Dual PDE4/10 Inhibition Restores CREB1 Function and Enhances Neuronal Resilience in Alzheimer's Disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dual PDE4/10 Inhibition Restores CREB1 Function and Enhances Neuronal Resilience in Alzheimer's Disease Xiaoli Rong, Xia Yao, Haohui Fang, Johns Saji, Yu Qian, Jia-Xuan Gu, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6907913/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Oct, 2025 Read the published version in Alzheimer's Research & Therapy → Version 1 posted 15 You are reading this latest preprint version Abstract Background Alzheimer’s disease (AD) involves cognitive decline, amyloid-beta (Aβ) accumulation, tau hyperphosphorylation, and neuroinflammation. CREB1, a key transcription factor for memory, is downregulated in AD, contributing to disease progression. Methods We used human iPSC-derived cortical neurons and microglia, along with the APP/PS1 AD mouse model, to investigate the role of CREB1 and assess the therapeutic potential of dual PDE4/10 inhibition. Results CREB1 deficiency increased Aβ and p-tau231 accumulation. Dual inhibition of PDE4 and PDE10 activated the cAMP-PKA-CREB pathway, restoring CREB1 activity, reducing Aβ and p-tau231, and mitigating neuroinflammation. This intervention improved synaptic plasticity and cognitive performance in vivo. Conclusions Our findings demonstrate that dual PDE4/10 inhibition synergistically enhances CREB1 signaling, promoting neuroprotection and synaptic remodeling. This approach offers a promising therapeutic strategy for modifying AD pathology and restoring cognitive function. Alzheimer's disease PDE4/10 inhibition cAMP-PKA-CREB signaling Neuronal resilience Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Alzheimer's Disease (AD) is a progressive neurodegenerative disorder characterized by the decline of cognitive functions, including memory, reasoning, and behavior[1]. Affecting millions worldwide, AD represents the most common cause of dementia among the elderly, posing significant challenges for patients, caregivers, and healthcare systems[2]. Central to the progression of AD is the loss of neuronal resilience, which refers to the ability of neurons to withstand and recover from pathological insults[3]. Neuronal resilience is crucial for maintaining cognitive functions, and its decline accelerates the deterioration seen in AD patients[4]. Enhancing neuronal resilience, therefore, holds promise as a strategy to mitigate the progression of AD, preserve cognitive abilities, and improve the quality of life for those affected by this devastating disease[5, 6]. The cAMP-PKA-CREB signaling pathway is integral to neuronal health and plasticity, orchestrating a multitude of processes essential for cognitive function and resilience[7, 8]. In this pathway, cyclic adenosine monophosphate (cAMP) serves as a second messenger that activates protein kinase A (PKA)[9]. Once activated, PKA phosphorylates the cAMP response element-binding protein (CREB), which then binds to specific DNA sequences to promote the transcription of genes involved in neuronal survival, growth, and synaptic plasticity[10, 11]. This pathway ensures that neurons can adapt to new information and recover from injury, underpinning the brain's ability to learn and remember[12, 13]. In AD pathology, the cAMP-PKA-CREB pathway is notably disrupted, leading to significant neuronal dysfunction[14]. Dysregulation of this pathway results in decreased phosphorylation of CREB, reducing the expression of genes critical for neuroprotection and synaptic maintenance. This impairment contributes to the accumulation of amyloid-beta (Aβ) plaques and hyperphosphorylated tau (p-tau), which are two major pathological hallmarks of AD[15]. The ensuing neuronal damage and synaptic loss exacerbate cognitive decline, highlighting the importance of the cAMP-PKA-CREB pathway in maintaining neuronal integrity. Therefore, targeting this pathway to restore its function holds promise for mitigating AD pathology and preserving cognitive function in affected individuals. AD is marked by progressive cognitive decline, with disruptions in many intracellular signaling pathways, in which cAMP plays a crucial role as a secondary messenger[16]. Phosphodiesterases (PDEs) are a family of enzymes that regulate intracellular signaling by hydrolyzing cyclic nucleotides, such as cAMP and cyclic guanosine monophosphate (cGMP)[17]. Among them, PDE4 and PDE10 play critical roles in neuronal and glial function and are implicated as targets for treatment of neurodegenerative diseases[18, 19]. PDE4, primarily expressed in the brain and immune cells, catalyzes the degradation of cAMP[20]. This regulation directly affects the cAMP-PKA-CREB pathway, which is essential for synaptic plasticity, memory formation, and neuroprotection[21, 22]. Inhibition of PDE4 has been shown to elevate cAMP levels, leading to enhanced CREB activation and improved cognitive function[23]. Previous studies show that PDE4 inhibition by Rolipram increases cAMP levels, but with significant side effects like nausea and vomiting, limiting clinical use[24]. PDE10, predominantly expressed in the striatum, hydrolyzes both cAMP and cGMP, thereby modulating key signaling pathways that influence motor control, learning, and cognition[25, 26]. The selective PDE10A inhibitor, TAK-063, has shown promise in preclinical models by increasing cAMP/cGMP levels, which may contribute to neuroprotection and cognitive enhancement[27]. Despite the promising preclinical data of TAK-063 in Huntington's disease or schizophrenia[19, 26], currently, there is no substantial evidence supporting the use of TAK-063 for AD. Some critical challenges remain in the development of PDE inhibitors for AD, including the need to minimize adverse effects, understand the regional specificity of PDE’s activity inhibition in neurodegeneration, assess the long-term impacts on AD pathology, and bridge the gap between preclinical findings and clinical outcomes. Addressing these gaps is essential for advancing PDE inhibitors as effective therapies for AD. Building upon this foundation, our research endeavors to elucidate whether single or dual PDE4/10 inhibition reduces AD pathology and how it regulates the cAMP-PKA-CREB pathway. Furthermore, we explored whether dual PDE4/10 inhibition in APP/PS1 AD mice improves cognitive function and enhances neuronal resilience. Our study aims to understand the synergistic effects of dual PDE4/10 inhibition and the molecular mechanisms underlying cognitive improvements in APP/PS1 mouse models. These areas require further investigation to fully establish the therapeutic potential of dual PDE4/10 inhibition in AD. Methods Human population analysis We extracted the genetic association summary statistics of the CREB1 gene region (approximately ±200kb of the gene region, hg19, chr2: 208194615-208670284) from a previously published study (up to 13,292 European ancestry cases and up to 17,219 European ancestry controls)[28]. Specifically, 1,259 single nucleotide polymorphisms (SNPs) were plotted in this region for AD. Based on the Mendelian randomization (MR) study design, genetic variants were used as instrumental variables to link the outcome (i.e., AD) via the exposure of interest (i.e., the PED4A gene expression level). The instrumental variables were extracted from the cis-eQTLs based on the eQTLGen consortium (whole blood) (P-value for cis-eQTL < 5×10-8) (25954001). Linkage clumping was conducted based on default protocols. The genetic association estimate of this instrumental variable with AD was obtained from one previous genome-wide association study, which included 111,326 clinically diagnosed/proxy AD cases and 677,663 controls (35379992). Additionally, we supplied an alternative two-sample MR method, the inverse-variance weighted method, to assess the robustness of this MR estimate. In this MR analysis, four genome-wide significant independent pQTLs were also selected as instrumental variables (r2<0.001 within 250kb distance), and only two genetic variants were available in the previous AD GWAS (35379992). Culture of iPSCs and human subjects The isogenic human iPSC (hiPSC) lines carrying APPswe mutations, and the engineered 7889SA iPSC line (WT control) were obtained from previous studies[29, 30]. All hiPSC cultures were maintained in mTeSR plus medium (STEMCELL Technologies) at 37°C, 5% CO2 on hESC-qualified Matrigel-coated culture vessels. The human postmortem brain tissue samples: Mid-frontal cortices from brains of age-matched patients with AD (n=6, 3 females and 3 males) and controls (n=6, 3 females and 3 males), Table S1. Mouse breeding and maintenance All procedures performed in this study were approved by the Institutional Animal Care and Use Committee (IACUC) at Soochow University. All of the live animals were maintained in a specific-pathogen-free (SPF) animal facility. Male and female mice of mixed genetic backgrounds (C57BL/6J) were used for these studies. The only exceptions were germline mutant mice (APP/PS1), which were backcrossed for at least 5 generations to a C57BL/6J background. All animals were group housed, with control and mutant animals in the same litters and cages. Littermates from the same genetic crosses were used as controls for each group, to control for variability in mouse strains/backgrounds. All the animals were genotyped following the standard protocol of The Jackson Laboratory (MMRRC stock #34832). Administration of PDE4/10 Inhibitors For in vitro experiments, the PDE4 inhibitor Rolipram (Catalog No.67177.LB0, Thermo Fisher) and the PDE10 inhibitor TAK-063 (Catalog No.S8459, Selleck Chemicals LLC) were administered to APP iPSC-derived neurons or microglia, with either 20 µM Rolipram, 20 µM TAK-063, or their combination (20 µM each) for 48 hours. Cells were treated with these inhibitors under standard culture conditions and their effects were accessed by immunohistochemistry, western blotting, and secretion of inflammatory factors. 20 µM each was utilized for the combinatorial application of Rolipram and TAK-063 in vitro . For in vivo experiments, Rolipram and TAK-063 were administered to mice at a concentration of either 0.5 mg/kg Rolipram, 0.5 mg/kg TAK-063, or their combination (0.5 mg/kg each). The inhibitors were dissolved in saline and delivered via nasal injection once daily for 4 weeks. Mice were monitored for any adverse effects throughout the treatment period, and the impact on relevant outcomes was assessed after the 4-week duration. CRISPR/Cas9 gene KO editing For CREB1 knock-out (KO) iPSCs line generation, 3 pairs of guide RNAs (gRNAs) were designed to target the CREB1 exon 2 and cloned the 2 gRNAs’ sequences into an expression vector EBNA-Cas9-copGFP (ECC) [31]. The plasmid was transfected into the iPSCs using Lipofectamine Stem Transfection Reagent (Invitrogen). Transfectants were sorted using fluorescence-activated cell sorting (FACS) for GFP-positive cells after 24h. The sorted single cells were seeded sparsely and cultured for an additional week for colony formation. Single colonies were then subject to expansion and validation. CREB1 KO of single colonies was confirmed by PCR and Sanger sequencing. Immuno fluorescence microscopy hiPSC-derived cortical neurons were seeded on glass coverslips in a 24-well plate at a density of 30,000 cells per well. After an initial wash with phosphate-buffered saline, 0.1% Tween-20 (PBST), the cells were fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes at room temperature (RT). Following another wash with PBS, the cells were permeabilized with 0.3% Triton X-100 in PBST for 10 minutes. Blocking was performed with 10% normal goat serum in PBST for 1 hour at RT. Primary antibodies were diluted in 5% normal goat serum in PBST (antibody dilution buffer) and applied overnight at 4°C. Primary antibodies and their working dilutions were as follows: CREB1(1:500, Abcam, 35-0900), p-CREB1Ser133 (1:500, Invitrogen, MA1-114), MAP2 (1:500; Abcam, ab151559), p-tau-231 (1:500,Cell signaling, 71429), PKA (1:500, Invitrogen, PA5-17626), BNDF (1:500, Abcam, ab108319), Aβ (1:500, Creative Biolabs, TAB-0809CLV), Synapsin I(1:500, Invitrogen, A-6442), and PSD95(1:500,Abcam, ab13552). The coverslips were then washed three times with PBST for 5 minutes each at RT. Secondary antibodies were applied in antibody dilution buffer and incubated for 1 hour at RT, followed by three washes with PBST. Stained for plaques with ThioflavinS (Sigma-Aldrich, 2 mg/10mL) for 8 min followed by three 2-min washes with 50% ethanol at room temperature. Cells were stained with 1 μg/mL Hoechst for 10 minutes at RT, briefly rinsed in dH2O, and dried. Coverslips were mounted on glass slides with Immu-Mount (Fisher Scientific). Fluorescent images were acquired using scanning confocal microscopy (LSM880, Carl Zeiss) at 40× or 63× magnification. Images were processed with Zen software (Carl Zeiss), and signal intensity was measured using ImageJ. I mmunohistochemistry (IHC) Paraffinized sections were deparaffinized and rehydrated before antigen retrieval using the IHC Antigen Retrieval Solution (Thermo Fisher). Endogenous peroxidase activity was blocked with 3% H 2 O 2 in PBST. Sections were then blocked with 10% goat serum in PBST with 0.3% Triton X-100. Rabbit anti-CREB1 antibody (1:500, Abcam, ab32515) was applied overnight at 4°C. The sections were subsequently treated with the VECTASTAIN® Elite® ABC-HRP Kit (Vector Laboratories) and developed using the ImmPACT® DAB Substrate Kit (SK-4105, Vector Laboratories). Positive regions were quantified using ImageJ. Western blotting Brain tissues, including human post-mortem AD brains and mouse brains, were homogenized using RIPA buffer (pH 7.4) supplemented with phosphatase inhibitor mixture I and II (Sigma-Aldrich) and a complete protease inhibitor mixture (Roche). After homogenization, the samples underwent three freeze-thaw cycles using dry ice, followed by centrifugation at 15,000 x g for 15 minutes to collect clear supernatants and freezing at -80°C. The protein samples were extracted from 2-month-old hiPSC-derived cortical neurons. In brief, neurons grown in each well of the 6-well plate were washed once with cold PBS and then lysed in 200 μl of soluble lysis buffer containing Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology). Protein concentrations were quantified using a BCA assay kit (Pierce), and SDS-PAGE was utilized for protein separation, with subsequent transfer to PVDF membranes for immunoblot analysis. Membranes were blocked in 5% non-fat milk in TBST for 1 hour at RT and then incubated with primary antibodies overnight at 4°C with continuous shaking. Primary antibodies and their working dilutions were as follows: CREB1(1:1000, Abcam, ab32515), p-CREB1 (1:1000, Cell Signaling, 9198), MAP2 (1:500, Invitrogen, PA1-10005), p-tau231 (1:1000, Cell Signaling, 71429), total tau(1:1000, Invitrogen, MA5-12808), PKA (1:1000, Cell Signaling, 4782), BNDF (1:1000, Abcam, ab108319), Aβ (1:1000, Creative Biolabs, TAB-0809CLV), and β-actin (1:1000, Invitrogen, MA5-15739-HRP). Target antigens were detected using appropriate HRP-conjugated secondary antibodies and visualized using Pierce™ Fast Western Blot Kits or SuperSignal™ West Femto ECL substrate (Thermo Scientific, 34094). Quantitative real-time PCR RNAs from human post-mortem AD brains or mouse brain samples were extracted by the Quick-RNA MicroPrep kit (Zymo Research). For mRNA analysis, 20-50 ng of total RNA from each sample was reverse-transcribed with Superscript III (Invitrogen,18080093). One-tenth of the reverse transcription reaction was used for subsequent qPCRs, which were performed on Viia7 thermocycler (Applied Biosystems) using SYBR Green PCR mix (Roche) for each gene of interest and GAPDH (as an internal control). CREB1 primer sequencing Forward: ACTCAGCCGGGTACTACCAT; Reverse: ACAGCGTAATAATATGCTCTCCT. GAPDH primer sequencing Forward: GGAGCGAGATCCCTCCAAAAT; Reverse: GGCTGTTGTCATACTTCTCATGG. Each qPCR reaction was performed in triplicates. PKA kinase and cAMP activity assay The method for preparation of conditioned medium (CM) was as described previously[32]. Briefly, iPSC-derived nearly two months old were plated in six-well plates at a density of 5 × 10 4 cells per well. After 48 h, when cells reached approximately 80% confluence, the after three times of neuron basal medium washing with DMEM-12. At 48h after incubation, the supernatants were harvested as CMs for use in experiments. CMs were centrifuged at 15,000 rpm for 15 min at 4°C, and the total amount of proteins in the supernatant was measured by a Bio-Rad protein assay, based on the method of Bradford, using BSA as a standard. PKA (Abcam, ab139435) and cAMP (Cell Signaling,4339) activity was measured using an ELISA kit according to the manufacturer’s instructions. Assessment of Inflammatory factor by ELISA Human iPSC-derived microglia were treated with pre-formed synthetic Human Synthetic Amyloid Beta 1-42 Pre-formed Fibrils (5 μM, CD creative diagnostics, PFF12) for 48 hours to model amyloid exposure. Fibrils were prepared by incubating the peptide at 37°C for 48 hours to induce aggregation. After treatment, cells were thoroughly washed to eliminate exogenous Aβ, then treated with Rolipram (20 μM) and TAK-063 (2020 μM) for 24 hours to assess the effect of dual PDE4/10 inhibition on inflammation and Aβ clearance. ELISA was performed to quantify secreted inflammatory cytokines from a conditioned medium (CM), and IF was used to evaluate Aβ accumulation and clearance within microglia. I10nflammatory factors (IFN-γ, IL-1β, IL-2, IL-6, IL-8, IL-10, and TGF-β) in APP iPSC-derived microglia were quantified using the U-PLEX kit (U-PLEX 10-Assay, 96-Well SECTOR plate, Cat. No. K15276K-2) from Meso Scale Discovery (MSD), following the manufacturer’s instructions. After treatment with combined PDE4/10 inhibitors, culture supernatants were collected. The pre-coated 96-well plates were blocked for 1 hour at room temperature, and then 50 µL of supernatants and standards were added and incubated for 2 hours with shaking. Plates were washed, and SULFO-TAG-conjugated detection antibodies were added and incubated for 1 hour with shaking. After a final wash, MSD Read Buffer was added, and the plates were read on the MSD SECTOR Imager. Cytokine concentrations were determined using standard curves from recombinant cytokines and analyzed with MSD Discovery Workbench software. Experiments were performed in triplicate. Human Aβ ELISA assays For quantitative analysis of Aβ42 and Aβ40 levels in human cortical neurons, ELISAs were conducted following the standard protocol (Thermo Fisher Scientific). iPSC-derived neurons were differentiated by plating an equal number of NPCs and maintaining the cultures in 6-well plates for 4 weeks. Forty-eight hours before harvest, the medium was fully replaced with 4 ml/well of fresh neuron basal medium. The conditioned medium was collected, centrifuged to remove insoluble material, and stored at -80°C. Aβ40 and Aβ42 levels were measured using the Human Aβ (1–40) ELISA Kit II (CAT# KHB3482) and Human Aβ (1–42) ELISA Kit (CAT# KHB3441), respectively, following the manufacturer's instructions. Aβ concentrations were normalized to the protein levels of the culture. Absorbance was measured with a Varioskan LUX Multimode Microplate Reader. Behavior tests All behavior experiments were performed between 8 am and 12 pm in a blinded fashion. All mice were 6 months old at the time of the assay. Mice were transported from their home vivarium room to the behavior core and allowed 30 min to habituate before beginning each test. Y-Maze Task APP/PS1 mice were subjected to the Y-Maze task to assess spatial memory and exploratory behavior. During a 10-minute testing period, spontaneous alternation behavior, the total number of novel arm entries, and the distance traveled were recorded to evaluate the animals' cognitive function and exploratory activities. The Y-Maze consists of three arms, and alternation behavior was defined as consecutive entries into each of the three different arms. Open field test The open-field test was used to evaluate general motor activity and anxiety-like behavior. At 6 months of age, APP/PS1 mice were placed in the center of a square open field arena, and their movements were tracked for 10 minutes. The total distance traveled and the time spent in the center of the arena were quantified. Increased time spent in the center is typically interpreted as reduced anxiety, while distance traveled reflects overall motor activity. Novel object exploration task The novel object exploration task was conducted to assess spatial memory and recognition memory in mice. During the 10-minute testing session, two objects were placed in an open field arena: one familiar object and one novel object. The amount of time spent exploring each object and the percentage of novel object contact were recorded. A preference for the novel object, indicated by a higher percentage of time spent interacting with it, suggests intact recognition memory. Electrophysiology Acute brain slices were prepared from experiment mice. Mice were deeply anesthetized with isoflurane and transcardially perfused with ice-cold, oxygenated (95% O₂/5% CO₂) cutting solution containing (in mM): 110 choline chloride, 25 NaHCO₃, 25 glucose, 11.6 sodium ascorbate, 7 MgCl₂, 3.1 sodium pyruvate, 2.5 KCl, 1.25 NaH₂PO₄, and 0.5 CaCl₂. Brains were rapidly removed and 300-μm coronal slices containing the cortex or hippocampus were cut using a vibratome (Leica VT1200S). Slices were incubated in artificial cerebrospinal fluid (aCSF; in mM: 125 NaCl, 2.5 KCl, 25 NaHCO₃, 1.25 NaH₂PO₄, 2 CaCl₂, 1 MgCl₂, 25 glucose) at 34°C for 30 minutes and then maintained at room temperature until recording. Whole-cell patch-clamp recordings were performed at 32–34°C using borosilicate glass pipettes (3–5 MΩ) filled with an internal solution containing (in mM): 135 K-gluconate, 5 KCl, 10 HEPES, 0.1 EGTA, 4 Mg-ATP, 0.3 Na-GTP, and 10 phosphocreatine (pH 7.3 with KOH, 290 mOsm). Neurons were visualized using infrared differential interference contrast microscopy. Signals were amplified with a MultiClamp 700B amplifier (Molecular Devices), low-pass filtered at 2 kHz, and digitized at 10 kHz using a Digidata 1550B digitizer and pClamp software (Molecular Devices). Series resistance was monitored throughout recordings, and cells with >20% change were excluded from the analysis. Spontaneous and evoked excitatory and inhibitory postsynaptic currents were recorded and analyzed using Clampfit and custom-written MATLAB scripts. Quantification and Statistical Analysis All quantitative data are expressed as mean ± SEM from a minimum of three independent experiments. Statistical analyses were conducted using GraphPad Prism 10. Comparisons between two groups were evaluated using unpaired two-tailed Student’s t-test, while multiple group comparisons were assessed by one-way ANOVA followed by Tukey’s post-hoc test. A p-value < 0.05 was considered statistically significant. Sample sizes were determined based on standards from similar published studies Results Downregulation of CREB1 expression across human samples To investigate the potential role of the CREB1 gene in Alzheimer's disease (AD) in the human population, we extracted genetic summary data from the CREB1 locus (hg19, chr2:208194615−208670284) from a large-scale genome-wide association study to test the association of CREB1 polymorphisms with AD[28]. Among the 1,259 single-nucleotide polymorphisms (SNPs) analyzed in this region, SNP rs10932205 is observed to associate with AD at a high significance level, implying a novel previously unreported potential risk factor of AD (chr2:208554332, P-value=6.75×10⁻ 4 ) (Fig. S1). Next, CREB1 expression was examined in both human postmortem brain tissue and human induced pluripotent stem cell (iPSC)-derived cortical neuron samples. We observed a significant reduction in the CREB1-positive area and intensity in human postmortem brain tissue from AD patients compared to age-matched normal brain tissue. ( p < 0.0001, Fig. 1A-C). To validate these findings at both mRNA and protein levels, qPCR and western blotting were performed on postmortem cerebral cortex samples, confirming a dramatically reduced level of CREB1 protein in AD ( p < 0.0001, Fig. 1D and E). This corroborates the observation of decreased CREB1 expression in AD and provides direct evidence of both RNA and protein-level changes. For in vitro studies, we employed isogenic iPSC lines with or without Swedish mutation on the amyloid precursor protein gene (hereafter referred to as WT or APP iPSC), to recapitulate the in vivo findings and to investigate the molecular and cellular mechanisms of CREB1-associated AD pathogenesis (Fig. S2). Immunofluorescence microscopy revealed a notable reduction in CREB1 intensity in 2-month-old AD mutant neurons compared to WT neurons ( p < 0.0001, Fig. 1G-I). Similar to the findings in human postmortem brain tissue, we observed a significant decrease in both CREB1 protein and mRNA levels in 2-month-old AD mutant neurons compared to WT neurons ( p < 0.001, Fig. 1 J and K, S2F). Furthermore, we conducted ELISA to measure the concentrations of CREB1 in both cerebrospinal fluid (CSF) and conditioned medium of neuron culture. The results revealed a dramatic reduction of CREB1 concentrations in both AD patients and APP iPSC-derived human cortical neurons ( p < 0.0001, Fig. 1 F and L). In summary, our comprehensive investigation, spanning human postmortem brain tissue, induced APP mutant neurons, and CSF samples, consistently indicates a significant decrease in CREB1 level in AD pathology. CREB1 deficiency was associated with exacerbated AD pathology in human cortical neurons To study the effect of CREB1 on AD pathology, we constructed CREB1 knockout (CREB1-KO) iPSC lines and assessed the levels of Aβ and phosphorylated tau 231 (p-tau231) in 2-month-old iPSC-derived cortical neurons (Fig. 2A). Aβ plays a central role in AD by forming amyloid plaques[33, 34]. Our results demonstrated a significant elevation in the intensity of Aβ in both the WT and APP-CREB1 deficient neurons compared to their corresponding isogenic WT neurons ( p <0.0001, Fig. 2B and C). Furthermore, we observed a greater accumulation of Aβ around the nucleus in CREB1-deficient neurons compared to their corresponding isogenic WT neurons ( p < 0.0001, Fig. 2D). Recent study has shown that p-tau231 is a new biomarker for incipient AD pathology[35]. We confirmed that p-tau231 intensity was substantially enhanced in both the WT and APP-CREB1 deficient neurons compared to their corresponding isogenic WT neurons ( p <0.0001, Fig. 2E and F). Meanwhile, we found that p-tau231 positive puncta was notably elevated in the APP-CREB1 deficient neurons ( p <0.0001, Fig. 2G). To further validate our findings, we performed ELISA analysis to measure the concentrations of Aβ42 and Aβ40 in the conditioned medium of 2-month-old human cortical neurons (Fig. 2H). Our results revealed that APP-CREB1 deficient neurons exhibited significantly elevated Aβ42 concentrations, while decreased Aβ40 concentrations compared to WT neurons (Fig. 2I-J). The ELISA results provide further evidence that CREB1 plays a role in regulating the production, processing, and clearance of Aβ peptides in AD. To assess the Aβ and p-tau231protein expression levels, WB analysis was performed on the fractions of iPSC-derived human cortical neurons. The WB results revealed a substantial increase in Aβ and p-tau231 protein expression in the CREB1-deficient neurons compared to their corresponding isogenic WT neurons ( p <0.01, Fig. 2 K-M). However, the total tau protein did not show a significant change between WT and CREB1-deficient neurons. Our study demonstrates that CREB1 deficiency significantly enhances the accumulation and intensity of Aβ and p-tau231 in human cortical neurons, indicating that CREB1 plays a crucial role in modulating these key biomarkers of AD pathology. Dual inhibition of PDE4/10 activated the cAMP-PKA-CREB pathway PDE inhibitors have been shown to enhance CREB1 activity by increasing cAMP levels and PKA activation in AD[18, 19, 36]. To examine whether the dual inhibition of PDE4/10 activates the cAMP-PKA-CREB pathway, we employed a combination of PDE4 inhibitor (Rolipram) and PDE10 inhibitor (TAK-063) to stimulate cAMP levels and CREB1 activity in AD (Fig. 3A). Initially, we confirmed that both Rolipram and TAK-063 activated cAMP and PKA levels in neurons; Furthermore, we optimized the concentration of the combined application of Rolipram and TAK-063 inhibitors, ranging from 0 to 20 μM for each inhibitor. We found that the intracellular cAMP and PKA levels significantly elevated in a dose-dependent manner, peaking at 20 μM ( p < 0.01, Fig. 3 B and D). Importantly, we observed that the combined application of Rolipram and TAK-063 showed a better effect than either inhibitor alone ( p < 0.01, Fig. 3 C and E). Next, to investigate how the combined application of Rolipram and TAK-063 inhibitors affects the cAMP-PKA-CREB pathway, we performed WB analysis on this signaling-related protein expression on APP mutant neurons. We found that PKA expression levels were markedly elevated after treatment with dual inhibition Rolipram and TAK-063 ( p < 0.01, Fig. 3 F and H). Additionally, we discovered that the expression of pCREB1 (Ser133) was significantly higher in the Rolipram and TAK-063 combined group compared to single applications and the non-treated control group ( p < 0.01, Fig. 3 F and G). Consistently, Rolipram and TAK-063 together induce a notable elevation in the cAMP-PKA-CREB pathway as well as its downstream target BDNF ( p < 0.01, Fig. 3 F and I). To further corroborate our results, we conducted immunostaining to quantify the expression of pCREB1 (Ser133) in the APP mutant neuron. There is a significant increase in pCREB1 (Ser133) intensity and the percentage of positively stained area in the APP mutant neurons ( p <0.0001, Fig. 3J-L). In summary, our study demonstrates that the combined application of PDE4/10 inhibitors, specifically Rolipram and TAK-063, effectively activates the cAMP-PKA-CREB pathway in AD model neurons. This activation results in elevated levels of PKA expression and pCREB1, indicative of enhanced neuronal signaling. Moreover, the observed increase in downstream BDNF expression suggests a potential mechanism for neuroprotection and synaptic plasticity. Dual inhibition of PDE4/10 rescues AD Pathology We found that higher PDE4A expression in human blood is associated with an increased risk of AD (Odds rate (OR): 1.145, 95% confidence interval (CI)=1.006-1.303, P-value=0.040) using summary-based Mendelian randomization (MR) analysis. Such association was replicated using alternative inverse-variance weighted MR analysis (OR: 1.141, 95% CI=1.018-1.278, P-value=0.022) (Table. S2) Next, to investigate whether the dual inhibition of PDE4/10 rescues AD pathology, we performed immunofluorescence microscopy (IF) and western blotting (WB) to examine levels of Aβ and p-tau231, along with quantification of Aβ40 and Aβ42 by ELISA in APP mutant neurons (Fig. 4A). ELISA of Aβ42 and Aβ40 was conducted for the conditioned media of 2 month-old iPSC-derived neurons. The combined application of Rolipram and TAK-063 effectively reduces Aβ42 concentration while elevating Aβ40 concentration in the APP-CREB1-KO neurons. Dual inhibition effectively normalizes Aβ42 and Aβ40 concentrations in APP-CREB1-KO neurons to levels comparable to those in WT neurons, suggesting an alternative pathway that could alleviate amyloid pathology independently of the cAMP-PKA-CREB pathway (Fig. 4B and C) IF demonstrates combined application of Rolipram and TAK-063 markedly reduced Aβ intensity compared to untreated APP mutant neurons ( p <0.0001, Fig. 4D and E). Furthermore, we observed that p-tau231 intensity was also significantly enhanced in the Rolipram and TAK-063 combined group ( p <0.0001, Fig. 4F and G). Consistent with the IF results, WB analysis confirms that both Aβ and p-tau231 protein levels dramatically decreased in the Rolipram and TAK-063 combined group (Fig.4H-J ). However, Aβ and p-tau231 expression levels in the Rolipram and TAK-063 combined group are not significantly different from those in WT neurons (Fig.4E, G, I, and J). These findings suggest that Rolipram and TAK-063 treatment can rescue AD pathology in APP mutant neurons. Dual inhibition of PDE4/10 reduced inflammation and exogenous Aβ accumulation in iPSC-derived microglia In AD pathogenesis, inflammation contributes to neurodegeneration through the activation of immune responses and the release of pro-inflammatory cytokines[37]. To investigate the impact of the dual inhibition PDE4/10 on inflammation, we conducted ELISA to characterize pro-inflammatory and anti-inflammatory factors in the conditioned medium of APP iPSC-derived microglia (Fig.5A and B). iPSC-derived microglia were exposed to pre-formed synthetic human Aβ1-42 fibrils, followed by treatment with dual PDE4/10 inhibitors to assess their anti-inflammatory effects. We found a notable decrease in pro-inflammatory cytokines, including IFN-γ, IL-1β, IL-2, IL-6, and IL-8, after combined treatment with Rolipram and TAK-063 in APP iPSC-derived microglia ( p <0.05, Fig.5 C-G). Conversely, anti-inflammatory cytokines IL-10 and TGF-β display a significant increase in the Rolipram and TAK-063 combined group ( p <0.05, Fig.5H and I). These results suggest that the dual inhibition of PDE4/10 effectively mitigates inflammation in iPSC-derived microglia, promoting an anti-inflammatory response. Previous studies show that the accumulation of Aβ plaques triggers a chronic inflammatory response, exacerbating neuronal damage and cognitive impairment[38]. In our study, we observed that exogenous Aβ accumulation was significantly reduced in APP iPSC-derived microglia treated with a combination of Rolipram (PDE4 inhibitor) and TAK-063 (PDE10 inhibitor) following activation with pre-formed synthetic Aβ1-42 fibrils. ( p <0.0001, Fig.5 J and K). In summary, these results suggest that the dual inhibition PDE4/10 reduces inflammation, and leads to a sequential decrease in exogenous Aβ accumulation in activated APP iPSC-derived microglia. Dual inhibition of PDE4/10 is critical for mitigating Aβ pathology and improving cognitive deficits in mice. To further investigate the role of the dual inhibition of PDE4/10 in vivo , we conducted nasal delivery of the inhibitors to APP/PS1 mice. We administered 1 mg/kg of combined Rolipram & TAK-063 (0.5 mg/kg each) via nasal delivery to 6-month-old adult APP/PS1 mice once daily for four weeks, followed by behavioral testing and brain analysis (Fig.6A). Our results indicate a significant reduction in both Aβ plaque and Thioflavin-S and Aβ co-staining positive area following combined administration of Rolipram and TAK-063 ( p <0.05, Fig.6B-E). Additionally, we confirmed that both Rolipram and TAK-063 individually decreased Aβ plaque volume and area compared to the untreated sham group; however, its effects were less substantial than those observed with the combined administration of Rolipram and TAK-06 ( p <0.01, Fig.6B-E). Consequently, we carried out an extensive series of behavioral tests with the four experimental groups, dual application of the two inhibitors, single inhibitor treatments, and non-treated control. Motor activity and spatial memory were assessed. After 4 weeks of combined Rolipram and TAK-063 treatment in APP/PS1 mice, there is approximately 32% increase in the percentage of spontaneous alternation compared to the non-treated control mice ( p <0.0001, Fig. 6F). Additionally, the combined Rolipram and TAK-063 treatment mice shows a significant ~22% increase in the percentage of entries into the novel arm compared to the non-treated control mice, as well as an increase in travel distance by approximately 3 meters compared to the non-treated control mice ( p <0.0001, Fig. 6G). Meanwhile, we assessed motor activity by open field test and found that the time spent in the center increased by approximately 28 seconds, along with a travel distance of approximately 2.1 meters longer compared to the non-treated control mice ( p <0.0001, Fig. 6H). Furthermore, our results showed that spatial memory, measured by novel object contact, increases by ~26%, and the exploration time increases by ~12 seconds in the combined Rolipram and TAK-063 treatment mice compared to the untreated control mice ( p <0.0001, Fig. 6I). In summary, our results demonstrated that the dual inhibition of PDE4/10 can reduce Aβ pathology and improve cognitive deficits in APP/PS1 mice. Dual inhibition of PDE4/10 promotes neuronal resilience in AD Next, to evaluate the impact of dual inhibition of PDE4/10 on neuronal resilience in AD, we assessed both pre-and post-synaptic changes, along with electrophysiological properties, in APP iPSC-derived human cortical neurons and APP/PS1 mouse model. Treatment of APP iPSC-derived human cortical neurons with a combination of Rolipram and TAK-063 resulted in a significant increase in the total puncta of the presynaptic protein Synapsin I and the postsynaptic protein PSD95 (Fig. 7A-C). Additionally, the colocalization puncta number of Synapsin I and PSD95 was significantly increased (Fig. 7A and D), suggesting the combination of Rolipram and TAK-063 treatment improves synaptic connectivity. These findings indicate that dual inhibition of PDE4/10 may contribute to enhanced synaptic resilience in the context of AD. Electrophysiological recordings from the APP/PS1 mouse brain further supported these observations. Measurement of miniature excitatory postsynaptic currents (mEPSCs) showed an increase in synaptic activity in Rolipram and TAK-063 treated mouse brains compared to the non-treated (Fig. 7E). Furthermore, measurement of miniature inhibitory postsynaptic currents (mIPSCs) reveals the establishment of a functional inhibitory network in the Rolipram and TAK-063 treated mice (Fig. 7F). These findings suggest that dual PDE4/10 inhibition with Rolipram and TAK-063 modulates synaptic activity, promotes functional inhibitory network formation, and enhances neuronal resilience, mitigating synaptic dysfunction in AD and highlighting a promising therapeutic strategy for neurodegenerative diseases. Discussion This study provides compelling evidence that CREB1 downregulates in AD. Moreover, CREB1-deficient neurons drive the accumulation of Aβ and p-tau231, which are crucial biomarkers of AD pathology. By leveraging a multifaceted approach that includes human postmortem brain tissue, iPSC-derived human cortical neurons, macroglia, and in vivo APP mutant AD iPSC model, this study robustly demonstrates that CREB1 deficiency exacerbates these AD pathological markers. Importantly, the dual PDE4/10 inhibition activates the cAMP-PKA-CREB pathway, effectively decreasing and normalizing Aβ and p-tau231 levels, and mitigating inflammation. This dual inhibition of PDE4/10 strategy not only alleviates AD pathology but also significantly improves cognitive function and neuronal resilience in APP/PS1 mice, emphasizing the innovative findings of this study and its potential for therapeutic advancements. In our study, we delve into the therapeutic potential of a dual inhibition strategy targeting both PDE4/10 in AD. Prior research has underscored the pivotal role of the cAMP-PKA-CREB signaling pathway in AD pathogenesis[39, 40]. Specifically, inhibition of PDE4 has been shown to elevate cAMP levels, triggering the activation of PKA and subsequent phosphorylation of CREB, processes pivotal for synaptic plasticity and memory formation—functions that are notably impaired in AD[41]. A previous study showed that pCREB1 (Ser133) plays a significant role in AD by modulating gene expression related to memory formation and neuronal survival[39]. Consistent with these studies, we confirmed a significant increase in cAMP and pCREB1 (Ser133) levels following dual PDE4/10 inhibition in AD mutant neurons. Despite the promising effects of Rolipram, a PDE4 inhibitor, in enhancing synaptic plasticity and promoting neurogenesis, its clinical utility remains constrained due to safety concerns, including gastrointestinal issues and an increased risk of seizures[42, 43]. Similarly, TAK-063, a novel compound targeting neural activity, holds promise in addressing neuronal diseases such as schizophrenia, Huntington's disease, and other mental health disorders in clinical trials[44, 45]. Our study provides evidence that PDE10 inhibitor (TAK-063) reduces the pathology of AD. Studies have illuminated that PDE10 inhibition induces elevated cGMP levels, activating downstream signaling cascades that intersect with cAMP pathways, thereby enhancing neuronal function and synaptic plasticity. Our study builds upon previous work by implementing a dual inhibition strategy targeting both PDE4 and PDE10[46]. This innovative approach not only enhances synaptic plasticity but also provides neuroprotective and anti-inflammatory effects, offering a more comprehensive therapeutic intervention. Additionally, by activating the cAMP-PKA-CREB signaling pathway, our approach can potentially mitigate side effects associated with high doses of single PDE4 inhibitor treatment, and boosting the inhibition of PDE10 modulates neural signaling and elevates the anti-inflammatory effects. During our study, we also verified that dual inhibition of PDE4/10 promotes both cognitive function and neuronal resilience in AD. This strategy leverages the synergistic interplay between PDE4/10 enzymes, presenting a promising multifaceted strategy for treating AD. By leveraging the synergistic interplay between PDE4/10 inhibitors, we observed a significant increase in downstream brain-derived neurotrophic factor (BDNF) expression in the AD mutant neurons model. This upregulation of BDNF suggests a potential mechanism for neuroprotection and enhanced synaptic plasticity, which are critical factors in maintaining neuronal health and function[47]. Moreover, the combined application of PDE4/10 inhibitors was shown to reduce inflammation and lead to a sequential decrease in Aβ accumulation in activated APP iPSC-derived microglia[48]. This reduction in Aβ pathology is particularly noteworthy as it addresses one of the hallmark features of AD[49]. Additionally, we discovered that tau-231 levels increased in CREB1-deficient neurons, while a notable reduction was observed after dual inhibition of PDE4/10 in neurons. Our results demonstrated that this therapeutic approach significantly mitigated Aβ and tau pathology in AD mutant neurons. Additionally, our electrophysiology results revealed significant improvements in neural signaling, including enhanced synaptic stability and functional network formation, following dual inhibition of PDE4/10 in APP/PS1 models. These findings underscore the potential efficacy of this approach in promoting neuronal resilience and function in AD. The observed pre- and post-synaptic changes further highlight the strategy's ability to support the integrity and connectivity of neural circuits, which are critical in combating the synaptic degeneration characteristic of AD[50]. The combination of Rolipram and TAK-063 not only improved synaptic connectivity, as shown by increased colocalization of Synapsin I and PSD95, but also modulated electrophysiological properties, leading to more robust synaptic activity and the formation of a functional inhibitory network. This dual inhibition approach addresses both excitatory and inhibitory synaptic dysfunctions, offering a promising strategy to mitigate progressive synaptic loss and cognitive decline in AD. However, it is essential to acknowledge the limitations of our study. One crucial aspect is the necessity to evaluate the long-term safety and efficacy of dual PDE4/10 inhibition in APP/PS1 mouse models. Additionally, further investigation is required to determine the precise dosage to achieve therapeutic benefits without inducing adverse side effects. Furthermore, future studies should consider the impact of dual PDE4/10 inhibition on other signaling pathways and their potential interactions with existing AD treatments. Additionally, there is a need to elucidate the detailed molecular mechanisms involved and to explore the long-term effects of combined PDE4/10 inhibition across diverse AD models. In conclusion, our study demonstrates that dual inhibition of PDE4/10 revitalizes neuronal resilience, presenting a promising strategy for combating AD. By targeting the cAMP-PKA-CREB signaling pathway, this approach effectively reduces inflammation and Aβ pathology, while enhancing synaptic plasticity and cognitive function. Our findings underscore the potential of dual PDE4/10 inhibition to provide more effective treatment compared to single-target strategies, offering a greater therapeutic benefit for this devastating disease. Abbreviations AD Alzheimer’s disease Aβ Amyloid‑beta APP Amyloid precursor protein BRAAK Braak neurofibrillary tangle stage C-KO CREB1 knockout CERAD Consortium to Establish a Registry for Alzheimer’s Disease CM Conditioned medium CREB1 cAMP response element‑binding protein 1 CSF Cerebrospinal fluid ELISA Enzyme‑linked immunosorbent assay FACS Fluorescence‑activated cell sorting FDX Final diagnosis GWAS Genome‑wide association study IF Immunofluorescence IL‑1β, IL‑2, IL‑6, etc. Interleukin‑1β, Interleukin‑2, Interleukin‑6, Interleukin‑8, Interleukin‑10 Iba1 Ionized calcium binding adapter molecule 1 MAP2 Microtubule‑associated protein 2 mEPSC Miniature excitatory postsynaptic current mIPSC Miniature inhibitory postsynaptic current PKA Protein kinase A PDE4 Phosphodiesterase type 4 PDE10 Phosphodiesterase type 10 p‑CREB1 Ser133 Phosphorylated CREB1 at serine 133 p‑tau231 Phosphorylated tau at threonine 231 PMD Postmortem delay PSD95 Postsynaptic density protein 95 qPCR (RT‑qPCR) Quantitative reverse transcription PCR SNP Single nucleotide polymorphism TAF1 TATA‑box binding protein‑associated factor 1 TGF‑β Transforming growth factor beta Thioflavin‑S Thioflavin‑S stain Y‑maze Y‑shaped maze (spatial memory test) Declarations Acknowledgements This research was funded by Jilin Dashu Biotechnology Co., Ltd., which holds intellectual property and patents related to this work. Author contributions X.R. and H.Z. contributed to conceptualization. H.F., J.S., M.Y., P.W., C.L., B.C., P.Z., C.C., and L.B. performed the experiments. Y.Q. and J.G. conducted the GWAS analysis. X.R. conducted formal data analysis, drew abstract graphic and wrote the original draft, H.Z. provided supervision. Funding Jilin Dashu Biotechnology Co., Ltd. for neurogenerative research. Competing interests The authors declare no competing interest Ethics declaration All animal experiments in this study were approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University Hospital and were conducted in accordance with institutional guidelines for the Care and Use of Laboratory Animals. All procedures involving human iPSCs or postmortem human brain tissue were approved by the Institutional Review Board of the Second Affiliated Hospital of Soochow University. Written informed consent was obtained from all participants or their legal guardians, and all human tissue research complied with the ethical principles outlined in the Declaration of Helsinki. Data availability Data will be made available on request References Mathys H, Peng Z, Boix CA, Victor MB, Leary N, Babu S, Abdelhady G, Jiang X, Ng AP, Ghafari K et al : Single-cell atlas reveals correlates of high cognitive function, dementia, and resilience to Alzheimer's disease pathology . Cell 2023, 186 (20):4365-4385.e4327. Chen S, Cao Z, Nandi A, Counts N, Jiao L, Prettner K, Kuhn M, Seligman B, Tortorice D, Vigo D et al : The global macroeconomic burden of Alzheimer's disease and other dementias: estimates and projections for 152 countries or territories . Lancet Glob Health 2024, 12 (9):e1534-e1543. Aiello Bowles EJ, Crane PK, Walker RL, Chubak J, LaCroix AZ, Anderson ML, Rosenberg D, Keene CD, Larson EB: Cognitive Resilience to Alzheimer's Disease Pathology in the Human Brain . J Alzheimers Dis 2019, 68 (3):1071-1083. Stern Y: Cognitive reserve in ageing and Alzheimer's disease . Lancet Neurol 2012, 11 (11):1006-1012. Cummings JL, Tong G, Ballard C: Treatment Combinations for Alzheimer's Disease: Current and Future Pharmacotherapy Options . J Alzheimers Dis 2019, 67 (3):779-794. Shanks HRC, Onuska KM, Massa SM, Schmitz TW, Longo FM: Targeting Endogenous Mechanisms of Brain Resilience for the Treatment and Prevention of Alzheimer's Disease . J Prev Alzheimers Dis 2023, 10 (4):699-705. Yuan L, Zhang J, Guo JH, Holscher C, Yang JT, Wu MN, Wang ZJ, Cai HY, Han LN, Shi H et al : DAla2-GIP-GLU-PAL Protects Against Cognitive Deficits and Pathology in APP/PS1 Mice by Inhibiting Neuroinflammation and Upregulating cAMP/PKA/CREB Signaling Pathways . J Alzheimers Dis 2021, 80 (2):695-713. Ning Z, Zhong X, Wu Y, Wang Y, Hu D, Wang K, Deng M: β-asarone improves cognitive impairment and alleviates autophagy in mice with vascular dementia via the cAMP/PKA/CREB pathway . Phytomedicine 2024, 123 :155215. Sassone-Corsi P: The cyclic AMP pathway . Cold Spring Harb Perspect Biol 2012, 4 (12). Skaper SD, Facci L, Zusso M, Giusti P: Synaptic Plasticity, Dementia and Alzheimer Disease . CNS Neurol Disord Drug Targets 2017, 16 (3):220-233. Parker T, Wang KW, Manning D, Dart C: Soluble adenylyl cyclase links Ca(2+) entry to Ca(2+)/cAMP-response element binding protein (CREB) activation in vascular smooth muscle . Sci Rep 2019, 9 (1):7317. Guan R, Lv J, Xiao F, Tu Y, Xie Y, Li L: Potential role of the cAMP/PKA/CREB signalling pathway in hypoxic preconditioning and effect on propofol ‑induced neurotoxicity in the hippocampus of neonatal rats . Mol Med Rep 2019, 20 (2):1837-1845. Luo Y, Kuang S, Li H, Ran D, Yang J: cAMP/PKA-CREB-BDNF signaling pathway in hippocampus mediates cyclooxygenase 2-induced learning/memory deficits of rats subjected to chronic unpredictable mild stress . Oncotarget 2017, 8 (22):35558-35572. Zhang T, Luu MDA, Dolga AM, Eisel ULM, Schmidt M: The old second messenger cAMP teams up with novel cell death mechanisms: potential translational therapeutical benefit for Alzheimer's disease and Parkinson's disease . Front Physiol 2023, 14 :1207280. Weller J, Budson A: Current understanding of Alzheimer's disease diagnosis and treatment . F1000Res 2018, 7 . Ricciarelli R, Fedele E: cAMP, cGMP and Amyloid β: Three Ideal Partners for Memory Formation . Trends Neurosci 2018, 41 (5):255-266. Azevedo MF, Faucz FR, Bimpaki E, Horvath A, Levy I, de Alexandre RB, Ahmad F, Manganiello V, Stratakis CA: Clinical and molecular genetics of the phosphodiesterases (PDEs) . Endocr Rev 2014, 35 (2):195-233. Gurney ME, D'Amato EC, Burgin AB: Phosphodiesterase-4 (PDE4) molecular pharmacology and Alzheimer's disease . Neurotherapeutics 2015, 12 (1):49-56. Zagorska A, Partyka A, Bucki A, Gawalskax A, Czopek A, Pawlowski M: Phosphodiesterase 10 Inhibitors - Novel Perspectives for Psychiatric and Neurodegenerative Drug Discovery . Curr Med Chem 2018, 25 (29):3455-3481. Bhat A, Ray B, Mahalakshmi AM, Tuladhar S, Nandakumar DN, Srinivasan M, Essa MM, Chidambaram SB, Guillemin GJ, Sakharkar MK: Phosphodiesterase-4 enzyme as a therapeutic target in neurological disorders . Pharmacol Res 2020, 160 :105078. Campbell SL, van Groen T, Kadish I, Smoot LHM, Bolger GB: Altered phosphorylation, electrophysiology, and behavior on attenuation of PDE4B action in hippocampus . BMC Neurosci 2017, 18 (1):77. Yang Y, Ma S, Wei F, Liang G, Yang X, Huang Y, Wang J, Zou Y: Pivotal role of cAMP-PKA-CREB signaling pathway in manganese-induced neurotoxicity in PC12 cells . Environ Toxicol 2019, 34 (9):1052-1062. Guo H, Cheng Y, Wang C, Wu J, Zou Z, Niu B, Yu H, Wang H, Xu J: FFPM, a PDE4 inhibitor, reverses learning and memory deficits in APP/PS1 transgenic mice via cAMP/PKA/CREB signaling and anti-inflammatory effects . Neuropharmacology 2017, 116 :260-269. Schepers M, Hendrix S, Mussen F, van Breedam E, Ponsaerts P, Lemmens S, Hellings N, Ricciarelli R, Fedele E, Bruno O et al : Amelioration of functional and histopathological consequences after spinal cord injury through phosphodiesterase 4D (PDE4D) inhibition . Neurotherapeutics 2024, 21 (4):e00372. Jäger R, Russwurm C, Schwede F, Genieser HG, Koesling D, Russwurm M: Activation of PDE10 and PDE11 phosphodiesterases . J Biol Chem 2012, 287 (2):1210-1219. Beaumont V, Zhong S, Lin H, Xu W, Bradaia A, Steidl E, Gleyzes M, Wadel K, Buisson B, Padovan-Neto FE et al : Phosphodiesterase 10A Inhibition Improves Cortico-Basal Ganglia Function in Huntington's Disease Models . Neuron 2016, 92 (6):1220-1237. Shiraishi E, Suzuki K, Harada A, Suzuki N, Kimura H: The Phosphodiesterase 10A Selective Inhibitor TAK-063 Improves Cognitive Functions Associated with Schizophrenia in Rodent Models . J Pharmacol Exp Ther 2016, 356 (3):587-595. Kunkle BW, Grenier-Boley B, Sims R, Bis JC, Damotte V, Naj AC, Boland A, Vronskaya M, van der Lee SJ, Amlie-Wolf A et al : Genetic meta-analysis of diagnosed Alzheimer's disease identifies new risk loci and implicates Aβ, tau, immunity and lipid processing . Nat Genet 2019, 51 (3):414-430. Paquet D, Kwart D, Chen A, Sproul A, Jacob S, Teo S, Olsen KM, Gregg A, Noggle S, Tessier-Lavigne M: Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9 . Nature 2016, 533 (7601):125-129. Kwart D, Gregg A, Scheckel C, Murphy EA, Paquet D, Duffield M, Fak J, Olsen O, Darnell RB, Tessier-Lavigne M: A Large Panel of Isogenic APP and PSEN1 Mutant Human iPSC Neurons Reveals Shared Endosomal Abnormalities Mediated by APP β-CTFs, Not Aβ . Neuron 2019, 104 (2):256-270.e255. Xie Y, Wang D, Lan F, Wei G, Ni T, Chai R, Liu D, Hu S, Li M, Li D et al : An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells . Sci Rep 2017, 7 (1):2320. Rong X, Chu W, Zhang H, Wang Y, Qi X, Zhang G, Wang Y, Li C: Antler stem cell-conditioned medium stimulates regenerative wound healing in rats . Stem Cell Res Ther 2019, 10 (1):326. Sadigh-Eteghad S, Sabermarouf B, Majdi A, Talebi M, Farhoudi M, Mahmoudi J: Amyloid-beta: a crucial factor in Alzheimer's disease . Med Princ Pract 2015, 24 (1):1-10. Hampel H, Hardy J, Blennow K, Chen C, Perry G, Kim SH, Villemagne VL, Aisen P, Vendruscolo M, Iwatsubo T et al : The Amyloid-β Pathway in Alzheimer’s Disease . Molecular Psychiatry 2021, 26 (10):5481-5503. Ashton NJ, Pascoal TA, Karikari TK, Benedet AL, Lantero-Rodriguez J, Brinkmalm G, Snellman A, Schöll M, Troakes C, Hye A et al : Plasma p-tau231: a new biomarker for incipient Alzheimer's disease pathology . Acta Neuropathol 2021, 141 (5):709-724. Sanders O, Rajagopal L: Phosphodiesterase Inhibitors for Alzheimer's Disease: A Systematic Review of Clinical Trials and Epidemiology with a Mechanistic Rationale . J Alzheimers Dis Rep 2020, 4 (1):185-215. Athar T, Al Balushi K, Khan SA: Recent advances on drug development and emerging therapeutic agents for Alzheimer's disease . Mol Biol Rep 2021, 48 (7):5629-5645. Habashi M, Vutla S, Tripathi K, Senapati S, Chauhan PS, Haviv-Chesner A, Richman M, Mohand SA, Dumulon-Perreault V, Mulamreddy R et al : Early diagnosis and treatment of Alzheimer's disease by targeting toxic soluble Aβ oligomers . Proc Natl Acad Sci U S A 2022, 119 (49):e2210766119. Sharma VK, Singh TG: CREB: A Multifaceted Target for Alzheimer's Disease . Curr Alzheimer Res 2020, 17 (14):1280-1293. Chen Y, Huang X, Zhang YW, Rockenstein E, Bu G, Golde TE, Masliah E, Xu H: Alzheimer's β-secretase (BACE1) regulates the cAMP/PKA/CREB pathway independently of β-amyloid . J Neurosci 2012, 32 (33):11390-11395. McCahill A, Campbell L, McSorley T, Sood A, Lynch MJ, Li X, Yan C, Baillie GS, Houslay MD: In cardiac myocytes, cAMP elevation triggers the down-regulation of transcripts and promoter activity for cyclic AMP phosphodiesterase-4A10 (PDE4A10) . Cell Signal 2008, 20 (11):2071-2083. Dastgheib M, Shetab-Boushehri SV, Baeeri M, Gholami M, Karimi MY, Hosseini A: Rolipram and pentoxifylline combination ameliorates experimental diabetic neuropathy through inhibition of oxidative stress and inflammatory pathways in the dorsal root ganglion neurons . Metab Brain Dis 2022, 37 (7):2615-2627. Gobejishvili L, Rodriguez WE, Bauer P, Wang Y, Soni C, Lydic T, Barve S, McClain C, Maldonado C: Novel Liposomal Rolipram Formulation for Clinical Application to Reduce Emesis . Drug Des Devel Ther 2022, 16 :1301-1309. Suzuki K, Kimura H: TAK-063, a novel PDE10A inhibitor with balanced activation of direct and indirect pathways, provides a unique opportunity for the treatment of schizophrenia . CNS Neurosci Ther 2018, 24 (7):604-614. Macek TA, Suzuki K, Asin K, Kimura H: Translational Development Strategies for TAK-063, a Phosphodiesterase 10A Inhibitor . Int J Neuropsychopharmacol 2020, 23 (8):524-532. Birjandi SZ, Abduljawad N, Nair S, Dehghani M, Suzuki K, Kimura H, Carmichael ST: Phosphodiesterase 10A Inhibition Leads to Brain Region-Specific Recovery Based on Stroke Type . Transl Stroke Res 2021, 12 (2):303-315. Leal G, Bramham CR, Duarte CB: BDNF and Hippocampal Synaptic Plasticity . Vitam Horm 2017, 104 :153-195. Abud EM, Ramirez RN, Martinez ES, Healy LM, Nguyen CHH, Newman SA, Yeromin AV, Scarfone VM, Marsh SE, Fimbres C et al : iPSC-Derived Human Microglia-like Cells to Study Neurological Diseases . Neuron 2017, 94 (2):278-293.e279. Bassil F, Brown HJ, Pattabhiraman S, Iwasyk JE, Maghames CM, Meymand ES, Cox TO, Riddle DM, Zhang B, Trojanowski JQ et al : Amyloid-Beta (Aβ) Plaques Promote Seeding and Spreading of Alpha-Synuclein and Tau in a Mouse Model of Lewy Body Disorders with Aβ Pathology . Neuron 2020, 105 (2):260-275.e266. Gao L, Zhang Y, Sterling K, Song W: Brain-derived neurotrophic factor in Alzheimer's disease and its pharmaceutical potential . Transl Neurodegener 2022, 11 (1):4. Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterials.pdf Cite Share Download PDF Status: Published Journal Publication published 27 Oct, 2025 Read the published version in Alzheimer's Research & Therapy → Version 1 posted Editorial decision: Revision requested 24 Jul, 2025 Reviews received at journal 24 Jul, 2025 Reviews received at journal 23 Jul, 2025 Reviews received at journal 23 Jul, 2025 Reviewers agreed at journal 16 Jul, 2025 Reviews received at journal 15 Jul, 2025 Reviews received at journal 11 Jul, 2025 Reviewers agreed at journal 10 Jul, 2025 Reviewers agreed at journal 10 Jul, 2025 Reviewers agreed at journal 08 Jul, 2025 Reviewers agreed at journal 25 Jun, 2025 Reviewers invited by journal 19 Jun, 2025 Editor assigned by journal 19 Jun, 2025 Submission checks completed at journal 19 Jun, 2025 First submitted to journal 16 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6907913","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":474564076,"identity":"615a9acd-cc64-4a6d-a592-ee27faccd8fa","order_by":0,"name":"Xiaoli Rong","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoli","middleName":"","lastName":"Rong","suffix":""},{"id":474564077,"identity":"a758ab41-65a4-4d5f-a68f-96fafad3d822","order_by":1,"name":"Xia Yao","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Yao","suffix":""},{"id":474564078,"identity":"05bacbf2-4f13-4f39-af29-790c32164c9c","order_by":2,"name":"Haohui Fang","email":"","orcid":"","institution":"Columbia University","correspondingAuthor":false,"prefix":"","firstName":"Haohui","middleName":"","lastName":"Fang","suffix":""},{"id":474564079,"identity":"99aba707-f279-406f-8210-fe379b2c1c5a","order_by":3,"name":"Johns Saji","email":"","orcid":"","institution":"Johns Hopkins University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Johns","middleName":"","lastName":"Saji","suffix":""},{"id":474564080,"identity":"45abc2d7-7e51-4b02-a8b9-e9e877bfbfa9","order_by":4,"name":"Yu Qian","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Qian","suffix":""},{"id":474564083,"identity":"3d06fde0-e5c8-4f03-9a58-ef6d06f7d7c6","order_by":5,"name":"Jia-Xuan Gu","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Jia-Xuan","middleName":"","lastName":"Gu","suffix":""},{"id":474564085,"identity":"ff0373d6-f807-4eea-a1aa-9dba44fbacd0","order_by":6,"name":"Meng-Yuan Yang","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Meng-Yuan","middleName":"","lastName":"Yang","suffix":""},{"id":474564087,"identity":"02ba71ca-4dca-4d42-9183-af305dde66bd","order_by":7,"name":"Peng Wei","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Wei","suffix":""},{"id":474564089,"identity":"fe0a4ac8-38a0-4130-8919-726ffe901de2","order_by":8,"name":"Cai-Rui Liu","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Cai-Rui","middleName":"","lastName":"Liu","suffix":""},{"id":474564098,"identity":"a8837842-f4ba-43ab-aad8-3c84e7dd44c1","order_by":9,"name":"Bin Chen","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Chen","suffix":""},{"id":474564099,"identity":"8fd02639-0d10-4a75-8561-f215af566895","order_by":10,"name":"Pian-Pian Zhao","email":"","orcid":"","institution":"Westlake University","correspondingAuthor":false,"prefix":"","firstName":"Pian-Pian","middleName":"","lastName":"Zhao","suffix":""},{"id":474564100,"identity":"769ed664-13d7-43d6-bd8c-c41bf75d5efd","order_by":11,"name":"Ching-Lung Cheung","email":"","orcid":"","institution":"The University of Hong Kong, SAR","correspondingAuthor":false,"prefix":"","firstName":"Ching-Lung","middleName":"","lastName":"Cheung","suffix":""},{"id":474564102,"identity":"b3c53a19-ef19-43ac-90fd-28a1010dc7d6","order_by":12,"name":"Lin Bo","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Bo","suffix":""},{"id":474564104,"identity":"38066be9-8340-4e3f-a165-e57a0dfe9f8f","order_by":13,"name":"Hou-Feng Zheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYBACAyD+wMBwAEgxAwk2kFgCQS2MMyBa2BJI1sJjQJwWc/YewwaGP3fkzPnXfP7MU2bHwM+eY8DwcwduLZY9Z4BaeJ4ZW854u02a51wyg2TPGwPG3jN4HHYjx/wBg8ThxA03zm5j5m1jBokYMDO24dUCtMXgcP2GG2cef+Ztq2ewJ05LwuEEg/M9DNK8bYcZDCQIaTlzrLAh4cBhww032Mwk55w7ziNx5lnBwV58Wo43b2z48OewvMH5w48/vCmrluNvT9744CceLWCQACIkwCQDD4g4QEADFPATqW4UjIJRMApGHgAA9LlWc7aYDEgAAAAASUVORK5CYII=","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":true,"prefix":"","firstName":"Hou-Feng","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2025-06-16 18:08:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6907913/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6907913/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13195-025-01869-6","type":"published","date":"2025-10-27T15:58:25+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":85231209,"identity":"28a350bd-5d63-4b18-b156-44cf89cf2d83","added_by":"auto","created_at":"2025-06-23 15:56:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1524732,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation of reduced CREB1 gene expression with AD. (A).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry for CREB1 expression in the prefrontal cortex of normal individuals and AD patients. Scale bar = 50 μm. \u003cstrong\u003e(B \u0026amp; C). \u003c/strong\u003eQuantitative analysis of CREB1-positive area and relative intensity in human postmortem brain tissue (n = 6). (\u003cstrong\u003eD). \u003c/strong\u003eQuantification of CREB1 mRNA relative expression by RT-qPCR in the prefrontal cortex of normal individuals and AD patients (n = 6). \u003cstrong\u003e(E). \u003c/strong\u003eWestern blotting to quantify CREB1 expression in postmortem cerebral cortex (n = 6). \u003cstrong\u003e(F). \u003c/strong\u003eELISA quantification of CREB1 concentration in cerebrospinal fluid (CSF) samples (n = 15). \u003cstrong\u003e(G). \u003c/strong\u003eExperimental design\u003c/p\u003e\n\u003cp\u003eusing isogenic iPSC lines (wild-type or APP Swedish mutation)-derived neurons for \u003cem\u003ein vitro \u003c/em\u003estudies. \u003cstrong\u003e(H). \u003c/strong\u003eImmunofluorescence staining of CREB1 in 2-month-old WT or APP iPSC-derived human cortical neurons. Scale bar = 20 μm. \u003cstrong\u003e(I). \u003c/strong\u003eQuantification of CREB1 relative intensity in H (n = 8). \u003cstrong\u003e(J). \u003c/strong\u003eWestern blotting and quantification of CREB1 in 2-month-old WT or APP iPSC-derived human cortical neurons (n = 6). \u003cstrong\u003e(K). \u003c/strong\u003eQuantification of CREB1 mRNA relative expression in iPSC-derived human cortical neurons by RT-qPCR (n = 6). \u003cstrong\u003e(L). \u003c/strong\u003eQuantification of CREB1 concentration from iPSC-derived human cortical neuron conditioned media by ELISA (n = 15). All experiments were repeated at least three times. Data are presented as the mean ± SEM. \u003cem\u003ep \u003c/em\u003evalues were determined by one-way ANOVA followed by Tukey’s post-hoc analysis, and two-tailed unpaired Student’s t-test, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/0998818b899a6befdc75a04c.png"},{"id":85231279,"identity":"1d160968-d6eb-4b57-884c-5ac649552ed7","added_by":"auto","created_at":"2025-06-23 16:04:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5980247,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCREB1 deficiency is associated with exacerbated AD pathology in differentiated human cortical neurons. (A). \u003c/strong\u003eExperimental scheme for B-G:\u003c/p\u003e\n\u003cp\u003edifferentiated neurons are subject to immunostaining and protein expression analyses. \u003cstrong\u003e(B). \u003c/strong\u003eImmunostaining of MAP2 (red) and A13 (green) in 2-month-old WT and APP neurons, and their corresponding isogenic CREB1-KO (C-KO) neurons. Scale bar = 10 μm. \u003cstrong\u003e(C \u0026amp; D). \u003c/strong\u003eQuantification of A13 relative intensity and positive area in B, n = 20 neurons/group. \u003cstrong\u003e(E). \u003c/strong\u003eImmunostaining of MAP2 (red) and p-tau231 (green) in 2-month-old WT and APP neurons, and their corresponding isogenic CREB1-KO neurons. Scale bar = 10 μm. \u003cstrong\u003e(F \u0026amp; G). \u003c/strong\u003eQuantification of p-tau231 relative intensity and positive area in 2-month-old neurons, n = 20 neurons/group. \u003cstrong\u003e(H). \u003c/strong\u003eExperimental scheme for I \u0026amp; J: the conditioned medium from iPSC-neurons were analyzed in their specific A13 expression. \u003cstrong\u003e(I). \u003c/strong\u003eQuantification of A1342 and A1340 concentration, n = 4. \u003cstrong\u003e(J). \u003c/strong\u003eQuantification of the ratio of A1342/A1340 from I \u003cstrong\u003e(K). \u003c/strong\u003eWestern blotting of A13, p-tau231, and total tau expression in 2-month-old iPSC-derived human cortical neurons. \u003cstrong\u003e(L \u0026amp; M). \u003c/strong\u003equantification of A13, p-tau231, and total tau protein expression from K, n = 4. All experiments were repeated at least three times. Data are presented as the mean ± SEM. \u003cem\u003ep \u003c/em\u003evalues were determined by one-way ANOVA followed by Tukey’s post-hoc analysis, and two-tailed unpaired Student’s t-test, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/fcefce193afb8a32f0bb54f4.png"},{"id":85231214,"identity":"f10c3f90-037d-4cb7-bdda-5c28f7eff7bc","added_by":"auto","created_at":"2025-06-23 15:56:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5092127,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 activates the cAMP-PKA-CREB pathway. (A). \u003c/strong\u003eExperimental scheme for B-E. Quantification of intracellular cAMP levels \u003cstrong\u003e(B \u0026amp; C) \u003c/strong\u003eand PKA kinase activity \u003cstrong\u003e(D \u0026amp; E) \u003c/strong\u003eof APP iPSC-derived neurons by ELISA after treatment with various concentrations (0-20 μM) of combined PDE4/10 inhibitors for 48h\u003cstrong\u003e. (F-I). \u003c/strong\u003eWestern blotting of the cAMP-PKA-CREB signaling pathway-related protein expression in APP mutant neurons, following treatment with either Rolipram, TAK-063, or their combination. \u003cstrong\u003e(J).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunofluorescence microscopy of MAP2 (green) and p-CREB1 Ser133 (red) in 2-month-old APP mutant neurons treated with combined PDE4/10 inhibitors, Scale bar = 20 μm. \u003cstrong\u003e(K \u0026amp; L) \u003c/strong\u003eQuantification of p-CREB1 Ser133 from J (n=10 images). All experiments were repeated at least three times. Data are presented as the mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey’s post-hoc analysis, and two-tailed unpaired Student’s t-test, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, **** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/a50c68fd14bba9db8415f3a0.png"},{"id":85231215,"identity":"c881a568-2514-4c70-af4f-0671da83eaca","added_by":"auto","created_at":"2025-06-23 15:56:21","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":9425117,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCombined application of PDE4/10 Inhibitors rescues AD pathology. (A). \u003c/strong\u003eExperimental scheme. 2-month-old WT, APP, and APP-CREB1-KO iPSC-derived neurons were used for the study, following treatment with either 20 µM Rolipram, 20 µM TAK-063, or their combination (20 µM each) for 48 hours, CM, conditioned medium. IF, immunofluorescence. WB, western blotting \u003cstrong\u003e(B \u0026amp; C). \u003c/strong\u003equantification of A1342 and A1340 concentration. \u003cstrong\u003e(D). \u003c/strong\u003eImmunostaining of MAP2 (red) and A13 (green). Scale bar = 10 μm. \u003cstrong\u003e(E). \u003c/strong\u003eQuantification of A13 staining relative intensity. n=20 neurons/group. \u003cstrong\u003e(F). \u003c/strong\u003eImmunostaining of MAP2 (red) and p-tau231 (green). Scale bar = 10 μm. \u003cstrong\u003e(G). \u003c/strong\u003eQuantification of the relative intensity of p-tau231 staining from F. n=20 neurons/group. \u003cstrong\u003e(H). \u003c/strong\u003eWestern blotting of A13, p-tau231, and total tau expression \u003cstrong\u003e(I). \u003c/strong\u003eQuantification of A13 and p-tau231 protein expression from H, n=4. All experiments were repeated at least three times. Data are presented as the mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey’s post-hoc analysis, and two-tailed unpaired Student’s t-test, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, **** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/e68117fbe9b8eb47e7cf237d.png"},{"id":85231212,"identity":"4b572910-9bc8-44f8-ab9a-809966a73c7b","added_by":"auto","created_at":"2025-06-23 15:56:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":5082028,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 reduces inflammation and exogenous Aβ accumulation in APP iPSC-derived microglia. (A). \u003c/strong\u003eExperimental design for measuring the secreted levels of inflammatory factors from iPSC-derived microglia in response to\u003c/p\u003e\n\u003cp\u003ePDE4/10 inhibitors, following treatment with either 20 µM Rolipram, 20 µM TAK-063, or their combination (20 µM each) for 48 hours. \u003cstrong\u003e(B). \u003c/strong\u003eRepresentative images showing activated APP iPSC-derived microglia. \u003cstrong\u003e(C-I). \u003c/strong\u003eQuantification of inflammatory factors (IFN-γ, IL-113, IL-2, IL-6, IL-8, IL-10, and TGF-13) secretion \u003cstrong\u003e(J). \u003c/strong\u003eIF was performed to evaluate exogenous A13 accumulation and clearance within microglia. IF staining of Iba1 (green) and A13 (red) in APP iPSC-derived microglia. Scale bar = 20 μm. \u003cstrong\u003e(K). \u003c/strong\u003eQuantification of A13 positive area in J, n = 10 images/group. All experiments were repeated at least three times. Data are presented as the mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey’s post-hoc analysis, and two-tailed unpaired Student’s t-test, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, **** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/deb8b079f75b64502666397e.png"},{"id":85231216,"identity":"ebb5f1d0-175a-4085-8f56-53329b54e0bd","added_by":"auto","created_at":"2025-06-23 15:56:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":8065730,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 mitigates Aβ pathology and improves cognitive deficits in APP/PS1 mice. (A). \u003c/strong\u003eResearch scheme to investigate the effects of nasal\u003c/p\u003e\n\u003cp\u003edelivery of PDE4/10 inhibitors on APP/PS1 AD mouse model. \u003cstrong\u003e(B). \u003c/strong\u003eRepresentative images of Thioflavin-S (green) and A13 co-staining in the cerebral cortex of APP/PS1 mice. Scale bar = 20 μm. \u003cstrong\u003e(C). \u003c/strong\u003eQuantification of A13 plaque volume in the cerebral cortex. Results are expressed in cubic micrometers (μm^3) as a percentage of the total cortical and hippocampus volume (n=8 mice). \u003cstrong\u003e(D). \u003c/strong\u003eQuantification of Thioflavin-S and A13 co-staining positive area (n = 8 mice). \u003cstrong\u003e(E). \u003c/strong\u003eQuantification of the relative A13 intensity (n=8 mice). \u003cstrong\u003e(F \u0026amp; G). \u003c/strong\u003eSpatial memory assessment in Y-maze task. During the 10-minute testing, the spontaneous alternation behavior, the total number of novel arm entries, and the distance traveled reflecting exploratory activities are measured. \u003cstrong\u003e(H). \u003c/strong\u003eMotor activity was evaluated by open field test for mice at 6 months through quantitation of time in the center and distance of travel. \u003cstrong\u003e(I). \u003c/strong\u003eSpatial memory testing through novel object exploration task: the novel object contact percentage and exploration time were quantified during a 10-minute window. n=8 mice. Data are presented as the mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc analysis, and two-tailed unpaired Student’s t-test, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/fda85c3003e8bf8436d06178.png"},{"id":85231210,"identity":"11b94045-3ef2-4bed-8450-51b9664f565d","added_by":"auto","created_at":"2025-06-23 15:56:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":4242030,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 promotes neuronal resilience in AD. (A). \u003c/strong\u003eImmunostaining of presynaptic protein Synapsin I (green), postsynaptic protein PSD95 (red), and MAP2 (Gray) in APP iPSC-derived human cortical neurons, 48 hours following\u003c/p\u003e\n\u003cp\u003etreatment with either 20 µM Rolipram, 20 µM TAK-063, or their combination (20 µM each), scale bar = 20 μm. \u003cstrong\u003e(B \u0026amp; C). \u003c/strong\u003eQuantification of the total puncta of Synapsin I and PSD95 (n = 8 neurons) from A. \u003cstrong\u003e(D). \u003c/strong\u003eQuantification of the colocalized puncta of Synapsin I and PSD95 (n = 8 neurons) from A. \u003cstrong\u003e(E). \u003c/strong\u003eMeasurement of miniature excitatory postsynaptic currents (mEPSCs) from APP/PS1 mouse brains (n = 8). \u003cstrong\u003e(F). \u003c/strong\u003eMeasurement of miniature inhibitory postsynaptic currents (mIPSCs) from APP/PS1 mouse brains (n = 8). Data are presented as the mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc analysis, and two-tailed unpaired Student’s t-test, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/87f3e234fa74b163f49b32fc.png"},{"id":95040977,"identity":"c261738a-410e-49db-b297-d07b8a93a0ed","added_by":"auto","created_at":"2025-11-03 16:10:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":40701622,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/52880949-ce41-43bb-a7a0-27cc2e4753a3.pdf"},{"id":85231280,"identity":"47b2f2b5-aebc-4441-beea-3fab67ed226f","added_by":"auto","created_at":"2025-06-23 16:04:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1162045,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6907913/v1/6ad313e1d669ff901c68ff08.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dual PDE4/10 Inhibition Restores CREB1 Function and Enhances Neuronal Resilience in Alzheimer's Disease","fulltext":[{"header":"Background","content":"\u003cp\u003eAlzheimer\u0026apos;s Disease (AD) is a progressive neurodegenerative disorder characterized by the decline of cognitive functions, including memory, reasoning, and behavior[1]. \u0026nbsp;Affecting millions worldwide, AD represents the most common cause of dementia among the elderly, posing significant challenges for patients, caregivers, and healthcare systems[2]. Central to the progression of AD is the loss of neuronal resilience, which refers to the ability of neurons to withstand and recover from pathological insults[3]. Neuronal resilience is crucial for maintaining cognitive functions, and its decline accelerates the deterioration seen in AD patients[4]. Enhancing neuronal resilience, therefore, holds promise as a strategy to mitigate the progression of AD, preserve cognitive abilities, and improve the quality of life for those affected by this devastating disease[5, 6].\u003c/p\u003e\n\u003cp\u003eThe cAMP-PKA-CREB signaling pathway is integral to neuronal health and plasticity, orchestrating a multitude of processes essential for cognitive function and resilience[7, 8]. In this pathway, cyclic adenosine monophosphate (cAMP) serves as a second messenger that activates protein kinase A (PKA)[9]. Once activated, PKA phosphorylates the cAMP response element-binding protein (CREB), which then binds to specific DNA sequences to promote the transcription of genes involved in neuronal survival, growth, and synaptic plasticity[10, 11]. This pathway ensures that neurons can adapt to new information and recover from injury, underpinning the brain\u0026apos;s ability to learn and remember[12, 13]. In AD pathology, the cAMP-PKA-CREB pathway is notably disrupted, leading to significant neuronal dysfunction[14]. Dysregulation of this pathway results in decreased phosphorylation of CREB, reducing the expression of genes critical for neuroprotection and synaptic maintenance. This impairment contributes to the accumulation of amyloid-beta (A\u0026beta;) plaques and hyperphosphorylated tau (p-tau), which are two major pathological hallmarks of AD[15]. The ensuing neuronal damage and synaptic loss exacerbate cognitive decline, highlighting the importance of the cAMP-PKA-CREB pathway in maintaining neuronal integrity. Therefore, targeting this pathway to restore its function holds promise for mitigating AD pathology and preserving cognitive function in affected individuals.\u003c/p\u003e\n\u003cp\u003eAD is marked by progressive cognitive decline, with disruptions in many intracellular signaling pathways, in which cAMP plays a crucial role as a secondary messenger[16]. Phosphodiesterases (PDEs) are a family of enzymes that regulate intracellular signaling by hydrolyzing cyclic nucleotides, such as cAMP and cyclic guanosine monophosphate (cGMP)[17]. Among them, PDE4 and PDE10 play critical roles in neuronal and glial function and are implicated as targets for treatment of neurodegenerative diseases[18, 19]. PDE4, primarily expressed in the brain and immune cells, catalyzes the degradation of cAMP[20]. This regulation directly affects the cAMP-PKA-CREB pathway, which is essential for synaptic plasticity, memory formation, and neuroprotection[21, 22]. Inhibition of PDE4 has been shown to elevate cAMP levels, leading to enhanced CREB activation and improved cognitive function[23]. Previous studies show that PDE4 inhibition by Rolipram increases cAMP levels, but with significant side effects like nausea and vomiting, limiting clinical use[24]. PDE10, predominantly expressed in the striatum, hydrolyzes both cAMP and cGMP, thereby modulating key signaling pathways that influence motor control, learning, and cognition[25, 26]. The selective PDE10A inhibitor, TAK-063, has shown promise in preclinical models by increasing cAMP/cGMP levels, which may contribute to neuroprotection and cognitive enhancement[27]. Despite the promising preclinical data of TAK-063 in Huntington\u0026apos;s disease or schizophrenia[19, 26], currently, there is no substantial evidence supporting the use of TAK-063 for AD. Some critical challenges remain in the development of PDE inhibitors for AD, including the need to minimize adverse effects, understand the regional specificity of PDE\u0026rsquo;s activity inhibition in neurodegeneration, assess the long-term impacts on AD pathology, and bridge the gap between preclinical findings and clinical outcomes. Addressing these gaps is essential for advancing PDE inhibitors as effective therapies for AD.\u003c/p\u003e\n\u003cp\u003eBuilding upon this foundation, our research endeavors to elucidate whether single or dual PDE4/10 inhibition reduces AD pathology and how it regulates the cAMP-PKA-CREB pathway. Furthermore, we explored whether dual PDE4/10 inhibition in APP/PS1 AD mice improves cognitive function and enhances neuronal resilience. Our study aims to understand the synergistic effects of dual PDE4/10 inhibition and the molecular mechanisms underlying cognitive improvements in APP/PS1 mouse models. These areas require further investigation to fully establish the therapeutic potential of dual PDE4/10 inhibition in AD.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eHuman population analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe extracted the genetic association summary statistics of the \u003cem\u003eCREB1\u003c/em\u003e gene region (approximately ±200kb of the gene region, hg19, chr2: 208194615-208670284) from a previously published study (up to 13,292 European ancestry cases and up to 17,219 European ancestry controls)[28]. Specifically, 1,259 single nucleotide polymorphisms (SNPs) were plotted in this region for AD.\u003c/p\u003e\n\u003cp\u003eBased on the Mendelian randomization\u0026nbsp;(MR) study design, genetic variants were used as instrumental variables to link the outcome (i.e., AD) via the exposure of interest (i.e., the \u003cem\u003ePED4A\u003c/em\u003e gene expression level). The instrumental variables were extracted from the cis-eQTLs based on the eQTLGen consortium (whole blood) (P-value for cis-eQTL \u0026lt; 5×10-8) (25954001). Linkage clumping was conducted based on default protocols. The genetic association estimate of this instrumental variable with AD was obtained from one previous genome-wide association study, which included 111,326 clinically diagnosed/proxy AD cases and 677,663 controls (35379992). Additionally, we supplied an alternative two-sample MR method, the inverse-variance weighted method, to assess the robustness of this MR estimate. In this MR analysis, four genome-wide significant independent pQTLs were also selected as instrumental variables (r2\u0026lt;0.001 within 250kb distance), and only two genetic variants were available in the previous AD GWAS (35379992).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCulture of iPSCs and human subjects\u0026nbsp;\u003c/strong\u003e \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe isogenic human iPSC (hiPSC) lines carrying APPswe mutations, and the engineered 7889SA iPSC line (WT control) were obtained from previous studies[29, 30]. All hiPSC cultures were maintained in mTeSR plus medium (STEMCELL Technologies) at 37°C, 5% CO2\u0026nbsp;on hESC-qualified Matrigel-coated culture vessels. \u0026nbsp;The human postmortem brain tissue samples: Mid-frontal cortices from brains of age-matched patients with AD (n=6, 3 females and 3 males) and controls (n=6, 3 females and 3 males), Table S1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMouse breeding and maintenance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures performed in this study were approved by the Institutional Animal Care and Use Committee (IACUC) at Soochow University. All of the live animals were maintained in a specific-pathogen-free (SPF) animal facility. Male and female mice of mixed genetic backgrounds (C57BL/6J) were used for these studies. The only exceptions were germline mutant mice (APP/PS1), which were backcrossed for at least 5 generations to a C57BL/6J background. All animals were group housed, with control and mutant animals in the same litters and cages. Littermates from the same genetic crosses were used as controls for each group, to control for variability in mouse strains/backgrounds. All the animals were genotyped following the standard protocol of The Jackson Laboratory (MMRRC stock #34832).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdministration of PDE4/10 Inhibitors \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor in vitro experiments, the PDE4 inhibitor Rolipram (Catalog No.67177.LB0, Thermo Fisher) and the PDE10 inhibitor TAK-063 (Catalog No.S8459, Selleck Chemicals LLC) were administered to APP iPSC-derived neurons or microglia,\u0026nbsp;with either\u0026nbsp;20\u0026nbsp;µM\u0026nbsp;Rolipram,\u0026nbsp;20\u0026nbsp;µM\u0026nbsp;TAK-063, or\u0026nbsp;their\u0026nbsp;combination\u0026nbsp;(20\u0026nbsp;µM\u0026nbsp;each) for 48 hours.\u0026nbsp;Cells were treated with these inhibitors under standard culture conditions\u0026nbsp;and\u0026nbsp;their effects\u0026nbsp;were accessed by\u0026nbsp;immunohistochemistry,\u0026nbsp;western blotting, and\u0026nbsp;secretion of\u0026nbsp;inflammatory factors.\u0026nbsp;20\u0026nbsp;µM\u0026nbsp;each was utilized for the combinatorial application of\u0026nbsp;Rolipram\u0026nbsp;and\u0026nbsp;TAK-063\u0026nbsp;\u003cem\u003ein vitro\u003c/em\u003e.\u0026nbsp;For \u003cem\u003ein vivo\u003c/em\u003e experiments, Rolipram and TAK-063 were administered to mice at a concentration of\u0026nbsp;either\u0026nbsp;0.5 mg/kg\u0026nbsp;Rolipram,\u0026nbsp;0.5 mg/kg\u0026nbsp;TAK-063, or\u0026nbsp;their\u0026nbsp;combination\u0026nbsp;(0.5 mg/kg\u0026nbsp;each). The inhibitors were dissolved in saline and delivered via nasal injection once daily for 4 weeks. Mice were monitored for any adverse effects throughout the treatment period, and the impact on relevant outcomes was assessed after the 4-week duration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRISPR/Cas9 gene KO editing\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor CREB1 knock-out (KO) iPSCs line generation, 3 pairs of guide RNAs (gRNAs) were designed to target the CREB1 exon 2 and cloned the 2 gRNAs’ sequences into an expression vector EBNA-Cas9-copGFP (ECC) [31]. The plasmid was transfected into the iPSCs using Lipofectamine Stem Transfection Reagent (Invitrogen). Transfectants were sorted using fluorescence-activated cell sorting (FACS) for GFP-positive cells after 24h. The sorted single cells were seeded sparsely and cultured for an additional week for colony formation. Single colonies were then subject to expansion and validation. CREB1 KO of single colonies was confirmed by PCR and Sanger sequencing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmuno\u003c/strong\u003e\u003cstrong\u003efluorescence microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ehiPSC-derived cortical neurons were seeded on glass coverslips in a 24-well plate at a density of 30,000 cells per well. After an initial wash with phosphate-buffered saline, 0.1% Tween-20 (PBST), the cells were fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes at room temperature (RT). Following another wash with PBS, the cells were permeabilized with 0.3% Triton X-100 in PBST for 10 minutes. Blocking was performed with 10% normal goat serum in PBST for 1 hour at RT. Primary antibodies were diluted in 5% normal goat serum in PBST (antibody dilution buffer) and applied overnight at 4°C. Primary antibodies and their working dilutions were as follows: CREB1(1:500, Abcam, 35-0900), p-CREB1Ser133 (1:500, Invitrogen, MA1-114), MAP2 (1:500; Abcam, ab151559), p-tau-231 (1:500,Cell signaling, 71429), PKA (1:500, Invitrogen, PA5-17626), BNDF (1:500, Abcam, ab108319), Aβ (1:500, Creative Biolabs, TAB-0809CLV), Synapsin I(1:500, Invitrogen, A-6442), and PSD95(1:500,Abcam, ab13552). The coverslips were then washed three times with PBST for 5 minutes each at RT. Secondary antibodies were applied in antibody dilution buffer and incubated for 1 hour at RT, followed by three washes with PBST. Stained for plaques with ThioflavinS (Sigma-Aldrich, 2 mg/10mL) for 8 min followed by three 2-min washes with 50% ethanol at room temperature. Cells were stained with 1 μg/mL Hoechst for 10 minutes at RT, briefly rinsed in dH2O, and dried. Coverslips were mounted on glass slides with Immu-Mount (Fisher Scientific). Fluorescent images were acquired using scanning confocal microscopy (LSM880, Carl Zeiss) at 40× or 63× magnification. Images were processed with Zen software (Carl Zeiss), and signal intensity was measured using ImageJ.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eI\u003c/strong\u003e\u003cstrong\u003emmunohistochemistry (IHC)\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eParaffinized sections were deparaffinized and rehydrated before antigen retrieval using the IHC Antigen Retrieval Solution (Thermo Fisher). Endogenous peroxidase activity was blocked with 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in PBST. Sections were then blocked with 10% goat serum in PBST with 0.3% Triton X-100. Rabbit anti-CREB1 antibody (1:500, Abcam, ab32515) was applied overnight at 4°C. The sections were subsequently treated with the VECTASTAIN® Elite® ABC-HRP Kit (Vector Laboratories) and developed using the ImmPACT® DAB Substrate Kit (SK-4105, Vector Laboratories). Positive regions were quantified using ImageJ.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u0026nbsp;\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBrain tissues, including human post-mortem AD brains and mouse brains, were homogenized using RIPA buffer (pH 7.4) supplemented with phosphatase inhibitor mixture I and II (Sigma-Aldrich) and a complete protease inhibitor mixture (Roche). After homogenization, the samples underwent three freeze-thaw cycles using dry ice, followed by centrifugation at 15,000 x g for 15 minutes to collect clear supernatants and freezing at -80°C. The protein samples were extracted from 2-month-old hiPSC-derived cortical neurons. In brief, neurons grown in each well of the 6-well plate were washed once with cold PBS and then lysed in 200 μl of soluble lysis buffer containing Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology). Protein concentrations were quantified using a BCA assay kit (Pierce), and SDS-PAGE was utilized for protein separation, with subsequent transfer to PVDF membranes for immunoblot analysis. Membranes were blocked in 5% non-fat milk in TBST for 1 hour at RT and then incubated with primary antibodies overnight at 4°C with continuous shaking. Primary antibodies and their working dilutions were as follows: CREB1(1:1000, Abcam, ab32515), p-CREB1 (1:1000, Cell Signaling, 9198), MAP2 (1:500, Invitrogen, PA1-10005), p-tau231 (1:1000, Cell Signaling, 71429), total tau(1:1000,\u0026nbsp;Invitrogen, MA5-12808), PKA (1:1000, Cell Signaling, 4782), BNDF (1:1000, Abcam, ab108319), Aβ (1:1000, Creative Biolabs, TAB-0809CLV), and β-actin (1:1000, Invitrogen, MA5-15739-HRP). Target antigens were detected using appropriate HRP-conjugated secondary antibodies and visualized using Pierce™ Fast Western Blot Kits or SuperSignal™ West Femto ECL substrate (Thermo Scientific, 34094).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNAs from human post-mortem AD brains or mouse brain samples were extracted by the Quick-RNA MicroPrep kit (Zymo Research). For mRNA analysis, 20-50 ng of total RNA from each sample was reverse-transcribed with Superscript III (Invitrogen,18080093). One-tenth of the reverse transcription reaction was used for subsequent qPCRs, which were performed on Viia7 thermocycler (Applied Biosystems) using SYBR Green PCR mix (Roche) for each gene of interest and GAPDH (as an internal control). CREB1 primer sequencing Forward: ACTCAGCCGGGTACTACCAT; \u0026nbsp;Reverse: ACAGCGTAATAATATGCTCTCCT. GAPDH primer sequencing Forward: GGAGCGAGATCCCTCCAAAAT; Reverse: GGCTGTTGTCATACTTCTCATGG. Each qPCR reaction was performed in triplicates.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePKA kinase and cAMP activity assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe method for preparation of conditioned medium (CM) was as described previously[32]. Briefly, iPSC-derived nearly two months old were plated in six-well plates at a density of 5 × 10\u003csup\u003e4\u003c/sup\u003e cells per well. After 48 h, when cells reached approximately 80% confluence, the after three times of neuron basal medium washing with DMEM-12. At 48h after incubation, the supernatants were harvested as CMs for use in experiments. CMs were centrifuged at 15,000 rpm for 15 min at 4°C, and the total amount of proteins in the supernatant was measured by a Bio-Rad protein assay, based on the method of Bradford, using BSA as a standard. PKA (Abcam, ab139435) and cAMP (Cell Signaling,4339) activity was measured using an ELISA kit according to the manufacturer’s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssessment of Inflammatory factor\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;by ELISA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman iPSC-derived microglia were treated with pre-formed synthetic Human Synthetic Amyloid Beta 1-42 Pre-formed Fibrils\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(5 μM, CD creative diagnostics, PFF12) for 48 hours to model amyloid exposure. Fibrils were prepared by incubating the peptide at 37°C for 48 hours to induce aggregation. After treatment, cells were thoroughly washed to eliminate exogenous Aβ, then treated with Rolipram (20 μM) and TAK-063 (2020 μM) for 24 hours to assess the effect of dual PDE4/10 inhibition on inflammation and Aβ clearance. ELISA was performed to quantify secreted inflammatory cytokines from a conditioned medium (CM), and IF was used to evaluate Aβ accumulation and clearance within microglia. I10nflammatory factors (IFN-γ, IL-1β, IL-2, IL-6, IL-8, IL-10, and TGF-β) in APP iPSC-derived microglia were quantified using the U-PLEX kit (U-PLEX 10-Assay, 96-Well SECTOR plate, Cat. No. K15276K-2) from Meso Scale Discovery (MSD), following the manufacturer’s instructions. After treatment with combined PDE4/10 inhibitors, culture supernatants were collected. The pre-coated 96-well plates were blocked for 1 hour at room temperature, and then 50 µL of supernatants and standards were added and incubated for 2 hours with shaking. Plates were washed, and SULFO-TAG-conjugated detection antibodies were added and incubated for 1 hour with shaking. After a final wash, MSD Read Buffer was added, and the plates were read on the MSD SECTOR Imager. Cytokine concentrations were determined using standard curves from recombinant cytokines and analyzed with MSD Discovery Workbench software. Experiments were performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman Aβ ELISA assays \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor quantitative analysis of Aβ42 and Aβ40 levels in human cortical neurons, ELISAs were conducted following the standard protocol (Thermo Fisher Scientific). iPSC-derived neurons were differentiated by plating an equal number of NPCs and maintaining the cultures in 6-well plates for 4 weeks. Forty-eight hours before harvest, the medium was fully replaced with 4 ml/well of fresh neuron basal medium. The conditioned medium was collected, centrifuged to remove insoluble material, and stored at -80°C. Aβ40 and Aβ42 levels were measured using the Human Aβ (1–40) ELISA Kit II (CAT# KHB3482) and Human Aβ (1–42) ELISA Kit (CAT# KHB3441), respectively, following the manufacturer's instructions. Aβ concentrations were normalized to the protein levels of the culture. Absorbance was measured with a Varioskan LUX Multimode Microplate Reader.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBehavior tests \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll behavior experiments were performed between 8 am and 12 pm in a blinded fashion. All mice were 6 months old at the time of the assay. Mice were transported from their home vivarium room to the behavior core and allowed 30 min to habituate before beginning each test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eY-Maze Task\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAPP/PS1 mice were subjected to the Y-Maze task to assess spatial memory and exploratory behavior. During a 10-minute testing period, spontaneous alternation behavior, the total number of novel arm entries, and the distance traveled were recorded to evaluate the animals' cognitive function and exploratory activities. The Y-Maze consists of three arms, and alternation behavior was defined as consecutive entries into each of the three different arms.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eOpen field test\u003c/em\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe open-field test was used to evaluate general motor activity and anxiety-like behavior. At 6 months of age, APP/PS1 mice were placed in the center of a square open field arena, and their movements were tracked for 10 minutes. The total distance traveled and the time spent in the center of the arena were quantified. Increased time spent in the center is typically interpreted as reduced anxiety, while distance traveled reflects overall motor activity.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNovel object exploration task\u0026nbsp;\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe novel object exploration task was conducted to assess spatial memory and recognition memory in mice. During the 10-minute testing session, two objects were placed in an open field arena: one familiar object and one novel object. The amount of time spent exploring each object and the percentage of novel object contact were recorded. A preference for the novel object, indicated by a higher percentage of time spent interacting with it, suggests intact recognition memory.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElectrophysiology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAcute brain slices were prepared from experiment mice. Mice were deeply anesthetized with isoflurane and transcardially perfused with ice-cold, oxygenated (95% O₂/5% CO₂) cutting solution containing (in mM): 110 choline chloride, 25 NaHCO₃, 25 glucose, 11.6 sodium ascorbate, 7 MgCl₂, 3.1 sodium pyruvate, 2.5 KCl, 1.25 NaH₂PO₄, and 0.5 CaCl₂. Brains were rapidly removed and 300-μm coronal slices containing the cortex or hippocampus were cut using a vibratome (Leica VT1200S). Slices were incubated in artificial cerebrospinal fluid (aCSF; in mM: 125 NaCl, 2.5 KCl, 25 NaHCO₃, 1.25 NaH₂PO₄, 2 CaCl₂, 1 MgCl₂, 25 glucose) at 34°C for 30 minutes and then maintained at room temperature until recording.\u003c/p\u003e\n\u003cp\u003eWhole-cell patch-clamp recordings were performed at 32–34°C using borosilicate glass pipettes (3–5 MΩ) filled with an internal solution containing (in mM): 135 K-gluconate, 5 KCl, 10 HEPES, 0.1 EGTA, 4 Mg-ATP, 0.3 Na-GTP, and 10 phosphocreatine (pH 7.3 with KOH, 290 mOsm). Neurons were visualized using infrared differential interference contrast microscopy. Signals were amplified with a MultiClamp 700B amplifier (Molecular Devices), low-pass filtered at 2 kHz, and digitized at 10 kHz using a Digidata 1550B digitizer and pClamp software (Molecular Devices). Series resistance was monitored throughout recordings, and cells with \u0026gt;20% change were excluded from the analysis. Spontaneous and evoked excitatory and inhibitory postsynaptic currents were recorded and analyzed using Clampfit and custom-written MATLAB scripts.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantification and Statistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll quantitative data are expressed as mean ± SEM from a minimum of three independent experiments. Statistical analyses were conducted using GraphPad Prism 10. Comparisons between two groups were evaluated using unpaired two-tailed Student’s t-test, while multiple group comparisons were assessed by one-way ANOVA followed by Tukey’s post-hoc test. A \u003cem\u003ep-value\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant. Sample sizes were determined based on standards from similar published studies\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDownregulation of CREB1 expression across human samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the potential role of the \u003cem\u003eCREB1\u003c/em\u003e gene in Alzheimer\u0026apos;s disease (AD) in the human population, we extracted genetic summary data from the \u003cem\u003eCREB1\u003c/em\u003e locus (hg19, chr2:208194615\u0026minus;208670284) from a large-scale genome-wide association study to test the association of \u003cem\u003eCREB1\u003c/em\u003e polymorphisms with AD[28]. Among the 1,259 single-nucleotide polymorphisms (SNPs) analyzed in this region, SNP rs10932205 is observed to associate with AD at a high significance level, implying a novel previously unreported potential risk factor of AD (chr2:208554332, P-value=6.75\u0026times;10⁻\u003csup\u003e4\u003c/sup\u003e) (Fig. S1). Next, \u003cem\u003eCREB1\u003c/em\u003e expression was examined in both human postmortem brain tissue and human\u0026nbsp;induced pluripotent stem cell (iPSC)-derived cortical neuron samples. We observed a significant reduction in the CREB1-positive area and intensity in human postmortem brain tissue from AD patients compared to age-matched normal brain tissue. (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001, Fig. 1A-C). To validate these findings at both mRNA and protein levels, qPCR and\u0026nbsp;western blotting\u0026nbsp;were performed on postmortem cerebral cortex samples, confirming\u0026nbsp;a\u0026nbsp;dramatically reduced level of CREB1 protein in AD (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, Fig. 1D and E). This corroborates the observation of decreased CREB1 expression in AD and provides direct evidence of both RNA and protein-level changes.\u0026nbsp;For \u003cem\u003ein vitro\u003c/em\u003e studies, we employed isogenic iPSC lines with or without Swedish mutation on the amyloid precursor protein gene (hereafter referred to as WT or APP iPSC), to recapitulate the \u003cem\u003ein vivo\u003c/em\u003e findings and to investigate the molecular and cellular mechanisms of CREB1-associated AD pathogenesis (Fig. S2). Immunofluorescence\u0026nbsp;microscopy\u0026nbsp;revealed a notable reduction in CREB1 intensity in 2-month-old AD mutant neurons compared to WT neurons (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, Fig. 1G-I). Similar to the findings in human postmortem brain tissue, we observed a significant decrease in both CREB1 protein and mRNA levels in 2-month-old AD mutant neurons compared to WT neurons (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001, Fig. 1 J and K, S2F). Furthermore, we conducted ELISA to measure the concentrations of CREB1 in both cerebrospinal fluid (CSF) and conditioned medium\u0026nbsp;of neuron culture. The results revealed a dramatic reduction of CREB1 concentrations in\u0026nbsp;both\u0026nbsp;AD patients and\u0026nbsp;APP\u0026nbsp;iPSC-derived human cortical neurons (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, Fig. 1 F and L). In summary, our comprehensive investigation, spanning human postmortem brain tissue, induced APP mutant neurons, and CSF samples, consistently indicates a significant decrease in CREB1 level in AD pathology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCREB1 deficiency\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ewas associated with exacerbated AD pathology in human cortical neurons\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo study the effect of CREB1 on AD pathology, we constructed CREB1 knockout (CREB1-KO) iPSC lines and assessed the levels of A\u0026beta; and phosphorylated tau 231 (p-tau231) in 2-month-old iPSC-derived cortical neurons (Fig. 2A). A\u0026beta; plays a central role in AD by forming amyloid plaques[33, 34]. Our results demonstrated a significant elevation in the intensity of A\u0026beta; in both the WT and APP-CREB1 deficient neurons compared to their corresponding isogenic WT neurons (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 2B and C). Furthermore, we observed a greater accumulation of A\u0026beta; around the nucleus in CREB1-deficient neurons compared to their corresponding isogenic WT neurons (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001, Fig. 2D). Recent study has shown that p-tau231 is a new biomarker for incipient AD pathology[35]. We confirmed that p-tau231 intensity was substantially enhanced in both the WT and APP-CREB1 deficient neurons compared to their corresponding isogenic WT neurons (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 2E and F). Meanwhile, we found that p-tau231 positive puncta was notably elevated in the APP-CREB1 deficient neurons (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 2G). To further validate our findings, we performed ELISA analysis to measure the concentrations of A\u0026beta;42 and A\u0026beta;40 in the conditioned medium of 2-month-old\u0026nbsp;human cortical neurons (Fig. 2H). Our results revealed that APP-CREB1 deficient neurons exhibited significantly elevated A\u0026beta;42 concentrations, while decreased A\u0026beta;40 concentrations compared to WT neurons (Fig. 2I-J). The ELISA results provide further evidence that CREB1 plays a role in regulating the production, processing, and clearance of A\u0026beta; peptides in AD.\u0026nbsp;To assess the A\u0026beta; and p-tau231protein expression levels, WB analysis was performed on the fractions of iPSC-derived human cortical neurons. The WB results revealed a substantial increase in A\u0026beta; and p-tau231 protein expression in the CREB1-deficient neurons compared to their corresponding isogenic WT neurons (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, Fig. 2 K-M). However, the total tau protein did not show a significant change between WT and CREB1-deficient neurons. Our study demonstrates that CREB1 deficiency significantly enhances the accumulation and intensity of A\u0026beta; and p-tau231 in human cortical neurons, indicating that CREB1 plays a crucial role in modulating these key biomarkers of AD pathology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eactivated the cAMP-PKA-CREB pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePDE inhibitors have been shown to enhance CREB1 activity by increasing cAMP levels and PKA activation in AD[18, 19, 36]. To examine whether the dual inhibition of PDE4/10 activates the cAMP-PKA-CREB pathway, we employed a combination of PDE4 inhibitor (Rolipram) and PDE10 inhibitor (TAK-063) to stimulate cAMP levels and CREB1 activity in AD (Fig. 3A). Initially, we confirmed that both Rolipram and TAK-063 activated cAMP and PKA levels in neurons; Furthermore, we optimized the concentration of the combined application of Rolipram and TAK-063 inhibitors, ranging from 0 to 20 \u0026mu;M for each inhibitor. We found that the intracellular cAMP and PKA levels significantly elevated in a dose-dependent manner, peaking at 20 \u0026mu;M (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01, Fig. 3 B and D). Importantly, we observed that the combined application of Rolipram and TAK-063 showed a better effect than either inhibitor alone (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01, Fig. 3 C and E). Next, to investigate how the combined application of Rolipram and TAK-063 inhibitors affects the cAMP-PKA-CREB pathway, we performed WB analysis on this signaling-related protein expression on APP mutant neurons. We found that PKA expression levels were markedly elevated after treatment with dual inhibition Rolipram and TAK-063 (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, Fig. 3 F and H). Additionally, we discovered that the expression of pCREB1 (Ser133) was significantly higher in the Rolipram and TAK-063 combined group compared to single applications and the non-treated control group (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, Fig. 3 F and G). Consistently, Rolipram and TAK-063 together induce a notable elevation in the cAMP-PKA-CREB pathway as well as its downstream target BDNF (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, Fig. 3 F and I). To further corroborate our results, we conducted immunostaining to quantify the expression of pCREB1 (Ser133) in the APP mutant neuron. There is a significant increase in pCREB1 (Ser133) intensity and the percentage of positively stained area in the APP mutant neurons (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 3J-L). In summary, our study demonstrates that the combined application of PDE4/10 inhibitors, specifically Rolipram and TAK-063, effectively activates the cAMP-PKA-CREB pathway in AD model neurons. This activation results in elevated levels of PKA expression and pCREB1, indicative of enhanced neuronal signaling. Moreover, the observed increase in downstream BDNF expression suggests a potential mechanism for neuroprotection and synaptic plasticity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 rescues AD Pathology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe found that higher \u003cem\u003ePDE4A\u003c/em\u003e expression in human blood is associated with an increased risk of AD (Odds rate (OR): 1.145, 95% confidence interval (CI)=1.006-1.303, P-value=0.040) using summary-based Mendelian randomization (MR) analysis. Such association was replicated using alternative inverse-variance weighted MR analysis (OR: 1.141, 95% CI=1.018-1.278, P-value=0.022) (Table. S2) Next, to investigate whether the dual inhibition of PDE4/10 rescues AD pathology, we performed\u0026nbsp;immunofluorescence microscopy (IF)\u0026nbsp;and\u0026nbsp;western blotting (WB)\u0026nbsp;to examine levels of A\u0026beta; and p-tau231, along with quantification of A\u0026beta;40 and A\u0026beta;42\u0026nbsp;by ELISA\u0026nbsp;in APP mutant neurons (Fig. 4A). ELISA\u0026nbsp;\u0026nbsp;of\u0026nbsp;A\u0026beta;42 and A\u0026beta;40\u0026nbsp;was conducted for\u0026nbsp;the conditioned media\u0026nbsp;of\u0026nbsp;2 month-old\u0026nbsp;iPSC-derived\u0026nbsp;neurons.\u0026nbsp;The combined application of Rolipram and TAK-063 effectively reduces\u0026nbsp;A\u0026beta;42 concentration while elevating A\u0026beta;40 concentration in\u0026nbsp;the\u0026nbsp;APP-CREB1-KO\u0026nbsp;neurons.\u0026nbsp;Dual inhibition\u0026nbsp;effectively normalizes A\u0026beta;42 and A\u0026beta;40 concentrations in APP-CREB1-KO\u0026nbsp;neurons to levels comparable to those in WT neurons, suggesting an alternative pathway that could alleviate amyloid pathology independently of the\u0026nbsp;cAMP-PKA-CREB pathway (Fig. 4B and C) IF demonstrates\u0026nbsp;combined application of Rolipram and TAK-063 markedly reduced A\u0026beta; intensity compared to untreated APP mutant neurons\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 4D and E). Furthermore, we observed that p-tau231 intensity was\u0026nbsp;also\u0026nbsp;significantly enhanced in the Rolipram and TAK-063 combined group (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 4F and G).\u0026nbsp;Consistent with the IF results, WB analysis confirms that both A\u0026beta; and p-tau231 protein levels dramatically decreased in the Rolipram and TAK-063 combined group (Fig.4H-J ).\u0026nbsp;However, A\u0026beta; and p-tau231 expression levels in the Rolipram and TAK-063 combined group are not significantly different from those in WT neurons (Fig.4E, G, I, and J). These findings suggest that Rolipram and TAK-063 treatment can rescue AD pathology in APP mutant neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 reduced inflammation and exogenous A\u0026beta; accumulation in iPSC-derived microglia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn AD pathogenesis, inflammation contributes to neurodegeneration through the activation of immune responses and the release of pro-inflammatory cytokines[37]. To investigate the impact of the dual inhibition PDE4/10 on inflammation, we conducted ELISA to characterize pro-inflammatory and anti-inflammatory factors in the conditioned medium of APP iPSC-derived microglia (Fig.5A and B). iPSC-derived microglia were exposed to pre-formed synthetic human A\u0026beta;1-42 fibrils, followed by treatment with dual PDE4/10 inhibitors to assess their anti-inflammatory effects. We found a notable decrease in pro-inflammatory cytokines, including IFN-\u0026gamma;, IL-1\u0026beta;, IL-2, IL-6, and IL-8, after combined treatment with Rolipram and TAK-063 in APP iPSC-derived microglia (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, Fig.5 C-G). Conversely, anti-inflammatory cytokines IL-10 and TGF-\u0026beta; display a significant increase in the Rolipram and TAK-063 combined group (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, Fig.5H and I). These results suggest that the dual inhibition of PDE4/10 effectively mitigates inflammation in iPSC-derived microglia, promoting an anti-inflammatory response. Previous studies show that the accumulation of A\u0026beta; plaques triggers a chronic inflammatory response, exacerbating neuronal damage and cognitive impairment[38]. In our study, we observed that exogenous A\u0026beta; accumulation was significantly reduced in APP iPSC-derived microglia treated with a combination of Rolipram (PDE4 inhibitor) and TAK-063 (PDE10 inhibitor) following activation with pre-formed synthetic A\u0026beta;1-42 fibrils. (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig.5 J and K). \u0026nbsp;In summary, these results suggest that the dual inhibition PDE4/10 reduces inflammation, and leads to a sequential decrease in exogenous A\u0026beta; accumulation in activated APP iPSC-derived microglia.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 is critical for mitigating A\u0026beta; pathology and improving cognitive deficits in mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the role of the dual inhibition of PDE4/10 \u003cem\u003ein vivo\u003c/em\u003e, we conducted nasal delivery of the inhibitors to APP/PS1 mice.\u0026nbsp;We administered 1 mg/kg of combined Rolipram \u0026amp; TAK-063 (0.5 mg/kg each) via nasal delivery to 6-month-old adult APP/PS1 mice once daily for four weeks, followed by behavioral testing and brain analysis (Fig.6A). Our results indicate a significant reduction in both A\u0026beta; plaque and Thioflavin-S and A\u0026beta; co-staining positive area following combined administration of Rolipram and TAK-063 (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, Fig.6B-E). Additionally, we confirmed that both Rolipram and TAK-063 individually decreased A\u0026beta; plaque volume and area compared to the untreated sham group; however, its effects were less substantial than those observed with the combined administration of Rolipram and TAK-06 (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, Fig.6B-E). Consequently, we carried out an extensive series of behavioral tests with the four experimental groups, dual application of the two inhibitors, single inhibitor treatments, and non-treated control. Motor activity and spatial memory were assessed. \u0026nbsp;After 4 weeks of combined Rolipram and TAK-063 treatment in APP/PS1 mice, there is approximately 32% increase in the percentage of spontaneous alternation compared to the non-treated control mice (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 6F). Additionally, the combined Rolipram and TAK-063 treatment mice shows a significant ~22% increase in the percentage of entries into the novel arm compared to the non-treated control mice, as well as an increase in travel distance by approximately 3 meters compared to the non-treated control mice (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 6G). Meanwhile, we assessed motor activity by open field test and found that the time spent in the center increased by approximately 28 seconds, along with a travel distance of approximately 2.1 meters longer compared to the non-treated control mice (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 6H). Furthermore, our results showed that spatial memory, measured by novel object contact, increases by ~26%, and the exploration time increases by ~12 seconds in the combined Rolipram and TAK-063 treatment mice compared to the untreated control mice (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, Fig. 6I). In summary, our results demonstrated that the dual inhibition of PDE4/10 can reduce A\u0026beta; pathology and improve cognitive deficits in APP/PS1 mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual inhibition of PDE4/10 promotes neuronal resilience in AD\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, to evaluate the impact of dual inhibition of PDE4/10 on neuronal resilience in AD, we assessed both pre-and post-synaptic changes, along with electrophysiological properties, in APP iPSC-derived human cortical neurons and APP/PS1 mouse model. Treatment of APP iPSC-derived human cortical neurons with a combination of Rolipram and TAK-063 resulted in a significant increase in the total puncta of the presynaptic protein Synapsin I and the postsynaptic protein PSD95 (Fig. 7A-C). Additionally, the colocalization puncta number of Synapsin I and PSD95 was significantly increased (Fig. 7A and D), suggesting the combination of Rolipram and TAK-063 treatment improves synaptic connectivity. These findings indicate that dual inhibition of PDE4/10 may contribute to enhanced synaptic resilience in the context of AD. Electrophysiological recordings from the APP/PS1 mouse brain further supported these observations. Measurement of miniature excitatory postsynaptic currents (mEPSCs) showed an increase in synaptic activity in Rolipram and TAK-063 treated mouse brains compared to the non-treated (Fig. 7E). Furthermore, measurement of miniature inhibitory postsynaptic currents (mIPSCs) reveals the establishment of a functional inhibitory network in the Rolipram and TAK-063 treated mice (Fig. 7F). These findings suggest that dual PDE4/10 inhibition with Rolipram and TAK-063 modulates synaptic activity, promotes functional inhibitory network formation, and enhances neuronal resilience, mitigating synaptic dysfunction in AD and highlighting a promising therapeutic strategy for neurodegenerative diseases.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study provides compelling evidence that CREB1 downregulates in AD. Moreover, CREB1-deficient neurons drive the accumulation of A\u0026beta; and p-tau231, which are crucial biomarkers of AD pathology. By leveraging a multifaceted approach that includes human postmortem brain tissue, iPSC-derived human cortical neurons, macroglia, and in vivo APP mutant AD iPSC model, this study robustly demonstrates that CREB1 deficiency exacerbates these AD pathological markers. Importantly, the dual PDE4/10 inhibition activates the cAMP-PKA-CREB pathway, effectively decreasing and normalizing A\u0026beta; and p-tau231 levels, and mitigating inflammation. This dual inhibition of PDE4/10 strategy not only alleviates AD pathology but also significantly improves cognitive function and neuronal resilience in APP/PS1 mice, emphasizing the innovative findings of this study and its potential for therapeutic advancements.\u003c/p\u003e\n\u003cp\u003eIn our study, we delve into the therapeutic potential of a dual inhibition strategy targeting both PDE4/10 in AD. Prior research has underscored the pivotal role of the cAMP-PKA-CREB signaling pathway in AD pathogenesis[39, 40]. Specifically, inhibition of PDE4 has been shown to elevate cAMP levels, triggering the activation of PKA and subsequent phosphorylation of CREB, processes pivotal for synaptic plasticity and memory formation\u0026mdash;functions that are notably impaired in AD[41]. A previous study showed that pCREB1 (Ser133) plays a significant role in AD by modulating gene expression related to memory formation and neuronal survival[39].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConsistent with these studies, we confirmed a significant increase in cAMP and pCREB1 (Ser133) levels following dual PDE4/10 inhibition in AD mutant neurons. Despite the promising effects of Rolipram, a PDE4 inhibitor, in enhancing synaptic plasticity and promoting neurogenesis, its clinical utility remains constrained due to safety concerns, including gastrointestinal issues and an increased risk of seizures[42, 43]. Similarly, TAK-063, a novel compound targeting neural activity, holds promise in addressing neuronal diseases such as schizophrenia, Huntington\u0026apos;s disease, and other mental health disorders in clinical trials[44, 45]. Our study provides evidence that PDE10 inhibitor (TAK-063) reduces the pathology of AD. Studies have illuminated that PDE10 inhibition induces elevated cGMP levels, activating downstream signaling cascades that intersect with cAMP pathways, thereby enhancing neuronal function and synaptic plasticity. Our study builds upon previous work by implementing a dual inhibition strategy targeting both PDE4 and PDE10[46]. This innovative approach not only enhances synaptic plasticity but also provides neuroprotective and anti-inflammatory effects, offering a more comprehensive therapeutic intervention. Additionally, by activating the cAMP-PKA-CREB signaling pathway, our approach can potentially mitigate side effects associated with high doses of single PDE4 inhibitor treatment, and boosting the inhibition of PDE10 modulates neural signaling and elevates the anti-inflammatory effects. During our study, we also verified that dual inhibition of PDE4/10 promotes both cognitive function and neuronal resilience in AD. This strategy leverages the synergistic interplay between PDE4/10 enzymes, presenting a promising multifaceted strategy for treating AD.\u003c/p\u003e\n\u003cp\u003eBy leveraging the synergistic interplay between PDE4/10 inhibitors, we observed a significant increase in downstream brain-derived neurotrophic factor (BDNF) expression in the AD mutant neurons model. This upregulation of BDNF suggests a potential mechanism for neuroprotection and enhanced synaptic plasticity, which are critical factors in maintaining neuronal health and function[47]. Moreover, the combined application of PDE4/10 inhibitors was shown to reduce inflammation and lead to a sequential decrease in A\u0026beta; accumulation in activated APP iPSC-derived microglia[48]. This reduction in A\u0026beta; pathology is particularly noteworthy as it addresses one of the hallmark features of AD[49]. Additionally, we discovered that tau-231 levels increased in CREB1-deficient neurons, while a notable reduction was observed after dual inhibition of PDE4/10 in neurons. Our results demonstrated that this therapeutic approach significantly mitigated A\u0026beta; and tau pathology in AD mutant neurons. \u0026nbsp;Additionally, our electrophysiology results revealed significant improvements in neural signaling, including enhanced synaptic stability and functional network formation, following dual inhibition of PDE4/10 in APP/PS1 models. These findings underscore the potential efficacy of this approach in promoting neuronal resilience and function in AD. The observed pre- and post-synaptic changes further highlight the strategy\u0026apos;s ability to support the integrity and connectivity of neural circuits, which are critical in combating the synaptic degeneration characteristic of AD[50]. The combination of Rolipram and TAK-063 not only improved synaptic connectivity, as shown by increased colocalization of Synapsin I and PSD95, but also modulated electrophysiological properties, leading to more robust synaptic activity and the formation of a functional inhibitory network. This dual inhibition approach addresses both excitatory and inhibitory synaptic dysfunctions, offering a promising strategy to mitigate progressive synaptic loss and cognitive decline in AD.\u003c/p\u003e\n\u003cp\u003eHowever, it is essential to acknowledge the limitations of our study. One crucial aspect is the necessity to evaluate the long-term safety and efficacy of dual PDE4/10 inhibition in APP/PS1 mouse models. Additionally, further investigation is required to determine the precise dosage to achieve therapeutic benefits without inducing adverse side effects. Furthermore, future studies should consider the impact of dual PDE4/10 inhibition on other signaling pathways and their potential interactions with existing AD treatments. Additionally, there is a need to elucidate the detailed molecular mechanisms involved and to explore the long-term effects of combined PDE4/10 inhibition across diverse AD models.\u003c/p\u003e\n\u003cp\u003eIn conclusion, our study demonstrates that dual inhibition of PDE4/10 revitalizes neuronal resilience, presenting a promising strategy for combating AD. By targeting the cAMP-PKA-CREB signaling pathway, this approach effectively reduces inflammation and A\u0026beta; pathology, while enhancing synaptic plasticity and cognitive function. Our findings underscore the potential of dual PDE4/10 inhibition to provide more effective treatment compared to single-target strategies, offering a greater therapeutic benefit for this devastating disease.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlzheimer\u0026rsquo;s disease\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAmyloid‑beta\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAPP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAmyloid precursor protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eBRAAK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eBraak neurofibrillary tangle stage\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eC-KO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCREB1 knockout\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCERAD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eConsortium to Establish a Registry for Alzheimer\u0026rsquo;s Disease\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eConditioned medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCREB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ecAMP response element‑binding protein 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCSF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCerebrospinal fluid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eELISA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eEnzyme‑linked immunosorbent assay\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eFACS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFluorescence‑activated cell sorting\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eFDX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFinal diagnosis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGWAS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGenome‑wide association study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eImmunofluorescence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIL‑1\u0026beta;, IL‑2, IL‑6, etc.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInterleukin‑1\u0026beta;, Interleukin‑2, Interleukin‑6, Interleukin‑8, Interleukin‑10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIba1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eIonized calcium binding adapter molecule 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eMAP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMicrotubule‑associated protein 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003emEPSC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMiniature excitatory postsynaptic current\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003emIPSC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMiniature inhibitory postsynaptic current\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePKA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProtein kinase A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePDE4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePhosphodiesterase type 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePDE10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePhosphodiesterase type 10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ep‑CREB1 Ser133\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePhosphorylated CREB1 at serine 133\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ep‑tau231\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePhosphorylated tau at threonine 231\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePMD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePostmortem delay\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePSD95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePostsynaptic density protein 95\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eqPCR (RT‑qPCR)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eQuantitative reverse transcription PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSingle nucleotide polymorphism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTAF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTATA‑box binding protein‑associated factor 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTGF‑\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTransforming growth factor beta\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eThioflavin‑S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eThioflavin‑S stain\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eY‑maze\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eY‑shaped maze (spatial memory test)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by Jilin Dashu Biotechnology Co., Ltd., which holds intellectual property and patents related to this work.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.R. and H.Z. contributed to conceptualization. H.F., J.S., M.Y., P.W., C.L., B.C., P.Z., C.C., and L.B. performed the experiments. Y.Q. and J.G. conducted the GWAS analysis. X.R. conducted formal data analysis, drew abstract graphic and wrote the original draft, H.Z. provided supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJilin Dashu Biotechnology Co., Ltd. for neurogenerative research.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments in this study were approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University Hospital and were conducted in accordance with institutional guidelines for the Care and Use of Laboratory Animals.\u003c/p\u003e\n\u003cp\u003eAll procedures involving human iPSCs or postmortem human brain tissue were approved by the Institutional Review Board of the Second Affiliated Hospital of Soochow University. Written informed consent was obtained from all participants or their legal guardians, and all human tissue research complied with the ethical principles outlined in the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMathys H, Peng Z, Boix CA, Victor MB, Leary N, Babu S, Abdelhady G, Jiang X, Ng AP, Ghafari K\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSingle-cell atlas reveals correlates of high cognitive function, dementia, and resilience to Alzheimer\u0026apos;s disease pathology\u003c/strong\u003e. \u003cem\u003eCell \u003c/em\u003e2023, \u003cstrong\u003e186\u003c/strong\u003e(20):4365-4385.e4327.\u003c/li\u003e\n\u003cli\u003eChen S, Cao Z, Nandi A, Counts N, Jiao L, Prettner K, Kuhn M, Seligman B, Tortorice D, Vigo D\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe global macroeconomic burden of Alzheimer\u0026apos;s disease and other dementias: estimates and projections for 152 countries or territories\u003c/strong\u003e. \u003cem\u003eLancet Glob Health \u003c/em\u003e2024, \u003cstrong\u003e12\u003c/strong\u003e(9):e1534-e1543.\u003c/li\u003e\n\u003cli\u003eAiello Bowles EJ, Crane PK, Walker RL, Chubak J, LaCroix AZ, Anderson ML, Rosenberg D, Keene CD, Larson EB: \u003cstrong\u003eCognitive Resilience to Alzheimer\u0026apos;s Disease Pathology in the Human Brain\u003c/strong\u003e. \u003cem\u003eJ Alzheimers Dis \u003c/em\u003e2019, \u003cstrong\u003e68\u003c/strong\u003e(3):1071-1083.\u003c/li\u003e\n\u003cli\u003eStern Y: \u003cstrong\u003eCognitive reserve in ageing and Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eLancet Neurol \u003c/em\u003e2012, \u003cstrong\u003e11\u003c/strong\u003e(11):1006-1012.\u003c/li\u003e\n\u003cli\u003eCummings JL, Tong G, Ballard C: \u003cstrong\u003eTreatment Combinations for Alzheimer\u0026apos;s Disease: Current and Future Pharmacotherapy Options\u003c/strong\u003e. \u003cem\u003eJ Alzheimers Dis \u003c/em\u003e2019, \u003cstrong\u003e67\u003c/strong\u003e(3):779-794.\u003c/li\u003e\n\u003cli\u003eShanks HRC, Onuska KM, Massa SM, Schmitz TW, Longo FM: \u003cstrong\u003eTargeting Endogenous Mechanisms of Brain Resilience for the Treatment and Prevention of Alzheimer\u0026apos;s Disease\u003c/strong\u003e. \u003cem\u003eJ Prev Alzheimers Dis \u003c/em\u003e2023, \u003cstrong\u003e10\u003c/strong\u003e(4):699-705.\u003c/li\u003e\n\u003cli\u003eYuan L, Zhang J, Guo JH, Holscher C, Yang JT, Wu MN, Wang ZJ, Cai HY, Han LN, Shi H\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDAla2-GIP-GLU-PAL Protects Against Cognitive Deficits and Pathology in APP/PS1 Mice by Inhibiting Neuroinflammation and Upregulating cAMP/PKA/CREB Signaling Pathways\u003c/strong\u003e. \u003cem\u003eJ Alzheimers Dis \u003c/em\u003e2021, \u003cstrong\u003e80\u003c/strong\u003e(2):695-713.\u003c/li\u003e\n\u003cli\u003eNing Z, Zhong X, Wu Y, Wang Y, Hu D, Wang K, Deng M: \u003cstrong\u003e\u0026beta;-asarone improves cognitive impairment and alleviates autophagy in mice with vascular dementia via the cAMP/PKA/CREB pathway\u003c/strong\u003e. \u003cem\u003ePhytomedicine \u003c/em\u003e2024, \u003cstrong\u003e123\u003c/strong\u003e:155215.\u003c/li\u003e\n\u003cli\u003eSassone-Corsi P: \u003cstrong\u003eThe cyclic AMP pathway\u003c/strong\u003e. \u003cem\u003eCold Spring Harb Perspect Biol \u003c/em\u003e2012, \u003cstrong\u003e4\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eSkaper SD, Facci L, Zusso M, Giusti P: \u003cstrong\u003eSynaptic Plasticity, Dementia and Alzheimer Disease\u003c/strong\u003e. \u003cem\u003eCNS Neurol Disord Drug Targets \u003c/em\u003e2017, \u003cstrong\u003e16\u003c/strong\u003e(3):220-233.\u003c/li\u003e\n\u003cli\u003eParker T, Wang KW, Manning D, Dart C: \u003cstrong\u003eSoluble adenylyl cyclase links Ca(2+) entry to Ca(2+)/cAMP-response element binding protein (CREB) activation in vascular smooth muscle\u003c/strong\u003e. \u003cem\u003eSci Rep \u003c/em\u003e2019, \u003cstrong\u003e9\u003c/strong\u003e(1):7317.\u003c/li\u003e\n\u003cli\u003eGuan R, Lv J, Xiao F, Tu Y, Xie Y, Li L: \u003cstrong\u003ePotential role of the cAMP/PKA/CREB signalling pathway in hypoxic preconditioning and effect on propofol\u003c/strong\u003e\u003cstrong\u003e‑induced neurotoxicity in the hippocampus of neonatal rats\u003c/strong\u003e. \u003cem\u003eMol Med Rep \u003c/em\u003e2019, \u003cstrong\u003e20\u003c/strong\u003e(2):1837-1845.\u003c/li\u003e\n\u003cli\u003eLuo Y, Kuang S, Li H, Ran D, Yang J: \u003cstrong\u003ecAMP/PKA-CREB-BDNF signaling pathway in hippocampus mediates cyclooxygenase 2-induced learning/memory deficits of rats subjected to chronic unpredictable mild stress\u003c/strong\u003e. \u003cem\u003eOncotarget \u003c/em\u003e2017, \u003cstrong\u003e8\u003c/strong\u003e(22):35558-35572.\u003c/li\u003e\n\u003cli\u003eZhang T, Luu MDA, Dolga AM, Eisel ULM, Schmidt M: \u003cstrong\u003eThe old second messenger cAMP teams up with novel cell death mechanisms: potential translational therapeutical benefit for Alzheimer\u0026apos;s disease and Parkinson\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eFront Physiol \u003c/em\u003e2023, \u003cstrong\u003e14\u003c/strong\u003e:1207280.\u003c/li\u003e\n\u003cli\u003eWeller J, Budson A: \u003cstrong\u003eCurrent understanding of Alzheimer\u0026apos;s disease diagnosis and treatment\u003c/strong\u003e. \u003cem\u003eF1000Res \u003c/em\u003e2018, \u003cstrong\u003e7\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eRicciarelli R, Fedele E: \u003cstrong\u003ecAMP, cGMP and Amyloid \u0026beta;: Three Ideal Partners for Memory Formation\u003c/strong\u003e. \u003cem\u003eTrends Neurosci \u003c/em\u003e2018, \u003cstrong\u003e41\u003c/strong\u003e(5):255-266.\u003c/li\u003e\n\u003cli\u003eAzevedo MF, Faucz FR, Bimpaki E, Horvath A, Levy I, de Alexandre RB, Ahmad F, Manganiello V, Stratakis CA: \u003cstrong\u003eClinical and molecular genetics of the phosphodiesterases (PDEs)\u003c/strong\u003e. \u003cem\u003eEndocr Rev \u003c/em\u003e2014, \u003cstrong\u003e35\u003c/strong\u003e(2):195-233.\u003c/li\u003e\n\u003cli\u003eGurney ME, D\u0026apos;Amato EC, Burgin AB: \u003cstrong\u003ePhosphodiesterase-4 (PDE4) molecular pharmacology and Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eNeurotherapeutics \u003c/em\u003e2015, \u003cstrong\u003e12\u003c/strong\u003e(1):49-56.\u003c/li\u003e\n\u003cli\u003eZagorska A, Partyka A, Bucki A, Gawalskax A, Czopek A, Pawlowski M: \u003cstrong\u003ePhosphodiesterase 10 Inhibitors - Novel Perspectives for Psychiatric and Neurodegenerative Drug Discovery\u003c/strong\u003e. \u003cem\u003eCurr Med Chem \u003c/em\u003e2018, \u003cstrong\u003e25\u003c/strong\u003e(29):3455-3481.\u003c/li\u003e\n\u003cli\u003eBhat A, Ray B, Mahalakshmi AM, Tuladhar S, Nandakumar DN, Srinivasan M, Essa MM, Chidambaram SB, Guillemin GJ, Sakharkar MK: \u003cstrong\u003ePhosphodiesterase-4 enzyme as a therapeutic target in neurological disorders\u003c/strong\u003e. \u003cem\u003ePharmacol Res \u003c/em\u003e2020, \u003cstrong\u003e160\u003c/strong\u003e:105078.\u003c/li\u003e\n\u003cli\u003eCampbell SL, van Groen T, Kadish I, Smoot LHM, Bolger GB: \u003cstrong\u003eAltered phosphorylation, electrophysiology, and behavior on attenuation of PDE4B action in hippocampus\u003c/strong\u003e. \u003cem\u003eBMC Neurosci \u003c/em\u003e2017, \u003cstrong\u003e18\u003c/strong\u003e(1):77.\u003c/li\u003e\n\u003cli\u003eYang Y, Ma S, Wei F, Liang G, Yang X, Huang Y, Wang J, Zou Y: \u003cstrong\u003ePivotal role of cAMP-PKA-CREB signaling pathway in manganese-induced neurotoxicity in PC12 cells\u003c/strong\u003e. \u003cem\u003eEnviron Toxicol \u003c/em\u003e2019, \u003cstrong\u003e34\u003c/strong\u003e(9):1052-1062.\u003c/li\u003e\n\u003cli\u003eGuo H, Cheng Y, Wang C, Wu J, Zou Z, Niu B, Yu H, Wang H, Xu J: \u003cstrong\u003eFFPM, a PDE4 inhibitor, reverses learning and memory deficits in APP/PS1 transgenic mice via cAMP/PKA/CREB signaling and anti-inflammatory effects\u003c/strong\u003e. \u003cem\u003eNeuropharmacology \u003c/em\u003e2017, \u003cstrong\u003e116\u003c/strong\u003e:260-269.\u003c/li\u003e\n\u003cli\u003eSchepers M, Hendrix S, Mussen F, van Breedam E, Ponsaerts P, Lemmens S, Hellings N, Ricciarelli R, Fedele E, Bruno O\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAmelioration of functional and histopathological consequences after spinal cord injury through phosphodiesterase 4D (PDE4D) inhibition\u003c/strong\u003e. \u003cem\u003eNeurotherapeutics \u003c/em\u003e2024, \u003cstrong\u003e21\u003c/strong\u003e(4):e00372.\u003c/li\u003e\n\u003cli\u003eJ\u0026auml;ger R, Russwurm C, Schwede F, Genieser HG, Koesling D, Russwurm M: \u003cstrong\u003eActivation of PDE10 and PDE11 phosphodiesterases\u003c/strong\u003e. \u003cem\u003eJ Biol Chem \u003c/em\u003e2012, \u003cstrong\u003e287\u003c/strong\u003e(2):1210-1219.\u003c/li\u003e\n\u003cli\u003eBeaumont V, Zhong S, Lin H, Xu W, Bradaia A, Steidl E, Gleyzes M, Wadel K, Buisson B, Padovan-Neto FE\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003ePhosphodiesterase 10A Inhibition Improves Cortico-Basal Ganglia Function in Huntington\u0026apos;s Disease Models\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2016, \u003cstrong\u003e92\u003c/strong\u003e(6):1220-1237.\u003c/li\u003e\n\u003cli\u003eShiraishi E, Suzuki K, Harada A, Suzuki N, Kimura H: \u003cstrong\u003eThe Phosphodiesterase 10A Selective Inhibitor TAK-063 Improves Cognitive Functions Associated with Schizophrenia in Rodent Models\u003c/strong\u003e. \u003cem\u003eJ Pharmacol Exp Ther \u003c/em\u003e2016, \u003cstrong\u003e356\u003c/strong\u003e(3):587-595.\u003c/li\u003e\n\u003cli\u003eKunkle BW, Grenier-Boley B, Sims R, Bis JC, Damotte V, Naj AC, Boland A, Vronskaya M, van der Lee SJ, Amlie-Wolf A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eGenetic meta-analysis of diagnosed Alzheimer\u0026apos;s disease identifies new risk loci and implicates A\u0026beta;, tau, immunity and lipid processing\u003c/strong\u003e. \u003cem\u003eNat Genet \u003c/em\u003e2019, \u003cstrong\u003e51\u003c/strong\u003e(3):414-430.\u003c/li\u003e\n\u003cli\u003ePaquet D, Kwart D, Chen A, Sproul A, Jacob S, Teo S, Olsen KM, Gregg A, Noggle S, Tessier-Lavigne M: \u003cstrong\u003eEfficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e2016, \u003cstrong\u003e533\u003c/strong\u003e(7601):125-129.\u003c/li\u003e\n\u003cli\u003eKwart D, Gregg A, Scheckel C, Murphy EA, Paquet D, Duffield M, Fak J, Olsen O, Darnell RB, Tessier-Lavigne M: \u003cstrong\u003eA Large Panel of Isogenic APP and PSEN1 Mutant Human iPSC Neurons Reveals Shared Endosomal Abnormalities Mediated by APP \u0026beta;-CTFs, Not A\u0026beta;\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2019, \u003cstrong\u003e104\u003c/strong\u003e(2):256-270.e255.\u003c/li\u003e\n\u003cli\u003eXie Y, Wang D, Lan F, Wei G, Ni T, Chai R, Liu D, Hu S, Li M, Li D\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAn episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells\u003c/strong\u003e. \u003cem\u003eSci Rep \u003c/em\u003e2017, \u003cstrong\u003e7\u003c/strong\u003e(1):2320.\u003c/li\u003e\n\u003cli\u003eRong X, Chu W, Zhang H, Wang Y, Qi X, Zhang G, Wang Y, Li C: \u003cstrong\u003eAntler stem cell-conditioned medium stimulates regenerative wound healing in rats\u003c/strong\u003e. \u003cem\u003eStem Cell Res Ther \u003c/em\u003e2019, \u003cstrong\u003e10\u003c/strong\u003e(1):326.\u003c/li\u003e\n\u003cli\u003eSadigh-Eteghad S, Sabermarouf B, Majdi A, Talebi M, Farhoudi M, Mahmoudi J: \u003cstrong\u003eAmyloid-beta: a crucial factor in Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eMed Princ Pract \u003c/em\u003e2015, \u003cstrong\u003e24\u003c/strong\u003e(1):1-10.\u003c/li\u003e\n\u003cli\u003eHampel H, Hardy J, Blennow K, Chen C, Perry G, Kim SH, Villemagne VL, Aisen P, Vendruscolo M, Iwatsubo T\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe Amyloid-\u0026beta; Pathway in Alzheimer\u0026rsquo;s Disease\u003c/strong\u003e. \u003cem\u003eMolecular Psychiatry \u003c/em\u003e2021, \u003cstrong\u003e26\u003c/strong\u003e(10):5481-5503.\u003c/li\u003e\n\u003cli\u003eAshton NJ, Pascoal TA, Karikari TK, Benedet AL, Lantero-Rodriguez J, Brinkmalm G, Snellman A, Sch\u0026ouml;ll M, Troakes C, Hye A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003ePlasma p-tau231: a new biomarker for incipient Alzheimer\u0026apos;s disease pathology\u003c/strong\u003e. \u003cem\u003eActa Neuropathol \u003c/em\u003e2021, \u003cstrong\u003e141\u003c/strong\u003e(5):709-724.\u003c/li\u003e\n\u003cli\u003eSanders O, Rajagopal L: \u003cstrong\u003ePhosphodiesterase Inhibitors for Alzheimer\u0026apos;s Disease: A Systematic Review of Clinical Trials and Epidemiology with a Mechanistic Rationale\u003c/strong\u003e. \u003cem\u003eJ Alzheimers Dis Rep \u003c/em\u003e2020, \u003cstrong\u003e4\u003c/strong\u003e(1):185-215.\u003c/li\u003e\n\u003cli\u003eAthar T, Al Balushi K, Khan SA: \u003cstrong\u003eRecent advances on drug development and emerging therapeutic agents for Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eMol Biol Rep \u003c/em\u003e2021, \u003cstrong\u003e48\u003c/strong\u003e(7):5629-5645.\u003c/li\u003e\n\u003cli\u003eHabashi M, Vutla S, Tripathi K, Senapati S, Chauhan PS, Haviv-Chesner A, Richman M, Mohand SA, Dumulon-Perreault V, Mulamreddy R\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEarly diagnosis and treatment of Alzheimer\u0026apos;s disease by targeting toxic soluble A\u0026beta; oligomers\u003c/strong\u003e. \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2022, \u003cstrong\u003e119\u003c/strong\u003e(49):e2210766119.\u003c/li\u003e\n\u003cli\u003eSharma VK, Singh TG: \u003cstrong\u003eCREB: A Multifaceted Target for Alzheimer\u0026apos;s Disease\u003c/strong\u003e. \u003cem\u003eCurr Alzheimer Res \u003c/em\u003e2020, \u003cstrong\u003e17\u003c/strong\u003e(14):1280-1293.\u003c/li\u003e\n\u003cli\u003eChen Y, Huang X, Zhang YW, Rockenstein E, Bu G, Golde TE, Masliah E, Xu H: \u003cstrong\u003eAlzheimer\u0026apos;s \u0026beta;-secretase (BACE1) regulates the cAMP/PKA/CREB pathway independently of \u0026beta;-amyloid\u003c/strong\u003e. \u003cem\u003eJ Neurosci \u003c/em\u003e2012, \u003cstrong\u003e32\u003c/strong\u003e(33):11390-11395.\u003c/li\u003e\n\u003cli\u003eMcCahill A, Campbell L, McSorley T, Sood A, Lynch MJ, Li X, Yan C, Baillie GS, Houslay MD: \u003cstrong\u003eIn cardiac myocytes, cAMP elevation triggers the down-regulation of transcripts and promoter activity for cyclic AMP phosphodiesterase-4A10 (PDE4A10)\u003c/strong\u003e. \u003cem\u003eCell Signal \u003c/em\u003e2008, \u003cstrong\u003e20\u003c/strong\u003e(11):2071-2083.\u003c/li\u003e\n\u003cli\u003eDastgheib M, Shetab-Boushehri SV, Baeeri M, Gholami M, Karimi MY, Hosseini A: \u003cstrong\u003eRolipram and pentoxifylline combination ameliorates experimental diabetic neuropathy through inhibition of oxidative stress and inflammatory pathways in the dorsal root ganglion neurons\u003c/strong\u003e. \u003cem\u003eMetab Brain Dis \u003c/em\u003e2022, \u003cstrong\u003e37\u003c/strong\u003e(7):2615-2627.\u003c/li\u003e\n\u003cli\u003eGobejishvili L, Rodriguez WE, Bauer P, Wang Y, Soni C, Lydic T, Barve S, McClain C, Maldonado C: \u003cstrong\u003eNovel Liposomal Rolipram Formulation for Clinical Application to Reduce Emesis\u003c/strong\u003e. \u003cem\u003eDrug Des Devel Ther \u003c/em\u003e2022, \u003cstrong\u003e16\u003c/strong\u003e:1301-1309.\u003c/li\u003e\n\u003cli\u003eSuzuki K, Kimura H: \u003cstrong\u003eTAK-063, a novel PDE10A inhibitor with balanced activation of direct and indirect pathways, provides a unique opportunity for the treatment of schizophrenia\u003c/strong\u003e. \u003cem\u003eCNS Neurosci Ther \u003c/em\u003e2018, \u003cstrong\u003e24\u003c/strong\u003e(7):604-614.\u003c/li\u003e\n\u003cli\u003eMacek TA, Suzuki K, Asin K, Kimura H: \u003cstrong\u003eTranslational Development Strategies for TAK-063, a Phosphodiesterase 10A Inhibitor\u003c/strong\u003e. \u003cem\u003eInt J Neuropsychopharmacol \u003c/em\u003e2020, \u003cstrong\u003e23\u003c/strong\u003e(8):524-532.\u003c/li\u003e\n\u003cli\u003eBirjandi SZ, Abduljawad N, Nair S, Dehghani M, Suzuki K, Kimura H, Carmichael ST: \u003cstrong\u003ePhosphodiesterase 10A Inhibition Leads to Brain Region-Specific Recovery Based on Stroke Type\u003c/strong\u003e. \u003cem\u003eTransl Stroke Res \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e(2):303-315.\u003c/li\u003e\n\u003cli\u003eLeal G, Bramham CR, Duarte CB: \u003cstrong\u003eBDNF and Hippocampal Synaptic Plasticity\u003c/strong\u003e. \u003cem\u003eVitam Horm \u003c/em\u003e2017, \u003cstrong\u003e104\u003c/strong\u003e:153-195.\u003c/li\u003e\n\u003cli\u003eAbud EM, Ramirez RN, Martinez ES, Healy LM, Nguyen CHH, Newman SA, Yeromin AV, Scarfone VM, Marsh SE, Fimbres C\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eiPSC-Derived Human Microglia-like Cells to Study Neurological Diseases\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2017, \u003cstrong\u003e94\u003c/strong\u003e(2):278-293.e279.\u003c/li\u003e\n\u003cli\u003eBassil F, Brown HJ, Pattabhiraman S, Iwasyk JE, Maghames CM, Meymand ES, Cox TO, Riddle DM, Zhang B, Trojanowski JQ\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAmyloid-Beta (A\u0026beta;) Plaques Promote Seeding and Spreading of Alpha-Synuclein and Tau in a Mouse Model of Lewy Body Disorders with A\u0026beta; Pathology\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2020, \u003cstrong\u003e105\u003c/strong\u003e(2):260-275.e266.\u003c/li\u003e\n\u003cli\u003eGao L, Zhang Y, Sterling K, Song W: \u003cstrong\u003eBrain-derived neurotrophic factor in Alzheimer\u0026apos;s disease and its pharmaceutical potential\u003c/strong\u003e. \u003cem\u003eTransl Neurodegener \u003c/em\u003e2022, \u003cstrong\u003e11\u003c/strong\u003e(1):4.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"alzheimers-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"azrt","sideBox":"Learn more about [Alzheimer's Research and Therapy](http://alzres.biomedcentral.com/)","snPcode":"13195","submissionUrl":"https://submission.nature.com/new-submission/13195/3","title":"Alzheimer's Research \u0026 Therapy","twitterHandle":"@AlzheimersRes","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Alzheimer's disease, PDE4/10 inhibition, cAMP-PKA-CREB signaling, Neuronal resilience","lastPublishedDoi":"10.21203/rs.3.rs-6907913/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6907913/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003eAlzheimer’s disease (AD) involves cognitive decline, amyloid-beta (Aβ) accumulation, tau hyperphosphorylation, and neuroinflammation. CREB1, a key transcription factor for memory, is downregulated in AD, contributing to disease progression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003eWe used human iPSC-derived cortical neurons and microglia, along with the APP/PS1 AD mouse model, to investigate the role of CREB1 and assess the therapeutic potential of dual PDE4/10 inhibition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eCREB1 deficiency increased Aβ and p-tau231 accumulation. Dual inhibition of PDE4 and PDE10 activated the cAMP-PKA-CREB pathway, restoring CREB1 activity, reducing Aβ and p-tau231, and mitigating neuroinflammation. This intervention improved synaptic plasticity and cognitive performance in vivo.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions \u003c/strong\u003eOur findings demonstrate that dual PDE4/10 inhibition synergistically enhances CREB1 signaling, promoting neuroprotection and synaptic remodeling. This approach offers a promising therapeutic strategy for modifying AD pathology and restoring cognitive function.\u003c/p\u003e","manuscriptTitle":"Dual PDE4/10 Inhibition Restores CREB1 Function and Enhances Neuronal Resilience in Alzheimer's Disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-23 15:56:16","doi":"10.21203/rs.3.rs-6907913/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-07-24T11:50:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-24T11:19:11+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-23T20:29:16+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-23T11:36:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"148485294300779767453860607645561941598","date":"2025-07-16T09:00:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-15T12:27:12+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-11T15:02:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"311346806864632653647690926007194293467","date":"2025-07-10T11:22:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"315266263752375752423176742422250110534","date":"2025-07-10T11:02:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"74385897076712072447922674856882303566","date":"2025-07-08T14:59:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"45763772852343494155227947118995611332","date":"2025-06-25T17:33:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-19T17:14:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-19T10:22:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-19T10:21:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Alzheimer's Research \u0026 Therapy","date":"2025-06-16T18:05:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"alzheimers-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"azrt","sideBox":"Learn more about [Alzheimer's Research and Therapy](http://alzres.biomedcentral.com/)","snPcode":"13195","submissionUrl":"https://submission.nature.com/new-submission/13195/3","title":"Alzheimer's Research \u0026 Therapy","twitterHandle":"@AlzheimersRes","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"40abd18e-8277-45cc-bbb0-af364fe2d6b3","owner":[],"postedDate":"June 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-03T16:07:41+00:00","versionOfRecord":{"articleIdentity":"rs-6907913","link":"https://doi.org/10.1186/s13195-025-01869-6","journal":{"identity":"alzheimers-research-and-therapy","isVorOnly":false,"title":"Alzheimer's Research \u0026 Therapy"},"publishedOn":"2025-10-27 15:58:25","publishedOnDateReadable":"October 27th, 2025"},"versionCreatedAt":"2025-06-23 15:56:16","video":"","vorDoi":"10.1186/s13195-025-01869-6","vorDoiUrl":"https://doi.org/10.1186/s13195-025-01869-6","workflowStages":[]},"version":"v1","identity":"rs-6907913","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6907913","identity":"rs-6907913","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.