (Not answered) Supplementary Files SupplementaryFigurelegendsCD70.docx Supplementary Figure legends SupplementaryMethodsCCD.docx Supplementary Methods SupplemetaryMaterialWB.pdf Supplemetary Material_WB SupplementaryFigures.pdf Supplementary Figures Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 02 Feb, 2026 Review # 2 received at journal 30 Dec, 2025 Reviewer # 2 agreed at journal 14 Dec, 2025 Review # 1 received at journal 11 Dec, 2025 Reviewer # 1 agreed at journal 08 Dec, 2025 Reviewers invited by journal 06 Dec, 2025 Submission checks completed at journal 26 Nov, 2025 Editor assigned by journal 25 Nov, 2025 First submitted to journal 25 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8206807","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":556287886,"identity":"b831edaa-27a4-41a9-9739-b4c500c3a60a","order_by":0,"name":"Tianshun Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYDACCRA2YKvnh3CZidRiUcCXINlAkpaKD3IJBgeI1SI/u/nZgxsGZnnGN7LTHjBUWCc2ENLCOOeYueEMg7Risxu52w0YzqQT1sIskWAmLWFwjHHbjdxtEoxthwlrYZNI/yb9x+A/4+YZIC3/iNDCI5FjJgEM5MQNEiAtDURokZDIKQNpMZY483abRMKxdGOCWuRnpG+TkPjDJsffDrTlQ421LEEtqCCBNOWjYBSMglEwCnABAGDKOibiHP/HAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-7018-8393","institution":"The Hormel Institute, University of Minnesota","correspondingAuthor":true,"prefix":"","firstName":"Tianshun","middleName":"","lastName":"Zhang","suffix":""},{"id":556287887,"identity":"9b8c8935-57f3-4955-b8b9-a37d59a90959","order_by":1,"name":"Qiushi Wang","email":"","orcid":"","institution":"The Hormel Institute, University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Qiushi","middleName":"","lastName":"Wang","suffix":""},{"id":556287888,"identity":"357624fd-3992-4f06-a48d-dffa03707611","order_by":2,"name":"Asad Khan","email":"","orcid":"","institution":"The Hormel Institute, University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Asad","middleName":"","lastName":"Khan","suffix":""},{"id":556287889,"identity":"2dd6bd6a-7c44-4829-b751-4d207e589313","order_by":3,"name":"Chengcheng Hu","email":"","orcid":"","institution":"3Department of Epidemiology and Biostatistics","correspondingAuthor":false,"prefix":"","firstName":"Chengcheng","middleName":"","lastName":"Hu","suffix":""},{"id":556287890,"identity":"f5cc5b6a-d5f8-4500-b02b-ac410f705aad","order_by":4,"name":"Emanuel Petricoin","email":"","orcid":"","institution":"Geroge Mason University","correspondingAuthor":false,"prefix":"","firstName":"Emanuel","middleName":"","lastName":"Petricoin","suffix":""},{"id":556287891,"identity":"076063bc-5171-4b08-b15f-6682239d7a3e","order_by":5,"name":"Rebecca Morris","email":"","orcid":"","institution":"The Hormel Institute, University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Rebecca","middleName":"","lastName":"Morris","suffix":""},{"id":556287892,"identity":"c34215ec-0d8f-432d-afdc-ece424fa9e58","order_by":6,"name":"Sally Dickinson","email":"","orcid":"","institution":"The University of Arizona Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Sally","middleName":"","lastName":"Dickinson","suffix":""},{"id":556287893,"identity":"30cf96fc-9981-41a9-8038-3d29c4a2b3bb","order_by":7,"name":"Georg Wondrak","email":"","orcid":"https://orcid.org/0000-0003-4799-8608","institution":"University of Arizona","correspondingAuthor":false,"prefix":"","firstName":"Georg","middleName":"","lastName":"Wondrak","suffix":""},{"id":556287894,"identity":"557fe703-3abd-4d62-87a6-08b5ec07852b","order_by":8,"name":"Ann.M Bode","email":"","orcid":"","institution":"University of Minnesota","correspondingAuthor":false,"prefix":"","firstName":"Ann.M","middleName":"","lastName":"Bode","suffix":""},{"id":556287895,"identity":"5cd52f50-7370-4935-92e7-264b842e0c0c","order_by":9,"name":"Clara Curiel-Lewandrowski","email":"","orcid":"","institution":"The University of Arizona Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Clara","middleName":"","lastName":"Curiel-Lewandrowski","suffix":""}],"badges":[],"createdAt":"2025-11-25 21:40:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8206807/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8206807/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98429881,"identity":"f93c7134-180e-4f02-9131-74d1d2b7596a","added_by":"auto","created_at":"2025-12-17 16:44:17","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102615,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptCCD.docx","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/99608fa4dd4288c741ad9c81.docx"},{"id":98430009,"identity":"2b9b633f-f8fc-4380-9fe2-5f008b5114d0","added_by":"auto","created_at":"2025-12-17 16:44:37","extension":"json","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11526,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS257408.json","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/ef98b2e1b7432fa27a3a3470.json"},{"id":98428434,"identity":"e4edc210-53ad-40dd-9ed6-cb7ef67ab554","added_by":"auto","created_at":"2025-12-17 16:42:01","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20860,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigurelegendsCD70.docx","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/66759acff5042c97d8d1a9d4.docx"},{"id":98430608,"identity":"4f1d20d5-8729-4613-b948-b55e38feb279","added_by":"auto","created_at":"2025-12-17 16:45:52","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":911673,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/bd68596eab43e4e89cf77ebd.pdf"},{"id":98430571,"identity":"b2cf4045-83c3-469f-b88e-655ea0fd73f1","added_by":"auto","created_at":"2025-12-17 16:45:46","extension":"docx","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31642,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMethodsCCD.docx","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/e5e027f80c919f9a763d50ac.docx"},{"id":98095227,"identity":"292cfd6a-ed06-4e40-8089-c22febcd2cfe","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"pdf","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":295784,"visible":true,"origin":"","legend":"","description":"","filename":"SupplemetaryMaterialWB.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/fca24607ff683f912d47777b.pdf"},{"id":98095223,"identity":"f061993b-61b1-49ac-8fbf-f2194c1279d3","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156207,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS2574080enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/2e68bc64d2ce6d41afa7fd6e.xml"},{"id":98095231,"identity":"da2e05b4-cf2b-4555-978d-22ba344adfa0","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":784804,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/25be344ad7883bdaca2b6b37.pdf"},{"id":98095232,"identity":"b9610f63-4596-417e-af54-d2390aa1baa7","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"pdf","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2655128,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/516da806f0c0cafccfff894e.pdf"},{"id":98095236,"identity":"3c51eee7-8b70-4d9b-9aa6-170837c7cf1b","added_by":"auto","created_at":"2025-12-12 18:25:59","extension":"pdf","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54011617,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/1cb18eff4cef27fa0b9f9298.pdf"},{"id":98095235,"identity":"710e19aa-19d3-4cda-bf52-530ae9c89357","added_by":"auto","created_at":"2025-12-12 18:25:59","extension":"pdf","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70290489,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/e3ce21781fdbff0c490f16e2.pdf"},{"id":98095226,"identity":"0be0b7ea-c280-47dd-b701-4b19fcf5ac66","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"pdf","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2202097,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/0095a7ad0303afb074eb012d.pdf"},{"id":98429630,"identity":"f458d1c8-e584-4737-8205-6af237b13753","added_by":"auto","created_at":"2025-12-17 16:43:53","extension":"pdf","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6597071,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/6cc29a35677aeb4ead971907.pdf"},{"id":98095229,"identity":"fd78b060-c8e6-431f-a979-7ec547f2fb60","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"pdf","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":190886,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/1d7ed9dcd5b70fbb7a678fd2.pdf"},{"id":98429357,"identity":"846d5ce4-0d01-4704-87a0-0b9b0bae652d","added_by":"auto","created_at":"2025-12-17 16:43:16","extension":"xml","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154465,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS2574080structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/1c1c2f5009af31745140d78e.xml"},{"id":98429505,"identity":"f5f308c4-eac3-45fb-8d7e-4e5f88201f1f","added_by":"auto","created_at":"2025-12-17 16:43:34","extension":"html","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":170070,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/ebb8cf041ef5858fd05a1232.html"},{"id":98430458,"identity":"c1ba3256-c144-47fa-a4e4-364aee525a86","added_by":"auto","created_at":"2025-12-17 16:45:29","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":576474,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCD70 is upregulated in sun exposed skin and non-melanoma skin cancers. (A)\u003c/strong\u003e Transcriptomic analysis of GTEx (sun exposed vs. sun protected skin) and GEO datasets (GSE2503, GSE42677; normal skin n=16, actinic keratosis [AK n=9], and cutaneous squamous cell carcinoma [cSCC n=15]) identified a variety of differentially expressed immune-related genes (FDR \u0026lt; 0.05, ≥2-fold). CD70 and CXCL13 were highlighted as candidates associated with sun exposure, immune response, and skin carcinogenesis. \u003cstrong\u003e(B)\u003c/strong\u003e CD70 expression is significantly higher in sun exposed skin compared with sun protected skin (left panel) and markedly elevated in AK and cSCC compared with normal controls (right panel). Statistical analysis was performed usingWilcoxon rank-sum test (***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001). Reverse-phase protein array (RPPA) analysis confirmed elevated CD70 expression in both epidermis \u003cstrong\u003e(C)\u003c/strong\u003e and dermis \u003cstrong\u003e(D)\u003c/strong\u003e of sun-damaged skin. Skin samples included 21 from sun-protected (SP) areas and 28 from sun-damaged (SD) areas, comprising 10 mild, 10 moderate, and 8 severe cases. \u003cstrong\u003e(E)\u003c/strong\u003e Immunofluorescence staining of human skin sections shows increased CD70 expression in AK (n=10) and cSCC (n=10) compared to normal skin (n=10). \u003cstrong\u003e(F)\u003c/strong\u003eimmunofluorescence further revealed significant CD70 induction in both SCC (n=43) and BCC (n=13) compared to normal skin (n=10), with the strongest upregulation observed in SCC. CD70 is shown in red, and nuclei are counterstained with DAPI (blue). Scale bar: 50 µm. Statistical significance was determined by one-way ANOVA (Tukey’s HSD) vs control (SP or Normal; *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/282abe6956be8d92bb19eb8a.jpg"},{"id":98430480,"identity":"3cd65131-6d69-45a8-aeed-b40653a984a1","added_by":"auto","created_at":"2025-12-17 16:45:33","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":645681,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of CD70 suppresses cSCC cell growth \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and in a xenograft mouse model. (A)\u003c/strong\u003e A431 and SCC12 cells with stable shCon or shCD70 knockdown were established, and CD70 expression was confirmed by Western blotting.\u003cstrong\u003e \u003c/strong\u003eCD70 knockdown reduces the proliferation of \u003cstrong\u003e(B) \u003c/strong\u003eA431 and \u003cstrong\u003e(C) \u003c/strong\u003eSCC12 cells as measured by MTS assays.\u003cstrong\u003e(D, E)\u003c/strong\u003e CD70 knockdown decreases spheroid growth of A431 and SCC12 cells in 3D spheroid assays. CD70 is shown in red, and nuclei are counterstained with DAPI (blue). Scale bar: 50 µm.\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eIn vivo\u003c/em\u003e xenograft assays using A431 cells with stable CD70 knockdown demonstrate reduced tumor \u003cstrong\u003e(F)\u003c/strong\u003e size,\u003cstrong\u003e(G) \u003c/strong\u003eweight, and \u003cstrong\u003e(H) \u003c/strong\u003evolume compared with controls.\u003cstrong\u003e (I)\u003c/strong\u003e Body weight measurements show no significant differences between groups.\u003cstrong\u003e(J)\u003c/strong\u003eImmunofluorescence staining reveal decreased PCNA expression in CD70-silenced tumors (left), which was quantified (right) using the ZEISS ZEN 3.7 software program.\u003cstrong\u003e \u003c/strong\u003eAsterisks indicate statistical significance (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs. shCon in each time point; Student’s \u003cem\u003et\u003c/em\u003e-test).\u003c/p\u003e","description":"","filename":"12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/58b9692d798d4ab965a385d5.jpg"},{"id":98095211,"identity":"df38256a-1af9-4e20-ba16-54525c8d08b8","added_by":"auto","created_at":"2025-12-12 18:25:57","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":694702,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSolar UV–induced DNA damage response mediates CD70 expression \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evia\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e E2F1. (A)\u003c/strong\u003e CD70 expression increases 24 h after SSL and DMBA treatment in HaCaT keratinocytes. \u003cstrong\u003e(B) \u003c/strong\u003eThe potential of transcript factors from TFs-JASPAR, TFs-PRMO and TFs Humna TFDB overlapped with GOBP_DNA_DAMAGE_RESPONSE from GSEA MSigDB identity E2F1 and TP53 as potential transcript factors mediating CD70. \u003cstrong\u003e(C) \u003c/strong\u003eCorrelation analysis of merged GEO datasets reveals a positive association between CD70 and E2F1 expression. \u003cstrong\u003e(D)\u003c/strong\u003e SSL exposure upregulates E2F1 and CD70 expression, whereas E2F1 knockdown attenuates CD70 induction in HaCaT cells, confirmed by Western blotting. \u003cstrong\u003e(E)\u003c/strong\u003e E2F1 knockdown attenuates CD70 expression in SSL-treated HaCaT cells as assessed by immunofluorescence (left). E2F1 is shown in green, CD70 is shown in red, and nuclei are counterstained with DAPI (blue). Scale bar: 50 µm. The intensity was quantified (right) using the ZEISS ZEN 3.7 software program. \u003cstrong\u003e(F) \u003c/strong\u003eE2F1 overexpression increases CD70 levels in HaCaT, A431, and SCC12 cells. \u003cstrong\u003e(G) \u003c/strong\u003eThis result was validated by immunofluorescence in A431 cells. Luciferase assays show that E2F1 overexpression enhances CD70 promoter activity in \u003cstrong\u003e(H)\u003c/strong\u003e HaCaT and \u003cstrong\u003e(I)\u003c/strong\u003e A431 cells. The statistical analysis was determined by one-way ANOVA, Tukey’s HSD. \u003cstrong\u003e(J) \u003c/strong\u003eChIP assay demonstrates E2F1 binding to the CD70 promoter region. \u003cstrong\u003e(K)\u003c/strong\u003e Predicted CD70 promoter motifs show E2F1 binding sites as assessed by JASPAR and MEME. \u003cstrong\u003e(L) \u003c/strong\u003eA CD70 promoter construct with mutated E2F1 binding sites was generated and sequence-verified by Genewiz. \u003cstrong\u003e(M) \u003c/strong\u003eLuciferase assays show that the mutated CD70 promoter reduces CD70 activity in HaCaT cells. Statistical significance was determined by one-way ANOVA followed by Tukey’s HSD test (H, I, M) and by Student’s \u003cem\u003et\u003c/em\u003e-test (E, G, J) (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/8ae3fe5c9bbc85764e5221d9.jpg"},{"id":98429767,"identity":"d645ea70-2469-4b2b-af12-691dcc239013","added_by":"auto","created_at":"2025-12-17 16:44:07","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":734487,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCD70 knockdown suppresses pro-tumorigenic signaling.\u003c/strong\u003e \u003cstrong\u003e(A, B)\u003c/strong\u003e RNA-seq of SSL-exposed HaCaT cells with or without CD70 silencing reveals distinct gene expression changes. \u003cstrong\u003e(C)\u003c/strong\u003e KEGG analysis highlights cytokine–cytokine receptor interaction and MAPK signaling as the most altered pathways. \u003cstrong\u003e(D)\u003c/strong\u003e Knockdown of CD70 attenuates SSL-induced ERK, p38, JNK phosphorylation in HaCaT cells. Knockdown of CD70 attenuates NF-κB nuclear translocation as assessed by luciferase assay \u003cstrong\u003e(E)\u003c/strong\u003eand immunofluorescence \u003cstrong\u003e(F)\u003c/strong\u003e in HaCaT cells. \u003cstrong\u003e(G)\u003c/strong\u003eKnockdown of CD70 suppress ERK, p38, JNK phosphorylation in A431 and SCC12 cells. \u003cstrong\u003e(H) \u003c/strong\u003eKnockdown of CD70 suppresses\u003cstrong\u003e \u003c/strong\u003eNF-κB activation with or without TPA treatment in A431 cells. \u003cstrong\u003e(I) \u003c/strong\u003eKnockdown of CD70 decreases TPA induced NF-κB nuclear translocation in A431 cells (left). Immunofluorescence images: scale bar, 50 μm. Signal intensity was quantified (right) using ZEISS ZEN 3.7 software. Data are presented as means ± SE. Statistical significance was determined by one-way ANOVA followed by Tukey’s HSD test (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"14.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/6fc0c67afd0200ba45a10324.jpg"},{"id":98095216,"identity":"744596f4-6dcc-44a9-980a-1791e94d7f53","added_by":"auto","created_at":"2025-12-12 18:25:57","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":526778,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCD70 expression in fibroblasts promotes tumor–stroma crosstalk.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Western blot confirming knockdown of CD70 in NHDF1-TGFβ fibroblasts. \u003cstrong\u003e(B, C)\u003c/strong\u003e 3D co-culture assays showing that NHDF1-TGFβ fibroblasts enhance A431 spheroid growth, whereas knockdown of CD70 suppresses spheroid growth. \u003cstrong\u003e(D)\u003c/strong\u003e Immunofluorescence analysis showing that knockdown of CD70 reduces NF-κB nuclear translocation in NHDF1-TGFβ fibroblasts upon TPA stimulation (left). Scale bar: 50 μm. Nuclear intensity was quantified (right) using the ZEISS ZEN 3.7 program. \u003cstrong\u003e(E)\u003c/strong\u003e Cytokine array of conditioned media (CM) showing decreased IL6 and MCP3 secretion after knockdown of CD70 (left). Spot intensities were quantified using ImageJ, and cytokine expression levels are presented in graphical form (right). \u003cstrong\u003e(F)\u003c/strong\u003eWestern blot validation showing reduced IL6 and MCP3 expression in fibroblast conditioned media (CM) after knockdown of CD70. Data are presented as mean values ± SE, with statistical significance determined by one-way ANOVA with Tukey’s HSD (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/915818ab2b21572bdfeff114.jpg"},{"id":98095219,"identity":"54f4b769-ee65-4775-b721-1fdf4e5bca05","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":720722,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFibroblast-derived CD70 enhances cSCC tumor growth \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Tumor growth curves of nude mice co-injected with A431 cells and fibroblasts show accelerated tumor growth with NHDF1-TGFβ fibroblasts compared with NHDF1 controls, and suppression with CD70-silenced NHDF1-TGFβ fibroblasts. Tumor \u003cstrong\u003e(B) \u003c/strong\u003eweights and \u003cstrong\u003e(C) \u003c/strong\u003evolumes at the endpoint of the study show reduced tumor burden in the CD70 knockdown group. \u003cstrong\u003e(D)\u003c/strong\u003eImmunofluorescence staining of xenograft tumors showing decreased PCNA, IL6, and MCP3 expression in tumors derived from CD70-silenced fibroblasts (upper). The scale bar: 50 μm. Intensity was evaluated (lower) using the ZEISS ZEN 3.7 software program. Data are presented as means ± SE, with statistical significance determined by one-way ANOVA with Tukey’s HSD (B, D) and Student’s \u003cem\u003et\u003c/em\u003e test (C) (**\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"16.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/0470c811045615988fc1549a.jpg"},{"id":98095217,"identity":"76d12efe-976a-461e-95d2-c1d7237d8097","added_by":"auto","created_at":"2025-12-12 18:25:58","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":329868,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic model of CD70-mediated signaling in solar UV–induced cSCC.\u003c/strong\u003e\u003cbr\u003e\nSolar UV triggers \u003cstrong\u003e(A)\u003c/strong\u003e DNA damage responses in keratinocytes, leading to increased E2F1 expression and induction of CD70 expression. \u003cstrong\u003e(B) \u003c/strong\u003eCD70 promotes activation of MAPK (ERK, p38, JNK) and NF-κB signaling pathways, driving the production of pro-inflammatory and pro-tumorigenic mediators such as IL1B. \u003cstrong\u003e(C) \u003c/strong\u003eFibroblast-derived CD70 further enhances NF-κB activation and cytokine secretion, including IL6 and MCP3, reinforcing tumor–stroma crosstalk. Together, these mechanisms link UV-induced genotoxic stress to CD70-driven oncogenic signaling and cSCC development.\u003c/p\u003e","description":"","filename":"17.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/ba334ce3eea9ae54eb990e71.jpg"},{"id":98775335,"identity":"1160c6f8-6f77-4b14-89e1-0264f16bd369","added_by":"auto","created_at":"2025-12-22 12:19:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5594050,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/3a7bb08c-3e39-40fc-bfe8-0b59fc499e9c.pdf"},{"id":98095209,"identity":"90c6e0e1-700c-44dc-8991-163d9309c4b9","added_by":"auto","created_at":"2025-12-12 18:25:57","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":20860,"visible":true,"origin":"","legend":"Supplementary Figure legends","description":"","filename":"SupplementaryFigurelegendsCD70.docx","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/de21fbad9913c557b5501058.docx"},{"id":98429575,"identity":"fefe7f74-5165-4055-86bc-c3bcf435627b","added_by":"auto","created_at":"2025-12-17 16:43:44","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":31642,"visible":true,"origin":"","legend":"Supplementary Methods","description":"","filename":"SupplementaryMethodsCCD.docx","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/5d03b6fdf3c9f2aeecfb91a9.docx"},{"id":98429690,"identity":"996d66b5-bffe-4688-bc65-e221acd8dae3","added_by":"auto","created_at":"2025-12-17 16:44:00","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":295784,"visible":true,"origin":"","legend":"Supplemetary Material_WB","description":"","filename":"SupplemetaryMaterialWB.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/085984c3b941ce3c6cbd740b.pdf"},{"id":98429662,"identity":"f755087f-9557-402d-acef-cb4166c98db6","added_by":"auto","created_at":"2025-12-17 16:43:58","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":911673,"visible":true,"origin":"","legend":"Supplementary Figures","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8206807/v1/63c21c4d1fb55da0dd13a1fb.pdf"}],"financialInterests":"(Not answered)","formattedTitle":"CD70 drives cSCC growth by linking DNA damage response, inflammation, and tumor–stromal signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNon-melanoma skin cancers (NMSCs), including actinic keratosis (AK) and cutaneous squamous cell carcinoma (cSCC), are the most common human malignancies, with rising incidence due to cumulative ultraviolet (UV) exposure and aging (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Chronic UV irradiation induces persistent DNA damage, oxidative stress, and inflammation, which are hallmarks of skin carcinogenesis (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Although mutations in oncogenic drivers such as \u003cem\u003eTP53, RAS\u003c/em\u003e, and \u003cem\u003eNOTCH\u003c/em\u003e have been well characterized (\u003cspan additionalcitationids=\"CR6 CR7 CR8\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e), the molecular regulators that integrate DNA damage signaling, inflammation, and tumor\u0026ndash;stroma interactions in NMSC remain poorly understood.\u003c/p\u003e\u003cp\u003eCD70, a type II transmembrane protein of the tumor necrosis factor (TNF) superfamily, is classically known for its role in adaptive immunity through CD27-mediated T-cell activation, proliferation, and differentiation (\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Aberrant CD70 expression has been reported in hematologic and solid malignancies, where it can contribute to immune evasion and tumor progression (\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Emerging evidence also indicates that CD70 can transmit tumor-intrinsic signals, engaging pathways such as PI3K/AKT and MAPK to promote proliferation, invasion, and epithelial\u0026ndash;mesenchymal transition (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). In these contexts, CD70 expression can be rapidly induced by inflammatory cytokines (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), viral infections (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), hypoxia (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), or genotoxic stress (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), despite its minimal expression in normal resting tissues (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). This inducible behavior suggests that CD70 may act as a stress-responsive integrator linking environmental insults to oncogenic, inflammatory, and stromal signaling. However, its mechanistic role in UV-driven epithelial carcinogenesis remains largely unexplored.\u003c/p\u003e\u003cp\u003eTumor progression is increasingly recognized as a product of interactions between malignant epithelial cells and the tumor microenvironment (TME) (\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Cancer-associated fibroblasts (CAFs), through secretion of cytokines, chemokines, and growth factors, can reinforce malignant signaling and promote tumor initiation, progression, and therapy resistance (\u003cspan additionalcitationids=\"CR27 CR28\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Whether CD70 expression extends beyond epithelial cells to modulate fibroblast activation and tumor\u0026ndash;stroma crosstalk in UV-induced skin cancer is unknown.\u003c/p\u003e\u003cp\u003eIn this study, we identify CD70 as a UV-inducible, DNA damage\u0026ndash;responsive molecule upregulated in sun-exposed skin, AK, and cSCC. Functional analyses demonstrate that CD70 promotes keratinocyte and fibroblast proliferation, activates MAPK and NF-κB signaling, and enhances pro-inflammatory cytokine expression. Mechanistically, CD70 is directly regulated by the DNA damage\u0026ndash;associated transcription factor E2F1. \u003cem\u003eIn vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e models reveal that fibroblast CD70 supports tumor growth and establishes a pro-tumorigenic TME. We hypothesize that UV-induced DNA damage activates CD70 via E2F1, linking genotoxic stress with pro-inflammatory and stromal remodeling pathways in NMSC.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eTranscriptomic data collection and analysis\u003c/h2\u003e\u003cp\u003eRNA-seq data from sun-exposed and sun-protected human skin were obtained from the GTEx database, and GEO datasets (GSE2503, GSE42677) were merged and normalized using the \u003cem\u003einSilicoMerging\u003c/em\u003e and \u003cem\u003elimma\u003c/em\u003e packages in R (v4.3.3). Differentially expressed genes (DEGs) were identified using empirical Bayes moderation with FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log₂FC| \u0026ge; 1. RNA-seq profiling of HaCaT cells 24 h post solar-simulated light (SSL; 60 kJ/m\u0026sup2; UVA, 2.9 kJ/m\u0026sup2; UVB) exposure was performed, and DEGs were analyzed using the same pipeline. All analyses and visualizations were performed in R (v4.3.3) by using the tidyverse (v2.0.0), ggplot2 (v3.5.1), ggpubr (v0.6.0), pheatmap, dplyr (v1.1.4), and limma (v3.58.1) packages. All bioinformatic details are provided in \u003cb\u003eSupplementary Materials and Methods\u003c/b\u003e.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eReverse phase microarray analysis (RPPA)\u003c/h3\u003e\n\u003cp\u003eRPPA was performed as described previously (\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Cell lysates were printed on nitrocellulose slides, probed with validated antibodies, and visualized using a tyramide-based amplification system. Data were quantified using MicroVigene software, normalized to total protein, and expressed as net signal intensity.\u003c/p\u003e\n\u003ch3\u003ePlasmid construction, cell culture, transfection, and lentiviral infection\u003c/h3\u003e\n\u003cp\u003eHuman E2F1, the pGL3 promoter vector, and packaging vectors (pMD2.0G and psPAX) were obtained from Addgene (Watertown, MA) The human CD70-pGL3 promoter vector was purchased from Thermo Fisher Scientific (Waltham, MA). Site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Cat. No. 200518-5; Agilent Technologies, anta Clara, CA) with primers for the human CD70 promoter: Forward: 5\u0026rsquo;-TGCCCAGGCTGGATGCGCTGCTGCCGCACAGCTCACAGCAGC-3\u0026rsquo; Reverse: 5\u0026rsquo;-GCTGCTGTGAGCTGTGCGGCAGCAGCGCATCCAGCCTGGGCA-3\u0026rsquo; Lentiviral plasmids shCD70 (#1, TRCN0000007840; #2, TRCN0000007841) were purchased from the University of Minnesota Genomics Center (Minneapolis, MN). ShE2F1 constructs (VB900040-4032wtd, VB900040-4039muj) were obtained from Vector Builder Inc. (Chicago, IL). The pLKO.1-puro Non-Target shRNA Control Plasmid (shCon) was purchased from Sigma-Aldrich (Burlington, MA). All constructs were verified by restriction enzyme mapping, DNA sequencing, and BLAST analysis.\u003c/p\u003e\u003cp\u003eHaCaT and HEK 293T cells were from ATCC (Manassas, VA); A431 and SCC-12 cells from Thermo Fisher Scientific (Waltham, MA); NHDF from Lonza (Walkersville, MD). Cells were used within 10 passages. HaCaT and A431 were cultured in DMEM with 10% FBS and 1% antibiotics; SCC-12 in RPMI 1640 with L-glutamine, 10% FBS, 1% antibiotics, and 1% MEM non-essential amino acids; NHDF in DMEM with 1X MEM, 10% FBS, and 1% antibiotics. CM was collected from serum-starved cells (48 h) and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. NHDF were treated with TGF-β (PeproTech, Rocky Hill, NJ) for 2 weeks to generate NHDF-TGF-β.\u003c/p\u003e\u003cp\u003eTransient transfection was performed using iMFectin DNA Transfection Reagent (GenDEPOT, Katy, TX) at 60\u0026ndash;70% confluence for 36\u0026ndash;48 h. For stable knockdown, lentiviral plasmids (shCD70, shE2F1, or shCon) with packaging vectors were transfected into HEK 293T cells using iMFectin Poly DNA Transfection Reagent (GenDEPOT). Viral supernatants were collected at 48 h, filtered (0.45 \u0026micro;m; MilliporeSigma, Burlington, MA), and used to infect target cells with 8 \u0026micro;g/mL polybrene (Sigma-Aldrich). Infected cells were selected with puromycin (1.2 \u0026micro;g/mL; Sigma-Aldrich) for 48 h.\u003c/p\u003e\u003cp\u003eMutated CD70 promoter constructs were generated using the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) and confirmed by Genewiz (South Plainfield, NJ).\u003c/p\u003e\n\u003ch3\u003eWestern blot analysis\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern blot analysis\u003c/div\u003e\u003cp\u003eWestern blotting was performed following previously established protocols(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Primary antibodies were diluted 1:1000 and incubated overnight at 4\u0026deg;C, followed by incubation with HRP-conjugated secondary antibodies at a 1:5000 dilution. Protein bands were visualized using a chemiluminescent substrate (GE Healthcare Biosciences, Piscataway, NJ). Detailed information is provided in \u003cb\u003eSupplementary Materials and Methods\u003c/b\u003e.\u003c/p\u003e\n\u003ch3\u003eSpheroid 3D cell culture\u003c/h3\u003e\n\u003cp\u003e Vitrogel Hydrogel Matrix (VHM01, TheWell Bioscience, North Brunswick, NJ) was used for spheroid 3D cell culture according to the manufacturer\u0026rsquo;s instructions. A431 and SCC12 cells (shCon or shCD70) were suspended in culture medium, and 1 mL of Vitrogel was mixed with 500 \u0026micro;L of the cell suspension. A total of 300 \u0026micro;L of the hydrogel\u0026ndash;cell mixture was dispensed into a 24-well plate at a density of 1 \u0026times; 10⁵ cells per well and allowed to gel at room temperature for 15 min. After gelation, 300 \u0026micro;L of medium were gently added to cover the hydrogel. Cultures were maintained at 37\u0026deg;C with medium changes every 48 h. After 10 days, cells were harvested for immunofluorescence analysis.\u003c/p\u003e\u003cp\u003eFor co-culture experiments, NHDF (shCon) or NHDF-TGF-β (shCon or shCD70) were combined with A431 or SCC12 cells and processed using the same Vitrogel-based procedure described above.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eChromatin immunoprecipitation (ChIP) and qPCR\u003c/h2\u003e\u003cp\u003eChIP was performed using the Magna ChIP A/G kit (MilliporeSigma, Burlington, MA, MAGNA0017) following the manufacturer\u0026rsquo;s instructions with minor optimizations. A431 cells (1 \u0026times; 10⁷ per IP) were cross-linked in 18.5% formaldehyde for 10 min and quenched with 10X glycine for 5 min. Cells were washed with ice-cold PBS, lysed sequentially with Cell Lysis Buffer and Nuclear Lysis Buffer supplemented with protease inhibitor, and chromatin was sheared by sonication into ~\u0026thinsp;200\u0026ndash;1000 bp fragments.\u003c/p\u003e\u003cp\u003eEqual amounts of chromatin were incubated with ChIP-grade antibody (E2F1) or rabbit IgG (1 \u0026micro;g per IP) and captured with Protein A/G magnetic beads overnight at 4\u0026deg;C. Beads were washed with Low Salt, High Salt, LiCl, and TE buffers. Chromatin was eluted with ChIP Elution Buffer containing Proteinase K, and cross-links were reversed at 62\u0026deg;C for 2 h followed by 95\u0026deg;C for 10 min. DNA was purified using the kit spin columns and eluted in 50 \u0026micro;L.\u003c/p\u003e\u003cp\u003eEnrichment at target loci was quantified by qPCR using primers (F: AGTAACACCCTATCCTCTACCCC; R: GCGCCCGGCCTAAATTAATATT) R: GTGCAGTTCAGTGATCGTACAGG). Reactions contained 2 \u0026micro;L DNA, 12.5 \u0026micro;L SYBR Green master mix, and 1 \u0026micro;L primer mix. Cycling: 94\u0026deg;C for 10 min; 50 cycles of 94\u0026deg;C for 20 s and 60\u0026deg;C for 1 min. Data are presented as fold enrichment over IgG control.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eXenograft mouse models\u003c/h3\u003e\n\u003cp\u003e All animal studies were conducted in accordance with protocols approved by the University of Minnesota Institutional Animal Care and Use Committee (IACUC, Minneapolis, MN; Protocol ID 2404-42009A). Xenograft experiments were performed to evaluate the effects of CD70 knockdown in A431 or NHDF cells.\u003c/p\u003e\u003cp\u003eFor the first experiment, six-week-old athymic nude mice (Charles River Laboratories, Wilmington, MA) were subcutaneously injected in the right flank with 4 \u0026times; 10⁶ A431 cells expressing either shCon or shCD70 (n\u0026thinsp;=\u0026thinsp;6 per group).\u003c/p\u003e\u003cp\u003eIn the second experiment, a mixture of 4 \u0026times; 10⁶ A431 cells with 1.67 \u0026times; 10⁶ NHDF or NHDF-TGF-β cells, expressing either shCon or shCD70, resuspended in 150 \u0026micro;L of a 1:1 PBS:Matrigel solution and injected subcutaneously into nude mice (n\u0026thinsp;=\u0026thinsp;6 per group). This design allowed comparison of tumors formed by A431 cells alone, A431 cells co-injected with NHDF-TGF-β cells expressing shCon, and A431 cells co-injected with NHDF-TGF-β cells expressing shCD70. Tumor size and body weight were measured weekly. Tumor volume was calculated using the formula: tumor volume (mm\u0026sup3;)\u0026thinsp;=\u0026thinsp;length \u0026times; width\u003csup\u003e2\u003c/sup\u003e \u0026times; 0.52.\u003c/p\u003e\u003cp\u003eThe detailed information of reagents and antibodies, RNA extraction (PureLink\u0026trade; RNA Mini Kit, Invitrogen, Carlsbad, CA), sequencing library, and bioinformatic analysis, Western blot analysis, cell viability (MTT) assay, immunofluorescence analysis, real-time PCR, Luciferase Assay and Human cytokine antibody array are described in \u003cb\u003eSupplementary Materials and Methods\u003c/b\u003e.\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eQuantitative data are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) or standard error (SE), based on at least 3 independent experiments or samples. Differences in gene expression among groups from GEO or GTEx datasets were assessed using the Wilcoxon rank-sum test. For RPPA data, Logarithmic transformation with base 2 (log2) was applied to expression levels of the RPPA analytes to achieve approximate normality. Box-and-whisker plots and waterfall plots were used to visually contrast distribution of expression levels across different groups. Expression levels were compared between groups by using generalized estimating equations (GEE), which adjusted for within-patient correlation (multiple patients contributed both sun protected and sun damaged skin samples to this study). The analysis was conducted using R (version 4.3.1). For experimental data, statistical significance was evaluated using either a Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test or one-way ANOVA, followed by post hoc multiple comparisons with Tukey\u0026rsquo;s HSD tests as appropriate. All analyses were conducted using SPSS software (version 23, IBM Corp., Armonk, NY) or R (v4.3.3). A \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eCD70 is highly expressed in sun exposed skin and non-melanoma skin cancers\u003c/h2\u003e\u003cp\u003eTo identify immune genes dysregulated in UV-exposed skin and NMSC, we analyzed GTEx transcriptomic data (sun exposed vs. sun protected skin) and merged GEO datasets GSE2503 and GSE42677 (AK, cSCC, and normal skin). Significant genes (FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u0026ge;\u0026thinsp;2-fold change) overlapping with immune signature genes (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) identified CD70 and CXCL13 as linked to sun exposure, immune responses, and skin carcinogenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). CD70 was significantly upregulated in sun-exposed skin versus protected sites and markedly elevated in AK and cSCC compared with normal skin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). CXCL13 was reduced in sun-exposed skin but increased in AK and cSCC (\u003cb\u003eSupplementary Fig.\u0026nbsp;1\u003c/b\u003e). Based on these results, we focused on CD70 for mechanistic studies in UV-induced skin damage and carcinogenesis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eConsistently, Reverse-phase protein array (RPPA) showed higher CD70 expression in both epidermis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and dermis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) of sun-damaged skin (mild to severe) versus protected skin. Immunofluorescence of human skin confirmed CD70 upregulation in AK and cSCC specimens (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE; University of Arizona, HSC #03\u0026ndash;65; IRB #11-0212-04, #12-0229-04). Immunofluorescence also showed elevated CD70 in SCC and BCC, with the strongest induction in SCC (SK801c, TissueArray.Com LLC, Derwood, MD) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). These findings indicate that CD70 is a UV-inducible gene activated early in skin carcinogenesis and maintained through disease progression.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCD70 promotes growth of cSCC cells\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo evaluate the functional significance of CD70 in skin cancer cells, we knocked down CD70 expression by using specific shRNAs in human cSCC cell lines (A431 and SCC12). Knockdown efficiency in A431 and SCC12 cells was confirmed by Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Knockdown of CD70 significantly reduced cell proliferation, as measured by MTS assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C); and suppressed spheroid formation in a 3D culture system (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E), indicating impaired tumorigenic capacity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo extend these findings \u003cem\u003ein vivo\u003c/em\u003e, A431 cells stably expressing CD70 shRNA or scrambled control were subcutaneously implanted into immunodeficient nude mice. Tumors derived from CD70-silenced cells exhibited significantly reduced tumor size \u003cb\u003e(representative images\u003c/b\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e, weight \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e, and volume \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH\u003cb\u003e)\u003c/b\u003e compared with controls but had no significant overall effect on body weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). Histological analysis (IF) further revealed decreased proliferation in CD70 knockdown tumors, as evidenced by reduced proliferating cell nuclear antigen (PCNA) staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ). Together, these results support a pro-proliferative role for CD70 in cSCC progression.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eCD70 is UV- and DNA damage\u0026ndash;inducible in keratinocytes\u003c/h2\u003e\u003cp\u003eSolar UV irradiation induces persistent DNA damage, a key driver of skin carcinogenesis (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). We found that solar simulated light (SSL) markedly increased CD70 expression in keratinocytes. Similarly, the chemical carcinogen 7,12-dimethylbenz[a]anthracene (DMBA), a classical DNA-damaging initiator, elevated CD70 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Other genotoxic agents, including camptothecin (CPT), etoposide (ETP), and aphidicolin (APH), also enhanced CD70 expression (\u003cb\u003eSupplementary Fig.\u0026nbsp;2A\u003c/b\u003e), indicating that CD70 is a DNA damage\u0026ndash;inducible gene and may function as a downstream effector of UV-driven genotoxic stress.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo identify transcription factors mediating CD70 induction, we queried JASPAR, PROMO, and HumanTFDB databases and overlapped predicted CD70-binding factors with the GOBP_DNA damage response gene set. E2F1 and TP53 emerged as top candidates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Meta-analysis of GSE2503 and GSE42677 datasets revealed a strong positive correlation between CD70 and E2F1 expression (R\u0026thinsp;=\u0026thinsp;0.66, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2.9 \u0026times; 10⁻⁶) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), and a negative correlation with TP53 (R = \u0026minus;\u0026thinsp;0.49, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0014) (\u003cb\u003eSupplementary Fig.\u0026nbsp;2B\u003c/b\u003e). E2F1 expression was also significantly elevated in AK and cSCC compared with normal skin (\u003cb\u003eSupplementary Fig.\u0026nbsp;2C\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eFunctionally, E2F1 knockdown markedly reduced CD70 expression in A431 and SCC12 cells (\u003cb\u003eSupplementary Fig.\u0026nbsp;2D\u003c/b\u003e) and inhibited cSCC cell proliferation (Supplementary Fig.\u0026nbsp;2E). SSL treatment increased both E2F1 and CD70 expression, whereas E2F1 silencing diminished CD70 levels, as confirmed by Western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) and immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, \u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e). Conversely, E2F1 overexpression elevated CD70 in HaCaT, A431, and SCC12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), a result further verified by immunofluorescence showing robust CD70 induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003eMechanistically, luciferase reporter assays demonstrated that E2F1 overexpression activated the CD70 promoter in HaCaT (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH) and A431 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI) cells. ChIP-qPCR confirmed direct E2F1 binding to predicted motifs within the CD70 promoter (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ). Motif analyses (JASPAR, MEME) identified a canonical E2F1 binding site (\u0026ndash;879 to \u0026minus;\u0026thinsp;890 bp relative to the transcription start site; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK), and site-directed mutagenesis (TGTGGCGCCACT \u0026rarr; TGCGGCAGCAGC; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eL) significantly attenuated E2F1-driven promoter activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eM). Together, these results establish E2F1 as a direct transcriptional activator of CD70 downstream of UV-induced DNA damage, linking genotoxic stress to oncogenic and inflammatory signaling in skin epithelial cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eCD70 knockdown alters pro-tumorigenic signaling pathways\u003c/h2\u003e\u003cp\u003eTo examine pathways regulated by CD70, we performed RNA-seq of HaCaT keratinocytes exposed to solar-simulated light (SSL) with or without CD70 knockdown. Differential expression analysis identified 1,275 upregulated and 2,333 downregulated genes (fold change\u0026thinsp;\u0026ge;\u0026thinsp;2, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). KEGG enrichment highlighted cytokine\u0026ndash;cytokine receptor interaction and MAPK signaling as the most affected pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eHeatmap visualization showed that CD70 knockdown led to reduced expression of pro-inflammatory mediators (e.g., IL1B, CCL20, CXCR2, CCL2, TNFRSF1A) and MAPK pathway components (e.g., IL1B, MAPK3, MAP2K6, MAPK13, JUND, FOS) (\u003cb\u003eSupplementary Fig.\u0026nbsp;4A, B\u003c/b\u003e). These results indicate that CD70 regulates keratinocyte pro-inflammatory mediators and MAPK signaling, likely via NF-κB\u0026ndash;mediated transcriptional control of cytokines and chemokines(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). RT-PCR analysis confirmed that knockdown of CD70 decreased IL1B expression, a gene involved in both cytokine\u0026ndash;cytokine receptor interactions and MAPK signaling, in HaCaT and A431 cells (\u003cb\u003eSupplementary Fig.\u0026nbsp;4C, D\u003c/b\u003e). MAPK signaling (ERK, p38, JNK) is rapidly activated by UV and mediates keratinocyte stress responses, proliferation, and pathways driving SCC initiation and progression (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Genetic inhibition of MAPK signaling suppresses UV-induced skin carcinogenesis in preclinical models (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). SSL exposure induced phosphorylation of ERK, p38, and JNK and nuclear translocation of NF-κB p65 in HaCaT cells; CD70 knockdown markedly attenuated these responses, as shown by Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e, luciferase assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e, and immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, \u003cb\u003eSupplementary Fig.\u0026nbsp;5A\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eSimilar results were observed in A431 and SCC12 cells, where CD70 knockdown reduced ERK, p38, and JNK phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG) and NF-κB transcriptional activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Immunofluorescence confirmed impaired NF-κB nuclear translocation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI; \u003cb\u003eSupplementary Fig.\u0026nbsp;5B\u003c/b\u003e). Together, these data indicate that CD70 amplifies NF-κB and MAPK signaling in response to UV, promoting cSCC cell growth.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eCD70 expression in fibroblasts promotes tumor\u0026ndash;stroma crosstalk and cSCC growth\u003c/h2\u003e\u003cp\u003eOur previous results demonstrate that CD70 is not only expressed in epidermis but also detected in dermis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D) Among stromal elements, CAFs drive drive tumor progression primarily through secretion of pro-inflammatory cytokines and growth factors (\u003cspan additionalcitationids=\"CR27 CR28\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). To model CAF activation, normal human dermal fibroblasts (NHDF1) were chronically treated with TGF-β to generate NHDF1-TGFβ cells (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Stable shCD70 and shCon NHDF1-TGFβ lines were established (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eConditioned media (CM) from NHDF1-TGFβ fibroblasts enhanced A431 and SCC12 cell growth compared with CM from normal NHDF1 cells, whereas CM from shCD70 NHDF1-TGFβ cells markedly suppressed growth \u003cb\u003e(Supplementary Fig.\u0026nbsp;6A, B)\u003c/b\u003e. In contrast, CM from shCD70 NHDF1-TGFβ cells significantly suppressed A431 and SCC12 growth relative to CM from shCon NHDF1-TGFβ cells (\u003cb\u003eSupplementary Fig.\u0026nbsp;6A, B, respectively\u003c/b\u003e). In 3D spheroid co-cultures, A431 cells co-cultured with NHDF1-TGFβ fibroblasts formed more compact spheroids than with normal fibroblasts, and CD70 knockdown in NHDF1-TGFβ cells significantly reduced spheroid formation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C).\u003c/p\u003e\u003cp\u003eMechanistically, CD70 knockdown in NHDF1-TGFβ fibroblasts suppressed TPA-induced NF-κB nuclear translocation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) and and reduced secretion of IL6 and MCP3, as confirmed by Cytokine Array and Western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, F; \u003cb\u003eSupplementary Fig.\u0026nbsp;7\u003c/b\u003e). Notably, NF-κB is a well-established regulator of IL6 and MCP3 expression (\u003cspan additionalcitationids=\"CR43 CR44\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e) and therefore its decreased activation and translocation induced by decreased CD70 correspond well. These results suggest that CD70 mediates fibroblast-derived cytokine production through the NF-κB pathway.\u003c/p\u003e\u003cp\u003e\u003cem\u003eIn vivo\u003c/em\u003e, co-injection of A431 cells with fibroblasts into nude mice enhanced tumor growth. Compared with co-injection of A431 cells with shCon NHDF1 fibroblasts, co-injection with NHDF1-TGFβ shCon fibroblasts further accelerated tumor growth. In contrast, knockdown of CD70 in NHDF1-TGFβ fibroblasts significantly suppressed tumor size \u003cb\u003e(representative images\u003c/b\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e, weight \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e, and volume \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e compared with the shCon group. Tumors from the CD70 knockdown group also exhibited reduced expression of PCNA and cytokines IL6, and MCP3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study identifies CD70 as a UV-inducible, DNA damage\u0026ndash;responsive mediator in NMSC, linking genotoxic stress, inflammatory signaling, and crosstalk between cSCC cells and fibroblasts. CD70 is upregulated in sun-exposed skin, AK, and cSCC, indicating its potential as an early molecular marker of UV-driven carcinogenesis. This extends prior work connecting UV-induced DNA damage and inflammation to skin cancer (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) and positions CD70 as a direct effector linking these processes.\u003c/p\u003e\u003cp\u003eWe demonstrate that UV-induced DNA damage induces CD70 in keratinocytes, revealing a previously unrecognized connection between environmental genotoxic stress and CD70 signaling. While CD70 is classically studied in immune activation through CD27 (\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), its role as a stress-responsive molecule in epithelial cells has been largely unexplored. This induction is directly mediated by E2F1, a DNA damage\u0026ndash;associated transcription factor (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e), which binds the CD70 promoter and activates transcription following UV or genotoxic treatment. E2F1 is a central mediator of DNA damage responses and oncogenic processes, regulating cell cycle progression, apoptosis, and DNA repair (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Our findings suggest that E2F1 promotes cSCC not only through cell growth but also via direct CD70 induction, consistent with reports of genotoxic stress\u0026ndash;driven CD70 expression (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e) revealing a novel E2F1\u0026ndash;CD70 axis connecting UV-induced DNA damage to oncogenic and inflammatory signaling.\u003c/p\u003e\u003cp\u003eFunctionally, CD70 amplifies pro-tumorigenic signaling by engaging MAPK and NF-κB pathways, shaping a cytokine-rich microenvironment that promotes keratinocyte proliferation and cSCC growth. Consistent with our findings, CD70 clustering can initiate reverse signaling through its cytoplasmic tail, engaging PI3K/AKT, MAPK and NF-κB pathways that promote proliferation, EMT, invasion, and immune-evasive phenotypes in tumor models (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) (\u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Activation of MAPK and NF-κB converges on inflammatory mediators and tumor-promoting genes such as IL1B, which facilitate tumor initiation, fibroblast activation, angiogenesis, EMT, and immune suppression (\u003cspan additionalcitationids=\"CR55 CR56 CR57\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Our RNA-seq and cytokine array analyses support CD70 as an upstream regulator of a feed-forward inflammatory module driving oncogenesis.\u003c/p\u003e\u003cp\u003eThe role of CD70 in stromal signaling represents a previously unrecognized mechanism in skin carcinogenesis, although previous studies have shown that CAFs form a distinct stromal subset that promotes tumor cell migration, drives regulatory T cell accumulation, and correlates with poor survival (\u003cspan additionalcitationids=\"CR60\" citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). Our findings reveal that fibroblast-derived CD70 amplifies cytokine production via NF-κB, thereby enhancing keratinocyte proliferation and 3D tumor spheroid formation. \u003cem\u003eIn vivo\u003c/em\u003e, co-injection of CD70-expressing fibroblasts with cSCC cells accelerates tumor growth, whereas CD70 knockdown impairs tumor progression and reduces PCNA, IL6, and MCP3 expression, confirming its functional relevance in the tumor microenvironment.\u003c/p\u003e\u003cp\u003eBeyond its direct effects on epithelial proliferation, CD70 shapes the tumor immune microenvironment by modulating the cytokine and chemokine milieu. Inflammatory mediators such as IL1β, IL6, and MCP-3 (CCL7) not only drive SCC cell growth but also recruit and condition myeloid populations, including monocytes, tumor-associated macrophages, and MDSCs, thereby promoting a suppressive, tumor-permissive niche (\u003cspan additionalcitationids=\"CR63 CR64 CR65\" citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e). CD70 in epithelial cells and fibroblasts may thus coordinate tumor progression by directly activating MAPK and NF-κB in tumor cells while indirectly sustaining immune evasion. Limitations include reliance on in vitro and murine models, incomplete demonstration of causal roles in vivo, and lack of human longitudinal or preclinical pharmacologic data, emphasizing the need for further validation.\u003c/p\u003e\u003cp\u003eCD70 functions as a dual-role node regulating epithelial proliferation, inflammatory signaling, and stromal crosstalk. Its rapid induction by UV-induced DNA damage, coupled with low basal expression in normal tissues, underscores its potential as a selective therapeutic target. Anti-CD70 therapies under investigation in hematologic malignancies and solid tumors (\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Our data suggest that CD70-targeted strategies could be repurposed for NMSC to disrupt both epithelial and stromal oncogenic programs. Future studies should investigate CD70/CD27 interactions across immune populations and assess CD70-targeted antibodies, antibody\u0026ndash;drug conjugates, and small-molecule inhibitors for preventing or treating UV-induced cSCC.\u003c/p\u003e\u003cp\u003eIn conclusion, we identify CD70 as a central integrator of DNA damage, inflammatory signaling, and tumor\u0026ndash;stroma interactions in UV-driven NMSC. Solar UV\u0026ndash;induced DNA damage robustly induces CD70 expression via E2F1, which in turn mediates keratinocyte and cSCC cell proliferation through MAPK and NF-κB signaling, driving the expression of inflammatory mediators and tumor-promoting factors such as IL1B. In addition, CD70 expressed in fibroblasts amplifies cytokine and chemokine production, including IL6 and MCP-3, which not only support cSCC growth, but also modulate the tumor microenvironment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Together, our findings reveal a previously unrecognized mechanism linking environmental genotoxic stress to pro-tumorigenic signaling and provide a compelling rationale for developing CD70-targeted strategies for skin cancer prevention and therapy.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e\u003cp\u003eThe RNA-seq datasets generated during this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003ch2\u003eFinancial Support\u003c/h2\u003e\u003cp\u003eThis work was supported by The Hormel Foundation and National Institutes of Health grant 1P01CA229112-01A1.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eConflicts of Interest:\u003c/h2\u003e\u003cp\u003eThe authors declare no potential conflicts of interest.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eFinancial Support\u003c/h2\u003e\u003cp\u003eThis work was supported by The Hormel Foundation and National Institutes of Health grant 1P01CA229112-01A1.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor contribution\u003c/h2\u003e\u003cp\u003eConceptualization: QW, TZ; Data Curation: QW, TZ; Formal Analysis: QW, AK, CH, TZ; Investigation: QW, AK, CC, TZ; Methodology: QW, RM, EFP, TZ; Resources: AMB, CC, TZ; Visualization: QW, CH, EFP, TZ; Writing, Original Draft Preparation: QW, TZ; Writing, Review and Editing: SD, GTW, AMB, CC, TZ. Supervision: TZ\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eThis work was supported by The Hormel Foundation and National Institutes of Health grant 1P01CA229112-01A1.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eApalla Z, Nashan D, Weller RB, Castellsagu\u0026eacute; X. Skin cancer: epidemiology, disease burden, pathophysiology, diagnosis, and therapeutic approaches. Dermatology and therapy 2017;7:5\u0026ndash;19\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLeiter U, Keim U, Garbe C. Epidemiology of skin cancer: update 2019. Sunlight, vitamin D and skin cancer 2020:123\u0026thinsp;\u0026ndash;\u0026thinsp;39\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNarayanan DL, Saladi RN, Fox JL. Ultraviolet radiation and skin cancer. International journal of dermatology 2010;49:978\u0026ndash;86\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWei M, He X, Liu N, Deng H. Role of reactive oxygen species in ultraviolet-induced photodamage of the skin. Cell division 2024;19:1\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBailey P, Ridgway RA, Cammareri P, Treanor-Taylor M, Bailey U-M, Schoenherr C, \u003cem\u003eet al.\u003c/em\u003e Driver gene combinations dictate cutaneous squamous cell carcinoma disease continuum progression. Nature Communications 2023;14:5211\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHosseini TM, Park SJ, Guo T. The mutational and microenvironmental landscape of cutaneous squamous cell carcinoma: a review. Cancers 2024;16:2904\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Z, Lu F, Zhou F, Song D, Chang L, Liu W, \u003cem\u003eet al.\u003c/em\u003e From actinic keratosis to cutaneous squamous cell carcinoma: the key pathogenesis and treatments. Frontiers in Immunology 2025;16:1518633\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePickering CR, Zhou JH, Lee JJ, Drummond JA, Peng SA, Saade RE, \u003cem\u003eet al.\u003c/em\u003e Mutational landscape of aggressive cutaneous squamous cell carcinoma. Clinical cancer research 2014;20:6582\u0026ndash;92\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang NJ, Sanborn Z, Arnett KL, Bayston LJ, Liao W, Proby CM, \u003cem\u003eet al.\u003c/em\u003e Loss-of-function mutations in Notch receptors in cutaneous and lung squamous cell carcinoma. Proceedings of the National Academy of Sciences 2011;108:17761-6\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFlieswasser T, Van den Eynde A, Van Audenaerde J, De Waele J, Lardon F, Riether C, \u003cem\u003eet al.\u003c/em\u003e The CD70-CD27 axis in oncology: the new kids on the block. Journal of experimental \u0026amp; clinical cancer research 2022;41:12\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumar S, Mahendiran S, Nair RS, Vyas H, Singh SK, Srivastava P, \u003cem\u003eet al.\u003c/em\u003e A mechanistic, functional, and clinical perspective on targeting CD70 in cancer. Cancer Letters 2025;611:217428\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eO\u0026rsquo;Neill RE, Du W, Mohammadpour H, Alqassim E, Qiu J, Chen G, \u003cem\u003eet al.\u003c/em\u003e T cell\u0026ndash;derived CD70 delivers an immune checkpoint function in inflammatory T cell responses. The Journal of Immunology 2017;199:3700\u0026ndash;10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSam I, Ben Hamouda N, Alkatrib M, Gonnin C, Siska PJ, Oudard S, \u003cem\u003eet al.\u003c/em\u003e The CD70\u0026ndash;CD27 Axis in Cancer Immunotherapy: Predictive Biomarker and Therapeutic Target. Clinical Cancer Research 2025:OF1-OF10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAl Sayed MF, Ruckstuhl CA, Hilmenyuk T, Claus C, Bourquin J-P, Bornhauser BC, \u003cem\u003eet al.\u003c/em\u003e CD70 reverse signaling enhances NK cell function and immunosurveillance in CD27-expressing B-cell malignancies. Blood, The Journal of the American Society of Hematology 2017;130:297\u0026ndash;309\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNilsson MB, Yang Y, Heeke S, Patel SA, Poteete A, Udagawa H, \u003cem\u003eet al.\u003c/em\u003e CD70 is a therapeutic target upregulated in EMT-associated EGFR tyrosine kinase inhibitor resistance. Cancer Cell 2023;41:340\u0026ndash;55. e6\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReinhardt C, Ochsenbein AF. Immune checkpoints regulate acute myeloid leukemia stem cells. Leukemia 2025:1\u0026ndash;17\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWolf K, Schulz C, Riegger G, Pfeifer M. Tumour necrosis factor-α induced CD70 and interleukin‐7R mRNA expression in BEAS‐2B cells. European Respiratory Journal 2002;20:369\u0026ndash;75\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIzawa K, Martin E, Soudais C, Bruneau J, Boutboul D, Rodriguez R, \u003cem\u003eet al.\u003c/em\u003e Inherited CD70 deficiency in humans reveals a critical role for the CD70\u0026ndash;CD27 pathway in immunity to Epstein-Barr virus infection. Journal of Experimental Medicine 2017;214:73\u0026ndash;89\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Q, Xu M. EBV-induced T-cell responses in EBV-specific and nonspecific cancers. Frontiers in immunology 2023;14:1250946\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKitajima S, Lee KL, Fujioka M, Sun W, You J, Chia GS, \u003cem\u003eet al.\u003c/em\u003e Hypoxia-inducible factor-2 alpha up-regulates CD70 under hypoxia and enhances anchorage-independent growth and aggressiveness in cancer cells. Oncotarget 2018;9:19123\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRuf M, Mittmann C, Nowicka AM, Hartmann A, Hermanns T, Poyet C, \u003cem\u003eet al.\u003c/em\u003e pVHL/HIF-regulated CD70 expression is associated with infiltration of CD27\u0026thinsp;+\u0026thinsp;lymphocytes and increased serum levels of soluble CD27 in clear cell renal cell carcinoma. Clinical Cancer Research 2015;21:889\u0026ndash;98\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSinitsky M, Sinitskaya A, Shishkova D, Tupikin A, Asanov M, Khutornaya M, \u003cem\u003eet al.\u003c/em\u003e Identification of key genes and pathways in genotoxic stress induced endothelial dysfunction: results of whole transcriptome sequencing. Biomedicines 2022;10:2067\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDesai SA, Patel VP, Bhosle KP, Nagare SD, Thombare KC. The tumor microenvironment: shaping cancer progression and treatment response. Journal of Chemotherapy 2025;37:15\u0026ndash;44\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThiruvalluvan M, Bhowmick NA. Stromal\u0026ndash;Epithelial Interactions in Cancer Progression and Therapy Response. Volume 15: MDPI; 2023. p 3014.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWilczyński B, Dąbrowska A, Kulbacka J, Baczyńska D. Chemoresistance and the tumor microenvironment: the critical role of cell\u0026ndash;cell communication. Cell Communication and Signaling 2024;22:486\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhan AU, Wang Q, Roh E, Dickinson SE, Wondrak GT, Curiel-Lewandowski C, \u003cem\u003eet al.\u003c/em\u003e TOPK Drives IL19-Mediated Crosstalk Between Cancer Cells and Fibroblasts to Promote Solar UV-Induced Skin Damage and Carcinogenesis. Cancers 2025;17:2067\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMao X, Xu J, Wang W, Liang C, Hua J, Liu J, \u003cem\u003eet al.\u003c/em\u003e Crosstalk between cancer-associated fibroblasts and immune cells in the tumor microenvironment: new findings and future perspectives. Molecular cancer 2021;20:131\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSahai E, Astsaturov I, Cukierman E, DeNardo DG, Egeblad M, Evans RM, \u003cem\u003eet al.\u003c/em\u003e A framework for advancing our understanding of cancer-associated fibroblasts. Nature Reviews Cancer 2020;20:174\u0026ndash;86\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu X, Tao P, Zhou Q, Li J, Yu Z, Wang X, \u003cem\u003eet al.\u003c/em\u003e IL-6 secreted by cancer-associated fibroblasts promotes epithelial-mesenchymal transition and metastasis of gastric cancer via JAK2/STAT3 signaling pathway. Oncotarget 2017;8:20741\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEinspahr JG, Curiel-Lewandrowski C, Calvert VS, Stratton SP, Alberts DS, Warneke J, \u003cem\u003eet al.\u003c/em\u003e Protein activation mapping of human sun-protected epidermis after an acute dose of erythemic solar simulated light. NPJ precision oncology 2017;1:34\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWolf DM, Yau C, Wulfkuhle J, Brown-Swigart L, Gallagher RI, Lee PRE, \u003cem\u003eet al.\u003c/em\u003e Redefining breast cancer subtypes to guide treatment prioritization and maximize response: Predictive biomarkers across 10 cancer therapies. Cancer cell 2022;40:609\u0026thinsp;\u0026ndash;\u0026thinsp;23. e6\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDickinson SE, Vaishampayan P, Jandova J, Ai YE, Kirschnerova V, Zhang T, \u003cem\u003eet al.\u003c/em\u003e Inhibition of UV-Induced Stress Signaling and Inflammatory Responses in SKH-1 Mouse Skin by Topical Small-Molecule PD-L1 Blockade. JID Innovations 2024;4:100255\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Q, Zhang T, Chang X, Lim DY, Wang K, Bai R, \u003cem\u003eet al.\u003c/em\u003e ARC is a critical protector against inflammatory bowel disease (IBD) and IBD-associated colorectal tumorigenesis. Cancer research 2020;80:4158\u0026ndash;71\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBindea G, Mlecnik B, Tosolini M, Kirilovsky A, Waldner M, Obenauf AC, \u003cem\u003eet al.\u003c/em\u003e Spatiotemporal dynamics of intratumoral immune cells reveal the immune landscape in human cancer. Immunity 2013;39:782\u0026ndash;95\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Z, Li M, Jiang Z, Wang X. A comprehensive immunologic portrait of triple-negative breast cancer. Translational oncology 2018;11:311\u0026ndash;29\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, \u003cem\u003eet al.\u003c/em\u003e NF-κB in biology and targeted therapy: new insights and translational implications. Signal transduction and targeted therapy 2024;9:53\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoberti A, Chaffey LE, Greaves DR. NF-κB signaling and inflammation\u0026mdash;drug repurposing to treat inflammatory disorders? Biology 2022;11:372\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu H, Lin L, Zhang Z, Zhang H, Hu H. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Signal transduction and targeted therapy 2020;5:209\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang X, Yang T, Yu D, Xiong H, Zhang S. Current insights and future perspectives of ultraviolet radiation (UV) exposure: Friends and foes to the skin and beyond the skin. Environment international 2024;185:108535\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao G, Zhang T, Wang Q, Reddy K, Chen H, Yao K, \u003cem\u003eet al.\u003c/em\u003e ADA-07 suppresses solar ultraviolet\u0026ndash;induced skin carcinogenesis by directly inhibiting TOPK. Molecular cancer therapeutics 2017;16:1843\u0026ndash;54\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoh E, Kim J-E, Zhang T, Shin SH, Kim B-G, Li J, \u003cem\u003eet al.\u003c/em\u003e Orobol, 3\u0026prime;-hydroxy-genistein, suppresses the development and regrowth of cutaneous SCC. Biochemical Pharmacology 2023;209:115415\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLibermann TA, Baltimore D. Activation of interleukin-6 gene expression through the NF-κB transcription factor. Molecular and cellular biology 1990;10:2327\u0026ndash;34\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMatsusaka T, Fujikawa K, Nishio Y, Mukaida N, Matsushima K, Kishimoto T, \u003cem\u003eet al.\u003c/em\u003e Transcription factors NF-IL6 and NF-kappa B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proceedings of the National Academy of Sciences 1993;90:10193-7\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThompson WL, Van Eldik LJ. Inflammatory cytokines stimulate the chemokines CCL2/MCP-1 and CCL7/MCP-7 through NFκB and MAPK dependent pathways in rat astrocytes. Brain research 2009;1287:47\u0026ndash;57\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao Y, Fu Y, Hu J, Liu Y, Yin X. The effect of tissue factor pathway inhibitor on the expression of monocyte chemotactic protein-3 and IκB-α stimulated by tumour necrosis factor-α in cultured vascular smooth muscle cells. Archives of Cardiovascular Diseases 2013;106:4\u0026ndash;11\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBiswas AK, Mitchell DL, Johnson DG. E2F1 responds to ultraviolet radiation by directly stimulating DNA repair and suppressing carcinogenesis. Cancer research 2014;74:3369\u0026ndash;77\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh RK. Regulation of E2F1 in Keratinocytes During UV-Damage and Differentiation: The University of Western Ontario (Canada); 2016.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKent LN, Leone G. The broken cycle: E2F dysfunction in cancer. Nature Reviews Cancer 2019;19:326\u0026ndash;38\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamazaki K, Hasegawa M, Ohoka I, Hanami K, Asoh A, Nagao T, \u003cem\u003eet al.\u003c/em\u003e Increased E2F-1 expression via tumour cell proliferation and decreased apoptosis are correlated with adverse prognosis in patients with squamous cell carcinoma of the oesophagus. Journal of clinical pathology 2005;58:904\u0026ndash;10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJacobs J, Deschoolmeester V, Rolfo C, Zwaenepoel K, Van den Bossche J, Deben C, \u003cem\u003eet al.\u003c/em\u003e Preclinical data on the combination of cisplatin and anti-CD70 therapy in non-small cell lung cancer as an excellent match in the era of combination therapy. Oncotarget 2017;8:74058\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePich C, Sarrabayrouse G, Teiti I, Mariam\u0026eacute; B, Rochaix P, Lamant L, \u003cem\u003eet al.\u003c/em\u003e Melanoma-expressed CD70 is involved in invasion and metastasis. British journal of cancer 2016;114:63\u0026ndash;70\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePich C, Teiti I, Sarrabayrouse G, Gallardo F, Gence R, Tilkin-Mariam\u0026eacute; A-F. Melanoma expressed-CD70 is regulated by RhoA and MAPK pathways without affecting vemurafenib treatment activity. PLoS One 2016;11:e0148095\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu R, Chen J, Wang G, Han L. CD70 as a target in cancer immunotherapy: advances, challenges, and future directions. Frontiers in Oncology 2025;15:1609840\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArai KY, Ono M, Kudo C, Fujioka A, Okamura R, Nomura Y, \u003cem\u003eet al.\u003c/em\u003e IL-1β stimulates activin βA mRNA expression in human skin fibroblasts through the MAPK pathways, the nuclear factor-κB pathway, and prostaglandin E2. Endocrinology 2011;152:3779-90\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGelfo V, Romaniello D, Mazzeschi M, Sgarzi M, Grilli G, Morselli A, \u003cem\u003eet al.\u003c/em\u003e Roles of IL-1 in cancer: from tumor progression to resistance to targeted therapies. International journal of molecular sciences 2020;21:6009\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKiss M, Vande Walle L, Saavedra PH, Lebegge E, Van Damme H, Murgaski A, \u003cem\u003eet al.\u003c/em\u003e IL1β promotes immune suppression in the tumor microenvironment independent of the inflammasome and gasdermin D. Cancer immunology research 2021;9:309\u0026thinsp;\u0026ndash;\u0026thinsp;23\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTulotta C, Lefley DV, Moore CK, Amariutei AE, Spicer-Hadlington AR, Quayle LA, \u003cem\u003eet al.\u003c/em\u003e IL-1B drives opposing responses in primary tumours and bone metastases; harnessing combination therapies to improve outcome in breast cancer. NPJ Breast Cancer 2021;7:95\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang J, Fu L, Yasuda-Yoshihara N, Yonemura A, Wei F, Bu L, \u003cem\u003eet al.\u003c/em\u003e IL-1β derived from mixed-polarized macrophages activates fibroblasts and synergistically forms a cancer-promoting microenvironment. Gastric Cancer 2023;26:187\u0026ndash;202\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJacobs J, Deschoolmeester V, Zwaenepoel K, Flieswasser T, Deben C, Van den Bossche J, \u003cem\u003eet al.\u003c/em\u003e Unveiling a CD70-positive subset of cancer-associated fibroblasts marked by pro-migratory activity and thriving regulatory T cell accumulation. Oncoimmunology 2018;7:e1440167\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInoue S, Ito H, Tsunoda T, Murakami H, Ebi M, Ogasawara N, \u003cem\u003eet al.\u003c/em\u003e CD70 expression in tumor-associated fibroblasts predicts worse survival in colorectal cancer patients. Virchows Archiv 2019;475:425\u0026ndash;34\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKomura M, Wang C, Ito S, Kato S, Ueki A, Ebi M, \u003cem\u003eet al.\u003c/em\u003e Simultaneous expression of CD70 and POSTN in cancer-associated fibroblasts predicts worse survival of colorectal cancer patients. International Journal of Molecular Sciences 2024;25:2537\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchafer ZT, Brugge JS. IL-6 involvement in epithelial cancers. The Journal of clinical investigation 2007;117:3660\u0026ndash;3\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Cai Y, Liu L, Wu Y, Xiong X. Crucial biological functions of CCL7 in cancer. PeerJ 2018;6:e4928\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee YS, Cho YB. CCL7 signaling in the tumor microenvironment. Tumor Microenvironment: The Role of Chemokines\u0026ndash;Part A 2020:33\u0026ndash;43\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR\u0026eacute;b\u0026eacute; C, Ghiringhelli F. Interleukin-1β and cancer. Cancers 2020;12:1791\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHirano T. IL-6 in inflammation, autoimmunity and cancer. International immunology 2021;33:127\u0026ndash;48\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"CD70, non-melanoma skin cancer, UV-induced DNA damage, Inflammatory signaling, E2F1, keratinocytes, fibroblasts","lastPublishedDoi":"10.21203/rs.3.rs-8206807/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8206807/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eChronic ultraviolet (UV) exposure drives the development of non-melanoma skin cancers (NMSCs), particularly cutaneous squamous cell carcinoma (cSCC), through persistent DNA damage and inflammation. However, the molecular mediators that link genotoxic stress to tumor-promoting signaling and stromal activation remain poorly defined. Here, we identify CD70, a TNF superfamily member, as a UV- and DNA damage\u0026ndash;inducible regulator that coordinates epithelial and stromal responses to promote skin carcinogenesis. Integrative analyses of transcriptomic (GTEx, GSE2503, GSE42677), proteomic (RPPA), and immunostaining datasets revealed marked upregulation of CD70 in sun-exposed skin, actinic keratoses, and cSCC lesions. Functionally, CD70 silencing suppressed cSCC proliferation and xenograft growth, whereas solar UV or DMBA exposure induced CD70 expression. Mechanistically, E2F1 directly bound and activated the CD70 promoter, establishing a transcriptional axis linking the DNA damage response to CD70 upregulation. CD70 depletion disrupted cytokine\u0026ndash;receptor and MAPK/NF-κB signaling and altered inflammatory gene expression in UV-irradiated keratinocytes. In dermal fibroblasts, TGF-β\u0026ndash;induced CD70 enhanced NF-κB activation and secretion of IL-6 and MCP3, thereby reinforcing paracrine inflammatory loops that supported cSCC spheroid expansion and tumor progression. CD70 knockdown in fibroblasts abrogated these effects and reduced tumor proliferation and cytokine expression in vivo. Collectively, our findings identify CD70 as a stress-inducible signaling hub that links DNA damage, inflammation, and tumor\u0026ndash;stromal communication in skin carcinogenesis. Targeting CD70 may disrupt this feed-forward inflammatory circuit and provide a therapeutic strategy for inflammation-driven skin cancer.\u003c/p\u003e","manuscriptTitle":"CD70 drives cSCC growth by linking DNA damage response, inflammation, and tumor–stromal signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-12 18:25:53","doi":"10.21203/rs.3.rs-8206807/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-02-02T15:47:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-12-30T08:11:13+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-12-14T12:18:31+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-12-11T12:43:32+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-12-08T12:07:04+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-12-06T16:46:59+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-26T13:54:44+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-25T21:36:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2025-11-25T21:36:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"19488e6c-fbf0-40ef-8cee-6054967263d6","owner":[],"postedDate":"December 12th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":59210167,"name":"Biological sciences/Cancer/Skin cancer/Squamous cell carcinoma"},{"id":59210168,"name":"Biological sciences/Immunology/Cytokines/Chemokines"},{"id":59210169,"name":"Biological sciences/Cell biology/Cell growth"},{"id":59210170,"name":"Biological sciences/Molecular biology/Transcription/Transcriptional regulatory elements"}],"tags":[],"updatedAt":"2026-04-17T01:10:39+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-12 18:25:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8206807","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8206807","identity":"rs-8206807","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}