Effect of neutral protease overproduction in Bacillus subtilis 168 via site-directed mutation against Meloidogyne incognita infecting eggplant under greenhouse conditions

preprint OA: closed
Full text JSON View at publisher

Abstract

AbstractRoot-knot nematodes (RKN),Meloidogyne incognita, caused significant problems for many important crops. Measuring control with low environmental impact has been required since EU legislation revised pesticide laws for crops. Bacteria-based control methods reduce pollutants and stabilise ecological changes, which makes them promising for controlling plant pathogens. In this study, the derivative ofBacillus subtilis168, termed Bs118, was generated by replacing the native promoter of the extracellular neutral metalloprotease-encoding gene (nprE) with a constitutive promoter of therepUgene responsible for replication of theStaphylococcus aureusplasmid pUB110. As a result, protease production increased to twice that of the wild type. Results revealed that the overproduction of neutral metalloprotease conferred Bs118 high nematocidal activity by inducing 98% mortality in theM. incognitaJ2 in vitro study. Bs118 stated its priority in affecting root-knot nematode reproduction under greenhouse conditions. The soil drench treatment was more promising than root dipping in controllingM. incognitacompared with the untreated control treatment. The same trend happened in the eggplant growth parameters, where Bs118 improved plant health more than Bs168. In conclusion, site-directed mutation via homologous recombination to replace the native promoter with another constitutive one is a promising approach to constructing modified strains with higher protease production that can be employed as an efficient biocontrol agent against root-knot nematodes in addition to the positive impacts on plant growth.
Full text 149,704 characters · extracted from preprint-html · click to expand
Effect of neutral protease overproduction in Bacillus subtilis 168 via site-directed mutation against Meloidogyne incognita infecting eggplant under greenhouse conditions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Article Effect of neutral protease overproduction in Bacillus subtilis 168 via site-directed mutation against Meloidogyne incognita infecting eggplant under greenhouse conditions Gaziea M. Soliman, Ghada M. El-Sayed, Shaimaa A. Nour, Usama S. Elkelany, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2592246/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Root-knot nematodes (RKN), Meloidogyne incognita , caused significant problems for many important crops. Measuring control with low environmental impact has been required since EU legislation revised pesticide laws for crops. Bacteria-based control methods reduce pollutants and stabilise ecological changes, which makes them promising for controlling plant pathogens. In this study, the derivative of Bacillus subtilis 168, termed Bs118, was generated by replacing the native promoter of the extracellular neutral metalloprotease-encoding gene ( npr E) with a constitutive promoter of the repU gene responsible for replication of the Staphylococcus aureus plasmid pUB110. As a result, protease production increased to twice that of the wild type. Results revealed that the overproduction of neutral metalloprotease conferred Bs118 high nematocidal activity by inducing 98% mortality in the M. incognita J2 in vitro study. Bs118 stated its priority in affecting root-knot nematode reproduction under greenhouse conditions. The soil drench treatment was more promising than root dipping in controlling M. incognita compared with the untreated control treatment. The same trend happened in the eggplant growth parameters, where Bs118 improved plant health more than Bs168. In conclusion, site-directed mutation via homologous recombination to replace the native promoter with another constitutive one is a promising approach to constructing modified strains with higher protease production that can be employed as an efficient biocontrol agent against root-knot nematodes in addition to the positive impacts on plant growth. Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Genetics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction In Egypt, annual losses in crop production caused by root-knot nematodes, Meloidogyne spp., are considered the major limiting factor in crop production in the tropics ( 1 ) . The mode of nematode attack against plant parts and their habitat in the soil make their management more difficult than that of other pests. Meloidogyne incognita is considered one of the most potent plant parasitic nematodes affecting Egyptian ‎vegetables ( 2 ) . The application and extensive use of chemical nematicide for nematode management caused environmental and health concerns, so alternative strategies have been urged to be used ( 3 ) . Biological agents have been investigated to control plant-parasitic nematodes. Bacterial and fungal infections of nematodes in the soil create the possibility of employing soil microorganisms to manage them ( 4 , 5 ) . Bacteria are numerically the most prevalent organism in soil; for example, members of the genera Pseudomonas and Bacillus have demonstrated a good potential for nematode biological control ( 6 , 7 ) . Over the past 20 years, extensive research has been done to evaluate their ability to suppress plant-parasitic nematodes. Several studies have revealed that bacteria are widespread and have a wide range of activity mechanisms. These bacteria influence nematodes in various ways, such as by producing antibiotics, toxins, or enzymes; interfering with plant–nematode recognition; causing systemic plant resistance; and encouraging plant health ( 8 , 9 ) . Different Bacillus spp . and Pseudomonas spp., which are the most common prevalent populations in the rhizosphere, have potential efficacy in stimulating induced systemic resistance in plants, which is attributed to a variety of factors, including fortifying cell wall strength through the accumulation of newly produced phenolic compounds ( 10 ) . In addition, to facilitate the synthesis of defence chemicals against the challenge pathogen, they promote the accumulation of pathogenesis-related proteins like chitinase and peroxidase, as well as the formation of phytoalexin and other secondary metabolites ( 11 , 12 ) . The cause of the nematocidal effect in B. subtilis is its ability to create a variety of poisonous metabolites, including benzene acetaldehyde, 2-nonanone, decanal, and 2-undecanone; dimethyl di-sulfide (DDS) ( 13 , 14 ) , enzyme production, particularly chitinase and protease enzymes ( 15 – 17 ) ; antibiotic secretion ( 18 ) ; exotic abilities for promoting growth and stimulating antioxidative potential; protection against various pathogens; and stress ( 19 ) . Therefore, it seems to be an ideal agent for relieving nematode infections in plants. Here is why this study manipulates B. subtilis as a bioagent for controlling the root-knot nematode, M. incognita . Different types of structural proteins are present in nematodes, and their proportions alter over the course of their life cycles. In contrast to the mobile stage, which largely includes an exterior cuticle layer made up of glycoproteins and lipids, the egg stage contains a chitin/protein complex ( 20 ) . Proteases, especially those secreted by Bacillus species, are critical nematicides ( 21 ) . Many molecular genetic techniques have been reported to improve the nematocidal effect of bacterial species. Microbial virulence determinants, for example, are bacterial proteases whose corresponding genes were cloned and expressed in another organism to maximise product ( 22 ) . Other genetic approaches are directed mutagenesis, in which a gene encoding a putative virulence determinant responsible for a certain pathogenic trait is replaced or disrupted for the construction of a mutant strain, or random mutagenesis that has been demonstrated by various current research projects; for example, Tn5 transposon-mediated mutagenesis was utilised by Wechter et al. ( 23 , 24 ) to construct a library of mutants and generate five BG33R mutants that have no wild-type ovicide activity of Pseudomonas sp. BG33R. Another approach is protoplast fusion, this method was manipulated by Mohamed et al ( 2 ) . They successed in formation of ten stable bacterial fusants that gave higher nematocidal effect against M. incognita compared with parental strains B. cereus and B. thuringiensis subsp tenebrionis . Here, in this study, the aim is to overproduce protease enzyme from B. subtilis subsp. subtilis strain 168 (Bs168) by site directed mutagenesis, as well as to study and compare the effect of modified strain and wild-typeagainst M. incognita in laboratory and greenhouse trials. Methods Bacterial strains, plasmids, and cloning The bacterial strains and plasmids used in this research are E. coli DH5α, used as a host for cloning and plasmid preparation, and Bacillus subtilis subsp. subtilis strain 168, accession no. AL009126.3 (Bs168), used as a source for genes isolation and an expression host. Genetic characteristics of bacterial strains, in terms of purchased and constructed plasmids containing genetic fragments, are listed in Table 1. The structures of plasmids are shown in fig. 1. Media, growth conditions, and preparation of culture supernatants Bacterial strains were grown in Luria-Bertani (LB) medium ( 25 ) for 18 hours at 37 °C and 150 rpm in a shaking incubator (Thermoscientific, UK) supplemented with ampicillin and neomycin (50µg/ml and 20µg/ml, respectively; Sigma, St. Louis, MO). Protease production was checked on agar plates containing 1% (v/v) skim milk. Centrifugation for 20 minutes at 10,000 rpm at 4°C was employed to obtain culture supernatant, which was then used immediately to determine proteolytic activity. Also, preparation of cell-free culture supernatants by microfiltration (membrane filter, cellulose acetate/nitrate, pore size, 0.22 m) was used to measure the proteolytic activity simultaneously to ensure the proteolytic activity was due to cell-free, i.e., secreted proteases (26) . Assay of protease activity Proteolytic activity on casein was determined using a slightly modified method described by Han and Damodaran (27) . The reaction mixture was composed of 1 mL of supernatant as a source of enzyme, and 1 mL of 1% casein solution in a 0.1 M Tris–HCl buffer (pH 8.9). Proteolysis was carried out at 37°C for 30 min and stopped by the addition of 2.0 ml of 15% w/v trichloroacetic acid (TCA). Also, TCA was used to inhibit the enzyme before incubation with casein solution and was considered a blank reaction. The sample was incubated on ice for 10 minutes and then centrifuged at 12000 rpm for 15 minutes. According to Lowry et al (28) , the reaction mixture was centrifuged for 10 minutes at 10,000 rpm at 4°C, and the protein released in the clear supernatant was measured. A unit of protease activity has been defined as the amount of enzyme necessary to release 1 μg of tyrosine per minute under test conditions. Protease overproduction using the site-direct mutation protocol Primer design During the construction of pGEM-derived pMG vectors dedicated to inducing the genetic exchange by homologous recombination in Bs168, a specific cassette was designated to replace the metallo-neural protease promoter (P nprE ) for Bs168. The cassette is made up of yla A partial sequences, tag="BSU_14710," and npr E partial sequences, encoding extracellular neutral metalloprotease locus_tag="BSU_14700."These two partial genes are upstream and downstream from the promoter that regulates the expression of the protease-encoding gene. Two primer pairs were designed for each partial gene sequence with artificial restriction sites. The sense primer (ylaA fwd) and anti-sense primer (ylaA rev) containing the two artificial restriction sites, SalI (GTCGAC) and SacI (GAGCTC), were designed to amplify partial fragment from yla A, while amplification of the npr E gene was achieved by nprE fwd and nprE rev primers containing the two artificial restriction sites, NcoI (CCATGG) and SphI (GCATGC), respectively. The sequence of primers is shown in Table 2. DNA manipulation and PCR amplification Genomic DNA isolation was performed using the Wizard® Genomic DNA Purification Kit from Promega (Madison, WI, U.S.A.). The PCR amplification steps were performed as follows: denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 seconds, and hybridization at 50 °C for 30 seconds for both genes, ylaA and nprE. An elongation step was at 72 °C for 45 sec, and final elongation steps were at 72 °C for 10 min. Preparation of competent cells Competent cells from E. coli DH5 were generated by following the method modified by Yang et al ( 29 ) . While competent B. subtilis 168 cells were briefly prepared, a ten-fold dilution of an overnight LB culture was performed by adding new LB medium. When the cell density reached 0.7 at 600 nm, arabinose was added at a final concentration of 0.6% w/v, and the culture was agitated for 1 hour. The culture was then ready to be altered. A total of 5 µL of the generated vector was mixed with 100 µL of competent cells and incubated at 37 oC, 180 rpm shaking conditions ( 30 ) . Bacterial strains Description Source Bacillus subtilis subsp. subtilis strain 168 trpC 2 , sfp 0 Lab stock E. coli DH5α F – endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG purB20 φ80d lacZ ΔM15 Δ( lacZYA-argF ) U169, hsdR17( r K – m K + ), λ – Lab stock Plasmids Description Source pGEM-T Easy Cloning vector, Ap r Promega pBG106 εpbp, P repU -neo, εfenF (Leclère et al . 2005) pMG112 1340 bp SalI and NotI p repU-neo fragment from pBG106 cloned into pGEM-T Easy Lab stock pMG115 576 bp ylaA gene fragment of B. subtilis 168 cloned into pGEM-T Easy This study pMG116 658 bp nprE gene fragment of B. subtilis 168 cloned into pGEM-T Easy This study pMG117 ylaA gene fragment SalI and SacI double digested and inserted into pMG112 This study pMG118 nprE partial gene fragment Nco I and SphI double digested and inserted into pMG117 This study Table 1. Bacterial strains and plasmids used in this study. Name Primer sequence ( 5'-3') Product size (bp) ylaA fwd GTCGAC TTATACGTTCGACCTTGCTG 576 ylaA rev GAGCTC TAAAGTGTTTCATCCGTAGG nprE fwd CCATGG TATCAATCAGCCTGCCAGGT 658 nprE rev GCATGC AACAGTTGCGCCCTTTAGC Table 2. Primers sequences for isolation of partial fragments from ylaA , and nprE Construction of the modular cassette This protocol was performed to replace the native P nprE by a constitutive promoter p repU in several steps by designing plasmid construction to include the two partial upstream and downstream genes, yla A and npr E, respectively, of P nprE in Bs168 and the new promoter, p repU and marker gene of neomycin, neo . The expected PCR products for the yla A and npr E gene fragments were separated on a 1.5% agarose gel, then purified using a gel purification kit (Thermo Scientific, USA), then cloned separately in pGEM-T Easy vector, and the ligation protocol was performed as described in the pGEM®-T Easy Vector Systems Technical Manual from Promega Corp. (Madison, WI, USA). The vector pBG106 (fig. 1b), which contained cassettes pbp, P repU - neo , fenF31, and pGEM, was double digested by SalI and NotI to obtain the P repU - neo fragment, which was then inserted into pGEM-T Easy (fig. 1a), yielding pMG112 (fig. 2). Double digestion of yla A and pGEM by SalI and SacI , followed by insertion, was implemented to obtain pMG115 (fig. 3a). Along the same lines, the pMG116 vector was generated by the insertion of the npr E gene fragment into pGEM-T after double digestion by NcoI and SphI (Fig. 3b). Then, vectors pMG115 and pMG112 were double digested via SalI and SacI and ligated, and a fragment of yla A was inserted in the corresponding sites to form pMG117 (Fig. 4). Finally, pMG118 was constructed by double digestion of both pMG116 and pMG117 plasmids with Nco1 and Sph1 enzymes and inserting the released npr E fragment into pMG117 (Fig. 5). The recombinant vectors were transformed into competent cells of E. coli DH5α. Following Sambrook and Russell (32) standard procedures for restriction endonuclease digestions and agarose gel electrophoresis, Plasmids from transformant colonies were purified using the Mini Plasmid Kit (Thermo Scientific, USA). The vectors, pMG118, were then transformed into comptent Bs168 cells. Transformant cells were plated on LB agar supplemented with neomycin and incubated at 37°C to select the recombinants. Trials of nematode biocontrol Nematode inoculum. Root-knot nematodes, initially isolated from the infested fields in Giza governorate and maintained on tomato roots, were used as inoculum in the experiment. The experiment was implemented in the greenhouse belonged to the Plant Pathology Department, National Research Centre, Egypt. By light microscopic investigations of a perennial pattern, separation, and identification of females as Meloidogyne incognita were implemented (33) . The infected roots were cut and incubated in tap water. After three days, M. incognita juveniles (J2s) were extracted according to method reported by Hussey and Barker (34) . Preparation of bacterial suspension. Single colonies of bacterial strains were allowed to grow on nutrient agar plates for Bs168 and on nutrient agar supplemented with neomycin in the case of the modified strain at 37 o C for 18 h. Vegetative cells of each stain were suspended in 10 ml of sterile distilled water in a 50 ml sterile falcon tube to get a concentration of approximately 1x10 6 CFU/ml (35) . Bioassay test The nematocidal efficacy of both the wild-type (Bs168) and the modified strain (Bs118) was assessed by mixing 1 mL of nematode suspension (approximately 100 ± 3 of M. incognita J2 with 2 mL of bacterial suspension containing 1x10 6 CFU/mL in test tubes separately. Test tubes containing only 2 mL of distilled water and 1 mL of nematode suspension were assigned as control. All treatments were replicated five times and incubated at 30 o C. Dead juveniles were counted after 24 and 48 h of bacterial treatment. At the end of incubation, the nematode suspensions in all treatments were washed and resuspended in 2 mL distilled water for another 24 h, then the average percentage of nematode recoveries was determined. The percentage of mortality was calculated according to the equation: mortality% = [C1-C2/C1] x 100, where C1 is the number of live nematode larvae in the control treatment and C2 is the number of live nematode larvae in the other treatments. Net mortality was calculated according to % mortality after 48 h of bacterial treatment minus nematode recovery in distilled water (1,16) . The greenhouse experiments A pot experiment was conducted in the experimental greenhouse of the Plant Pathology Department, National Research Centre, Giza, Egypt. The plastic pots (20 cm in diameter) were filled with 2 kg of sterilised sandy and clay soil (1:1 w/w). Instantly, three weeks old eggplant seedlings of Solanum melongena (cv. Alabaster) were transplanted, two seedlings per pot. One week later, seedlings were thinned to one seedling per pot. Each pot was inoculated with 2000 M. incognita J2, followed by five mL of the bacterial suspension (1x10 6 CFU/mL) of each strain, besides the control treatment. Simultaneously, all treatments were replicated five times. The pots were then watered and arranged in a completely random design on the bench in the greenhouse at a temperature of 27–32 ºC (1,16) . Recorded data Estimation of nematodes parameters Sixty days after nematode inoculation, eggplants in the five replicates were gently uprooted, and the roots were washed and cleaned from the adhering soil particles. J2 was extracted from 200 g of soil using the sieving and decanting technique ( 36 ) and examined under a light microscope with a Hawksley counting slide. The number of galls and egg masses was determined for the whole root system. For each parameter, the percentage of nematode reduction was calculated and compared with the control. Measurement of eggplant growth parameters Plant parameters such as length of shoots (cm), fresh weights of shoots and roots, and dry weight of shoots (g) of eggplant were measured. The percentage of plant growth increase for each criterion was calculated and compared to the untreated control (2) . Measurement of Biochemical parameters in eggplants Two months after eggplant treatment by bacterial cultures, one gram of collected leaves from each treatment was used to demonstrate biochemical parameters represented by the assessment of polyphenol oxidase, PPO (units. g-1 fresh weight of leaves) following the method of Vamos-Vigyazo and Nadudvari-Marlcus 37 , β-1,3-glucanase (GLU) (units. g -1 fresh weight of leaves) using the method of Gupta et al ( 38 ) , chitinase ( 39 ) (units. g-1 fresh weight of leaves), and total phenolic compounds (U/mg) following the assay of Saikia et al ( 40 ) . Enzymes extraction was accomplished according to McCord and Fridovich ( 41 ) . Protein content was determined according to Lowry et al ( 28 ) . Bovine serum albumin was used as a standard. Ethical approval The eggplant seedlings identified by the Agricultural Research Center, were supplied from Egyptian nurseries and agriculture. All the methods and handling of the cultivated eggplants included in experimental research were performed in accordance with relevant guidelines and regulations. Results Protease overproduction using site directed mutation PCR amplification of ylaA and nprE partial sequences The sense primer (ylaA fwd) and anti-sense primer (ylaA rev) succeeded in generating ylaA with a size of 576 bp. Furthermore, the nprE gene was amplified at 658 bp using nprE forward and nprE reverse primers (Fig. 6) . Each of them was cloned separately in pGEM-T Easy to construct pMG115 and pMG116, respectively. The constructed vector pMG112, which included the P repU-neo cassette fragment, received the cloned fragment of ylaA in a vector named pMG116, which was then inserted with the fragment of P repU-neo cassette in a new construct pMG118 (Fig. 5). Taking this into consideration, the direction (5' 3') of P repU-neo cassette and nprE is linear, while that of the ylaA gene fragment is in the opposite direction. After transformation of competent cells of BS168 via pMG118, the positive transformants successfully grew on LB agar media supplemented with neomycin. Homologous recombination between the constructed vector pMG118 and the Bs168 chromosome is represented in Fig. 7. The crossingover between homologous fragments leads to the replacement of p nprE with constitutive P repU-neo that will consecutively enhance and increase protease yield. The modified strain was referred to as Bs118. Estimation of protease activity for wild-typeand modified strain Genetic modification is believed to be an efficient tool to achieve potent modified strains of industrial enzymes, such as protease, for different applications. In this study, site-directed mutations employed the P repU promoter to replace the native extracellular neutral protease promoter to construct the plasmid pMG118 used to transform B. subtilis 168 for protease overproduction. The enzyme activity of wild-type was measured at 43.33 u/ml, while the enzyme activity of the modified strain, Bs118, was 90 u/ml, which was two times more than wild-type (Fig. 8). Nematocidal effect of Bs118 and Bs168 bacterial strain suspensions on M. incognita J2 in vitro test The modified bacterial strain and the wild-typewere examined for their nematocidal properties via the effects of their different biochemical components in vitro. Table 3 shows that Bs168 and the modified strain Bs118 have a significant lethal effect on M. incognita J2 after 24, and 48 hours of exposure compared to the control. Generally, the mortality gradually increased with time, and it was noticed that the highest J2 mortality (98%) after 48 h was obtained by Bs118 treatment, whereas Bs168 recorded an 88.67% mortality as compared with the control. M. incognita J2 did not recover after being washed with distilled water and left for 24 hours, indicating that the death was real. Treatments Nematode mortality After different exposure time* % Net mortality # 24h 48 h Control 0.00 c ** 0.00 c 0.00 c Bs118 81.67 b 88.67 b 88.67 b Bs168 93.33 a 98.00 a 98.00 a Table 3. The effect of Bs118 and Bs168 on M. incognita juveniles mortality under laboratory conditions. *Values are average of five replicates **Means followed by the same letter(s) are not significantly (P≤ 0.05) different according to Duncan’s Multiple Range Test. # % Net mortality = mortality after 48 h minus nematode recovery in distilled water which =zero, Bs118 = modified B. subtilis , Bs168 = wild-typeof B. subtilis Greenhouse experiment In a greenhouse experiment, the effect of the wild-typeBs168 and the modified strain Bs118 on root-knot nematodes M. incognita in infected eggplant was evaluated using soil drench and/or root dipping application methods.The data in Table 4 revealed that the tested Bs168 and Bs118 significantly (P ≤0.05) reduced nematode multiplication, and the modified strain was more effective in decreasing the number of M. incognita J2 in soil, root galls, and egg masses/root systems and reducing nematode infection than the wild-type as compared with the control.The soil drench treatment was more effective than the root dipping treatment in reducing nematode counts in soil and eggplants. In soil drench application, data showed that the modified strain Bs118 resulted in 86.05%, 68.80%, and 79.94% reductions in the number of J2s in soil, galls, and egg-masses numbers, respectively, while Bs168 recorded 40.04%, 42.23%, and 63.41% reductions in the number of J2s, galls, and egg-masses numbers, respectively, compared with the control. Also, the same trend was noticed in root dipping, where the Bs118 achieved a reduction of 61.41%, 62.83%, and 72.35% in the aforementioned parameters, respectively. While the BS168 reduced the same parameters by 21.38 percent, 28.50%, and 61.95 percent, respectively. Treatments No. J 2 in soil R%.** No. galls / root system R%. No. egg-masses / root system R%. Control 276.00 a --- 528.00 a ---- 240.50a --- Soil drenches application Bs118 38.50 e 86.05 164.75 e 68.80 48.25 d 79.94 Bs168 165.50 c 40.04 305.00 c 52.23 88.00 b 63.41 Root dipping application Bs118 106.50 d 61.41 196.25 d 62.83 66.50 c 72.35 Bs168 217.00 b 21.38 377.50 b 28.51 91.50 b 61.95 Table 4. The nematocidal effects of Bs168 and Bs118 strains against M. incognita infecting eggplant #Values are average of five replicates. Different letters within the same column indicate significant differences among treatments according to least significant difference test (P ≤ 0.05) ** R. % = % Reduction, Bs118 = modified B. subtilis , Bs168 = wild-type of B. subtilis Effect of Bs168 and Bs118 on the eggplant growth parameters Table 5 indicated that the two evaluated strains significantly (P≤0.05) increased plant growth parameters compared to the control, and Bs118 was more promising than Bs 168. In soil drench applications, the percentage increases in shoot length, fresh weight, and flower numbers due to Bs118 were 81.94%, 175.22%, and 300%, respectively, compared with the control. While Bs168 recorded a 44.56%, 35.32%, and 280% increase in the same parameters, respectively, compared with the control. In root dipping application, Bs118 exhibited the same trend by increasing the previously mentioned plant parameters by 18.69%, 35.41%, and 120%, respectively, more than Bs168, which recorded 10.28%, 23.32%, and 60% in the same parameters, respectively, compared with the control. In general, soil drenching led to greater increases in plant parameters under investigation than root dipping, and the modified strain Bs118 was more effective rather than the wild-type Bs168. Treatments Shoot System Length (cm) % Inc. No. of Flowers % Inc. Length (cm) *% Inc. fresh weight (g) % Inc. Control 26.75 d * --- 10.25 b ---- 18.00 c --- 1.25 c Soil drench Bs118 48.67 a 81.94 28.21 a 175.22 32.67 a 76.59 5.00 a 410 Bs168 38.67 b 44.56 13.87 ab 35.32 28.92 b 56.32 4.75 ab 280 Root dipping Bs118 31. 67 c 18.69 13.88 b 35.41 20.33 c 9.46 2.75 b 120 Bs168 29.67 c 10.28 12.97 b 23.32 20.00 c 8.11 2.00 c 60 Table 5. The effect of Bs168 and Bs118 on eggplant growth parameters under greenhouse conditions #Values are average of five replicates. *Within a column, means followed by the same letter(s) are not significantly different according to Duncan’s Multiple Range Test. ** R. % = % Reduction %Inc.- % Increase, Bs118 = modified B. subtilis , Bs168 = wild-type of B. subtilis Estimation of Biochemical analysis in eggplant leaves The potential to induce plant resistance against nematode infection was assessed by assessing the biochemical compounds such as protein, total phenols, and enzyme activity (glucanases (GLU), polyphenol oxidase (PPO), and chitinase (CHI) activities). The data in Fig. 9 demonstrated that the preceding treatments greatly increased PPO, GLU, and CHI activities. The plant analysis revealed that the two treatments had a high level of PPO activity when compared to the control. Generally, plants treated with Bs118 as a soil drench application produced the most PPO, GLU, and CHI, which recorded at 3.90, 6.95, and 0.39 U/mg, according to the findings of this study. While Bs168 had the lowest recorded increase, with 3.05, 0.95, and 0.29 U/mg compared to the control, which had 0.14 U/mg.However, chitinase showed a non-significant value in eggplant leaves between the Bs118 and Bs168 in both applications compared to the control. Notably, soil drench application stimulated activity in eggplant leaf companies when combined with root dipping application. The same trend was observed with the obtained data, demonstrating that Bs118 was more effective than Bs168 in activating PPO, GLU, and CHI in eggplant leaves after two applications. Noteworthy, Bs118 showed the best activity with the wild-typeand untreated control at two applications. Generally, the soil drenches are definitely more applicable than the root dipping for stimulating the antioxidant enzymes in plants. Effect of the bacterial strains, Bs168 and Bs118, on the total phenolic compounds (TPC) in eggplant leaves The effect of Bs168 and Bs118 on TPC in eggplant leaves infected with M. incognita was studied in a greenhouse setting. The results in Fig. 10 showed that Bs118 treatments were quite helpful in enhancing TPC in leaves (7.68 U/mg) compared to Bs168 (0.46 U/mg) and the control (0.46 U/mg) in the case of the soil drench. The same trend was observed when root dipping was applied: Bs118 achieved a higher level of TPC in leaves (7.68 U/mg) compared to Bs118 (7.06 U/mg). Discussion Due to climate change, a rising human population, and a declining supply of farmland, there is a growing demand for food production. These issues have so far been resolved via molecular methods and chemical applications (using fertilisers and pesticides). A sustainable alternative to replace chemical fertilizers and pesticides is the use of bio-derived materials. Various microorganisms, such as Fungi ( 42 ) , bacteria ( 12 ) and actinomycetes ( 43 ) , all have a history of producing compounds with anti-RKN efficiency. More research is required to identify and develop novel nematocidal metabolites ( 17 ) specifically fungal and bacterial metabolites that exhibit nematocidal action, which seems to be limited. More research is needed to discover and create new nematocidal metabolites (17) since, in contrast to fungal and bacterial metabolites, those with nematocidal activity are uncommon. The nematocidal activity of microbial metabolites has also been linked to their enzymatic capacity, particularly chitinase and protease enzymes (13,14) . Bacillus species are considered the main producers of extracellular proteases, which have a crucial role as nematocidal nematocidal (16) . In this study, enhancement of protease production originating from Bs168 was achieved by site-directed mutation, a powerful approach to increase nematocidal activity. The native promoter of the Bs168 extracellular neutral protease was replaced by a constitutive promoter controlling the gene repU responsible for replication of the Staphylococcus aureus plasmid pUB110. This resulted in the discovery of Bs118, a modified strain that produced twice as much protease as the wild type. It is obvious that P repU -regulated metalloprotease overproduction is implicated in the nematocidal effect evolved in vivo by the modified strain, Bs168 that has been conferred extra nematode biocontrol potential. The P repU promoter previously proved its efficiency in previous publications, as reported by Lecle`re et al (31) . They replaced the native promoter of the mycosubtilin operon with P repU , and that increased mycosubtilin up to 15-fold more than B. subtilis ATCC 6633 as a wild type. Hussein and Fahim (44) created a mutant strain, BMG06, that overexpressed plipastatin and fengycin by about 35 and 4 folds, respectively, more than wild-type B. subtilis 168, using constitutive promotor PrepU to replace Ppps (the plipastatin promoter) and Pfen (the fengycin promoter).Different genetic approaches were employed to improve the protease production from microbial sources for different applications; for example, UV-laser random mutagenesis was employed to treat B. subtilis to select high protease producers for increasing the peptide level of fermented soybean meal, which helps to improve its nutritional value (45) . Suberu etal (46) established the heterologous expression of the serine alkaline protease gene from Bacillus subtilis RD7 using the pET15b vector in E. coli BL21 cells, and the purified recombinant protease enzyme was employed to eliminate egg yolk stains at 40 °C and pH 10. The study conducted by Degering et al (47) presented a novel approach to increasing the extracellular production of a protease enzyme, subtilisin BPN from B. amyloliquefaciens , using various Bacillus host strains and the fusion of 393 N-terminal signal peptides (SPs), with 173 SPs originating from B. subtilis (termed homologous SPs) and 220 SPs originating from B. licheniformis DSM (termed heterologous SPs). The fusion constructs were then cloned and produced in B. subtilis and B. licheniformis , resulting in improved protein export not only in the original screening host but also in two distinct B. licheniformis strains. Darwesh et al (48) investigated other applications of thermostable alkaline protease secreted by Saccharomonospora viridi to control harmful nematodes. Several studies have also shown that the biochemical changes caused by the interaction of several factors within the biological control strategy and influencing the plant's immune system are an effective way to reduce nematode damage to plants. PGPB also play an important role in improving plant health and inducing resistance mechanisms by overproducing plant defence hormones and enzymes like catalase, chitinase, peroxidase, phenylalanine ammonia-lyase, and polyphenol oxidase (49, 50) . Pooled data collected after the experiment of root dipping with either the wild-type strain Bs168 or the overproducer derivative Bs118 proved that they have plant resistance-inducing activity. Moreover, plantlets inoculated with bacterial cultures induce growth in the absence of nematode infections, providing evidence that Bs168 and Bs118 lack any phytotoxic effects per se. Under greenhouse conditions, Bs118 achieved significantly higher levels of oxidative enzymes than Bs168. These results are in agreement with Khanna et al ( 51 ) , since they reported that applied organic fertilisers and bio-agents increased the activities of defense-related enzymes peroxidase (POX), PPO, and phenylalanine ammonia oxidase, phenylalanine ammonia. PPO's effect as a defense-related enzyme is caused by the oxidation of TPC to quinones, which are more toxic than the original phenols and frequently induce plant pathogen resistance ( 52 ) . Also, improvement of nematocidal effect is attributed to the increase in GLU's which is due to its ability to degrade pathogenic agent cell walls and hydrolyze the corresponding substrates ( 53 ) . In contrast, this result disagrees with Abd-Elgawad et al ( 54 ) , who found nematode infection had no effect on GLU activity but increased PPO activity in inoculated roots compared to uninoculated roots. By comparing the efficiency of soil drench and root dipping experiments as an approach to applying biocontrol, soil drench is preferable, and that can be explained by the higher effective performance of optimised bacterial cells than in the case of root dipping. These results agree with Khan and Tarannum ( 55 ) ; Ramadan and Soliman ( 56 ) proved the higher efficacy of soil drench than root dipping treatment in enhancing plant growth and nematode infection reduction. A recent study by Mohammad et al ( 57 ) concluded that when tomato plants were exposed to sweet annie and garden cress aqueous extracts, they produced a response that included the accumulation of phenolic compounds and an increase in the activity of defensive enzymes. Conclusion The use of biological agents as an alternative to chemical pesticides offers considerable potential for controlling a variety of plant infections, including root-knot nematodes ( Meloidogyne spp .). Enhancement of microbial protease by means of genetic engineering techniques, such as replacement of the native promotor with a constitutive promotor, results in increased suppression of Meloidogyne incognita and improved plant parameters. This method is thought to be effective for releasing potently modified strains as bioagents in a promising manner. And that qualifies them for additional research to increase their effectiveness in the field. Declarations Data availability The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Author contribution All authors participated in the development and implementation of the reviewing plan and subsequently written it. They discussed the different parts of the article, finalize the experimentation, and write the manuscript. All authors have read and approved the final manuscript. Ethics approval and consent to participate Not applicable. Competing interests The authors declare that they have no competing interests. Funding Financial support was partially made by National Research Centre, Egypt (by supplement chemicals and instruments) to develop and analyze the data Acknowledgement This study was supported in part by the NRC via providing chemicals and instruments. The facilities offered by The National Research Centre are appreciated. References El-Nagdi, M.A.W., Abd-El-Khair, H., Soliman, G.M., Ameen, H.H. & El-Sayed, M.G. Application of protoplast fusants of Bacillus licheniformis and Pseudomonas aeruginosa on Meloidogyne incognita in tomato and eggplant. Middle East J. of Appl. Sci. 9 , 622–629 (2019). Mohamed, S.A. et al . A local Bacillus spp: isolation, genetic improvement, nematode biocontrol, and nitrogen fixation. Egypt. Pharmaceut. J. 20 , 352. (2021). Singh, R., Kumar, M., Mittal, A. & Mehta, P.K. Microbial metabolites in nutrition, healthcare, and agriculture. Biotech. 7 , 15. (2017). Ciancio, A., Pieterse, C.M.J. & Mercado-Blanco, J. Editorial: Harnessing useful rhizosphere microorganisms for pathogen and pest biocontrol-second edition. Front. Microbiol . 10 , 1935. (2019). Ferreira, F.V. & Musumeci, M.A. Trichoderma as biological control agent: scope and prospects to improve efficacy. World J. Microbiol. Biotechnol. 37 , 1–17 (2021). Berg, G. et al . Plant microbial diversity is suggested as the key to future biocontrol and health trends. FEMS Microbiol. Ecol. 93 , 1–9 (2017). Tian, B., Yang, J. & Zhang, K.Q. Bacteria used in the biological control of plant-parasitic nematodes: populations, mechanisms of action, and future prospects. FEMS Microbiol. Ecol. 61 ,197–213 (2007). Sikora, R.A., Schäfer, K. & Dababat, A.A. Modes of action associated with microbially induced in planta suppression of plant parasitic nematodes. Australas. Plant Pathol. 36 , 124–134 (2007). Kahn, T.W., Duck, N.B. & McCarville, M.T. A Bacillus thuringiensis Cry protein controls soybean cyst nematode in transgenic soybean plants. Nat. Commun. 12 , 3380 (2021). Xia, Y. et al. The purL gene of Bacillus subtilis is associated with nematocidal activity. FEMS Microbiol. Lett. 322 , 99–107 (2011). Aballay, E., Mårtensson, A. & Persson, P. Screening of rhizosphere bacteria from grapevine for their suppressive effect on Xiphinema index Thorne & Allen on in vitro grape plants. Plant Soil 347 , 313–325 (2011). Aballay, E., Prodan, S., Zamorano, A. & Castaneda-Alvarez, C. Nematocidal effect of rhizobacteria on plant-parasitic nematodes associated with vineyards. World J. Microbiol. Biotechnol. 33 , 131 (2017). Ahmad, G. Khan, A. Khan, A. A., Ali, A. & Mohhamad, H.I. Biological control: a novel strategy for the control of the plant parasitic nematodes. Antonie Van Leeuwenhoek, 114 , 885–912 (2021). Jankiewicz, U., Larkowska, E. & Brzezinska, M.S. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from Stenotrophomonas maltophilia N4, J. Biosci. Bioengin. 121 , 614–618 (2016). Ruiz, S.E. et al. In vitro antagonistic activity of Bacillus subtilis strains isolated from soils of the Yucatan peninsula against Macrophomina phaseolina and Meloidogyne incognita . FYTON . 83 , 45–47 (2014). Soliman, G.M, Ameen, H.H., Abdel-Aziz, S.H.M. and El-sayed, G.M. In vitro evaluation of some isolated bacteria against the plant parasite nematode Meloidogyne incognita . Bull. Natl. Res. Cent. 43 , 171. (2019). Ju, S. et al. Alcaligenes faecalis ZD02, a novel nematocidal bacterium with an extracellular serine protease virulence factor, Appl. Environ. Microbiol. 82 , 2112–2120 (2016). Nagesh, M., Asokan, R., & Mohan, K.S. Partial characterization of novel nematocidal toxins from Bacillus cereus and their effect on root-knot nematode, Meloidogyne incognita (Kofoid & White) Chitwood. J. Biol. Control 19 , 65–70 (2005). Chandran, H., Meena, M. & Swapnil, P. Plant Growth-Promoting Rhizobacteria as a Green Alternative for Sustainable Agriculture. Sustain. 13 , 10986 (2021). Wharton, D.A. The production and functional morphology of helminth egg-shells. Parasitol. 86 , 85–97 (1983). Castaneda-Alvarez, C., Prodan, S., Rosales, I.M. & Aballay, E. Exoenzymes and metabolites related to the nematocidal effect of rhizobacteria on Xiphinema index Thorne & Allen. J. Appl. Microbiol. 120 , 413–424 (2016). Youssef, M.M.A. & Hassabo, S.A. The role of genetic engineering in management of plant parasitic nematodes with emphasis on root-knot nematodes: A review. Paki. J. of Nematol. 38 , 179–185 (2020). Wechter, W.P., Glandorf, D.C.M., Derrick, W.C., Leverentz, B. & Kluepfel, D.A. Identification of genetic loci in a rhizosphere-inhibiting species of Pseudomonas involved in expression of a phytoparasitic nematode ovicidal factor. Soil Biol. Biochem. 33 , 1749–1758 (2001). Wechter, W.P. et al . Physical mapping BAC-end sequence analysis, and marker tagging of the soilborne nematocidal bacterium, Pseudomonas synxantha BG33R. OMICS. 6 : 11–21 (2002). Bertani, L, G. Studies on lysogenesis: The Mode of Phage Liberation by Lysogenic Escherichia coli . J. of Bacteriol. 62 , 293–300 (1951). Pant, G, et al. Production, optimization, and partial purification of protease from Bacillus subtilis , J. of Taibah Univ, for Sci, 9 , 50–55 (2015). Han, X. & Damodaran, S. Isolation, identification, and fermentation of a Bacillus species producing a detergent-stable endopeptidase. J. Agric. Food Chem. 45 , 4191–4195 (1997). Lowry, O.H., Rosebrough, N.J., Farr, A.L. & Randall, R.J. Protein measurement with folin phenol reagent. J. Boil. Chem. 193 , 265–275 (1951). Yang, Y. et al . Escherichia coli BW25113 competent cells prepared using a simple chemical method have unmatched transformation and cloning Efficiencies. Front. Microbiol. 13 , 838698 (2022). Shi, T. et al. Establishment of a markerless mutation delivery system in Bacillus subtilis stimulated by a double-strand break in the chromosome. PLoS One. 8, 11. (2013). Leclère, V. et al . Mycosubtilin overproduction by Bacillus subtilis BBG100 enhances the organism’s antagonistic and biocontrol activities. Appl. Environ. Microbiol. 71 , 4577–4584 (2005). Sambrook, J. & Russell, D.W. Molecular Cloning, A Laboratory Manual, New York. rdedition. Cold Spring Harbor Laboratory Press, Cold (Spring Harbor, New York (2001). Eisenback, J. D. A. New Technique for Photographing Perineal Patterns of Root-knot Nematodes. J. Nematol. 42 , 33–34. (2010). Hussey, R.S. & Barker, K.R.A. Comparison of methods of collecting inocula of Meloidogyne spp. including a new technique. PLos. Dis. Rep. 571 , 1025–1028 (1973). Davis, R.W., Botstein, D. & Rotho, J.R. Transfection of DNA in Bacterial Genetics: A Manual for Genetic Engineering Advanced Bacterial Genetic. Cold Spring Harbor laboratory cold spring harbor, New York 67 , 134–137 (1980). Barker, T.R. Nematode extraction and bioassays. In: An Advanced Treatise on Meloidogyne Vol. II, Barker, T. R., Carter, C. C. and Sasser. J. N. (Eds.). North Carolina University, Graphics, Raleigh, N.C. pp. 19–35 (1985). Vamos-Vigyazo, L. & Nadudvari-Markus, V. Enzymatic browning, polyphenol oxidase and peroxidase in pearcultivars. Acta Aliment. 11 , 157–164 (1982). Gupta, P., Indu, R. & Sharma, V. Induction of β-1,3- glucanase and chitinase activity in the defense response of Erucasativa plants against the fungal pathogen Alternaria brassicicola , J. Plant. Interact. 8 , 155–161, (2012). Rustiguel, C. B., Jorge, J. A. & Guimaraes, L. H. S. Optimization of the chitinase production by different Metarhizium anisopliae strains under solid-state fermentation with silkworm chrysalis as substrate using CCRD. Adv. Microbiol. 2 , 268 (2012). Saikia, S., Mahnot, N. K. & Mahanta, C. L. Phytochemical content and antioxidant activities of thirteen fruits of Assam, India. Food Biosci. 13 , 15–20 (2016). McCord, J.M & Fridovich, I. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244 , 6049–6055 (1969). Suarez, B. M., Rey, P., Castillo, E., Monte & Llobell, Isolation and characterization of PRA1, a trypsin-like protease from the biocontrol agent Trichoderma harzianum CECT 2413 displaying nematocidal activity, Appl. Microbiol. Biotechnol. 65 , 46–55 (2004). Ma, Y.Y, Li, Y.L., Lai, H.X., Guo, Q. & Xue, Q.H. Effects of two strains of Streptomyces on root-zone microbes and nematodes for biocontrol of root-knot nematode disease in tomato, Appl. Soil Ecol. 112 , 34–41, (2017). Hussein, W. & Fahim, S. Expression of pps and fen promoters in Bacillus subtilis under optimal production condition. Res. J. Pharma. Biol. Chem. Sci. 7 , 1114–1121 (2016). Lu, F. et al . Enhancing protease activity of Bacillus subtilis using UV-laser random mutagenesis and high-throughput screening. Process Biochem. 119 , 119–127. (2022). Suberu, Y., Akande, I. Samuel, T. Lawal, A. & Olaniran, A. Cloning, expression, purification, and characterisation of serine alkaline protease from Bacillus subtilis RD7. Biocatal. Agric. Biotechnol. 20 , 101264. (2019). Degering, C. et al . Optimization of protease secretion in Bacillus subtilis and Bacillus licheniformis by screening of homologous and heterologous signal peptides. Appl Environ Microbiol. 76 , 6370–6. (2010). Darwesh, O.M., El-Hawary, A.S., El Kelany, U.S. & El-Sherbiny, G.M. Nematocidal activity of thermostable alkaline protease produced by Saccharomonospora viridis strain Hw G550. Biotechnol. Rep. 24 , e00386 (2019). De Aquino, J. P. A. et al . Plant growth-promoting endophytic bacteria on maize and sorghum1. Pesqui. Agropecu. Trop. 49, e56241 (2019) Tiepo, A.N. et al. Plant growth-promoting bacteria improve leaf antioxidant metabolism of drought-stressed neotropical trees. Planta. 251 , 83 (2020). Khanna, K. et al. Role of plant growth promoting bacteria (PGPRs) as biocontrol agents of Meloidogyne incognita through improved plant defense of Lycopersicon esculentum . Plant Soil 436 , 325–345 (2019). Mayer, A.M. Polyphenol oxidases in plants and fungi: Going places? Rev. Phytochem. 67 , 2318–2331 (2006). Zinov'eva, S.V. et al. PR proteins in plants infested with the root-knot nematode Meloidogyne incognita (Kofoid and White, 1912) Chitwood, 1949. Doklady Biol. Sci. 379 , 393–395 (2001). Abd-Elgawad, M.M. & Kabeil, S.S. Biological control of Meloidogyne incognita by Trichoderma harzianum and Serratia marcescens and their related enzymatic changes in tomato roots. African J. of Biotechnol. 11 , 16247–1625 (2012). Khan, M.R. & Tarannum Z. Effects of field application of various micro-organisms on Meloidogyne incognita on tomato. Nematol medit. 27 , 233–238 (1999). Ramadan W.A. & Soliman G.M. Effect of different applications of bio-agent Achromobacter xylosoxidans against Meloidogyne incognita and gene expression in infected eggplant. Jordan J. of Biological Sci. 13 , 363–370 (2020). Mohammad, A.A. et al . Nematocidal activity of sweet annie and garden cress nano-formulations and their impact on the vegetative growth and fruit quality of tomato plants. Sci Rep. 12 , 22302. (2022). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2592246","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":178337929,"identity":"638e84a2-e934-44f8-8172-1837f99f9736","order_by":0,"name":"Gaziea M. Soliman","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gaziea","middleName":"M.","lastName":"Soliman","suffix":""},{"id":178337930,"identity":"57ee9864-232d-4a4e-b894-fda4fcb72330","order_by":1,"name":"Ghada M. El-Sayed","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/UlEQVRIiWNgGAWjYDACCTBKSGBgZ2D4wFDBwGBAvBZmBsYZDGdI1sLYRoQW+ejmhzd+MKTl8TczH2z4Oe+wvDl78wGGHxXbcGoxvHPM2LKHIadY4jBbYmPvtsOGO3uOJTD2nLmNW8uMBDMJHoaKxIbDPOYPeLcdZtxwI8eAmbENn5b0b5J/gFrmH+b/2Ph3zmF7glrkJXLMpHkYchI3HOZhbOZtOJxIUIuBRE6xtYxBWuLGw2yGzTLH0pM3nDmWcBCfX+RnpG+8+aYiOXHe8eaHjW9qrG03HG8++OBHBR5bDoBJOL8ZTB7AqR5kSwMqvw6f4lEwCkbBKBihAADJEV9SbfMW6gAAAABJRU5ErkJggg==","orcid":"","institution":"National Research Centre","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ghada","middleName":"M.","lastName":"El-Sayed","suffix":""},{"id":178337931,"identity":"fe6637c4-562c-44e6-a744-49f3dafa2f72","order_by":2,"name":"Shaimaa A. Nour","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shaimaa","middleName":"A.","lastName":"Nour","suffix":""},{"id":178337932,"identity":"f488f905-9efe-4168-9730-b9dc875957e3","order_by":3,"name":"Usama S. Elkelany","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Usama","middleName":"S.","lastName":"Elkelany","suffix":""},{"id":178337933,"identity":"6fbbedad-dafa-4df0-859d-52a9b071840f","order_by":4,"name":"Hoda H. Ameen","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hoda","middleName":"H.","lastName":"Ameen","suffix":""},{"id":178337934,"identity":"34309b9a-ee2b-4e35-9735-22813234e93a","order_by":5,"name":"walaa Hussein","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"walaa","middleName":"","lastName":"Hussein","suffix":""}],"badges":[],"createdAt":"2023-02-15 21:29:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2592246/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2592246/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":33430025,"identity":"bf228924-a546-4d87-afcd-b93ac96ef0ba","added_by":"auto","created_at":"2023-02-24 23:16:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":190752,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of plasmid Vectors used in this study, (\u003cstrong\u003ea)\u003c/strong\u003e: pGEM-T Easy, and (\u003cstrong\u003eb)\u003c/strong\u003e: pBG106.\u003c/p\u003e","description":"","filename":"f1.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/b6412120fc109425bb1918ea.png"},{"id":33429769,"identity":"7b68bcfc-4a76-4e71-b078-7366ceae04f9","added_by":"auto","created_at":"2023-02-24 23:08:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":51839,"visible":true,"origin":"","legend":"\u003cp\u003eThe construction of recombinant vectors pMG112 by double digestion of pBG106 and pGEM-T by \u003cem\u003eSalI\u003c/em\u003e and \u003cem\u003eNotI \u003c/em\u003eand ligation\u003c/p\u003e","description":"","filename":"f2.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/71c8290c4af7c8542fe0a501.png"},{"id":33429775,"identity":"6a91bd08-7cfb-44bf-abe0-04137cca6ffb","added_by":"auto","created_at":"2023-02-24 23:08:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":74078,"visible":true,"origin":"","legend":"\u003cp\u003eThe construction of recombinant vectors, pMG115, containing gene fragment of \u003cem\u003eylaA\u003c/em\u003e (a), and pMG116 exhibiting \u003cem\u003enprE\u003c/em\u003egene fragment (b)\u003c/p\u003e","description":"","filename":"f3.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/2c01d2341a5256ebbe4b0ec4.png"},{"id":33429770,"identity":"9a7742c6-5b20-4022-a12b-a9ad4e78200b","added_by":"auto","created_at":"2023-02-24 23:08:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":63364,"visible":true,"origin":"","legend":"\u003cp\u003eThe construction of recombinant vectors pMG117 by ligation of \u003cem\u003eylaA\u003c/em\u003e gene fragment into pMG112 after double digestion of both pMG112 and pMG115 by \u003cem\u003eSalI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003e\u003c/p\u003e","description":"","filename":"f4.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/8ec422bdd93f2971b0fff558.png"},{"id":33430098,"identity":"184658e6-24d5-4bcd-b8f9-2ba900a5f437","added_by":"auto","created_at":"2023-02-24 23:24:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":90198,"visible":true,"origin":"","legend":"\u003cp\u003eThe construction of recombinant vectors pMG118 by ligation of \u003cem\u003enprE\u003c/em\u003e gene into pMG117 after double digestion of both pMG116 and pMG117 by \u003cem\u003eSphI \u003c/em\u003eand \u003cem\u003eApaI\u003c/em\u003e, the arrows onn PMG118 vector refer to the direction of genes expression (\u003cstrong\u003e5' \u003c/strong\u003e→\u003cstrong\u003e 3')\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"f5.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/654d31d13b0c0fa287ead6e6.png"},{"id":33430026,"identity":"1c9b8469-9f00-4883-9dcb-c9ebb3968e4d","added_by":"auto","created_at":"2023-02-24 23:16:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":165187,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of \u003cem\u003eylaA\u003c/em\u003e and \u003cem\u003enprE\u003c/em\u003e gene fragments from \u003cem\u003eBacillus subtilis\u003c/em\u003e 168. (a) lane M: DNA ladder 1kb, lane1: \u003cem\u003eylaA\u003c/em\u003e was PCR generated at 576 bp, and Lane 2: \u003cem\u003enprE\u003c/em\u003e was PCR amplified at 658 bp. (b): Thermo Scientific GeneRuler 1 kb DNA Ladder\u003c/p\u003e","description":"","filename":"f6.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/556db00979cb7c3291f2be6c.png"},{"id":33430027,"identity":"bf3a30fd-df9d-480d-a77f-8ccfa4afad1a","added_by":"auto","created_at":"2023-02-24 23:16:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":79843,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of host strain \u003cem\u003eB. subtilis\u003c/em\u003e PMG118. (F)Two DNA fragments of \u003cem\u003eylaA \u003c/em\u003eand \u003cem\u003enprE \u003c/em\u003ewere fused upstream and downstream of \u003cem\u003eP\u003c/em\u003e\u003csub\u003e\u003cem\u003erepU\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e-neo\u003c/em\u003e cassette, respectively to construct vector PMG118. (G)The sequence, P\u003cem\u003enpE\u003c/em\u003e, between DNA fragments of \u003cem\u003eylaA \u003c/em\u003eand \u003cem\u003enprE \u003c/em\u003ewas replaced by \u003cem\u003eP\u003c/em\u003e\u003csub\u003e\u003cem\u003erepU\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e-neo\u003c/em\u003e cassette via a double-crossover recombination. Crossed lines indicated double-crossingover recombinant events.\u003c/p\u003e","description":"","filename":"f7.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/80b77f7ed7316f8ce48d1f8f.png"},{"id":33429778,"identity":"ba485fa2-fabe-42a3-819b-c007699c813d","added_by":"auto","created_at":"2023-02-24 23:08:50","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":13018,"visible":true,"origin":"","legend":"\u003cp\u003eProtease activity for Bs168 and modified Bs118\u003c/p\u003e","description":"","filename":"f8.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/232d97bc18250420c41d109a.png"},{"id":33429772,"identity":"f23b4b18-de1a-4da5-8d50-a107204b0fa6","added_by":"auto","created_at":"2023-02-24 23:08:49","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":23004,"visible":true,"origin":"","legend":"\u003cp\u003eEstimation of\u003cstrong\u003e \u003c/strong\u003ePolyphenol oxidase (PPO), β - 3,1 - Glucanases (GLU) and chitinase activities in eggplant leaves treated by bacterial suspension of Bs168 and Bs118 by two application, soil drench and root dipping as compared to untreated plants\u003c/p\u003e","description":"","filename":"f9.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/31879e479285b62b550fdca6.png"},{"id":33429777,"identity":"d7bab1fc-23a3-49cf-b24c-433644eeefbe","added_by":"auto","created_at":"2023-02-24 23:08:49","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":16816,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of bacterial suspension treatment by Bs168 and Bs118 on the total phenol content by two application, Soil drench and root dipping as compared to untreated plants\u003c/p\u003e","description":"","filename":"f10.png","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/6e35d41ef0ec146c5d13d5a8.png"},{"id":41985347,"identity":"85cf9f5e-bb9a-4071-b661-93b5520e6003","added_by":"auto","created_at":"2023-08-23 07:37:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1386483,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2592246/v1/62f9832d-523b-47a0-9403-277d7026f325.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effect of neutral protease overproduction in Bacillus subtilis 168 via site-directed mutation against Meloidogyne incognita infecting eggplant under greenhouse conditions","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn Egypt, annual losses in crop production caused by root-knot nematodes, Meloidogyne spp., are considered the major limiting factor in crop production in the tropics \u003csup\u003e(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e)\u003c/sup\u003e. The mode of nematode attack against plant parts and their habitat in the soil make their management more difficult than that of other pests. \u003cem\u003eMeloidogyne incognita\u003c/em\u003e is considered one of the most potent plant parasitic nematodes affecting Egyptian \u0026lrm;vegetables \u003csup\u003e(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e)\u003c/sup\u003e. The application and extensive use of chemical nematicide for nematode management caused environmental and health concerns, so alternative strategies have been urged to be used \u003csup\u003e(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e)\u003c/sup\u003e. Biological agents have been investigated to control plant-parasitic nematodes. Bacterial and fungal infections of nematodes in the soil create the possibility of employing soil microorganisms to manage them \u003csup\u003e(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e)\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBacteria are numerically the most prevalent organism in soil; for example, members of the genera Pseudomonas and Bacillus have demonstrated a good potential for nematode biological control\u003csup\u003e(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e)\u003c/sup\u003e. Over the past 20 years, extensive research has been done to evaluate their ability to suppress plant-parasitic nematodes. Several studies have revealed that bacteria are widespread and have a wide range of activity mechanisms. These bacteria influence nematodes in various ways, such as by producing antibiotics, toxins, or enzymes; interfering with plant\u0026ndash;nematode recognition; causing systemic plant resistance; and encouraging plant health \u003csup\u003e(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e)\u003c/sup\u003e. Different \u003cem\u003eBacillus spp\u003c/em\u003e. and \u003cem\u003ePseudomonas\u003c/em\u003e spp., which are the most common prevalent populations in the rhizosphere, have potential efficacy in stimulating induced systemic resistance in plants, which is attributed to a variety of factors, including fortifying cell wall strength through the accumulation of newly produced phenolic compounds\u003csup\u003e(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e)\u003c/sup\u003e. In addition, to facilitate the synthesis of defence chemicals against the challenge pathogen, they promote the accumulation of pathogenesis-related proteins like chitinase and peroxidase, as well as the formation of phytoalexin and other secondary metabolites \u003csup\u003e(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e)\u003c/sup\u003e. The cause of the nematocidal effect in \u003cem\u003eB. subtilis\u003c/em\u003e is its ability to create a variety of poisonous metabolites, including benzene acetaldehyde, 2-nonanone, decanal, and 2-undecanone; dimethyl di-sulfide (DDS)\u003csup\u003e(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e)\u003c/sup\u003e, enzyme production, particularly chitinase and protease enzymes\u003csup\u003e(\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e)\u003c/sup\u003e; antibiotic secretion\u003csup\u003e(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e)\u003c/sup\u003e; exotic abilities for promoting growth and stimulating antioxidative potential; protection against various pathogens; and stress \u003csup\u003e(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e)\u003c/sup\u003e. Therefore, it seems to be an ideal agent for relieving nematode infections in plants. Here is why this study manipulates \u003cem\u003eB. subtilis\u003c/em\u003e as a bioagent for controlling the root-knot nematode, \u003cem\u003eM. incognita\u003c/em\u003e. Different types of structural proteins are present in nematodes, and their proportions alter over the course of their life cycles. In contrast to the mobile stage, which largely includes an exterior cuticle layer made up of glycoproteins and lipids, the egg stage contains a chitin/protein complex\u003csup\u003e(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e)\u003c/sup\u003e. Proteases, especially those secreted by Bacillus species, are critical nematicides\u003csup\u003e(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e)\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMany molecular genetic techniques have been reported to improve the nematocidal effect of bacterial species. Microbial virulence determinants, for example, are bacterial proteases whose corresponding genes were cloned and expressed in another organism to maximise product \u003csup\u003e(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e)\u003c/sup\u003e. Other genetic approaches are directed mutagenesis, in which a gene encoding a putative virulence determinant responsible for a certain pathogenic trait is replaced or disrupted for the construction of a mutant strain, or random mutagenesis that has been demonstrated by various current research projects; for example, Tn5 transposon-mediated mutagenesis was utilised by Wechter et al. \u003csup\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e)\u003c/sup\u003e to construct a library of mutants and generate five BG33R mutants that have no wild-type ovicide activity of \u003cem\u003ePseudomonas\u003c/em\u003e sp. BG33R. Another approach is protoplast fusion, this method was manipulated by Mohamed et al \u003csup\u003e(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e)\u003c/sup\u003e. They successed in formation of ten stable bacterial fusants that gave higher nematocidal effect against \u003cem\u003eM. incognita\u003c/em\u003e compared with parental strains \u003cem\u003eB. cereus\u003c/em\u003e and \u003cem\u003eB. thuringiensis\u003c/em\u003e subsp \u003cem\u003etenebrionis\u003c/em\u003e. Here, in this study, the aim is to overproduce protease enzyme from \u003cem\u003eB. subtilis\u003c/em\u003e subsp. \u003cem\u003esubtilis\u003c/em\u003e strain 168 (Bs168) by site directed mutagenesis, as well as to study and compare the effect of modified strain and wild-typeagainst \u003cem\u003eM. incognita\u003c/em\u003e in laboratory and greenhouse trials.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eBacterial strains, plasmids, and cloning\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bacterial strains and plasmids used in this research are \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;, used as a host for cloning and plasmid preparation, and \u003cem\u003eBacillus subtilis\u003c/em\u003e subsp. \u003cem\u003esubtilis\u003c/em\u003e strain 168, accession no. AL009126.3 (Bs168), used as a source for genes isolation and an expression host. Genetic characteristics of bacterial strains, in terms of purchased and constructed plasmids containing genetic fragments, are listed in Table 1. The structures of plasmids are shown in fig. 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMedia, growth conditions, and preparation of culture supernatants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBacterial strains were grown in Luria-Bertani (LB) medium\u003csup\u003e(\u003c/sup\u003e\u003csup\u003e25\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e for 18 hours at 37 \u0026deg;C and 150 rpm in a shaking incubator (Thermoscientific, UK) supplemented with ampicillin and neomycin (50\u0026micro;g/ml and 20\u0026micro;g/ml, respectively; Sigma, St. Louis, MO). Protease production was checked on agar plates containing 1% (v/v) skim milk. Centrifugation for 20 minutes at 10,000 rpm at 4\u0026deg;C was employed to obtain culture supernatant, which was then used immediately to determine proteolytic activity. Also, preparation of cell-free culture supernatants by microfiltration (membrane filter, cellulose acetate/nitrate, pore size, 0.22 m) was used to measure the proteolytic activity simultaneously to ensure the proteolytic activity was due to cell-free, i.e., secreted proteases \u003csup\u003e(26)\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssay of protease activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProteolytic activity on casein was determined using a slightly modified method described by Han and Damodaran \u003csup\u003e(27)\u003c/sup\u003e. The reaction mixture was composed of 1 mL of supernatant as a source of enzyme, and 1 mL of 1% casein solution in a 0.1 M Tris\u0026ndash;HCl buffer (pH 8.9). Proteolysis was carried out at 37\u0026deg;C for 30 min and stopped by the addition of 2.0 ml of 15% w/v trichloroacetic acid (TCA). Also, TCA was used to inhibit the enzyme before incubation with casein solution and was considered a blank reaction. The sample was incubated on ice for 10 minutes and then centrifuged at 12000 rpm for 15 minutes. According to Lowry et al \u003csup\u003e(28)\u003c/sup\u003e, the reaction mixture was centrifuged for 10 minutes at 10,000 rpm at 4\u0026deg;C, and the protein released in the clear supernatant was measured. A unit of protease activity has been defined as the amount of enzyme necessary to release 1 \u0026mu;g of tyrosine per minute under test conditions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtease overproduction using the site-direct mutation protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the construction of pGEM-derived pMG vectors dedicated to inducing the genetic exchange by homologous recombination in Bs168, a specific cassette was designated to replace the metallo-neural protease promoter (P\u003cem\u003enprE\u003c/em\u003e) for Bs168. The cassette is made up of \u003cem\u003eyla\u003c/em\u003eA partial sequences, tag=\"BSU_14710,\" and \u003cem\u003enpr\u003c/em\u003eE partial sequences, encoding extracellular neutral metalloprotease locus_tag=\"BSU_14700.\"These two partial genes are upstream and downstream from the promoter that regulates the expression of the protease-encoding gene. Two primer pairs were designed for each partial gene sequence with artificial restriction sites. The sense primer (ylaA fwd) and anti-sense primer (ylaA rev) containing the two artificial restriction sites, \u003cem\u003eSalI\u003c/em\u003e (GTCGAC) and \u003cem\u003eSacI\u003c/em\u003e (GAGCTC),\u0026nbsp;were designed to amplify partial fragment from \u003cem\u003eyla\u003c/em\u003eA, while amplification of the\u0026nbsp;\u003cem\u003enpr\u003c/em\u003eE gene was achieved by nprE fwd and nprE rev primers containing the two artificial restriction sites, \u003cem\u003eNcoI\u003c/em\u003e (CCATGG) and \u003cem\u003eSphI \u003c/em\u003e(GCATGC), respectively. The sequence of primers is shown in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA manipulation and PCR amplification\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGenomic DNA isolation was performed using the Wizard\u0026reg; Genomic DNA Purification Kit from Promega (Madison, WI, U.S.A.). The PCR amplification steps were performed as follows: denaturation at 94 \u0026deg;C for 3 min, followed by 35 cycles of denaturation at 94 \u0026deg;C\u0026nbsp;for 30 seconds, and hybridization at 50 \u0026deg;C for 30 seconds for both genes, ylaA\u0026nbsp;and nprE. An elongation step was at 72 \u0026deg;C for 45 sec, and final elongation steps were at 72 \u0026deg;C for 10 min.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of competent cells \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompetent cells from \u003cem\u003eE. coli\u003c/em\u003e DH5 were generated by following the method modified by Yang et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e29\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e. While competent \u003cem\u003eB. subtilis\u003c/em\u003e 168 cells were briefly prepared, a ten-fold dilution of an overnight LB culture was performed by adding new LB medium. When the cell density reached 0.7 at 600 nm, arabinose was added at a final concentration of 0.6% w/v, and the culture was agitated for 1 hour. The culture was then ready to be altered. A total of 5 \u0026micro;L of the generated vector was mixed with 100 \u0026micro;L of competent cells and incubated at 37 oC, 180 rpm shaking conditions \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e30\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e.\u003c/p\u003e\n\u003ctable width=\"103%\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial strains\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003e\u003cstrong\u003eSource\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003e\u003cem\u003eBacillus subtilis \u003c/em\u003esubsp.\u003cem\u003e subtilis \u003c/em\u003estrain 168\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003etrpC\u003csup\u003e2\u003c/sup\u003e, sfp\u003csup\u003e0\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eLab stock\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003eF\u003csup\u003e\u0026ndash;\u003c/sup\u003e\u003cem\u003eendA1\u003c/em\u003e\u003cem\u003eglnV44\u003c/em\u003e\u003cem\u003ethi-1\u003c/em\u003e\u003cem\u003erecA1\u003c/em\u003e\u003cem\u003erelA1\u003c/em\u003e\u003cem\u003egyrA96\u003c/em\u003e\u003cem\u003edeoR\u003c/em\u003e\u003cem\u003enupG\u003c/em\u003e\u003cem\u003epurB20\u003c/em\u003e \u0026phi;80d\u003cem\u003elacZ\u003c/em\u003e\u0026Delta;M15 \u0026Delta;(\u003cem\u003elacZYA-argF\u003c/em\u003e) U169, hsdR17(\u003cem\u003er\u003csub\u003eK\u003c/sub\u003e\u003c/em\u003e\u003csup\u003e\u0026ndash;\u003c/sup\u003e\u003cem\u003em\u003csub\u003eK\u003c/sub\u003e\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e), \u0026lambda;\u003csup\u003e\u0026ndash;\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eLab stock\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003e\u003cstrong\u003ePlasmids\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003e\u003cstrong\u003eSource\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epGEM-T Easy\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003eCloning vector, Ap\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003ePromega\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epBG106\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e\u003cem\u003e\u0026epsilon;pbp, P\u003csub\u003erepU\u003c/sub\u003e-neo, \u0026epsilon;fenF\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003e(Lecl\u0026egrave;re \u003cem\u003eet al\u003c/em\u003e. 2005)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epMG112\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e1340 bp\u003cem\u003e SalI\u003c/em\u003e and \u003cem\u003eNotI\u003c/em\u003e p\u003cem\u003e\u003csub\u003erepU-neo \u003c/sub\u003e\u003c/em\u003efragment from pBG106 cloned into pGEM-T Easy\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eLab stock\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epMG115\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e576 bp \u003cem\u003eylaA\u003c/em\u003e gene fragment of \u003cem\u003eB. subtilis\u003c/em\u003e 168 cloned into pGEM-T Easy\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eThis study\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epMG116\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e658 bp \u003cem\u003enprE\u003c/em\u003e gene fragment of \u003cem\u003eB. subtilis\u003c/em\u003e 168 cloned into pGEM-T Easy\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eThis study\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epMG117\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e\u003cem\u003eylaA \u003c/em\u003egene fragment \u003cem\u003eSalI \u003c/em\u003eand\u003cem\u003e SacI\u003c/em\u003e double digested and inserted into pMG112\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eThis study\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003epMG118\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"63%\"\u003e\n\u003cp\u003e\u003cem\u003enprE\u003c/em\u003e partial gene fragment \u003cem\u003eNco\u003c/em\u003e\u003cem\u003eI \u003c/em\u003eand\u003cem\u003e SphI \u003c/em\u003edouble digested and inserted into pMG117\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"17%\"\u003e\n\u003cp\u003eThis study\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 1. Bacterial strains and plasmids used in this study.\u003c/p\u003e\n\u003ctable width=\"610\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"152\"\u003e\n\u003cp\u003e\u003cstrong\u003eName\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"335\"\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer sequence (\u003c/strong\u003e\u003cstrong\u003e5'-3')\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"123\"\u003e\n\u003cp\u003e\u003cstrong\u003eProduct size (bp)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"152\"\u003e\n\u003cp\u003e\u003cem\u003eylaA\u003c/em\u003e fwd\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"335\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003eGTCGAC\u003c/u\u003e\u003c/strong\u003e TTATACGTTCGACCTTGCTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"123\"\u003e\n\u003cp\u003e576\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"152\"\u003e\n\u003cp\u003e\u003cem\u003eylaA\u003c/em\u003e rev\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"335\"\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003e\u003cu\u003eGAGCTC \u003c/u\u003e\u003c/strong\u003eTAAAGTGTTTCATCCGTAGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"152\"\u003e\n\u003cp\u003e\u003cem\u003enprE\u003c/em\u003e fwd\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"335\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003eCCATGG\u003c/u\u003e\u003c/strong\u003eTATCAATCAGCCTGCCAGGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"123\"\u003e\n\u003cp\u003e658\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"152\"\u003e\n\u003cp\u003e\u003cem\u003enprE\u003c/em\u003e rev\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"335\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003eGCATGC\u003c/u\u003e\u003c/strong\u003eAACAGTTGCGCCCTTTAGC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 2. Primers sequences for isolation of partial fragments from \u003cem\u003eylaA\u003c/em\u003e, and\u003cem\u003e nprE\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of the modular cassette\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis protocol was performed to replace the native P\u003cem\u003enprE\u003c/em\u003e by a constitutive promoter p\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e in several steps by designing plasmid construction to include the two partial upstream and downstream genes, \u003cem\u003eyla\u003c/em\u003eA and \u003cem\u003enpr\u003c/em\u003eE, respectively, of P\u003cem\u003e\u003csub\u003enprE\u003c/sub\u003e\u003c/em\u003e in Bs168 and the new promoter, p\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e and marker gene of neomycin, \u003cem\u003eneo\u003c/em\u003e. The expected PCR products for the \u003cem\u003eyla\u003c/em\u003eA and \u003cem\u003enpr\u003c/em\u003eE gene fragments were separated on a 1.5% agarose gel, then purified using a gel purification kit (Thermo Scientific, USA), then cloned separately in pGEM-T Easy vector, and the ligation protocol was performed as described in the pGEM\u0026reg;-T Easy Vector Systems Technical Manual from Promega Corp. (Madison, WI, USA). The vector pBG106 (fig. 1b), which contained cassettes pbp, P\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e-\u003cem\u003e\u003csub\u003eneo\u003c/sub\u003e\u003c/em\u003e, fenF31, and pGEM, was double digested by \u003cem\u003eSalI\u003c/em\u003e and \u003cem\u003eNotI\u003c/em\u003e to obtain the P\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e-\u003cem\u003e\u003csub\u003eneo\u003c/sub\u003e\u003c/em\u003e fragment, which was then inserted into pGEM-T Easy (fig. 1a), yielding pMG112 (fig. 2). Double digestion of \u003cem\u003eyla\u003c/em\u003eA and pGEM by \u003cem\u003eSalI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003e, followed by insertion, was implemented to obtain pMG115 (fig. 3a). Along the same lines, the pMG116 vector was generated by the insertion of the \u003cem\u003enpr\u003c/em\u003eE gene fragment into pGEM-T after double digestion by \u003cem\u003eNcoI\u003c/em\u003e and \u003cem\u003eSphI\u003c/em\u003e (Fig. 3b). Then, vectors pMG115 and pMG112 were double digested via \u003cem\u003eSalI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003e and ligated, and a fragment of \u003cem\u003eyla\u003c/em\u003eA was inserted in the corresponding sites to form pMG117 (Fig. 4). Finally, pMG118 was constructed by double digestion of both pMG116 and pMG117 plasmids with \u003cem\u003eNco1\u003c/em\u003e and \u003cem\u003eSph1\u003c/em\u003e enzymes and inserting the released \u003cem\u003enpr\u003c/em\u003eE fragment into pMG117 (Fig. 5). The recombinant vectors were transformed into competent cells of \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;. Following Sambrook and Russell \u003csup\u003e(32)\u003c/sup\u003e standard procedures for restriction endonuclease digestions and agarose gel electrophoresis, Plasmids from transformant colonies were purified using the Mini Plasmid Kit (Thermo Scientific, USA). The vectors, pMG118, were then transformed into comptent Bs168 cells. Transformant cells were plated on LB agar supplemented with neomycin and incubated at 37\u0026deg;C to select the recombinants.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTrials of nematode biocontrol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNematode inoculum.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRoot-knot nematodes, initially isolated from the infested fields in Giza governorate and maintained on tomato roots, were used as inoculum in the experiment. The experiment was implemented in the greenhouse belonged to the Plant Pathology Department, National Research Centre, Egypt. By light microscopic investigations of a perennial pattern, separation, and identification of females as \u003cem\u003eMeloidogyne incognita\u003c/em\u003e were implemented \u003csup\u003e(33)\u003c/sup\u003e. The infected roots were cut and incubated in tap water. After three days,\u003cem\u003e M. incognita\u003c/em\u003e juveniles (J2s) were extracted according to method reported by Hussey and Barker \u003csup\u003e(34)\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of bacterial \u003c/strong\u003e\u003cstrong\u003esuspension.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSingle colonies of bacterial strains were allowed to grow on nutrient agar plates for Bs168 and on nutrient agar supplemented with neomycin in the case of the modified strain at 37 \u003csup\u003eo\u003c/sup\u003eC for 18 h. Vegetative cells of each stain were suspended in 10 ml of sterile distilled water in a 50 ml sterile falcon tube to get a concentration of approximately 1x10\u003csup\u003e6\u003c/sup\u003e CFU/ml \u003csup\u003e(35)\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioassay test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nematocidal efficacy of both the wild-type (Bs168) and the modified strain (Bs118) was assessed by mixing 1 mL of nematode suspension (approximately 100 \u0026plusmn; 3 of \u003cem\u003eM. incognita\u003c/em\u003e J2 with 2 mL of bacterial suspension containing 1x10\u003csup\u003e6\u003c/sup\u003e CFU/mL in test tubes separately. Test tubes containing only 2 mL of distilled water and 1 mL of nematode suspension were assigned as control. All treatments were replicated five times and incubated at 30 \u003csup\u003eo\u003c/sup\u003eC. Dead juveniles were counted after 24 and 48 h of bacterial treatment. At the end of incubation, the nematode suspensions in all treatments were washed and resuspended in 2 mL distilled water for another 24 h, then the average percentage of nematode recoveries was determined. The percentage of mortality was calculated according to the equation: mortality% = [C1-C2/C1] x 100, where C1 is the number of live nematode larvae in the control treatment and C2 is the number of live nematode larvae in the other treatments. Net mortality was calculated according to % mortality after 48 h of bacterial treatment minus nematode recovery in distilled water \u003csup\u003e(1,16)\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe greenhouse experiments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA pot experiment was conducted in the experimental greenhouse of the Plant Pathology Department, National Research Centre, Giza, Egypt. The plastic pots (20 cm in diameter) were filled with 2 kg of sterilised sandy and clay soil (1:1 w/w). Instantly, three weeks old eggplant seedlings of \u003cem\u003eSolanum melongena\u003c/em\u003e (cv. Alabaster) were transplanted, two seedlings per pot. One week later, seedlings were thinned to one seedling per pot. Each pot was inoculated with 2000 \u003cem\u003eM. incognita\u003c/em\u003e J2, followed by five mL of the bacterial suspension (1x10\u003csup\u003e6\u003c/sup\u003e CFU/mL) of each strain, besides the control treatment. Simultaneously, all treatments were replicated five times. The pots were then watered and arranged in a completely random design on the bench in the greenhouse at a temperature of 27\u0026ndash;32 \u0026ordm;C \u003csup\u003e(1,16)\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRecorded data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstimation of nematodes parameters \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSixty days after nematode inoculation, eggplants in the five replicates were gently uprooted, and the roots were washed and cleaned from the adhering soil particles. J2 was extracted from 200 g of soil using the sieving and decanting technique\u003csup\u003e(\u003c/sup\u003e\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e and examined under a light microscope with a Hawksley counting slide. The number of galls and egg masses was determined for the whole root system. For each parameter, the percentage of nematode reduction was calculated and compared with the control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of eggplant growth parameters\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlant parameters such as length of shoots (cm), fresh weights of shoots and roots, and dry weight of shoots (g) of eggplant were measured. The percentage of plant growth increase for each criterion was calculated and compared to the untreated control \u003csup\u003e(2)\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of Biochemical parameters in eggplants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo months after eggplant treatment by bacterial cultures, one gram of collected leaves from each treatment was used to demonstrate biochemical parameters represented by the assessment of polyphenol oxidase, PPO (units. g-1 fresh weight of leaves) following the method of Vamos-Vigyazo and Nadudvari-Marlcus\u003csup\u003e37\u003c/sup\u003e, \u0026beta;-1,3-glucanase (GLU) (units. g\u003csup\u003e-1\u003c/sup\u003e fresh weight of leaves) using the method of Gupta et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e38\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e, chitinase \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e39\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e (units. g-1 fresh weight of leaves), and total phenolic compounds (U/mg) following the assay of Saikia et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e40\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e. Enzymes extraction was accomplished according to McCord and Fridovich \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e. Protein content was determined according to Lowry et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e28\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e. Bovine serum albumin was used as a standard.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe eggplant seedlings identified by the Agricultural Research Center, were supplied from Egyptian nurseries and agriculture. All the methods and handling of the cultivated eggplants included in experimental research were performed in accordance with relevant guidelines and regulations.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eProtease overproduction using site directed mutation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePCR amplification \u003c/strong\u003e\u003cstrong\u003eof \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eylaA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e and \u003cem\u003enprE \u003c/em\u003epartial sequences\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sense primer (ylaA fwd) and anti-sense primer (ylaA rev) succeeded in generating \u003cem\u003eylaA\u003c/em\u003e with a size of \u003cstrong\u003e576 bp.\u003c/strong\u003e Furthermore, the \u003cem\u003enprE\u003c/em\u003e gene was amplified at 658 bp using nprE forward and nprE reverse primers \u003cstrong\u003e(Fig. 6)\u003c/strong\u003e. Each of them was cloned separately in pGEM-T Easy to construct pMG115 and pMG116, respectively. The constructed vector pMG112, which included the P\u003cem\u003e\u003csub\u003erepU-neo \u003c/sub\u003e\u003c/em\u003ecassette fragment, received the cloned fragment of \u003cem\u003eylaA\u003c/em\u003e in a vector named pMG116, which was then inserted with the fragment of P\u003cem\u003e\u003csub\u003erepU-neo \u003c/sub\u003e\u003c/em\u003ecassette in a new construct pMG118 (Fig. 5). Taking this into consideration, the direction (5' 3') of P\u003cem\u003e\u003csub\u003erepU-neo \u003c/sub\u003e\u003c/em\u003ecassette and \u003cem\u003enprE \u003c/em\u003eis linear, while that of the \u003cem\u003eylaA\u003c/em\u003e gene fragment is in the opposite direction. After transformation of competent cells of BS168 via pMG118, the positive transformants successfully grew on LB agar media supplemented with neomycin. Homologous recombination between the constructed vector pMG118 and the Bs168 chromosome is represented in Fig. 7. The crossingover between homologous fragments leads to the replacement of p\u003cem\u003enprE\u003c/em\u003e with constitutive P\u003cem\u003e\u003csub\u003erepU-neo\u003c/sub\u003e\u003c/em\u003e that will consecutively enhance and increase protease yield. The modified strain was referred to as Bs118.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstimation of protease activity for wild-typeand modified strain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenetic modification is believed to be an efficient tool to achieve potent modified strains of industrial enzymes, such as protease, for different applications. In this study, site-directed mutations employed the P\u003cem\u003erepU\u003c/em\u003e promoter to replace the native extracellular neutral protease promoter to construct the plasmid pMG118 used to transform \u003cem\u003eB. subtilis \u003c/em\u003e168 for protease overproduction. The enzyme activity of wild-type was measured at 43.33 u/ml, while the enzyme activity of the modified strain, Bs118, was 90 u/ml, which was two times more than wild-type (Fig. 8).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNematocidal effect of Bs118 and Bs168 bacterial strain suspensions on \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eM. incognita\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e J2 \u003cem\u003ein vitro \u003c/em\u003etest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe modified bacterial strain and the wild-typewere examined for their nematocidal properties via the effects of their different biochemical components \u003cem\u003ein vitro. Table 3 shows that Bs168 and the modified strain Bs118 have a significant lethal effect on M. incognita J2 after 24, and 48 hours of exposure compared to the control.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eGenerally, the mortality gradually increased with time, and it was noticed that the highest J2 mortality (98%) after 48 h was obtained by Bs118 treatment, whereas Bs168 recorded an 88.67% mortality as compared with the control. \u003cem\u003eM. incognita\u003c/em\u003e J2 did not recover after being washed with distilled water and left for 24 hours, indicating that the death was real.\u003c/p\u003e\n\u003ctable width=\"455\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"102\"\u003e\n\u003cp\u003eTreatments\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" width=\"227\"\u003e\n\u003cp\u003eNematode mortality After different exposure time*\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"126\"\u003e\n\u003cp\u003e% Net mortality\u003csup\u003e#\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"132\"\u003e\n\u003cp\u003e24h\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e48 h\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003eControl\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"132\"\u003e\n\u003cp\u003e0.00\u003csup\u003ec\u003c/sup\u003e**\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"126\"\u003e\n\u003cp\u003e0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003eBs118\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"132\"\u003e\n\u003cp\u003e81.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e88.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"126\"\u003e\n\u003cp\u003e88.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003eBs168\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"132\"\u003e\n\u003cp\u003e93.33\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e98.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"126\"\u003e\n\u003cp\u003e98.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. \u003c/strong\u003eThe effect of Bs118 and Bs168 on \u003cem\u003eM. incognita\u003c/em\u003e juveniles mortality under laboratory conditions.\u003c/p\u003e\n\u003cp\u003e*Values are average of five replicates **Means followed by the same letter(s) are not significantly (P\u0026le; 0.05) different according to Duncan\u0026rsquo;s Multiple Range Test. # % Net mortality = mortality after 48 h minus nematode recovery in distilled water which =zero, Bs118 \u003cem\u003e=\u003c/em\u003e modified\u003cem\u003e B. subtilis\u003c/em\u003e, Bs168 \u003cem\u003e= \u003c/em\u003ewild-typeof \u003cem\u003eB. subtilis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGreenhouse experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn a greenhouse experiment, the effect of the wild-typeBs168 and the modified strain Bs118 on root-knot nematodes \u003cem\u003eM. incognita\u003c/em\u003e in infected eggplant was evaluated using soil drench and/or root dipping application methods.The data in Table 4 revealed that the tested Bs168 and Bs118 significantly (P \u0026le;0.05) reduced nematode multiplication, and the modified strain was more effective in decreasing the number of \u003cem\u003eM. incognita\u003c/em\u003e J2 in soil, root galls, and egg masses/root systems and reducing nematode infection than the wild-type as compared with the control.The soil drench treatment was more effective than the root dipping treatment in reducing nematode counts in soil and eggplants. In soil drench application, data showed that the modified strain Bs118 resulted in 86.05%, 68.80%, and 79.94% reductions in the number of J2s in soil, galls, and egg-masses numbers, respectively, while Bs168 recorded 40.04%, 42.23%, and 63.41% reductions in the number of J2s, galls, and egg-masses numbers, respectively, compared with the control. Also, the same trend was noticed in root dipping, where the Bs118 achieved a reduction of 61.41%, 62.83%, and 72.35% in the aforementioned parameters, respectively. While the BS168 reduced the same parameters by 21.38 percent, 28.50%, and 61.95 percent, respectively.\u0026nbsp;\u003c/p\u003e\n\u003ctable width=\"565\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eTreatments\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e\u003cstrong\u003eNo. J\u003csub\u003e2\u003c/sub\u003e in soil\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003eR%.**\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"85\"\u003e\n\u003cp\u003e\u003cstrong\u003eNo. galls / root system\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003eR%.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e\u003cstrong\u003eNo. egg-masses /\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eroot system\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003eR%.\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e276.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e---\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"85\"\u003e\n\u003cp\u003e528.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e----\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e240.50a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e---\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\" width=\"499\"\u003e\n\u003cp\u003e\u003cstrong\u003eSoil drenches application\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eBs118\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e38.50\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e86.05\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"85\"\u003e\n\u003cp\u003e164.75\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e68.80\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e48.25\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e79.94\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eBs168\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e165.50\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e40.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"85\"\u003e\n\u003cp\u003e305.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e52.23\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e88.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e63.41\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\" width=\"499\"\u003e\n\u003cp\u003eRoot dipping application\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eBs118\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e106.50\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e61.41\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"85\"\u003e\n\u003cp\u003e196.25\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e62.83\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e66.50\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e72.35\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eBs168\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e217.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e21.38\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"85\"\u003e\n\u003cp\u003e377.50\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e28.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e91.50\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e61.95\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4. \u003c/strong\u003eThe nematocidal effects of Bs168 and Bs118 strains against \u003cem\u003eM. incognita\u003c/em\u003e infecting eggplant\u003c/p\u003e\n\u003cp\u003e#Values are average of five replicates. Different letters within the same column indicate significant differences among treatments according to least significant difference test (P \u0026le; 0.05) ** R. % = % Reduction, Bs118 \u003cem\u003e=\u003c/em\u003e modified\u003cem\u003e B. subtilis\u003c/em\u003e, Bs168 \u003cem\u003e= \u003c/em\u003ewild-type of \u003cem\u003eB. subtilis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of Bs168 and Bs118 on the eggplant growth parameters\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTable 5 indicated that the two evaluated strains significantly (P\u0026le;0.05) increased plant growth parameters compared to the control, and Bs118 was more promising than Bs 168. In soil drench applications, the percentage increases in shoot length, fresh weight, and flower numbers due to Bs118 were 81.94%, 175.22%, and 300%, respectively, compared with the control. While Bs168 recorded a 44.56%, 35.32%, and 280% increase in the same parameters, respectively, compared with the control. In root dipping application, Bs118 exhibited the same trend by increasing the previously mentioned plant parameters by 18.69%, 35.41%, and 120%, respectively, more than Bs168, which recorded 10.28%, 23.32%, and 60% in the same parameters, respectively, compared with the control. In general, soil drenching led to greater increases in plant parameters under investigation than root dipping, and the modified strain Bs118 was more effective rather than the wild-type Bs168.\u003c/p\u003e\n\u003ctable width=\"545\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"90\"\u003e\n\u003cp\u003e\u003cstrong\u003eTreatments\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"226\"\u003e\n\u003cp\u003e\u003cstrong\u003eShoot System\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"68\"\u003e\n\u003cp\u003e\u003cstrong\u003eLength\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"46\"\u003e\n\u003cp\u003e% Inc.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"74\"\u003e\n\u003cp\u003e\u003cstrong\u003eNo. of Flowers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"41\"\u003e\n\u003cp\u003e% Inc.\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e\u003cstrong\u003eLength\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"37\"\u003e\n\u003cp\u003e*% Inc.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"83\"\u003e\n\u003cp\u003e\u003cstrong\u003efresh weight (g)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"40\"\u003e\n\u003cp\u003e%\u003c/p\u003e\n\u003cp\u003eInc.\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003eControl\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e26.75\u003csup\u003ed\u003c/sup\u003e*\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"37\"\u003e\n\u003cp\u003e---\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"83\"\u003e\n\u003cp\u003e10.25\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"40\"\u003e\n\u003cp\u003e----\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e18.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e---\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003e1.25\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"9\" width=\"545\"\u003e\n\u003cp\u003e\u003cstrong\u003eSoil drench\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003eBs118\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e48.67\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"37\"\u003e\n\u003cp\u003e81.94\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"83\"\u003e\n\u003cp\u003e28.21\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"40\"\u003e\n\u003cp\u003e175.22\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e32.67\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e76.59\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003e5.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41\"\u003e\n\u003cp\u003e410\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003eBs168\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e38.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"37\"\u003e\n\u003cp\u003e44.56\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"83\"\u003e\n\u003cp\u003e13.87\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"40\"\u003e\n\u003cp\u003e35.32\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e28.92\u003csup\u003eb \u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e56.32\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003e4.75\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41\"\u003e\n\u003cp\u003e280\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"9\" width=\"545\"\u003e\n\u003cp\u003e\u003cstrong\u003eRoot dipping\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003eBs118\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e31. 67\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"37\"\u003e\n\u003cp\u003e18.69\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"83\"\u003e\n\u003cp\u003e13.88\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"40\"\u003e\n\u003cp\u003e35.41\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e20.33\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e9.46\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003e2.75\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41\"\u003e\n\u003cp\u003e120\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003eBs168\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"66\"\u003e\n\u003cp\u003e29.67\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"37\"\u003e\n\u003cp\u003e10.28\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"83\"\u003e\n\u003cp\u003e12.97\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"40\"\u003e\n\u003cp\u003e23.32\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e20.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e8.11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003e2.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41\"\u003e\n\u003cp\u003e60\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5. \u003c/strong\u003eThe effect of Bs168 and Bs118 on eggplant growth parameters under greenhouse conditions\u003c/p\u003e\n\u003cp\u003e#Values are average of five replicates. *Within a column, means followed by the same letter(s) are not significantly different according to Duncan\u0026rsquo;s Multiple Range Test. ** R. % = % Reduction %Inc.- % Increase, Bs118 \u003cem\u003e=\u003c/em\u003e modified\u003cem\u003e B. subtilis\u003c/em\u003e, Bs168 \u003cem\u003e= \u003c/em\u003ewild-type of \u003cem\u003eB. subtilis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstimation of Biochemical analysis in eggplant leaves \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe potential to induce plant resistance against nematode infection was assessed by assessing the biochemical compounds such as protein, total phenols, and enzyme activity (glucanases (GLU), polyphenol oxidase (PPO), and chitinase (CHI) activities). The data in Fig. 9 demonstrated that the preceding treatments greatly increased PPO, GLU, and CHI activities. The plant analysis revealed that the two treatments had a high level of PPO activity when compared to the control. Generally, plants treated with Bs118 as a soil drench application produced the most PPO, GLU, and CHI, which recorded at 3.90, 6.95, and 0.39 U/mg, according to the findings of this study. While Bs168 had the lowest recorded increase, with 3.05, 0.95, and 0.29 U/mg compared to the control, which had 0.14 U/mg.However, chitinase showed a non-significant value in eggplant leaves between the Bs118 and Bs168 in both applications compared to the control. Notably, soil drench application stimulated activity in eggplant leaf companies when combined with root dipping application. The same trend was observed with the obtained data, demonstrating that Bs118 was more effective than Bs168 in activating PPO, GLU, and CHI in eggplant leaves after two applications. Noteworthy, Bs118 showed the best activity with the wild-typeand untreated control at two applications. Generally, the soil drenches are definitely more applicable than the root dipping for stimulating the antioxidant enzymes in plants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of the bacterial strains, Bs168 and Bs118, on the total phenolic compounds (TPC) in eggplant leaves \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of Bs168 and Bs118 on TPC in eggplant leaves infected with \u003cem\u003eM. incognita\u003c/em\u003e was studied in a greenhouse setting. The results in Fig. 10 showed that Bs118 treatments were quite helpful in enhancing TPC in leaves (7.68 U/mg) compared to Bs168 (0.46 U/mg) and the control (0.46 U/mg) in the case of the soil drench. The same trend was observed when root dipping was applied: Bs118 achieved a higher level of TPC in leaves (7.68 U/mg) compared to Bs118 (7.06 U/mg).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDue to climate change, a rising human population, and a declining supply of farmland, there is a growing demand for food production. These issues have so far been resolved via molecular methods and chemical applications (using fertilisers and pesticides). A sustainable alternative to replace chemical fertilizers and pesticides is the use of bio-derived materials. Various microorganisms, such as Fungi \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e42\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e, bacteria \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e12\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e and actinomycetes \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e43\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e, all have a history of producing compounds with anti-RKN efficiency. More research is required to identify and develop novel nematocidal metabolites \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e17\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e specifically fungal and bacterial metabolites that exhibit nematocidal action, which seems to be limited.\u003c/p\u003e\n\u003cp\u003eMore research is needed to discover and create new nematocidal metabolites \u003csup\u003e(17)\u003c/sup\u003e since, in contrast to fungal and bacterial metabolites, those with nematocidal activity are uncommon. The nematocidal activity of microbial metabolites has also been linked to their enzymatic capacity, particularly chitinase and protease enzymes \u003csup\u003e(13,14)\u003c/sup\u003e. Bacillus species are considered the main producers of extracellular proteases, which have a crucial role as nematocidal nematocidal \u003csup\u003e(16)\u003c/sup\u003e. In this study, enhancement of protease production originating from Bs168 was achieved by site-directed mutation, a powerful approach to increase nematocidal activity. The native promoter of the Bs168 extracellular neutral protease was replaced by a constitutive promoter controlling the gene \u003cem\u003erepU\u0026nbsp;\u003c/em\u003eresponsible for replication of the \u003cem\u003eStaphylococcus aureus\u003c/em\u003e plasmid pUB110. This resulted in the discovery of Bs118, a modified strain that produced twice as much protease as the wild type. It is obvious that P\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e-regulated metalloprotease overproduction is implicated in the nematocidal effect evolved in vivo by the modified strain, Bs168 that has been conferred extra nematode biocontrol potential. The P\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e promoter previously proved its efficiency in previous publications, as reported by Lecle`re \u003cem\u003eet al\u003c/em\u003e\u003csup\u003e(31)\u003c/sup\u003e. They replaced the native promoter of the mycosubtilin operon with P\u003cem\u003e\u003csub\u003erepU\u003c/sub\u003e\u003c/em\u003e, and that increased mycosubtilin up to 15-fold more than \u003cem\u003eB. subtilis\u003c/em\u003e ATCC 6633 as a wild type. Hussein and Fahim \u003csup\u003e(44)\u003c/sup\u003e created a mutant strain, BMG06, that overexpressed plipastatin and fengycin by about 35 and 4 folds, respectively, more than wild-type \u003cem\u003eB. subtilis\u003c/em\u003e 168, using constitutive promotor PrepU to replace Ppps (the plipastatin promoter) and Pfen (the fengycin promoter).Different genetic approaches were employed to improve the protease production from microbial sources for different applications; for example, UV-laser random mutagenesis was employed to treat \u003cem\u003eB. subtilis\u003c/em\u003e to select high protease producers for increasing the peptide level of fermented soybean meal, which helps to improve its nutritional value \u003csup\u003e(45)\u003c/sup\u003e. Suberu etal \u003csup\u003e(46)\u003c/sup\u003eestablished the heterologous expression of the serine alkaline protease gene from \u003cem\u003eBacillus subtilis\u003c/em\u003e RD7 using the pET15b vector in \u003cem\u003eE. coli\u003c/em\u003e BL21 cells, and the purified recombinant protease enzyme was employed to eliminate egg yolk stains at 40 \u0026deg;C and pH 10. The study conducted by Degering et al \u003csup\u003e(47)\u003c/sup\u003e presented a novel approach to increasing the extracellular production of a protease enzyme, subtilisin BPN from \u003cem\u003eB. amyloliquefaciens\u003c/em\u003e, using various Bacillus host strains and the fusion of 393 N-terminal signal peptides (SPs), with 173 SPs originating from \u003cem\u003eB. subtilis\u003c/em\u003e (termed homologous SPs) and 220 SPs originating from \u003cem\u003eB. licheniformis\u003c/em\u003e DSM (termed heterologous SPs). The fusion constructs were then cloned and produced in \u003cem\u003eB. subtilis\u003c/em\u003e and \u003cem\u003eB. licheniformis\u003c/em\u003e, resulting in improved protein export not only in the original screening host but also in two distinct \u003cem\u003eB. licheniformis\u003c/em\u003e strains. Darwesh et al \u003csup\u003e(48)\u003c/sup\u003e investigated other applications of thermostable alkaline protease secreted by \u003cem\u003eSaccharomonospora viridi\u003c/em\u003e to control harmful nematodes.\u003c/p\u003e\n\u003cp\u003eSeveral studies have also shown that the biochemical changes caused by the interaction of several factors within the biological control strategy and influencing the plant\u0026apos;s immune system are an effective way to reduce nematode damage to plants. PGPB also play an important role in improving plant health and inducing resistance mechanisms by overproducing plant defence hormones and enzymes like catalase, chitinase, peroxidase, phenylalanine ammonia-lyase, and polyphenol oxidase \u003csup\u003e(49, 50)\u003c/sup\u003e. Pooled data collected after the experiment of root dipping with either the wild-type strain Bs168 or the overproducer derivative Bs118 proved that they have plant resistance-inducing activity. Moreover, plantlets inoculated with bacterial cultures induce growth in the absence of nematode infections, providing evidence that Bs168 and Bs118 lack any phytotoxic effects per se.\u003c/p\u003e\n\u003cp\u003eUnder greenhouse conditions, Bs118 \u0026nbsp;achieved significantly higher levels of oxidative enzymes than Bs168. These results are in agreement with Khanna et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e51\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e, since they reported that applied organic fertilisers and bio-agents increased the activities of defense-related enzymes peroxidase (POX), PPO, and phenylalanine ammonia oxidase, phenylalanine ammonia. PPO\u0026apos;s effect as a defense-related enzyme is caused by the oxidation of TPC to quinones, which are more toxic than the original phenols and frequently induce plant pathogen resistance \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e52\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e. Also, improvement of nematocidal effect is attributed to the increase in GLU\u0026apos;s which is due to its ability to degrade pathogenic agent cell walls and hydrolyze the corresponding substrates \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e53\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e. In contrast, this result disagrees with Abd-Elgawad et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e54\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e, who found nematode infection had no effect on GLU activity but increased PPO activity in inoculated roots compared to uninoculated roots. By comparing the efficiency of soil drench and root dipping experiments as an approach to applying biocontrol, soil drench is preferable, and that can be explained by the higher effective performance of optimised bacterial cells than in the case of root dipping. These results agree with Khan and Tarannum \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e55\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e; Ramadan and Soliman \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e56\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e proved the higher efficacy of soil drench than root dipping treatment in enhancing plant growth and nematode infection reduction. A recent study by Mohammad et al \u003csup\u003e(\u003c/sup\u003e\u003csup\u003e57\u003c/sup\u003e\u003csup\u003e)\u003c/sup\u003e concluded that when tomato plants were exposed to sweet annie and garden cress aqueous extracts, they produced a response that included the accumulation of phenolic compounds and an increase in the activity of defensive enzymes.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe use of biological agents as an alternative to chemical pesticides offers considerable potential for controlling a variety of plant infections, including root-knot nematodes (\u003cem\u003eMeloidogyne spp\u003c/em\u003e.). Enhancement of microbial protease by means of genetic engineering techniques, such as replacement of the native promotor with a constitutive promotor, results in increased suppression of \u003cem\u003eMeloidogyne incognita\u003c/em\u003e and improved plant parameters. This method is thought to be effective for releasing potently modified strains as bioagents in a promising manner. And that qualifies them for additional research to increase their effectiveness in the field.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors participated in the development and implementation of the reviewing plan and subsequently written it. They discussed the different parts of the article, finalize the experimentation, and write the manuscript. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFinancial support was partially made by National Research Centre, Egypt (by supplement chemicals and instruments) to develop and analyze the data\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;This study was supported in part by the NRC via providing chemicals and instruments. The facilities offered by The National Research Centre are appreciated.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eEl-Nagdi, M.A.W., Abd-El-Khair, H., Soliman, G.M., Ameen, H.H. \u0026amp; El-Sayed, M.G. Application of protoplast fusants of \u003cem\u003eBacillus licheniformis\u003c/em\u003e and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e on \u003cem\u003eMeloidogyne incognita\u003c/em\u003e in tomato and eggplant. Middle East J. of Appl. Sci. \u003cb\u003e9\u003c/b\u003e, 622\u0026ndash;629 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamed, S.A. \u003cem\u003eet al\u003c/em\u003e. A local \u003cem\u003eBacillus\u003c/em\u003e spp: isolation, genetic improvement, nematode biocontrol, and nitrogen fixation. Egypt. Pharmaceut. J. \u003cb\u003e20\u003c/b\u003e, 352. (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh, R., Kumar, M., Mittal, A. \u0026amp; Mehta, P.K. Microbial metabolites in nutrition, healthcare, and agriculture. Biotech. \u003cb\u003e7\u003c/b\u003e, 15. (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCiancio, A., Pieterse, C.M.J. \u0026amp; Mercado-Blanco, J. Editorial: Harnessing useful rhizosphere microorganisms for pathogen and pest biocontrol-second edition. \u003cem\u003eFront. Microbiol\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 1935. (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira, F.V. \u0026amp; Musumeci, M.A. Trichoderma as biological control agent: scope and prospects to improve efficacy. World J. Microbiol. Biotechnol. \u003cb\u003e37\u003c/b\u003e, 1\u0026ndash;17 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerg, G. \u003cem\u003eet al\u003c/em\u003e. Plant microbial diversity is suggested as the key to future biocontrol and health trends. FEMS Microbiol. Ecol. \u003cb\u003e93\u003c/b\u003e, 1\u0026ndash;9 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, B., Yang, J. \u0026amp; Zhang, K.Q. Bacteria used in the biological control of plant-parasitic nematodes: populations, mechanisms of action, and future prospects. FEMS Microbiol. Ecol. \u003cb\u003e61\u003c/b\u003e,197\u0026ndash;213 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSikora, R.A., Sch\u0026auml;fer, K. \u0026amp; Dababat, A.A. Modes of action associated with microbially induced in planta suppression of plant parasitic nematodes. Australas. Plant Pathol. \u003cb\u003e36\u003c/b\u003e, 124\u0026ndash;134 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKahn, T.W., Duck, N.B. \u0026amp; McCarville, M.T. A \u003cem\u003eBacillus thuringiensis\u003c/em\u003e Cry protein controls soybean cyst nematode in transgenic soybean plants. Nat. Commun. \u003cb\u003e12\u003c/b\u003e, 3380 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia, Y. \u003cem\u003eet al.\u003c/em\u003e The purL gene of \u003cem\u003eBacillus subtilis\u003c/em\u003e is associated with nematocidal activity. FEMS Microbiol. Lett. \u003cb\u003e322\u003c/b\u003e, 99\u0026ndash;107 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAballay, E., M\u0026aring;rtensson, A. \u0026amp; Persson, P. Screening of rhizosphere bacteria from grapevine for their suppressive effect on \u003cem\u003eXiphinema index\u003c/em\u003e Thorne \u0026amp; Allen on \u003cem\u003ein vitro\u003c/em\u003e grape plants. Plant Soil \u003cb\u003e347\u003c/b\u003e, 313\u0026ndash;325 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAballay, E., Prodan, S., Zamorano, A. \u0026amp; Castaneda-Alvarez, C. Nematocidal effect of rhizobacteria on plant-parasitic nematodes associated with vineyards. World J. Microbiol. Biotechnol. \u003cb\u003e33\u003c/b\u003e, 131 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmad, G. Khan, A. Khan, A. A., Ali, A. \u0026amp; Mohhamad, H.I. Biological control: a novel strategy for the control of the plant parasitic nematodes. Antonie Van Leeuwenhoek, \u003cb\u003e114\u003c/b\u003e, 885\u0026ndash;912 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJankiewicz, U., Larkowska, E. \u0026amp; Brzezinska, M.S. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from \u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e N4, J. Biosci. Bioengin. \u003cb\u003e121\u003c/b\u003e, 614\u0026ndash;618 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuiz, S.E. \u003cem\u003eet al.\u003c/em\u003e In vitro antagonistic activity of \u003cem\u003eBacillus subtilis\u003c/em\u003e strains isolated from soils of the \u003cem\u003eYucatan peninsula\u003c/em\u003e against \u003cem\u003eMacrophomina phaseolina\u003c/em\u003e and \u003cem\u003eMeloidogyne incognita\u003c/em\u003e. \u003cem\u003eFYTON\u003c/em\u003e. \u003cb\u003e83\u003c/b\u003e, 45\u0026ndash;47 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoliman, G.M, Ameen, H.H., Abdel-Aziz, S.H.M. and El-sayed, G.M. In vitro evaluation of some isolated bacteria against the plant parasite nematode \u003cem\u003eMeloidogyne incognita\u003c/em\u003e. Bull. Natl. Res. Cent. \u003cb\u003e43\u003c/b\u003e, 171. (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJu, S. \u003cem\u003eet al. Alcaligenes faecalis\u003c/em\u003e ZD02, a novel nematocidal bacterium with an extracellular serine protease virulence factor, \u003cem\u003eAppl. Environ. Microbiol.\u003c/em\u003e \u003cb\u003e82\u003c/b\u003e, 2112\u0026ndash;2120 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagesh, M., Asokan, R., \u0026amp; Mohan, K.S. Partial characterization of novel nematocidal toxins from \u003cem\u003eBacillus cereus\u003c/em\u003e and their effect on root-knot nematode, \u003cem\u003eMeloidogyne incognita\u003c/em\u003e (Kofoid \u0026amp; White) Chitwood. J. Biol. Control \u003cb\u003e19\u003c/b\u003e, 65\u0026ndash;70 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandran, H., Meena, M. \u0026amp; Swapnil, P. Plant Growth-Promoting Rhizobacteria as a Green Alternative for Sustainable Agriculture. Sustain. \u003cb\u003e13\u003c/b\u003e, 10986 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWharton, D.A. The production and functional morphology of helminth egg-shells. Parasitol. \u003cb\u003e86\u003c/b\u003e, 85\u0026ndash;97 (1983).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastaneda-Alvarez, C., Prodan, S., Rosales, I.M. \u0026amp; Aballay, E. Exoenzymes and metabolites related to the nematocidal effect of rhizobacteria on \u003cem\u003eXiphinema index\u003c/em\u003e Thorne \u0026amp; Allen. J. Appl. Microbiol. \u003cb\u003e120\u003c/b\u003e, 413\u0026ndash;424 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoussef, M.M.A. \u0026amp; Hassabo, S.A. The role of genetic engineering in management of plant parasitic nematodes with emphasis on root-knot nematodes: A review. Paki. J. of Nematol. \u003cb\u003e38\u003c/b\u003e, 179\u0026ndash;185 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWechter, W.P., Glandorf, D.C.M., Derrick, W.C., Leverentz, B. \u0026amp; Kluepfel, D.A. Identification of genetic loci in a rhizosphere-inhibiting species of Pseudomonas involved in expression of a phytoparasitic nematode ovicidal factor. Soil Biol. Biochem. \u003cb\u003e33\u003c/b\u003e, 1749\u0026ndash;1758 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWechter, W.P. \u003cem\u003eet al\u003c/em\u003e. Physical mapping BAC-end sequence analysis, and marker tagging of the soilborne nematocidal bacterium, \u003cem\u003ePseudomonas synxantha\u003c/em\u003e BG33R. OMICS. \u003cb\u003e6\u003c/b\u003e: 11\u0026ndash;21 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertani, L, G. Studies on lysogenesis: The Mode of Phage Liberation by Lysogenic \u003cem\u003eEscherichia coli\u003c/em\u003e. J. of Bacteriol. \u003cb\u003e62\u003c/b\u003e, 293\u0026ndash;300 (1951).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePant, G, \u003cem\u003eet al.\u003c/em\u003e Production, optimization, and partial purification of protease from \u003cem\u003eBacillus subtilis\u003c/em\u003e, J. of Taibah Univ, for Sci, \u003cb\u003e9\u003c/b\u003e, 50\u0026ndash;55 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan, X. \u0026amp; Damodaran, S. Isolation, identification, and fermentation of a Bacillus species producing a detergent-stable endopeptidase. J. Agric. Food Chem. \u003cb\u003e45\u003c/b\u003e, 4191\u0026ndash;4195 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLowry, O.H., Rosebrough, N.J., Farr, A.L. \u0026amp; Randall, R.J. Protein measurement with folin phenol reagent. J. Boil. Chem. \u003cb\u003e193\u003c/b\u003e, 265\u0026ndash;275 (1951).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, Y. \u003cem\u003eet al\u003c/em\u003e. \u003cem\u003eEscherichia coli\u003c/em\u003e BW25113 competent cells prepared using a simple chemical method have unmatched transformation and cloning Efficiencies. Front. Microbiol. \u003cb\u003e13\u003c/b\u003e, 838698 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, T. \u003cem\u003eet al.\u003c/em\u003e Establishment of a markerless mutation delivery system in \u003cem\u003eBacillus subtilis\u003c/em\u003e stimulated by a double-strand break in the chromosome. PLoS One. 8, 11. (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLecl\u0026egrave;re, V. \u003cem\u003eet al\u003c/em\u003e. Mycosubtilin overproduction by \u003cem\u003eBacillus subtilis\u003c/em\u003e BBG100 enhances the organism\u0026rsquo;s antagonistic and biocontrol activities. Appl. Environ. Microbiol. \u003cb\u003e71\u003c/b\u003e, 4577\u0026ndash;4584 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook, J. \u0026amp; Russell, D.W. Molecular Cloning, A Laboratory Manual, New York. rdedition. Cold Spring Harbor Laboratory Press, Cold (Spring Harbor, New York (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEisenback, J. D. A. New Technique for Photographing Perineal Patterns of Root-knot Nematodes. J. Nematol. \u003cb\u003e42\u003c/b\u003e, 33\u0026ndash;34. (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHussey, R.S. \u0026amp; Barker, K.R.A. Comparison of methods of collecting inocula of \u003cem\u003eMeloidogyne\u003c/em\u003e spp. including a new technique. PLos. Dis. Rep. \u003cb\u003e571\u003c/b\u003e, 1025\u0026ndash;1028 (1973).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavis, R.W., Botstein, D. \u0026amp; Rotho, J.R. Transfection of DNA in Bacterial Genetics: A Manual for Genetic Engineering Advanced Bacterial Genetic. Cold Spring Harbor laboratory cold spring harbor, \u003cem\u003eNew York\u003c/em\u003e \u003cb\u003e67\u003c/b\u003e, 134\u0026ndash;137 (1980).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarker, T.R. Nematode extraction and bioassays. In: An Advanced Treatise on \u003cem\u003eMeloidogyne\u003c/em\u003e Vol.\u0026nbsp;II, Barker, T. R., Carter, C. C. and Sasser. J. N. (Eds.). North Carolina University, Graphics, Raleigh, N.C. pp.\u0026nbsp;19\u0026ndash;35 (1985).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVamos-Vigyazo, L. \u0026amp; Nadudvari-Markus, V. Enzymatic browning, polyphenol oxidase and peroxidase in pearcultivars. Acta Aliment. \u003cb\u003e11\u003c/b\u003e, 157\u0026ndash;164 (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta, P., Indu, R. \u0026amp; Sharma, V. Induction of β-1,3- glucanase and chitinase activity in the defense response of Erucasativa plants against the fungal pathogen \u003cem\u003eAlternaria brassicicola\u003c/em\u003e, J. Plant. Interact. \u003cb\u003e8\u003c/b\u003e, 155\u0026ndash;161, (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRustiguel, C. B., Jorge, J. A. \u0026amp; Guimaraes, L. H. S. Optimization of the chitinase production by different \u003cem\u003eMetarhizium anisopliae\u003c/em\u003e strains under solid-state fermentation with silkworm chrysalis as substrate using CCRD. Adv. Microbiol. \u003cb\u003e2\u003c/b\u003e, 268 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaikia, S., Mahnot, N. K. \u0026amp; Mahanta, C. L. Phytochemical content and antioxidant activities of thirteen fruits of Assam, India. Food Biosci. \u003cb\u003e13\u003c/b\u003e, 15\u0026ndash;20 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCord, J.M \u0026amp; Fridovich, I. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. \u003cb\u003e244\u003c/b\u003e, 6049\u0026ndash;6055 (1969).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuarez, B. M., Rey, P., Castillo, E., Monte \u0026amp; Llobell, Isolation and characterization of PRA1, a trypsin-like protease from the biocontrol agent \u003cem\u003eTrichoderma harzianum\u003c/em\u003e CECT 2413 displaying nematocidal activity, Appl. Microbiol. Biotechnol. \u003cb\u003e65\u003c/b\u003e, 46\u0026ndash;55 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, Y.Y, Li, Y.L., Lai, H.X., Guo, Q. \u0026amp; Xue, Q.H. Effects of two strains of Streptomyces on root-zone microbes and nematodes for biocontrol of root-knot nematode disease in tomato, Appl. Soil Ecol. \u003cb\u003e112\u003c/b\u003e, 34\u0026ndash;41, (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHussein, W. \u0026amp; Fahim, S. Expression of pps and fen promoters in \u003cem\u003eBacillus subtilis\u003c/em\u003e under optimal production condition. Res. J. Pharma. Biol. Chem. Sci. \u003cb\u003e7\u003c/b\u003e, 1114\u0026ndash;1121 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, F. \u003cem\u003eet al\u003c/em\u003e. Enhancing protease activity of \u003cem\u003eBacillus subtilis\u003c/em\u003e using UV-laser random mutagenesis and high-throughput screening. Process Biochem. \u003cb\u003e119\u003c/b\u003e, 119\u0026ndash;127. (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuberu, Y., Akande, I. Samuel, T. Lawal, A. \u0026amp; Olaniran, A. Cloning, expression, purification, and characterisation of serine alkaline protease from \u003cem\u003eBacillus subtilis\u003c/em\u003e RD7. Biocatal. Agric. Biotechnol. \u003cb\u003e20\u003c/b\u003e, 101264. (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDegering, C. \u003cem\u003eet al\u003c/em\u003e. Optimization of protease secretion in \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003eBacillus licheniformis\u003c/em\u003e by screening of homologous and heterologous signal peptides. Appl Environ Microbiol. \u003cb\u003e76\u003c/b\u003e, 6370\u0026ndash;6. (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarwesh, O.M., El-Hawary, A.S., El Kelany, U.S. \u0026amp; El-Sherbiny, G.M. Nematocidal activity of thermostable alkaline protease produced by \u003cem\u003eSaccharomonospora viridis\u003c/em\u003e strain Hw G550. Biotechnol. Rep. \u003cb\u003e24\u003c/b\u003e, e00386 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Aquino, J. P. A. \u003cem\u003eet al\u003c/em\u003e. Plant growth-promoting endophytic bacteria on maize and sorghum1. Pesqui. Agropecu. Trop. 49, e56241 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTiepo, A.N. \u003cem\u003eet al.\u003c/em\u003e Plant growth-promoting bacteria improve leaf antioxidant metabolism of drought-stressed neotropical trees. Planta. \u003cb\u003e251\u003c/b\u003e, 83 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhanna, K. \u003cem\u003eet al.\u003c/em\u003e Role of plant growth promoting bacteria (PGPRs) as biocontrol agents of \u003cem\u003eMeloidogyne incognita\u003c/em\u003e through improved plant defense of \u003cem\u003eLycopersicon esculentum\u003c/em\u003e. Plant Soil \u003cb\u003e436\u003c/b\u003e, 325\u0026ndash;345 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayer, A.M. Polyphenol oxidases in plants and fungi: Going places? Rev. Phytochem. \u003cb\u003e67\u003c/b\u003e, 2318\u0026ndash;2331 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZinov'eva, S.V. \u003cem\u003eet al.\u003c/em\u003e PR proteins in plants infested with the root-knot nematode \u003cem\u003eMeloidogyne incognita\u003c/em\u003e (Kofoid and White, 1912) Chitwood, 1949. Doklady Biol. Sci. \u003cb\u003e379\u003c/b\u003e, 393\u0026ndash;395 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbd-Elgawad, M.M. \u0026amp; Kabeil, S.S. Biological control of \u003cem\u003eMeloidogyne incognita\u003c/em\u003e by \u003cem\u003eTrichoderma harzianum\u003c/em\u003e and \u003cem\u003eSerratia marcescens\u003c/em\u003e and their related enzymatic changes in tomato roots. \u003cem\u003eAfrican J. of Biotechnol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 16247\u0026ndash;1625 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan, M.R. \u0026amp; Tarannum Z. Effects of field application of various micro-organisms on \u003cem\u003eMeloidogyne incognita\u003c/em\u003e on tomato. Nematol medit. \u003cb\u003e27\u003c/b\u003e, 233\u0026ndash;238 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamadan W.A. \u0026amp; Soliman G.M. Effect of different applications of bio-agent \u003cem\u003eAchromobacter xylosoxidans\u003c/em\u003e against \u003cem\u003eMeloidogyne incognita\u003c/em\u003e and gene expression in infected eggplant. Jordan J. of Biological Sci. \u003cb\u003e13\u003c/b\u003e, 363\u0026ndash;370 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohammad, A.A. \u003cem\u003eet al\u003c/em\u003e. Nematocidal activity of sweet annie and garden cress nano-formulations and their impact on the vegetative growth and fruit quality of tomato plants. Sci Rep. \u003cb\u003e12\u003c/b\u003e, 22302. (2022).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-2592246/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2592246/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRoot-knot nematodes (RKN), \u003cem\u003eMeloidogyne incognita\u003c/em\u003e, caused significant problems for many important crops. Measuring control with low environmental impact has been required since EU legislation revised pesticide laws for crops. Bacteria-based control methods reduce pollutants and stabilise ecological changes, which makes them promising for controlling plant pathogens. In this study, the derivative of \u003cem\u003eBacillus subtilis\u003c/em\u003e168, termed Bs118, was generated by replacing the native promoter of the extracellular neutral metalloprotease-encoding gene (\u003cem\u003enpr\u003c/em\u003eE) with a constitutive promoter of the \u003cem\u003erepU\u003c/em\u003e gene responsible for replication of the \u003cem\u003eStaphylococcus aureus\u003c/em\u003e plasmid pUB110. As a result, protease production increased to twice that of the wild type. Results revealed that the overproduction of neutral metalloprotease conferred Bs118 high nematocidal activity by inducing 98% mortality in the \u003cem\u003eM. incognita\u003c/em\u003e J2 in vitro study. Bs118 stated its priority in affecting root-knot nematode reproduction under greenhouse conditions. The soil drench treatment was more promising than root dipping in controlling \u003cem\u003eM. incognita\u003c/em\u003e compared with the untreated control treatment. The same trend happened in the eggplant growth parameters, where Bs118 improved plant health more than Bs168. In conclusion, site-directed mutation via homologous recombination to replace the native promoter with another constitutive one is a promising approach to constructing modified strains with higher protease production that can be employed as an efficient biocontrol agent against root-knot nematodes in addition to the positive impacts on plant growth.\u003c/p\u003e","manuscriptTitle":"Effect of neutral protease overproduction in Bacillus subtilis 168 via site-directed mutation against Meloidogyne incognita infecting eggplant under greenhouse conditions","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-02-24 23:08:44","doi":"10.21203/rs.3.rs-2592246/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"80f82efe-3fc7-42ae-90d5-b9b02a64827a","owner":[],"postedDate":"February 24th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":19427867,"name":"Biological sciences/Biological techniques"},{"id":19427868,"name":"Biological sciences/Biotechnology"},{"id":19427869,"name":"Biological sciences/Genetics"}],"tags":[],"updatedAt":"2023-08-23T07:29:22+00:00","versionOfRecord":[],"versionCreatedAt":"2023-02-24 23:08:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2592246","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2592246","identity":"rs-2592246","version":["v1"]},"buildId":"re_ckhLnmML6MCF96OHNJ","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00