Liujunzi Decoction Ameliorates Ulcerative Colitis by Suppression of M1 Macrophage via the NF-κB/MAPK Pathway in DSS mice

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Liujunzi Decoction is a traditional Chinese medicine prescription, which is made by decocting six herbs: Citrus reticulata Blanco (Family Rutaceae) , Pinellia ternata (Thunb.) Makino (Family Araceae) , Panax ginseng C. A. Meyer (Family Araliaceae) , Atractylodes macrocephala Koidz. (Family Compositae) , Poria cocos (Schw.) Wolf (Family Polyporaceae) and Glycyrrhiza glabra L. (Family Leguminosae) . It is mainly used to treat Spleen-Stomach deficiency syndrome. Methods Network pharmacology and transcriptomics (RNA-seq) identified LJD’s potential targets and pathways. A DSS-induced mouse colitis model assessed LJD efficacy including symptom severity, colon length, histology. In vitro, RAW 264.7 macrophages stimulated with LPS + LJD-containing serum were analyzed via flow cytometry (CD86), RT-qPCR (cytokines), and Western blot (NF-κB P65, ERK, JNK, P38 phosphorylation). LC-MS/MS characterized LJD components. Results LJD significantly alleviated DSS-induced colitis, reducing disease activity, colon shortening, and histopathological damage. Network and transcriptomic analyses converged on NF-κB/MAPK pathway inhibition. LJD downregulated pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and suppressed M1 macrophage polarization in vivo (reduced CD86 + ) and in vitro (reduced CD86 + cells and iNOS). Mechanistically, LJD inhibited phosphorylation of NF-κB, ERK, JNK and P38 in colonic tissue and LPS-stimulated macrophages. Conclusion LJD ameliorates UC by inhibiting NF-κB/MAPK signaling, thereby suppressing pathogenic M1 macrophage polarization and inflammation. This supports LJD’s potential as a complementary UC therapy targeting macrophage plasticity.
Full text 178,904 characters · extracted from preprint-html · click to expand
Liujunzi Decoction Ameliorates Ulcerative Colitis by Suppression of M1 Macrophage via the NF-κB/MAPK Pathway in DSS mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Liujunzi Decoction Ameliorates Ulcerative Colitis by Suppression of M1 Macrophage via the NF-κB/MAPK Pathway in DSS mice Qingyuan Zhang, Jing Jing, Wenyu Jia, Huiru Lu, Bangjie Li, Jinju Zhang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7486667/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Liujunzi Decoction is a traditional Chinese medicine prescription, which is made by decocting six herbs: Citrus reticulata Blanco (Family Rutaceae) , Pinellia ternata (Thunb.) Makino (Family Araceae) , Panax ginseng C. A. Meyer (Family Araliaceae) , Atractylodes macrocephala Koidz. (Family Compositae) , Poria cocos (Schw.) Wolf (Family Polyporaceae) and Glycyrrhiza glabra L. (Family Leguminosae) . It is mainly used to treat Spleen-Stomach deficiency syndrome. Methods Network pharmacology and transcriptomics (RNA-seq) identified LJD’s potential targets and pathways. A DSS-induced mouse colitis model assessed LJD efficacy including symptom severity, colon length, histology. In vitro, RAW 264.7 macrophages stimulated with LPS + LJD-containing serum were analyzed via flow cytometry (CD86), RT-qPCR (cytokines), and Western blot (NF-κB P65, ERK, JNK, P38 phosphorylation). LC-MS/MS characterized LJD components. Results LJD significantly alleviated DSS-induced colitis, reducing disease activity, colon shortening, and histopathological damage. Network and transcriptomic analyses converged on NF-κB/MAPK pathway inhibition. LJD downregulated pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and suppressed M1 macrophage polarization in vivo (reduced CD86 + ) and in vitro (reduced CD86 + cells and iNOS). Mechanistically, LJD inhibited phosphorylation of NF-κB, ERK, JNK and P38 in colonic tissue and LPS-stimulated macrophages. Conclusion LJD ameliorates UC by inhibiting NF-κB/MAPK signaling, thereby suppressing pathogenic M1 macrophage polarization and inflammation. This supports LJD’s potential as a complementary UC therapy targeting macrophage plasticity. Ulcerative Colitis Traditional Chinese Medicine Liujunzi Decoction Inflammation Macrophage Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Highlights • LJD effectively alleviates acute colitis in mice. • Network pharmacology & transcriptomics: LJD curbs inflammation via NF-κB/MAPK. • LJD lowers inflammatory factors and blocks M1 macrophage polarization. • LJD suppresses M1 polarization by down-regulating NF-κB/MAPK signaling. 1. Introduction Ulcerative colitis (UC) is one of the two forms of inflammatory bowel disease. It affects 5 million people globally and is a chronic and recurring inflammation of the gastrointestinal tract with clinical presentation of abdominal pain, chronic diarrhea, rectal bleeding, and weight loss(Ungaro et al., 2017 ). The pathogenesis of UC involves multiple contributing factors, including but not limited to: genetic predisposition(Uhlig et al., 2014 ), dysregulation of the immune system(De Souza et aland Claudio., 2016), gut dysbiosis(Quaglio et al., 2022), and environmental triggers such as dietary habits(Lo et al., 2020 ), psychological stress(Bisgaard et al., 2022 ), and smoking(Lunney et al., 2012). The cause and the etiology of UC remain poorly understood(Nakase et al., 2022 ). Current mainstream therapies, including Aminosalicylates(Ben-Horin et al., 2022 ), Corticosteroids(Ben-Horin et al., 2022 ), Immunomodulators(Siddharth et al., 2024), and biologics (e.g., anti-TNFα agents(Francesca et al., 2020), often produce suboptimal responses, risk of significant adverse effects, or result in loss of efficacy over time(Stefan et al., 2017). Therefore, there is an urgent need to identify new therapeutic strategies with improved efficacy and safety profiles for the UC treatment. Central to the dysregulated immune response in UC is the aberrant activation and polarization of macrophages within the inflamed intestinal mucosa(Liu et al., 2023 ). Macrophages exhibit remarkable plasticity, dynamically shifting between classically activated (M1) and alternatively activated (M2) phenotypes in response to microenvironmental cues(Nitima et al., 2018 and Zhang et al., 2023 ). M1 macrophages, induced by pro-inflammatory stimuli such as IFN-γ and LPS, are potent producers of inflammatory cytokines (e.g., TNF-α, IL-1β, IL-6, IL-23), reactive oxygen species (ROS), and nitric oxide (NO)( Sheyda et al., 2025 ). Their sustained activation and accumulation within the lamina propria are critically implicated in driving the destructive inflammatory cascade, epithelial barrier disruption, and tissue damage characteristic of active UC(Nitima et al., 2018). Therefore, modulating macrophage polarization, specifically suppressing the detrimental M1 phenotype, represents a promising therapeutic avenue for mitigating the intestinal inflammation. The activation and inflammatory functions of M1 macrophages are tightly regulated by intricate intracellular signaling networks(Chen et al., 2023 ). Among these, the Nuclear Factor-kappa B (NF-κB)( Peng et al., 2023 ) and Mitogen-Activated Protein Kinase (MAPK) pathways are paramount(Yu et al., 2020 ). The NF-κB pathway, particularly involving the P65 (RelA) subunit, is a master regulator of inflammation(Mitchell et al., 2018 ). Upon activation by various stimulant (e.g., TNF-α, IL-1β, TLR ligands), inhibitor of κB (IκB) is degraded, allowing P65 translocation to the nucleus where it drives the transcription of numerous pro-inflammatory genes(Moens et al., 2013 ). Concurrently, the MAPK pathway, encompassing key subfamilies like P38, JNK, and ERK, regulates diverse cellular processes including inflammation(Wang et al., 2024 ), proliferation(Fei et al., 2023 ), and stress responses(Xu et al., 2022 ). Activation of MAPKs signaling leads to the induction of cytokines (e.g., TNF-α, IL-1β, IL-6) and chemokines (e.g., CCL3, CCL4, CCLL5)(Guo et al., 2024 ). Crucially, crosstalk exists between the NF-κB and MAPK pathways, often amplifying the inflammatory response in macrophages(Mao et al., 2024 ). Persistent activation of P65 and MAPK signaling is a hallmark of UC mucosa and a key driver of M1 macrophage-mediated inflammation, making this axis a critical therapeutic target. Traditional Chinese Medicine (TCM) demonstrates distinct advantages and therapeutic potential in managing UC based on clinical practice(Matos et al., 2021 ). Numerous TCM herbs including Coptis Chinensis (Hao et al., 2022 ), Scutellaria Baicalensis (Hu et al., 2021 ), Phellodendri Cortex (Zhan et al., 2025 ), Pulsatilla Chinensis (Wei et al., 2023 ), Licorice (Shi et al., 2025 ) and their compound formulas (such as Shaoyao Decoction(Wei et al., 2021 ), Pulsatilla Decoction(Niu et al., 2023 ), and Gegen Qinlian Decoction(Ma et al., 2023 ) exhibit significant anti-inflammatory properties. These agents can inhibit the expression and activity of various pro-inflammatory cytokines, including TNF-α, IL-1β, IL-6, IL-8, and IL-17, thereby attenuating intestinal inflammation. Furthermore, when prescribed based on accurate syndrome differentiation and appropriate medication strategies, TCM treatment typically results in fewer and milder side effects compared to long-term administration of Western medications like corticosteroids and immunosuppressants(Liu et al., 2022 ). Common TCM-related adverse effects, such as gastrointestinal discomfort (e.g., abdominal distension, diarrhea) or allergic reactions, are generally mild and often resolve upon discontinuation or prescription adjustment(Liu et al., 2020 ). Combining TCM with conventional Western medicine often enhances clinical efficacy, offering greater effectiveness in inducing and maintaining disease remission and alleviating patient symptoms(Su et al., 2023 ). Consequently, TCM offers distinct advantages in ameliorating UC symptoms, reducing relapse rates, and mitigating the side effects associated with Western pharmaceuticals. Liujunzi Decoction (LJD), a classical formula from the TCM, is a modification of the renowned Si Jun Zi Tang (Four Gentlemen Decoction) with the addition of Citri Reticulatae Pericarpium and Pinellia Ternata . Traditionally, it is prescribed for treating Spleen-Stomach deficiency syndrome manifesting as fatigue, anorexia, abdominal distension, nausea, vomiting, and excessive phlegm/dampness(Wu, 1998 ). Modern pharmacological studies have attributed various beneficial effects to LJD and its components, including immunomodulation, anti-inflammation, antioxidant activity, and gastrointestinal motility regulation(Wang et al., 2025 ). Preliminary evidence suggests potential efficacy in gastrointestinal disorders like chronic gastritis and functional dyspepsia, which share some pathophysiological features (like immune dysregulation) with UC. However, its specific effects on UC, particularly concerning macrophage polarization and the underlying molecular mechanisms involving key inflammatory signaling cascades, remain largely unexplored. In this study, we first investigated the composition of LJD and its potential therapeutic mechanism in UC. Subsequently, we established a DSS-induced murine colitis model. In vivo experiments demonstrated that LJD significantly ameliorated DSS-induced UC symptoms and reduced the expression of pro-inflammatory cytokines in the colon. Furthermore, we explored the relationship between the anti-inflammatory effects of LJD and macrophages, key inflammatory cell mediators. In vitro studies revealed that serum from LJD-treated rats inhibited M1-like macrophage polarization and the expression of pro-inflammatory cytokines by suppressing the activation of the NF-κB/MAPK signaling pathway. Collectively, our work elucidates the role of macrophages in mediating LJD's efficiency in UC and provides evidence supporting LJD's potential application as a complementary or alternative therapeutic strategy for UC management. 2. Methods 2.1. Network Pharmacology-Based Analysis 2.1.1. Target Prediction for Liujunzi Decoction (LJD) Active Ingredients and Ulcerative Colitis (UC) Potential active ingredients of LJD (comprising Ginseng radix et rhizoma, Atractylodis macrocephalae rhizoma, Poria, Glycyrrhizae radix et rhizoma, Citri reticulatae pericarpium, and Pinelliae rhizoma) were identified from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP; http://lsp.nwu.edu.cn/tcmsp.php ). Selection criteria were oral bioavailability (OB) ≥ 30% and drug-likeness (DL) ≥ 0.8. Targets for these potential LJD active ingredients were retrieved directly from the TCMSP database. Disease targets associated with UC were collated from the DisGeNET ( https://www.disgenet.org/ ), GeneCards ( https://www.genecards.org/ ), and Online Mendelian Inheritance in Man (OMIM; https://omim.org/ ) databases using "ulcerative colitis" as the search term. The combined target list was compiled. Compound SMILES strings were obtained from the PubChem database ( https://pubchem.ncbi.nlm.nih.gov ) and subsequently input into Swiss Target Prediction ( http://www.swisstargetprediction.ch ) for target identification and ID standardization. 2.1.2. Construction of Venn Diagram and Protein-Protein Interaction (PPI) Network The UC-related targets and the LJD potential active ingredient targets were intersected using Venny 2.1 ( https://bioinfogp.cnb.csic.es/tools/venny/ ) to identify key overlapping genes. A PPI network for these key genes was constructed using Cytoscape 3.7.0. Furthermore, relevant potential active components linked to these intersection targets were screened. An active component-target network was visualized in Cytoscape 3.7.0, applying filtering criteria (Betweenness > 280.6, Closeness > 0.002, Degree > 40.4). 2.1.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysi s GO functional enrichment analysis (covering cellular components, molecular functions, and biological processes) and KEGG pathway enrichment analysis were performed using the DAVID database ( https://david.ncifcrf.gov/ ). The resulting enrichment data were uploaded to the WeiShengXin platform ( https://www.bioinformatics.com.cn/ ) for visualization. 2.2. Preparation and Composition Analysis of LJD LJD formula granules, provided by Guangdong Yifang Pharmaceutical Co., Ltd., were procured from Foshan Hospital of Traditional Chinese Medicine. Table 1 LJD composition. Chinese Name Latin name Medicinal Parts Granules Dose(g) Chenpi Citrus reticulata Blanco (Family Rutaceae) Pericarp 7.5 Banxia Pinellia ternata (Thunb.) Makino (Family Araceae) Tuber 6.818 Renshen Panax ginseng C. A. Meyer (Family Araliaceae) Rhizome 4 Baizhu Atractylodes macrocephala Koidz. (Family Compositae) Rhizome 11.538 Fuling Poria cocos (Schw.) Wolf (Family Polyporaceae) Sclerotia 1.6 Gancao Glycyrrhiza glabra L. (Family Leguminosae) Root 2.5 Compositional analysis of LJD was conducted using high-resolution liquid chromatography coupled with mass spectrometry (LC-MS/MS). Separation was achieved using a Thermo Hypersil Gold C18 column (1.9 µm, 2.1 mm × 100 mm). The flow rate was 0.3 mL/min with an injection volume of 5 µL. The mobile phase consisted of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). Gradient elution was performed according to the following program: Table 2 Mobile Phase Gradient Elution Procedure Time (min) A (%) B (%) 0 90 10 1 90 10 15 0 100 17 0 100 17.1 90 10 20 90 10 Mass spectrometry analysis was performed on a Q-Exactive instrument (Thermo Fisher Scientific, CA, USA) equipped with a HESI source. Operating parameters were: ion source temperature 310°C, capillary temperature 320°C, sheath gas flow 30 arbitrary units (au), auxiliary gas flow 10 au, spray voltage 3.0 kV (positive ion mode) and 2.8 kV (negative ion mode). Data-dependent acquisition (DDA) was employed with a loop count of 10. Higher-energy collisional dissociation (HCD) fragmentation used stepped normalized collision energies of 10, 28, and 35 eV. Full MS scans (m/z 100–1500) were acquired at a resolution of 70,000 (AGC target 3e6, maximum injection time 200 ms). MS/MS scans were performed at a resolution of 17,500 (AGC target 1e5, maximum injection time 50 ms). 2.3. Animal Experiment and Dextran Sulfate Sodium (DSS)-Induced Ulcerative Colitis Model Eight-week-old male C57BL/6 mice (23-25g) were obtained from the Guangdong Medical Laboratory Animal Center. All procedures adhered to guidelines approved by the Center's Animal Ethics Committee (Approval No. B202302-9). Following one week of acclimatization, mice were randomly assigned to six groups (n = 8 per group): control (CON), model (MOD), sulfasalazine (SSZ), high-dose LJD (LJDH), medium-dose LJD (LJDM), and low-dose LJD (LJDL). The MOD, SSZ, LJDH, LJDM, and LJDL groups received 2.5% (w/v) DSS dissolved in drinking water ad libitum for 8 days, while the CON group received normal water. Sulfasalazine was administered orally at 300 mg/kg/day. LJD doses were 36.8 g/kg/day (LJDH), 16.4 g/kg/day (LJDM), and 8.2 g/kg/day (LJDL). The medium dose (LJDM) was calculated based on human equivalent dose (HED) conversion using body surface area, following FDA guidance (Food and Drug Administration, 2005). Drug treatments (SSZ, LJD) or an equivalent volume of water (MOD) were administered daily by oral gavage. After 8 days, mice were euthanized. Colon tissue was excised, measured, and processed for subsequent analyses. Throughout the experimental period, mice were monitored daily for changes in body weight, defecation characteristics, and the presence of fecal blood to assess UC progression. Overall disease severity was quantified using the Disease Activity Index (DAI), calculated as the sum of scores for weight loss, stool consistency, and fecal bleeding (Table 2 )(Wirtz et al., 2017 ) Table 3 Disease Activity Index (DAI) Scoring Criteria Score Weight loss (%) Fecal traits Fecal occult blood 0 None Normal Normal 1 0–5 Loose Occult blood 2 5–15 Soft Visible blood traces 3 > 15 Diarrhea Gross blood DAI = [Weight loss score] + [Stool consistency score] + [Fecal blood score]. 2.4. RNA Sequencing (RNA-Seq) Analysis 2.4.1. RNA Extraction and Library Construction Total RNA was extracted from colon tissue of three randomly selected mice per group (CON, MOD, LJDH). RNA concentration and purity were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA). RNA integrity was evaluated using an Agilent Bioanalyzer 2100 (Agilent, CA, USA; RIN > 7.0) and confirmed by denaturing agarose gel electrophoresis. Poly(A) + RNA was purified from 1 µg total RNA using Dynabeads Oligo(dT)25 (Thermo Fisher, CA, USA) with two rounds of purification. Purified poly(A) + RNA was fragmented using the Magnesium RNA Fragmentation Module (NEB, cat. e6150, USA) at 94°C for 5–7 min. First-strand cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen, cat. 1896649, USA). Second-strand synthesis incorporated dUTP and utilized E. coli DNA Polymerase I (NEB, cat. m0209, USA), RNase H (NEB, cat. m0297, USA), and dUTP Solution (Thermo Fisher, cat. R0133, USA). Following end repair and A-tailing, indexed adapters were ligated. Size selection was performed using AMPure XP beads. Uracil-containing second strands were digested with UDG enzyme (NEB, cat. m0280, USA). Adapter-ligated fragments were amplified by PCR under the following conditions: 95°C for 3 min; 8 cycles of 98°C for 15 sec, 60°C for 15 sec, 72°C for 30 sec; final extension at 72°C for 5 min. Final cDNA libraries had an average insert size of 300 ± 50 bp. Paired-end sequencing (2 × 150 bp) was performed on an Illumina NovaSeq 6000 platform (LC-Bio Technology Co., Ltd., Hangzhou, China). 2.4.2. Bioinformatics Analysis of RNA-Seq Data Raw sequencing reads were quality-controlled using fastp software (v0.20.0; https://github.com/OpenGene/fastp ) to remove adapter sequences, low-quality bases (Q 5%). Clean reads were aligned to the reference genome (specify version/species if possible, e.g., Mus musculus GRCm38) using [Specify Aligner, e.g., HISAT2 or STAR - this is missing in the original and should be added]. Transcript assembly and quantification of FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values for mRNAs were performed using StringTie ( https://ccb.jhu.edu/software/stringtie ) with default parameters. Assembled transcripts from all samples were merged using gffcompare ( https://github.com/gpertea/gffcompare ) to generate a unified transcriptome. Expression levels were then re-estimated against this merged transcriptome using StringTie. Differentially expressed mRNAs (DEGs) were identified using the R package edgeR ( https://bioconductor.org/packages/release/bioc/html/edgeR.html ), applying thresholds of absolute fold change > 2 (i.e., FC > 2 or FC < 0.5) and a significance level of p < 0.05 based on a negative binomial generalized linear model. 2.5. Histological (H&E) and Immunohistochemical (IHC) Staining Half of each colon sample was fixed in 4% paraformaldehyde. Fixed tissues were processed, paraffin-embedded, sectioned, and stained with Hematoxylin and Eosin (H&E) or immunohistochemically for CD86, Occludin, and ZO-1 by Wuhan Pinuofei Biological Co., Ltd. (Wuhan, China). Whole-slide images were acquired using an SQS-20Pro slide scanner. The number of immunohistochemically positive cells was quantified using ImageJ software (National Institutes of Health, USA). 2.6. Preparation of LJD-Containing Serum Six 8-week-old male Sprague Dawley (SD) rats underwent a 1-week acclimatization period. Rats were then orally administered using LJD (16.8 g/kg, twice daily) for 7 consecutive days. Two hours after the final dose, rats were anesthetized with pentobarbital, and blood was collected via abdominal aorta puncture using sterile needles. Blood was allowed to clot at room temperature for 2 hours and then centrifuged at 4,000 rpm (≈ 2,000 × g) for 15 min. Serum was separated, heat-inactivated at 56°C for 30 min, filtered through a 0.22 µm filter, and stored at -80°C until use. 2.7. Cell Experiments 2.7.1. Cell Culture The RAW 264.7 murine macrophage cell line was purchased from Xiamen Immocell Biotechnology Co., Ltd. RAW 264.7 cells were maintained in DMEM with 10% FBS and 1% penicillin/streptomycin at 37°C in a humidified 5% CO 2 atmosphere. 2.7.2. Polarization Stimulation Cells were harvested, dissociated, counted, and seeded at appropriate densities: RAW 264.7 cells at 6×10 4 cells/mL in 6-well, 12-well or 24-well plates. After 24 hours, cells were stimulated for a further 24 hours with either: LPS (10 ng/mL; InvivoGen, USA) in medium containing 10% blank rat serum, or LPS (10 ng/mL) in medium containing LJD-containing serum at final concentrations of 2.5%, 5% or 10% (supplemented with blank rat serum to maintain 10% total serum). 2.8. Quantitative Real-Time PCR (RT-qPCR) Total RNA was extracted from RAW 264.7 cells or colon tissue using Trizol reagent. cDNA synthesized using the EVO M-MLV RT Mix Kit with gDNA Clean (AG11728) according to the manufacturer's instructions. RT-qPCR was performed using SYBR Green Master Mix (TransGen, AQ611-04). Primer sequences are listed in Table 3 . Relative mRNA expression levels were calculated using the 2 −ΔΔCt method, and normalized to β-actin. Table 4 RT-qPCR Primer Sequences. Genes Forward primer (5′–3′) Reverse primer (5′–3′) IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT IL-6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG IL-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG IL-17A TCAGCGTGTCCAAACACTGAG CGCCAAGGGAGTTAAAGACTT IL-17F AACCAGGGCATTTCTGTCCCAC GGCATTGATGCAGCCTGAGTGT IL-23 CAGCAGCTCTCTCGGAATCTC TGGATACGGGGCACATTATTTTT TNF-α CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG TGF-β TGATACGCCTGAGTGGCTGTCT CACAAGAGCAGTGAGCGCTGAA Arg1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC iNOS GTTCTCAGCCCAACAATACAAGA ATCTTTTGGGGTCCGTCAACT β-Actin CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG 2.9. Enzyme-Linked Immunosorbent Assay (ELISA) Blood samples were collected, allowed to clot, and centrifuged at 12,000 × g for 10 min to obtain serum. Absolute concentrations of serum cytokines TNF-α (ELM-TNFa-1), IL-6 (ELM-IL6-1), and IL-10 (ELM-IL10-1) were quantified using commercial ELISA kits according to the manufacturers' protocols. 2.10. Western Blotting Analysis Total protein was extracted from RAW 264.7 cells or colon tissue using RIPA lysis buffer containing protease inhibitors. Protein concentration was determined using a BCA assay kit (Thermo Fisher). Proteins were denatured, separated by 12% SDS-PAGE, and transferred to 0.22 µm nitrocellulose membranes (Merck Millipore). Membranes were blocked with 5% bovine serum albumin (BSA) and incubated overnight at 4°C with primary antibodies, followed by appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Affinity, CA). Protein bands were visualized using an enhanced chemiluminescence (ECL) reagent. Band intensities were quantified using ImageJ software (National Institutes of Health, USA). Expression levels were normalized to loading controls (GAPDH, β-Actin, or α-Tubulin). Antibodies used: anti-GAPDH (Proteintech, 60004-1-ig), anti-β-Actin (CST, 970S), anti-α-Tubulin (Proteintech, 6603-1-ig), anti-NF-κB p65 (CST, 8242S), anti-phospho-NF-κB p65 (Ser536) (CST, 3033S), anti-ERK1/2 (CST, 4695S), anti-phospho-ERK1/2 (Thr202/Tyr204) (CST, 4370S), anti-SAPK/JNK (CST, 9252S), anti-phospho-SAPK/JNK (Thr183/Tyr185) (CST, 4668S), anti-p38 MAPK (CST, 8690S), anti-phospho-p38 MAPK (Thr180/Tyr182) (CST, 4511S), HRP-conjugated goat anti-rabbit IgG (Affinity), HRP-conjugated goat anti-mouse IgG (Affinity). 2.11. Flow Cytometry For the Flow Cytometry test, Raw264.7 cells were seeded in a 12-well plate at a density of 2.4×10 5 cells/ml. The remaining conditions are the same as 2.7.2. Polarization Stimulation. Cells were washed twice with FACS buffer (PBS + 2%FBS + 2‰ EDTA) and incubated with TruStain FcX™ (anti-mouse CD16/32; BioLegend, 101320) for 15 min at room temperature to block Fc receptors. Without washing, cells were stained with anti-CD86 antibody (BioLegend, 105032) in FACS buffer for 30 min on ice, and protected from light. Cells were washed twice and stained with 7-AAD Viability Staining Solution (BioLegend, 420404) for 10 min. Cells were washed, resuspended in FACS buffer, and analyzed immediately using a Cytek Aurora flow cytometer (Cytek Biosciences, USA). Data analysis was performed using FlowJo software V10.8.1 (Tree Star Inc., Ashland, OR, USA). 2.12. Statistical Analysis Data are presented as mean ± standard error of the mean (SEM). Statistical analysis and graphing were performed using GraphPad Prism version 9.5.0. Comparisons among multiple groups were conducted using one-way analysis of variance ( ANOVA ) or two-way ANOVA followed by appropriate post-hoc tests. Statistical significance was defined as p < 0.05. 3. Results 3.1. Chemical Composition of LJD LC-MS analysis of LJD generated positive and negative ion chromatograms (Fig. 1 A, B). Database interrogation (ChemSpider, ChEBI, ChEMBL, Natural Products Database, Flavonoid Database, OTC Database, mzCloud) identified 193 chemical components, filtered for high spectral match scores and relative abundance. The top 15 compounds by abundance are listed in Fig. 1 C. Notably, several components-including nobiletin(Sanjay et al., 2024 ), tangeretin(Birong et al., 2024), glycyrrhizic acid(Yangye et al., 2022), and citric acid(Pengcheng et al., 2024) exhibit documented anti-inflammatory activity and/or intestinal protective effects. 3.2. Network Pharmacology Implicates NF-κB/MAPK Signaling in LJD’s Anti-UC Mechanism Integrated analysis identified 2,689 UC-associated targets (GeneCards, OMIM, DisGeNET; deduplicated) and 801 potential LJD targets (TCMSP/SwissTargetPrediction; OB ≥ 30%, DL ≥ 0.18; deduplicated). Venn analysis revealed 277 overlapping targets (Fig. 2 A), with Il6 , Tnf , Il1β , Nfkb1 , and Mapk3 emerging as core hubs (Fig. 2 B-D). Cytoscape 3.7.0 mapped the LJD-component-target network (Fig. 2 E). Functional enrichment (DAVID) demonstrated significant association of overlapping targets with: BPs: Inflammatory response, positive regulation of MAPK activity, NF-κB signaling, negative regulation of inflammation (Fig. 2 F). KEGG Pathways: TNF, MAPK, and NF-κB signaling pathways (Fig. 2 G). 3.3. LJD Attenuates DSS-Induced UC In Vivo We established a mouse model of DSS-induced acute colitis and in the DSS-induced UC model (experimental design: Fig. 3 A), LJD (LJDM/LJDH) and SSZ significantly mitigated disease phenotypes compared with MOD group, including reduced weight loss (Fig. 3 B, C), DAI scores (Fig. 3 D), and colon shortening (Fig. 3 E, F). H&E staining testing revealed severe mucosal damage, goblet cell depletion, crypt distortion, and inflammatory infiltration in MOD mice. LJD groups showed preserved mucosal architecture and reduced infiltration (Fig. 3 G), indicating a better efficacy against colitis comparable to SSZ group. 3.4. Transcriptomics Confirms Involvement of NF-κB/MAPK Pathways To further investigate the signaling mechanisms underlying LJD's ameliorative effects on UC, we performed RNA-seq analysis on colonic tissues. Pearson correlation coefficient analysis and principal component analysis (PCA) demonstrated strong intra-group sample correlations and revealed distinct genetic profiles between the LJDH and MOD groups (Fig. 4 A, B). Compared to the CON group, the MOD group exhibited 4331 differentially expressed genes (DEGs) (1329 upregulated, 729 downregulated). Furthermore, the LJDH group displayed 1871 DEGs relative to the MOD group (265 upregulated, 330 downregulated) (Fig. 4 C-E). Heatmaps depicting the top 100 DEGs across the three groups are presented in Fig. 4 F-G. Protein-protein interaction (PPI) network analysis identified Il6 and Il1β as hub genes with the highest connectivity. As anticipated, GO and KEGG pathway enrichment analyses yielded results largely consistent with our prior network pharmacology predictions. These analyses indicated a strong association between LJD intervention, UC alleviation, immune system responses, and the MAPK signaling pathway (Fig. 5 A-B). Gene Set Enrichment Analysis (GSEA) further highlighted the MAPK signaling pathway as significantly enriched, a finding corroborated by numerous previous studies on IBD (Fig. 5 C, D). Analysis of Fragments Per Kilobase of transcript per Million mapped reads (FPKM) values revealed that LJDH treatment remarkably reduced the gene expression levels of inflammatory cytokines, including Lrg1, Ngp , and Il6 . Notably, we observed a significant downregulation in the gene expression of iNOS (inducible nitric oxide synthase) and Marco (macrophage receptor with collagenous structure) following LJDH treatment (Fig. 5 E). These findings suggest that macrophages may represent a key cellular target through which LJD exerts its anti-UC effects. 3.5. LJD Modulates Inflammatory Mediators in Colon and Serum Based on the suggestion of RNA-Seq results, we applied RT-qPCR to detect the expression of pro-inflammatory factors and anti-inflammatory factors in colon tissue to verify the effect of LJD on UC. Compared with CON group, the expression of pro-inflammatory cytokines including IL-6, IL-17A, IL-17F, TNF-α and IL-1β in colon tissue of MOD group was remarkably increased. The expression of IL-23 in the MOD group was not significantly different from that in the CON group. However, as with other pro-inflammatory factors, the expressions of these pro-inflammatory cytokines were obviously down-regulated after administration of LJD compared to the MOD group (Fig. 5 A-F). In addition, the expressions of anti-inflammatory factors such as IL-10, TGF-β and ARG1 in colon tissue in the LJD group were obviously upregulated compared to the MOD group (Fig. 5 G-I). At the same time, we also used ELISA to test the contents of TNF-α, IL-6 and IL-10 in mouse serum, and the results were consistent with those suggested by RT-qPCR. These results suggest that LJD may protect the intestinal barrier by improving the inflammatory response in mice. 3.6. LJD inhibits activation of NF-κB/MAPK signaling pathway The results of network pharmacology and RNA-seq analysis indicate that the NF-κB/MAPK is a potential signaling pathway for LJD to exert anti-inflammatory effects, so we used Western Blot to detect whether LJD exerts anti-UC effects through the NF-κB/MAPK signaling pathway (Fig. 6 A). Western blot results confirmed that the protein expression levels of p-NF-κB, p-JNK, p-ERk and p-P38 in the colon tissue of MOD mice were significantly higher than those in CON group. The protein expression levels of p-NF-κB, p-JNK, p-ERk and p-P38 in the colon tissue of mice in the LJDH group were significantly lower than those in the MOD group (Fig. 6 B-E). NF-κB and MAPK pathways are the core hubs of inflammatory signaling, and NF-κB mainly directly regulates the transcription of pro-inflammatory genes(Ting et al., 2017). MAPK, especially JNK/P38, plays a central role in pro-inflammatory factor production by activating transcription factors and regulating mRNA stability/translation(Hae-Young et al., 2009). Combined with Fig. 5 D and E results, we conclude that LJD may improve DSS-induced UC in mice by inhibiting the activation of TNF-α and IL-1β mediated NF-κB/MAPK signaling pathway. 3.7. LJD Inhibits M1 Polarization of Macrophages Macrophage polarization plays a critical role in the pathogenesis of UC. To evaluate this, we assessed the levels of CD86, a marker for M1 macrophages, in the colon tissues of UC model mice using immunohistochemical staining. As anticipated, CD86 expression was remarkably elevated in the colons of mice in the MOD group. Notably, this increase was mitigated by LJD intervention (Fig. 7 A). In vitro, we further examined the effects of LJD-containing serum on RAW 264.7. Flow cytometry analysis revealed that LJD-containing serum greatly reduced the proportion of CD86 + macrophages induced by LPS. Importantly, 10% LJD-containing serum did not suppress the proportion of M2 macrophages. These results collectively indicate that LJD likely inhibits M1 polarization of macrophages. 3.8. LJD Suppresses M1 Polarization via the NF-κB/MAPK Signaling Pathway in RAW 264.7 Cells The NF-κB and MAPK signaling pathways represent crucial and interconnected intracellular transduction cascades that regulate immune cell activation and maturation. They play a central role in modulating macrophage polarization states. In vitro, we investigated the impact of LJD-containing serum on LPS-induced M1 polarization. As expected, LPS stimulation robustly promoted the phosphorylation (activation) of key signaling molecules, including NF-κB, JNK, ERK, and P38. Conversely, LJD-containing serum effectively suppressed this LPS-induced phosphorylation. Furthermore, RT-qPCR analysis demonstrated that LJD-containing serum inhibited the LPS-induced upregulation of pro-inflammatory cytokines TNF-α and IL-1β at the mRNA level. Additionally, 10% LJD-containing serum significantly downregulated the expression of inducible nitric oxide synthase (iNOS), a characteristic marker of M1 macrophages, consistent with the suppression of M1 polarization. 4. Discussion UC, characterized by recurrent diarrhea, abdominal pain, and bloody stools, predominantly affects individuals aged 20–49 years with comparable gender incidence(Wangchuket al., 2024). Although associated with low fatality, chronic UC significantly elevates colorectal neoplasia risk. Recent years have witnessed burgeoning research into TCM for UC management(Zhang et al., 2025 ). It has been shown that Huangqin Decoction (HQD) can alleviate UC by modulating amino acid metabolism and gut microbiota to activate the mTOR pathway, thereby suppressing colonic epithelial apoptosis(Liu et al., 2022 ). Moreover, Linderae Radix mitigates inflammation by inhibiting the JAK-STAT pathway, preserving intestinal barrier integrity in murine models(Wang et al., 2024 ). This study demonstrates that LJD, a classical TCM formula, significantly ameliorates DSS-induced UC in mice. Mechanistically, LJD exerts its protective effect primarily by repolarizing macrophages towards an anti-inflammatory phenotype through inhibition of the NF-κB/MAPK signaling axis. Our integrated approach, combining network pharmacology and transcriptomic analysis, identified NF-κB and MAPK signaling cascades as central targets of LJD in UC. Network analysis revealed core inflammatory targets ( e.g. , IL6, TNF, IL1β, NFKB1 and MAPK3) within the LJD-UC interaction network and enriched these targets in TNF, NF-κB, and MAPK pathways. This prediction aligns with the well-established pro-inflammatory roles of cytokines (IL-1β, IL6, TNF-α) and signaling molecules (NF-κB and MAPK) in UC pathogenesis, which is corroborated by colonic transcriptome profiling. RNA-seq analysis further detailed distinct gene expression profiles in LJD-treated mice versus model mice, with pathway enrichment confirming LJD-mediated marked regulation of the MAPK pathway. Crucially, Western blot analysis provided functional validation: LJD potently suppressed DSS-induced phosphorylation of key NF-κB and MAPK pathway components in vivo. Given the pivotal role of NF-κB in transcribing pro-inflammatory genes and the contribution of MAPK kinases (particularly JNK/ERK) to cytokine production, suppression of this signaling axis provides a coherent molecular basis for the observed attenuation of M1 macrophage polarization and the associated inflammatory cytokine storm(Hu et al., 2024 ). The convergence of network prediction, transcriptomic data, and phosphoprotein evidence robustly establishes NF-κB/MAPK inhibition as the primary mechanism underpinning LJD's disruption of the UC inflammatory cascade. As pivotal innate immune mediators, macrophages adopt distinct functional phenotypes in response to microenvironmental cues. LPS/IFN-γ-induced M1 macrophages drive early inflammation, while M2 macrophages, critical for intestinal homeostasis, secrete anti-inflammatory factors ( e.g. , IL-10) to suppress inflammation and promote tissue repair(Zhang et al., 2023 ). Studies indicate M2-derived factors (e.g., IL-10) directly upregulate intestinal tight-junction proteins (e.g., Occludin, and ZO-1), facilitating epithelial restitution. Consistently, we observed LJD reversed DSS-induced downregulation of Occludin and ZO-1 by immunohistochemistry (Fig. S1 ). Zhou et al. further reported that Yes-associated protein (YAP) impairs M2 polarization, exacerbating UC(Zhou et al., 2019 ). LJD specifically modulated macrophage polarization: profound downregulation of M1 genes ( e.g. , iNOS, IL-1β, IL-6, TNF-α and IL-17A/F) and upregulation of anti-inflammatory mediators (IL-10, TGF-β and Arg1) occurred in colon tissue. In vitro, LJD serum dose-dependently inhibited LPS-induced CD86 (M1 marker) in RAW 264.7 cells but not IL-4/IL-13-induced CD206 (M2 marker). This selective M1 suppression, coupled with inhibited M1 cytokine/iNOS expression, underscores LJD’s targeted immunomodulation. Notably, lower LJD doses showed paradoxical inhibition of some M2 markers-a finding warranting further investigation. While M2 macrophages promote epithelial repair via factors like Arg-1, LJD’s functional impact on M2-mediated restitution remains unexplored. LC-MS/MS identified multiple bioactive LJD constituents (Fig. 1 , Table 5), including compounds with established anti-inflammatory/immunomodulatory properties: Nobiletin downregulates NF-κB and IL-6 to mitigate inflammation(Sanjay et al., 2024 ). Tangeretin suppresses chondrocyte inflammation in osteoarthritis(Peng et al., 2024 ). Glycyrrhizic acid inhibits MMP2/MMP9 via JNK/p38 pathways, counteracting inflammatory responses(Chen et al., 2022 ). Citric acid promotes intestinal epithelial growth and tight-junction stability(Hu et al., 2024 ). LJD’s efficacy likely arises from synergistic/additive actions of these components targeting the NF-κB/MAPK-macrophage axis. Such multi-target, multi-component modulation, a hallmark of TCM formulas, may offer broader efficacy and lower resistance risk than single-target biologics. Therapeutic relevance was further demonstrated by LJD’s efficacy matching first-line drug sulfasalazine (SSZ) in alleviating disease activity and preserving mucosal integrity (Fig. 3 ). Crucially, LJD achieved this without suppressing beneficial M2 polarization, suggesting a nuanced immunomodulatory profile distinct from broad immunosuppression and potentially lower infection risk. Current UC therapies (e.g., cytokine-targeting biologics) face limitations including non-response, loss of response, and adverse effects. By acting upstream via macrophage polarization through NF-κB/MAPK, LJD offers a distinct mechanistic strategy. Its multi-component nature may provide broader anti-inflammatory control and circumvent single-agent limitations. Furthermore, LJD has been traditionally applied for the treatment of Spleen and Stomach Deficiency Syndrome, whose symptoms include fatigue, anorexia, abdominal distension, which is considerable overlap with UC. This positions LJD as a promising complementary/alternative therapy, especially for patients unresponsive to conventional treatments or concerned about long-term side effects. Future studies should elucidate contributions of key LJD constituents and define LJD’s impact on M2-mediated epithelial repair. 5. Conclusion This study demonstrates that LJD effectively ameliorates DSS-induced ulcerative colitis in mice. The therapeutic efficacy is mechanistically driven by LJD's potent inhibition of the NF-κB/MAPK signaling axis, leading to a significant suppression of pro-inflammatory M1 macrophage polarization and associated cytokine storm. These findings highlight LJD's potential as a multi-target therapeutic strategy for UC, supporting further investigation into its bioactive components and clinical translation. Abbreviations UC Ulcerative colitis IBD Inflammatory bowel disease LJD Liujunzi Decoction SSZ Sulfasalazine TCM Traditional Chinese medicine DAI Disease activity index GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes H&E Hematoxylin and eosin PPI Protein-protein interaction ELISA Enzyme-linked immunosorbent assay RT-qPCR Reverse transcription quantitative polymerase chain reaction NF-κB Nuclear Factor-kappa B MAPK Mitogen-Activated Protein Kinase DSS Dextran Sulfate Sodium iNOS Inducible nitric oxide synthase Declarations Ethics approval and consent to participate All procedures adhered to guidelines approved by the Center's Animal Ethics Committee (Approval No. B202302-9). Consent for publication All authors agreed with the content of the manuscript and approved the final version of the manuscript. Availability of data and materials The data associated with this study can be obtained from the corresponding author upon reasonable request. Competing interests The authors declare that there are no known competing financial interests. Funding This work was supported by funds from the Basic and Applied Basic Research Grant of Guangdong Province (No. 2024A1515140129), University-Hospital Joint Fund Project of Guangzhou University of Chinese Medicine (No. GZYFS2024U03, GZYFS2024U01), and Fund Project of Foshan Hospital of Traditional Chinese Medicine (NO. 2024021). Authors' contributions QZ : Writing-original draft, Writing–review and editing, Validation, Investigation, Visualization, Data curation. JJ : Software, Formal analysis. WJ : Data curation, Formal analysis, Validation. HL : Validation, Investigation. BL : Data curation, Software, Validation. JZ : Data curation, Formal analysis, Validation. BL : Investigation, Methodology. DY : Software, Data curation. JZ : Data curation, Formal analysis. XC : Funding acquisition, Investigation, Supervision. EM : Investigation, Supervision. JC : Writing-review and editing, Writing-original draft, Project administration, Investigation, Conceptualization, Funding acquisition, Methodology. Acknowledgements Graphical abstract created with Figdraw (https://www.figdraw.com/). References Ben-Horin et al. “Corticosteroids and Mesalamine Versus Corticosteroids for Acute Severe Ulcerative Colitis: A Randomized Controlled Trial.” Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association vol. 20,12 (2022): 2868-2875.e1. doi:10.1016/j.cgh.2022.02.055 Bisgaard, Tania H et al. “Depression and anxiety in inflammatory bowel disease: epidemiology, mechanisms and treatment.” Nature reviews. Gastroenterology & hepatology vol. 19,11 (2022): 717-726. doi:10.1038/s41575-022-00634-6 Chen, Shanze et al. “Macrophages in immunoregulation and therapeutics.” Signal transduction and targeted therapy vol. 8,1 207. 22 May. 2023, doi:10.1038/s41392-023-01452-1 Chen, Yangye et al. “Glycyrrhizic Acid Alleviates Lipopolysaccharide (LPS)-Induced Acute Lung Injury by Regulating Angiotensin-Converting Enzyme-2 (ACE2) and Caveolin-1 Signaling Pathway.” Inflammation vol. 45,1 (2022): 253-266. doi:10.1007/s10753-021-01542-8 De Souza, Heitor S P, and Claudio Fiocchi. “Immunopathogenesis of IBD: current state of the art.” Nature reviews. Gastroenterology & hepatology vol. 13,1 (2016): 13-27. doi:10.1038/nrgastro.2015.186 Fei, Xiaowei et al. “TRIM22 promotes the proliferation of glioblastoma cells by activating MAPK signaling and accelerating the degradation of Raf-1.” Experimental & molecular medicine vol. 55,6 (2023): 1203-1217. doi:10.1038/s12276-023-01007-y Ghamangiz, Sheyda et al. “Reprogram to heal: Macrophage phenotypes as living therapeutics.” Life sciences vol. 371 (2025): 123601. doi:10.1016/j.lfs.2025.123601 Guo, Qing et al. “NF-κB in biology and targeted therapy: new insights and translational implications.” Signal transduction and targeted therapy vol. 9,1 53. 4 Mar. 2024, doi:10.1038/s41392-024-01757-9 Hao, Wei et al. “Classical prescription Huanglian Decoction relieves ulcerative colitis via maintaining intestinal barrier integrity and modulating gut microbiota.” Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 107 (2022): 154468. doi:10.1016/j.phymed.2022.154468 Hu, Pengcheng et al. “Citric Acid Promotes Immune Function by Modulating the Intestinal Barrier.” International journal of molecular sciences vol. 25,2 1239. 19 Jan. 2024, doi:10.3390/ijms25021239 Hu, Qichao et al. “Baicalin and the liver-gut system: Pharmacological bases explaining its therapeutic effects.” Pharmacological research vol. 165 (2021): 105444. doi:10.1016/j.phrs.2021.105444 Li, Mu-Xia et al. “Huangqin decoction ameliorates DSS-induced ulcerative colitis: Role of gut microbiota and amino acid metabolism, mTOR pathway and intestinal epithelial barrier.” Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 100 (2022): 154052. doi:10.1016/j.phymed.2022.154052 Liu, Juan et al. “Recent advances in the treatment of IBD: Targets, mechanisms and related therapies.” Cytokine & growth factor reviews vol. 71-72 (2023): 1-12. doi:10.1016/j.cytogfr.2023.07.001 Liu, Runping et al. “Toxicity of traditional Chinese medicine herbal and mineral products.” Advances in pharmacology (San Diego, Calif.) vol. 87 (2020): 301-346. doi:10.1016/bs.apha.2019.08.001 Liu, Ting et al. “NF-κB signaling in inflammation.” Signal transduction and targeted therapy vol. 2 (2017): 17023. doi:10.1038/sigtrans.2017.23 Liu, Yang et al. “Potential activity of Traditional Chinese Medicine against Ulcerative colitis: A review.” Journal of ethnopharmacology vol. 289 (2022): 115084. doi:10.1016/j.jep.2022.115084 Lo, Chun-Han et al. “Dietary Inflammatory Potential and Risk of Crohn's Disease and Ulcerative Colitis.” Gastroenterology vol. 159,3 (2020): 873-883.e1. doi:10.1053/j.gastro.2020.05.011 Lunney, P C, and R W L Leong. “Review article: Ulcerative colitis, smoking and nicotine therapy.” Alimentary pharmacology & therapeutics vol. 36,11-12 (2012): 997-1008. doi:10.1111/apt.12086 Ma, Jing et al. “Modified Gegen Qinlian decoction ameliorates DSS-induced chronic colitis in mice by restoring the intestinal mucus barrier and inhibiting the activation of γδT17 cells.” Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 111 (2023): 154660. doi:10.1016/j.phymed.2023.154660 Mao, Ningning et al. “Preventive effects of matrine on LPS-induced inflammation in RAW 264.7 cells and intestinal damage in mice through the TLR4/NF-κB/MAPK pathway.” International immunopharmacology vol. 143,Pt 2 (2024): 113432. doi:10.1016/j.intimp.2024.113432 Matos, Luís Carlos et al. “Understanding Traditional Chinese Medicine Therapeutics: An Overview of the Basics and Clinical Applications.” Healthcare (Basel, Switzerland) vol. 9,3 257. 1 Mar. 2021, doi:10.3390/healthcare9030257 Mitchell, Jennifer P, and Ruaidhrí J Carmody. “NF-κB and the Transcriptional Control of Inflammation.” International review of cell and molecular biology vol. 335 (2018): 41-84. doi:10.1016/bs.ircmb.2017.07.007 Moens, Ugo et al. “The Role of Mitogen-Activated Protein Kinase-Activated Protein Kinases (MAPKAPKs) in Inflammation.” Genes vol. 4,2 101-33. 26 Mar. 2013, doi:10.3390/genes4020101 Nakase, Hiroshi et al. “The influence of cytokines on the complex pathology of ulcerative colitis.” Autoimmunity reviews vol. 21,3 (2022): 103017. doi:10.1016/j.autrev.2021.103017 Niu, Chun et al. “Pulsatilla decoction improves DSS-induced colitis via modulation of fecal-bacteria-related short-chain fatty acids and intestinal barrier integrity.” Journal of ethnopharmacology vol. 300 (2023): 115741. doi:10.1016/j.jep.2022.115741 Penagini, Francesca et al. “Biological therapy in pediatric age.” Pharmacological research vol. 161 (2020): 105120. doi:10.1016/j.phrs.2020.105120 Peng, Birong et al. “Tangeretin alleviates inflammation and oxidative response induced by spinal cord injury by activating the Sesn2/Keap1/Nrf2 pathway.” Phytotherapy research : PTR vol. 38,9 (2024): 4555-4569. doi:10.1002/ptr.8294 Peng, Yuan et al. “Regulatory Mechanism of M1/M2 Macrophage Polarization in the Development of Autoimmune Diseases.” Mediators of inflammation vol. 2023 8821610. 8 Jun. 2023, doi:10.1155/2023/8821610 Quaglio, Ana Elisa Valencise et al. “Gut microbiota, inflammatory bowel disease and colorectal cancer.” World journal of gastroenterology vol. 28,30 (2022): 4053-4060. doi:10.3748/wjg.v28.i30.4053 Sanjay et al. “Nobiletin regulates intracellular Ca2+ levels via IP3R and ameliorates neuroinflammation in Aβ42-induced astrocytes.” Redox biology vol. 73 (2024): 103197. doi:10.1016/j.redox.2024.103197 Shi, Ruipeng et al. “Jiegeng Gancao Decoction Ameliorates Ulcerative Colitis: An Integrative Approach Combining Network Pharmacology and Proteomics via in silico and in vivo studies.” Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 145 (2025): 156972. doi:10.1016/j.phymed.2025.156972 Singh, Siddharth et al. “AGA Living Clinical Practice Guideline on Pharmacological Management of Moderate-to-Severe Ulcerative Colitis.” Gastroenterology vol. 167,7 (2024): 1307-1343. doi:10.1053/j.gastro.2024.10.001 Su, Jianan et al. “Efficacy and safety of the integration of traditional Chinese medicine and western medicine in the treatment of diabetes-associated cognitive decline: a systematic review and meta-analysis.” Frontiers in pharmacology vol. 14 1280736. 22 Nov. 2023, doi:10.3389/fphar.2023.1280736 Tatiya-Aphiradee, Nitima et al. “Immune response and inflammatory pathway of ulcerative colitis.” Journal of basic and clinical physiology and pharmacology vol. 30,1 (2018): 1-10. doi:10.1515/jbcpp-2018-0036 Uhlig, Holm H et al. “The diagnostic approach to monogenic very early onset inflammatory bowel disease.” Gastroenterology vol. 147,5 (2014): 990-1007.e3. doi:10.1053/j.gastro.2014.07.023 Ungaro, Ryan et al. “Ulcerative colitis.” Lancet (London, England) vol. 389,10080 (2017): 1756-1770. doi:10.1016/S0140-6736(16)32126-2 Wang, Jing et al. “Forsythiaside A alleviates acute lung injury by inhibiting inflammation and epithelial barrier damages in lung and colon through PPAR-γ/RXR-α complex.” Journal of advanced research vol. 60 (2024): 183-200. doi:10.1016/j.jare.2023.08.006 Wang, Yingying et al. “Linderae Radix extract attenuates ulcerative colitis by inhibiting the JAK/STAT signaling pathway.” Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 132 (2024): 155868. doi:10.1016/j.phymed.2024.155868 Wang, Zhiwang et al. “Therapeutic mechanism of Jinshui Liujunzi Decoction in treating COPD: targeting the PI3K/Akt signaling pathway.” Journal of ethnopharmacology vol. 351 (2025): 120070. doi:10.1016/j.jep.2025.120070 Wangchuk, Phurpa et al. “Ulcerative colitis: clinical biomarkers, therapeutic targets, and emerging treatments.” Trends in pharmacological sciences vol. 45,10 (2024): 892-903. doi:10.1016/j.tips.2024.08.003 Wei, Peng et al. “Baitouweng decoction alleviates dextran sulfate sodium-induced ulcerative colitis by suppressing leucine-related mTORC1 signaling and reducing oxidative stress.” Journal of ethnopharmacology vol. 304 (2023): 116095. doi:10.1016/j.jep.2022.116095 Wei, Yuan-Yuan et al. “Shaoyao decoction attenuates DSS-induced ulcerative colitis, macrophage and NLRP3 inflammasome activation through the MKP1/NF-κB pathway.” Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 92 (2021): 153743. doi:10.1016/j.phymed.2021.153743 Wirtz, Stefan et al. “Chemically induced mouse models of acute and chronic intestinal inflammation.” Nature protocols vol. 12,7 (2017): 1295-1309. doi:10.1038/nprot.2017.044 Wu, Xie-Ning. “Current concept of Spleen-Stomach theory and Spleen deficiency syndrome in TCM.” World journal of gastroenterology vol. 4,1 (1998): 2-6. doi:10.3748/wjg.v4.i1.2 Xu, Qinglei et al. “Acidifiers Attenuate Diquat-Induced Oxidative Stress and Inflammatory Responses by Regulating NF-κB/MAPK/COX-2 Pathways in IPEC-J2 Cells.” Antioxidants (Basel, Switzerland) vol. 11,10 2002. 10 Oct. 2022, doi:10.3390/antiox11102002 Yong, Hae-Young et al. “The p38 MAPK inhibitors for the treatment of inflammatory diseases and cancer.” Expert opinion on investigational drugs vol. 18,12 (2009): 1893-905. doi:10.1517/13543780903321490 Yu, Hui et al. “Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study.” Signal transduction and targeted therapy vol. 5,1 209. 21 Sep. 2020, doi:10.1038/s41392-020-00312-6 Zhan, Jiaguo et al. “A comparative pharmacological study of three Chinese traditional medicines found Blautia to be the key functional bacterium of Coptis chinensis Franch. and Phellodendri chinensis Cortex against colitis.” Frontiers in pharmacology vol. 16 1587119. 18 Jun. 2025, doi:10.3389/fphar.2025.1587119 Zhang, Kun et al. “Macrophage polarization in inflammatory bowel disease.” Cell communication and signaling : CCS vol. 21,1 367. 21 Dec. 2023, doi:10.1186/s12964-023-01386-9 Zhang, Lechang et al. “Colorectal cancer risk in ulcerative colitis: an updated population-based systematic review and meta-analysis.” EClinicalMedicine vol. 84 103269. 22 May. 2025, doi:10.1016/j.eclinm.2025.103269 Zhang, Maorun et al. “Roles of macrophages on ulcerative colitis and colitis-associated colorectal cancer.” Frontiers in immunology vol. 14 1103617. 16 Mar. 2023, doi:10.3389/fimmu.2023.1103617 Zhou, Xin et al. “YAP Aggravates Inflammatory Bowel Disease by Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis.” Cell reports vol. 27,4 (2019): 1176-1189.e5. doi:10.1016/j.celrep.2019.03.028 Additional Declarations No competing interests reported. Supplementary Files SupplymentaryFigure1.pdf Sup Fig.1 LJD modulates intestinal barrier function in colitis mice. (A) The expression of Occludin and ZO-1 in the colon was determined by IHC. (B) Relative Occludin and ZO-1 protein expression (n=3). Data represent means ± S.E.M. p < 0.05, p < 0.01, p < 0.001 vs. MOD group; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. CON group. P-values were obtained from two-way ANOVA. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7486667","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531147594,"identity":"7fa87314-69cb-4e7f-8fda-06761e281e14","order_by":0,"name":"Qingyuan Zhang","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Qingyuan","middleName":"","lastName":"Zhang","suffix":""},{"id":531147595,"identity":"5fa4f908-c360-428c-a584-29cc0b43da9b","order_by":1,"name":"Jing Jing","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Jing","suffix":""},{"id":531147596,"identity":"eeaca171-4770-4b42-ae91-d1f4bc171ee6","order_by":2,"name":"Wenyu Jia","email":"","orcid":"","institution":"The Eighth Clinical Medical College of Guangzhou University of Chinese Medicine, Foshan Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenyu","middleName":"","lastName":"Jia","suffix":""},{"id":531147597,"identity":"a288f94b-f7f6-4bfd-b832-fb9f29390640","order_by":3,"name":"Huiru Lu","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Huiru","middleName":"","lastName":"Lu","suffix":""},{"id":531147598,"identity":"a3e41d13-85b1-4c77-8840-1bd5e9426df9","order_by":4,"name":"Bangjie Li","email":"","orcid":"","institution":"The Eighth Clinical Medical College of Guangzhou University of Chinese Medicine, Foshan Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bangjie","middleName":"","lastName":"Li","suffix":""},{"id":531147599,"identity":"52e0b93f-3247-4d4f-8ff1-aab7892d1631","order_by":5,"name":"Jinju Zhang","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Jinju","middleName":"","lastName":"Zhang","suffix":""},{"id":531147600,"identity":"be79ea73-bfea-4511-9f36-7ec523dcbd61","order_by":6,"name":"Bingying Liu","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Bingying","middleName":"","lastName":"Liu","suffix":""},{"id":531147601,"identity":"7fa8b7cb-bca1-4dcd-8702-fffbafa0b5e7","order_by":7,"name":"Die Yang","email":"","orcid":"","institution":"The Eighth Clinical Medical College of Guangzhou University of Chinese Medicine, Foshan Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Die","middleName":"","lastName":"Yang","suffix":""},{"id":531147602,"identity":"787b727d-396d-4951-977e-7de4374c5a85","order_by":8,"name":"Jie Zhang","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Zhang","suffix":""},{"id":531147603,"identity":"9e0ee4bd-18d1-4f86-b7c5-df4679ccb64a","order_by":9,"name":"Xuezhang Chen","email":"","orcid":"","institution":"The Eighth Clinical Medical College of Guangzhou University of Chinese Medicine, Foshan Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xuezhang","middleName":"","lastName":"Chen","suffix":""},{"id":531147604,"identity":"0e85cd7b-deaa-4fa6-983b-fe3bc3ee4c97","order_by":10,"name":"Enlong Ma","email":"","orcid":"","institution":"Shenyang Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Enlong","middleName":"","lastName":"Ma","suffix":""},{"id":531147605,"identity":"1bf1ed73-4cff-4dd2-bd3b-dd4452062785","order_by":11,"name":"Ju Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA80lEQVRIiWNgGAWjYBACxgYGNiD1T46NvQEmlkCUlgPGfDwHiNQCBGAtifMk4CoJaGGekfzswccddxjbJJ9f/sxTs42Bnz3HgOHnDjwOm5FmbjjzzDNmNumcAmOeY7cZJHveGDD2nsGnJYdNmreNmQ2oJSGZt+E2g8GNHANmxjYCWv62MfOwSZ5JOAzSYk+UFsa2wxJsEuwHm8G2SBDS0vPMTLK3Lc2AjSeHmXHOsds8EmeeFRzsxaPFsD35mcTPNpv6+e3HH394U3Nbjr89eeODn/i0NMCZPAZgEkQcwK2BgUEewWR/gE/hKBgFo2AUjGAAAESfTyDlpJLxAAAAAElFTkSuQmCC","orcid":"","institution":"The Eighth Clinical Medical College of Guangzhou University of Chinese Medicine, Foshan Hospital of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Ju","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-08-29 08:39:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7486667/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7486667/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93928854,"identity":"44ceb968-e893-430a-815b-9bb30d8e11e7","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":367031,"visible":true,"origin":"","legend":"","description":"","filename":"LJDManuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/97f7ee823d915a35228cbcca.docx"},{"id":93929645,"identity":"bbe2f7ae-699b-4a13-b2a6-7168d74442b4","added_by":"auto","created_at":"2025-10-20 11:27:37","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12409,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/2886116af87715ece8c3b8bd.docx"},{"id":93928867,"identity":"ed4c6a56-6085-4449-842a-94fd72a9dd9e","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11320,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/5cf42fc0cba4c55d876c19e5.docx"},{"id":93928853,"identity":"817668dc-74c3-43aa-8d3a-e4eca57d15ed","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11452,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/6ce08dddf03803675067132e.docx"},{"id":93928860,"identity":"220e2102-4aa7-4466-ace7-d09d8efe35c2","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12767,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.docx","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/ac2f3ea67cb7df362fec8445.docx"},{"id":93928857,"identity":"89e9835b-a8a1-40bb-b898-340240ae1524","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"json","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12254,"visible":true,"origin":"","legend":"","description":"","filename":"ec5dd8d2e19f465eb7206f3e145eef95.json","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/d14ba96eb58e80e8c3eaccaf.json"},{"id":93929896,"identity":"45ec46f3-d14d-4d8b-b4ce-edcd50d1bf5d","added_by":"auto","created_at":"2025-10-20 11:35:36","extension":"zip","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13073710,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7Data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/967f44b90f39f8051ad1fd28.zip"},{"id":93928868,"identity":"777bf0f4-6cd2-4227-9807-aa355a50e457","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"zip","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":95972,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1Data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/a3be994baefa76287a045aeb.zip"},{"id":93928881,"identity":"5bd11d4e-e07b-4b3a-a3f0-d75ff976b355","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"zip","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119298,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/14102b73600afec8474c3047.zip"},{"id":93929642,"identity":"d01b053d-766f-478b-afa6-412a59f5cc74","added_by":"auto","created_at":"2025-10-20 11:27:36","extension":"zip","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1344447,"visible":true,"origin":"","legend":"","description":"","filename":"Figure45Data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/d7c72c546426282a4ed5a1e1.zip"},{"id":93928864,"identity":"d8ef450b-036e-4d9f-b899-3fd8e0ec6a57","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"zip","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5621875,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6Data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/fc669b5ed92d920ab4842256.zip"},{"id":93928888,"identity":"006077da-9269-4921-88b6-a079e96d29d3","added_by":"auto","created_at":"2025-10-20 11:19:39","extension":"zip","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":219721532,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/d2ad5ed5c2ed042a6d2f0090.zip"},{"id":93928886,"identity":"f06293ab-f78f-4aaf-a0e4-9467b7d35d44","added_by":"auto","created_at":"2025-10-20 11:19:38","extension":"zip","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":29870921,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/f3595592576ee5c8fef5f204.zip"},{"id":93928866,"identity":"b9a8f839-9de5-49ed-8489-e99c8e1f3ecc","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"zip","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15699983,"visible":true,"origin":"","legend":"","description":"","filename":"figure3Data.zip","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/15198fe3ecdc1d5a9aeb6b87.zip"},{"id":93928884,"identity":"72aac824-bcbf-4214-8466-0ddcc220bc6e","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"xml","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":153814,"visible":true,"origin":"","legend":"","description":"","filename":"ec5dd8d2e19f465eb7206f3e145eef951enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/cf25e216efd655421333b59a.xml"},{"id":93928885,"identity":"5a859571-3b5d-42db-8189-d878a235aec2","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"pdf","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":196661,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/386cad702356ae44d354adac.pdf"},{"id":93928877,"identity":"6ad85193-0764-4aa7-8e75-19babde02085","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"pdf","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1326601,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/dc4b14ed68652e2e2e285d00.pdf"},{"id":93928883,"identity":"ab97675f-6441-47aa-9e2d-a971225b4c54","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"pdf","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1686829,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/6c446d9774421c7982800535.pdf"},{"id":93928875,"identity":"f12b51c7-fd7f-4083-b29b-abe0109fd150","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"pdf","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2826875,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/89cf8c0d45b3d4cedeeaa19f.pdf"},{"id":93929646,"identity":"1d505cbf-56e6-4ef7-8a1f-cfa909238af8","added_by":"auto","created_at":"2025-10-20 11:27:37","extension":"pdf","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":894507,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/1f3321f63fc92d70651582a1.pdf"},{"id":93929647,"identity":"cc8c4518-6027-4557-9f2e-93366d6c9faf","added_by":"auto","created_at":"2025-10-20 11:27:37","extension":"pdf","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150353,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/7998bd883982f8bc1035c623.pdf"},{"id":93929650,"identity":"0f221e68-167a-44f0-a2dd-f20c7dc4f356","added_by":"auto","created_at":"2025-10-20 11:27:38","extension":"pdf","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":212101,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/8969b8587bd749912e48d1d8.pdf"},{"id":93928878,"identity":"c7d2363e-cc7e-4da8-8fce-1721f5beeb73","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"pdf","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":459755,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/777403e78fe27c01c108ddee.pdf"},{"id":93928872,"identity":"f1ca1dfa-5dea-46a1-8524-41fdb7cbd616","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"pdf","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":199492,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/6f07144b369ed3a6fddcd4fb.pdf"},{"id":93929649,"identity":"9e6626ac-6134-4d29-be27-5f8490aa7b6f","added_by":"auto","created_at":"2025-10-20 11:27:37","extension":"pdf","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":422454,"visible":true,"origin":"","legend":"","description":"","filename":"SupplymentaryFigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/934ac50b5c4b8bd46935e383.pdf"},{"id":93928874,"identity":"8dffc727-6cc1-4528-970c-85da82da6725","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"jpeg","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4057250,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/c76cc65f91cf7d23a2b47f72.jpeg"},{"id":93928855,"identity":"8a655cc8-25b6-4e29-85f8-a0bd9af90dba","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59745,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/45b78a82269a3d2841c0fcf4.png"},{"id":93929648,"identity":"30324c4b-20b7-49ab-a033-22e51ae6ec36","added_by":"auto","created_at":"2025-10-20 11:27:37","extension":"xml","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":153655,"visible":true,"origin":"","legend":"","description":"","filename":"ec5dd8d2e19f465eb7206f3e145eef951structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/9df5d795a6ba8c5a4109498c.xml"},{"id":93928882,"identity":"e0c68082-5e41-4faa-999b-b52ffe1f082e","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"html","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":169697,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/79dec831a0591920124fdf87.html"},{"id":93929895,"identity":"ff44518e-b721-4b89-8142-5c0de8374be8","added_by":"auto","created_at":"2025-10-20 11:35:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":54103,"visible":true,"origin":"","legend":"\u003cp\u003eUHPLC-MS analysis of LJD components. Total ion chromatograms (TIC) of LJD in (A) positive ion mode and (B) negative ion mode. (Table-2) The top 15 compounds identified in LJD.\u003c/p\u003e","description":"","filename":"Binder11.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/98f418ea5ead23a277935f71.png"},{"id":93928849,"identity":"61309791-00d5-4384-9e2a-2b12ca32d684","added_by":"auto","created_at":"2025-10-20 11:19:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":844888,"visible":true,"origin":"","legend":"\u003cp\u003eNetwork pharmacology analysis of core pharmacological substances in LJD. (A) Venn diagram of shared targets between LJD and UC. (B-D) Screening and visualization of core therapeutic targets. (E) Component-target network for LJD. (F) GO functional enrichment analysis. (G) KEGG pathway enrichment analysis.\u003c/p\u003e","description":"","filename":"Binder12.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/9eb8bae83df7ff5765a88d0c.png"},{"id":93929639,"identity":"bd06be42-59e6-47a2-8d24-0b1c9248645e","added_by":"auto","created_at":"2025-10-20 11:27:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":747333,"visible":true,"origin":"","legend":"\u003cp\u003eLJD attenuates DSS-induced ulcerative colitis in mice. (A) The scheme of 2.5%DSS and LJD treatment in mice for 8 days. (B, C) Body weight changes in the established colitis mice. (D) DAI score statistics. (E, F) Colon length quantification (n=8). (G) Representative H\u0026amp;E-stained colon tissue sections. Data represent means ± S.E.M. \u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e***\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group;\u003c/em\u003e\u003csup\u003e\u003cem\u003e #\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01,\u003c/em\u003e\u003csup\u003e\u003cem\u003e ###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group\u003c/em\u003e. P-values were obtained from one-way ANOVA or two-way ANOVA.\u003c/p\u003e","description":"","filename":"Binder13.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/f7355c0dfd68f6708aec29ee.png"},{"id":93928851,"identity":"6d0dcfc0-2689-4a6d-9adc-1e9e9cae70c4","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":375186,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic profiling of colon tissues. (A) Pearson correlation matrix. (B) Principal component analysis (PCA) plot. (C) Bar plot of DEGs. (D, E) Volcano plots of DEGs. (F) Heatmap of all DEGs. (G) Heatmap of the top 100 DEGs. (H) PPI network of the top 100 DEGs.\u003c/p\u003e","description":"","filename":"Binder14.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/b7333a6de224063458f38a18.png"},{"id":93929638,"identity":"e2c258f6-face-4fc6-90da-e68a915a7178","added_by":"auto","created_at":"2025-10-20 11:27:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":259030,"visible":true,"origin":"","legend":"\u003cp\u003eFunctional enrichment analysis of colon tissue transcriptomics. (A) GO term enrichment of DEGs. (B) KEGG pathway enrichment of DEGs. (C) GSEA of the MAPK signaling pathway. (D) FPKM values of relevant gene expression (n=3). Data represent means ± S.E.M. \u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e***\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group; \u003c/em\u003e\u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01,\u003c/em\u003e\u003csup\u003e\u003cem\u003e ###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group.\u003c/em\u003e P-values were obtained from two-way ANOVA.\u003c/p\u003e","description":"","filename":"Binder15.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/1b9f6dbabe5f9cf29fbcce77.png"},{"id":93929640,"identity":"0b0ac135-7e36-45f2-a863-727abb979ed9","added_by":"auto","created_at":"2025-10-20 11:27:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":47812,"visible":true,"origin":"","legend":"\u003cp\u003eLJD alleviates inflammatory responses in UC mice. (A-H) mRNA expression levels of pro-inflammatory cytokines and Anti-inflammatory cytokines (RT-qPCR). (G) mRNA expression of Arg1 (RT-qPCR; n=6). (J-L) Serum protein levels of TNF-α, IL-6, and IL-10 (ELISA; n=6). Data represent means ± S.E.M. \u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group; \u003c/em\u003e\u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group. \u003c/em\u003eP-values were obtained from two-way ANOVA.\u003c/p\u003e","description":"","filename":"Binder16.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/64b38255867770e8c09d09f9.png"},{"id":93928861,"identity":"16117447-d0fb-4de1-8ed5-5599a7424cbe","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":144804,"visible":true,"origin":"","legend":"\u003cp\u003eLJD modulates the NF-κB/MAPK signaling pathway in vivo. (A) Representative western blots and quantification of (B) p-NF-κB, (C) p-JNK, (D) p-ERK, and (E) p-p38 protein expression (n=4). Data represent means ± S.E.M. \u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e***\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group; \u003c/em\u003e\u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group. \u003c/em\u003eP-values were obtained from two-way ANOVA.\u003c/p\u003e","description":"","filename":"Binder17.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/abe6ab97a392e53914df612d.png"},{"id":93929644,"identity":"c0bc4e43-5fef-424f-bb66-2bce2dc893a6","added_by":"auto","created_at":"2025-10-20 11:27:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":505622,"visible":true,"origin":"","legend":"\u003cp\u003eLJD regulates macrophage M1/M2 polarization balance. (A) Representative IHC images of CD86 expression. (B) RAW 264.7 and were treated with LJD-containing serum (2.5%,5% and 10%) in the presence or absence of LPS (10 ng/ml) for 24 h. The expression of M1 marker CD86 was examined by flow cytometry. (C) RAW 264.7 and were treated with LJD-containing serum (2.5%,5% and 10%) in the presence or absence of IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 24 h. The expression of M2 marker CD206 was examined by flow cytometry.(D) Relative CD86 protein expression (n=3). (E, F) Quantification of CD86 and CD206 in\u003csup\u003e \u003c/sup\u003eRAW 264.7 cells treated by LJD-containing serum (n=4). Data represent means ± S.E.M. \u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e***\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group; \u003c/em\u003e\u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group. \u003c/em\u003eP-values were obtained from two-way ANOVA.\u003c/p\u003e","description":"","filename":"Binder18.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/46d759cf806d0d64138189f5.png"},{"id":93928871,"identity":"7ee5de69-757a-4bfe-8adf-88ee2807985f","added_by":"auto","created_at":"2025-10-20 11:19:37","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":150047,"visible":true,"origin":"","legend":"\u003cp\u003eLJD inhibits NF-κB/MAPK signaling in M1-polarized macrophages. RAW 264.7 and were treated with LJD-containing serum (2.5%,5% and 10%) in the presence or absence of LPS (10 ng/ml) for 24 h. (A) Representative western blots and quantification of (B) p-NF-κB, (C) p-JNK, (D) p-ERK, and (E) p-P38 in RAW 264.7 cells (n=3). (F-H) mRNA expression of TNF-α, IL-1β, and iNOS (RT-qPCR; n=6). Data represent means ± S.E.M.\u003cem\u003e \u003c/em\u003e\u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e***\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group; \u003c/em\u003e\u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group. \u003c/em\u003eP-values were obtained from two-way ANOVA.\u003c/p\u003e","description":"","filename":"Binder19.png","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/560abac286a56d0c916afa17.png"},{"id":97248423,"identity":"8d923f13-01d5-427c-b3a0-40e297483c65","added_by":"auto","created_at":"2025-12-02 12:58:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4593328,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/814d3f70-d430-4e9f-8d8c-99eb5711cd98.pdf"},{"id":93928862,"identity":"a7a542bd-4e74-40bd-a5a9-c8b71061999d","added_by":"auto","created_at":"2025-10-20 11:19:36","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":422454,"visible":true,"origin":"","legend":"\u003cp\u003eSup Fig.1 LJD modulates intestinal barrier function in colitis mice. (A) The expression of Occludin and ZO-1 in the colon was determined by IHC. (B) Relative Occludin and ZO-1 protein expression (n=3). Data represent means ± S.E.M.\u003cem\u003e \u003c/em\u003e\u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e**\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e***\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. MOD group; \u003c/em\u003e\u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.01, \u003c/em\u003e\u003csup\u003e\u003cem\u003e###\u003c/em\u003e\u003c/sup\u003e\u003cem\u003ep \u0026lt; 0.001 vs. CON group. \u003c/em\u003eP-values were obtained from two-way ANOVA.\u003c/p\u003e","description":"","filename":"SupplymentaryFigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7486667/v1/bf4fcca441ab876728066a1b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Liujunzi Decoction Ameliorates Ulcerative Colitis by Suppression of M1 Macrophage via the NF-κB/MAPK Pathway in DSS mice","fulltext":[{"header":"Highlights","content":"\u003cp\u003e\u003cstrong\u003e•\u0026nbsp;\u003c/strong\u003eLJD effectively alleviates acute colitis in mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e•\u003c/strong\u003e Network pharmacology \u0026amp; transcriptomics: LJD curbs inflammation via NF-κB/MAPK.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e•\u003c/strong\u003e LJD lowers inflammatory factors and blocks M1 macrophage polarization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e•\u003c/strong\u003e LJD suppresses M1 polarization by down-regulating NF-κB/MAPK signaling.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eUlcerative colitis (UC) is one of the two forms of inflammatory bowel disease. It affects 5\u0026nbsp;million people globally and is a chronic and recurring inflammation of the gastrointestinal tract with clinical presentation of abdominal pain, chronic diarrhea, rectal bleeding, and weight loss(Ungaro et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The pathogenesis of UC involves multiple contributing factors, including but not limited to: genetic predisposition(Uhlig et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), dysregulation of the immune system(De Souza et aland Claudio., 2016), gut dysbiosis(Quaglio et al., 2022), and environmental triggers such as dietary habits(Lo et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), psychological stress(Bisgaard et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and smoking(Lunney et al., 2012). The cause and the etiology of UC remain poorly understood(Nakase et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Current mainstream therapies, including Aminosalicylates(Ben-Horin et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), Corticosteroids(Ben-Horin et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), Immunomodulators(Siddharth et al., 2024), and biologics (e.g., anti-TNFα agents(Francesca et al., 2020), often produce suboptimal responses, risk of significant adverse effects, or result in loss of efficacy over time(Stefan et al., 2017). Therefore, there is an urgent need to identify new therapeutic strategies with improved efficacy and safety profiles for the UC treatment.\u003c/p\u003e\u003cp\u003eCentral to the dysregulated immune response in UC is the aberrant activation and polarization of macrophages within the inflamed intestinal mucosa(Liu et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Macrophages exhibit remarkable plasticity, dynamically shifting between classically activated (M1) and alternatively activated (M2) phenotypes in response to microenvironmental cues(Nitima et al., 2018 and Zhang et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). M1 macrophages, induced by pro-inflammatory stimuli such as IFN-γ and LPS, are potent producers of inflammatory cytokines (e.g., TNF-α, IL-1β, IL-6, IL-23), reactive oxygen species (ROS), and nitric oxide (NO)(\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eSheyda et al., 2025\u003c/span\u003e). Their sustained activation and accumulation within the lamina propria are critically implicated in driving the destructive inflammatory cascade, epithelial barrier disruption, and tissue damage characteristic of active UC(Nitima et al., 2018). Therefore, modulating macrophage polarization, specifically suppressing the detrimental M1 phenotype, represents a promising therapeutic avenue for mitigating the intestinal inflammation.\u003c/p\u003e\u003cp\u003eThe activation and inflammatory functions of M1 macrophages are tightly regulated by intricate intracellular signaling networks(Chen et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Among these, the Nuclear Factor-kappa B (NF-κB)(\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ePeng et al., 2023\u003c/span\u003e) and Mitogen-Activated Protein Kinase (MAPK) pathways are paramount(Yu et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The NF-κB pathway, particularly involving the P65 (RelA) subunit, is a master regulator of inflammation(Mitchell et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Upon activation by various stimulant (e.g., TNF-α, IL-1β, TLR ligands), inhibitor of κB (IκB) is degraded, allowing P65 translocation to the nucleus where it drives the transcription of numerous pro-inflammatory genes(Moens et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Concurrently, the MAPK pathway, encompassing key subfamilies like P38, JNK, and ERK, regulates diverse cellular processes including inflammation(Wang et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), proliferation(Fei et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and stress responses(Xu et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Activation of MAPKs signaling leads to the induction of cytokines (e.g., TNF-α, IL-1β, IL-6) and chemokines (e.g., CCL3, CCL4, CCLL5)(Guo et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Crucially, crosstalk exists between the NF-κB and MAPK pathways, often amplifying the inflammatory response in macrophages(Mao et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Persistent activation of P65 and MAPK signaling is a hallmark of UC mucosa and a key driver of M1 macrophage-mediated inflammation, making this axis a critical therapeutic target.\u003c/p\u003e\u003cp\u003eTraditional Chinese Medicine (TCM) demonstrates distinct advantages and therapeutic potential in managing UC based on clinical practice(Matos et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Numerous TCM herbs including \u003cem\u003eCoptis Chinensis\u003c/em\u003e(Hao et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), \u003cem\u003eScutellaria Baicalensis\u003c/em\u003e(Hu et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), \u003cem\u003ePhellodendri Cortex\u003c/em\u003e(Zhan et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), \u003cem\u003ePulsatilla Chinensis\u003c/em\u003e(Wei et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), \u003cem\u003eLicorice\u003c/em\u003e(Shi et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) and their compound formulas (such as Shaoyao Decoction(Wei et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), Pulsatilla Decoction(Niu et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and Gegen Qinlian Decoction(Ma et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) exhibit significant anti-inflammatory properties. These agents can inhibit the expression and activity of various pro-inflammatory cytokines, including TNF-α, IL-1β, IL-6, IL-8, and IL-17, thereby attenuating intestinal inflammation. Furthermore, when prescribed based on accurate syndrome differentiation and appropriate medication strategies, TCM treatment typically results in fewer and milder side effects compared to long-term administration of Western medications like corticosteroids and immunosuppressants(Liu et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Common TCM-related adverse effects, such as gastrointestinal discomfort (e.g., abdominal distension, diarrhea) or allergic reactions, are generally mild and often resolve upon discontinuation or prescription adjustment(Liu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Combining TCM with conventional Western medicine often enhances clinical efficacy, offering greater effectiveness in inducing and maintaining disease remission and alleviating patient symptoms(Su et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Consequently, TCM offers distinct advantages in ameliorating UC symptoms, reducing relapse rates, and mitigating the side effects associated with Western pharmaceuticals.\u003c/p\u003e\u003cp\u003eLiujunzi Decoction (LJD), a classical formula from the TCM, is a modification of the renowned Si Jun Zi Tang (Four Gentlemen Decoction) with the addition of \u003cem\u003eCitri Reticulatae Pericarpium\u003c/em\u003e and \u003cem\u003ePinellia Ternata\u003c/em\u003e. Traditionally, it is prescribed for treating Spleen-Stomach deficiency syndrome manifesting as fatigue, anorexia, abdominal distension, nausea, vomiting, and excessive phlegm/dampness(Wu, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Modern pharmacological studies have attributed various beneficial effects to LJD and its components, including immunomodulation, anti-inflammation, antioxidant activity, and gastrointestinal motility regulation(Wang et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Preliminary evidence suggests potential efficacy in gastrointestinal disorders like chronic gastritis and functional dyspepsia, which share some pathophysiological features (like immune dysregulation) with UC. However, its specific effects on UC, particularly concerning macrophage polarization and the underlying molecular mechanisms involving key inflammatory signaling cascades, remain largely unexplored.\u003c/p\u003e\u003cp\u003eIn this study, we first investigated the composition of LJD and its potential therapeutic mechanism in UC. Subsequently, we established a DSS-induced murine colitis model. In vivo experiments demonstrated that LJD significantly ameliorated DSS-induced UC symptoms and reduced the expression of pro-inflammatory cytokines in the colon. Furthermore, we explored the relationship between the anti-inflammatory effects of LJD and macrophages, key inflammatory cell mediators. In vitro studies revealed that serum from LJD-treated rats inhibited M1-like macrophage polarization and the expression of pro-inflammatory cytokines by suppressing the activation of the NF-κB/MAPK signaling pathway. Collectively, our work elucidates the role of macrophages in mediating LJD's efficiency in UC and provides evidence supporting LJD's potential application as a complementary or alternative therapeutic strategy for UC management.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Network Pharmacology-Based Analysis\u003c/h2\u003e\u003cdiv id=\"Sec4\" class=\"Section3\"\u003e\u003ch2\u003e2.1.1. Target Prediction for Liujunzi Decoction (LJD) Active Ingredients and Ulcerative Colitis (UC)\u003c/h2\u003e\u003cp\u003ePotential active ingredients of LJD (comprising Ginseng radix et rhizoma, Atractylodis macrocephalae rhizoma, Poria, Glycyrrhizae radix et rhizoma, Citri reticulatae pericarpium, and Pinelliae rhizoma) were identified from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://lsp.nwu.edu.cn/tcmsp.php\u003c/span\u003e\u003cspan address=\"http://lsp.nwu.edu.cn/tcmsp.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Selection criteria were oral bioavailability (OB)\u0026thinsp;\u0026ge;\u0026thinsp;30% and drug-likeness (DL)\u0026thinsp;\u0026ge;\u0026thinsp;0.8. Targets for these potential LJD active ingredients were retrieved directly from the TCMSP database.\u003c/p\u003e\u003cp\u003eDisease targets associated with UC were collated from the DisGeNET (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.disgenet.org/\u003c/span\u003e\u003cspan address=\"https://www.disgenet.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), GeneCards (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genecards.org/\u003c/span\u003e\u003cspan address=\"https://www.genecards.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and Online Mendelian Inheritance in Man (OMIM; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://omim.org/\u003c/span\u003e\u003cspan address=\"https://omim.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases using \"ulcerative colitis\" as the search term. The combined target list was compiled. Compound SMILES strings were obtained from the PubChem database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and subsequently input into Swiss Target Prediction (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.swisstargetprediction.ch\u003c/span\u003e\u003cspan address=\"http://www.swisstargetprediction.ch\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for target identification and ID standardization.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section3\"\u003e\u003ch2\u003e2.1.2. Construction of Venn Diagram and Protein-Protein Interaction (PPI) Network\u003c/h2\u003e\u003cp\u003eThe UC-related targets and the LJD potential active ingredient targets were intersected using Venny 2.1 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioinfogp.cnb.csic.es/tools/venny/\u003c/span\u003e\u003cspan address=\"https://bioinfogp.cnb.csic.es/tools/venny/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to identify key overlapping genes. A PPI network for these key genes was constructed using Cytoscape 3.7.0. Furthermore, relevant potential active components linked to these intersection targets were screened. An active component-target network was visualized in Cytoscape 3.7.0, applying filtering criteria (Betweenness\u0026thinsp;\u0026gt;\u0026thinsp;280.6, Closeness\u0026thinsp;\u0026gt;\u0026thinsp;0.002, Degree\u0026thinsp;\u0026gt;\u0026thinsp;40.4).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section3\"\u003e\u003ch2\u003e\u003cem\u003e2.1.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysi\u003c/em\u003es\u003c/h2\u003e\u003cp\u003eGO functional enrichment analysis (covering cellular components, molecular functions, and biological processes) and KEGG pathway enrichment analysis were performed using the DAVID database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://david.ncifcrf.gov/\u003c/span\u003e\u003cspan address=\"https://david.ncifcrf.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The resulting enrichment data were uploaded to the WeiShengXin platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.bioinformatics.com.cn/\u003c/span\u003e\u003cspan address=\"https://www.bioinformatics.com.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for visualization.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Preparation and Composition Analysis of LJD\u003c/h2\u003e\u003cp\u003eLJD formula granules, provided by Guangdong Yifang Pharmaceutical Co., Ltd., were procured from Foshan Hospital of Traditional Chinese Medicine.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eLJD composition.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChinese Name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLatin name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMedicinal Parts\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGranules Dose(g)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChenpi\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eCitrus reticulata Blanco (Family Rutaceae)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePericarp\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e7.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBanxia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePinellia ternata (Thunb.) Makino (Family Araceae)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTuber\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e6.818\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRenshen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePanax ginseng C. A. Meyer (Family Araliaceae)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRhizome\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBaizhu\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eAtractylodes macrocephala Koidz. (Family Compositae)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRhizome\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e11.538\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFuling\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePoria cocos (Schw.) Wolf (Family Polyporaceae)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSclerotia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGancao\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eGlycyrrhiza glabra L. (Family Leguminosae)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRoot\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eCompositional analysis of LJD was conducted using high-resolution liquid chromatography coupled with mass spectrometry (LC-MS/MS). Separation was achieved using a Thermo Hypersil Gold C18 column (1.9 \u0026micro;m, 2.1 mm \u0026times; 100 mm). The flow rate was 0.3 mL/min with an injection volume of 5 \u0026micro;L. The mobile phase consisted of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). Gradient elution was performed according to the following program:\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eMobile Phase Gradient Elution Procedure\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTime (min)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eB (%)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e17.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eMass spectrometry analysis was performed on a Q-Exactive instrument (Thermo Fisher Scientific, CA, USA) equipped with a HESI source. Operating parameters were: ion source temperature 310\u0026deg;C, capillary temperature 320\u0026deg;C, sheath gas flow 30 arbitrary units (au), auxiliary gas flow 10 au, spray voltage 3.0 kV (positive ion mode) and 2.8 kV (negative ion mode).\u003c/p\u003e\u003cp\u003eData-dependent acquisition (DDA) was employed with a loop count of 10. Higher-energy collisional dissociation (HCD) fragmentation used stepped normalized collision energies of 10, 28, and 35 eV. Full MS scans (m/z 100\u0026ndash;1500) were acquired at a resolution of 70,000 (AGC target 3e6, maximum injection time 200 ms). MS/MS scans were performed at a resolution of 17,500 (AGC target 1e5, maximum injection time 50 ms).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Animal Experiment and Dextran Sulfate Sodium (DSS)-Induced Ulcerative Colitis Model\u003c/h2\u003e\u003cp\u003eEight-week-old male C57BL/6 mice (23-25g) were obtained from the Guangdong Medical Laboratory Animal Center. All procedures adhered to guidelines approved by the Center's Animal Ethics Committee (Approval No. B202302-9). Following one week of acclimatization, mice were randomly assigned to six groups (n\u0026thinsp;=\u0026thinsp;8 per group): control (CON), model (MOD), sulfasalazine (SSZ), high-dose LJD (LJDH), medium-dose LJD (LJDM), and low-dose LJD (LJDL). The MOD, SSZ, LJDH, LJDM, and LJDL groups received 2.5% (w/v) DSS dissolved in drinking water ad libitum for 8 days, while the CON group received normal water. Sulfasalazine was administered orally at 300 mg/kg/day. LJD doses were 36.8 g/kg/day (LJDH), 16.4 g/kg/day (LJDM), and 8.2 g/kg/day (LJDL). The medium dose (LJDM) was calculated based on human equivalent dose (HED) conversion using body surface area, following FDA guidance (Food and Drug Administration, 2005). Drug treatments (SSZ, LJD) or an equivalent volume of water (MOD) were administered daily by oral gavage. After 8 days, mice were euthanized. Colon tissue was excised, measured, and processed for subsequent analyses.\u003c/p\u003e\u003cp\u003eThroughout the experimental period, mice were monitored daily for changes in body weight, defecation characteristics, and the presence of fecal blood to assess UC progression. Overall disease severity was quantified using the Disease Activity Index (DAI), calculated as the sum of scores for weight loss, stool consistency, and fecal bleeding (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e)(Wirtz et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2017\u003c/span\u003e)\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDisease Activity Index (DAI) Scoring Criteria\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eScore\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWeight loss (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFecal traits\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFecal occult blood\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNormal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNormal\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u0026ndash;5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLoose\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOccult blood\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5\u0026ndash;15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSoft\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eVisible blood traces\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026gt;\u0026thinsp;15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDiarrhea\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGross blood\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eDAI = [Weight loss score] + [Stool consistency score] + [Fecal blood score].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.4. RNA Sequencing (RNA-Seq) Analysis\u003c/h2\u003e\u003cdiv id=\"Sec10\" class=\"Section3\"\u003e\u003ch2\u003e2.4.1. RNA Extraction and Library Construction\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from colon tissue of three randomly selected mice per group (CON, MOD, LJDH). RNA concentration and purity were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA). RNA integrity was evaluated using an Agilent Bioanalyzer 2100 (Agilent, CA, USA; RIN\u0026thinsp;\u0026gt;\u0026thinsp;7.0) and confirmed by denaturing agarose gel electrophoresis. Poly(A)\u0026thinsp;+\u0026thinsp;RNA was purified from 1 \u0026micro;g total RNA using Dynabeads Oligo(dT)25 (Thermo Fisher, CA, USA) with two rounds of purification. Purified poly(A)\u0026thinsp;+\u0026thinsp;RNA was fragmented using the Magnesium RNA Fragmentation Module (NEB, cat. e6150, USA) at 94\u0026deg;C for 5\u0026ndash;7 min. First-strand cDNA synthesis was performed using SuperScript\u0026trade; II Reverse Transcriptase (Invitrogen, cat. 1896649, USA). Second-strand synthesis incorporated dUTP and utilized E. coli DNA Polymerase I (NEB, cat. m0209, USA), RNase H (NEB, cat. m0297, USA), and dUTP Solution (Thermo Fisher, cat. R0133, USA). Following end repair and A-tailing, indexed adapters were ligated. Size selection was performed using AMPure XP beads. Uracil-containing second strands were digested with UDG enzyme (NEB, cat. m0280, USA). Adapter-ligated fragments were amplified by PCR under the following conditions: 95\u0026deg;C for 3 min; 8 cycles of 98\u0026deg;C for 15 sec, 60\u0026deg;C for 15 sec, 72\u0026deg;C for 30 sec; final extension at 72\u0026deg;C for 5 min. Final cDNA libraries had an average insert size of 300\u0026thinsp;\u0026plusmn;\u0026thinsp;50 bp. Paired-end sequencing (2 \u0026times; 150 bp) was performed on an Illumina NovaSeq 6000 platform (LC-Bio Technology Co., Ltd., Hangzhou, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section3\"\u003e\u003ch2\u003e2.4.2. Bioinformatics Analysis of RNA-Seq Data\u003c/h2\u003e\u003cp\u003eRaw sequencing reads were quality-controlled using fastp software (v0.20.0; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/OpenGene/fastp\u003c/span\u003e\u003cspan address=\"https://github.com/OpenGene/fastp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to remove adapter sequences, low-quality bases (Q\u0026thinsp;\u0026lt;\u0026thinsp;20), and reads with undetermined bases (\u0026gt;\u0026thinsp;5%). Clean reads were aligned to the reference genome (specify version/species if possible, e.g., Mus musculus GRCm38) using [Specify Aligner, e.g., HISAT2 or STAR - this is missing in the original and should be added]. Transcript assembly and quantification of FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values for mRNAs were performed using StringTie (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ccb.jhu.edu/software/stringtie\u003c/span\u003e\u003cspan address=\"https://ccb.jhu.edu/software/stringtie\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) with default parameters. Assembled transcripts from all samples were merged using gffcompare (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/gpertea/gffcompare\u003c/span\u003e\u003cspan address=\"https://github.com/gpertea/gffcompare\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to generate a unified transcriptome. Expression levels were then re-estimated against this merged transcriptome using StringTie. Differentially expressed mRNAs (DEGs) were identified using the R package edgeR (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioconductor.org/packages/release/bioc/html/edgeR.html\u003c/span\u003e\u003cspan address=\"https://bioconductor.org/packages/release/bioc/html/edgeR.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), applying thresholds of absolute fold change\u0026thinsp;\u0026gt;\u0026thinsp;2 (i.e., FC\u0026thinsp;\u0026gt;\u0026thinsp;2 or FC\u0026thinsp;\u0026lt;\u0026thinsp;0.5) and a significance level of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 based on a negative binomial generalized linear model.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Histological (H\u0026amp;E) and Immunohistochemical (IHC) Staining\u003c/h2\u003e\u003cp\u003eHalf of each colon sample was fixed in 4% paraformaldehyde. Fixed tissues were processed, paraffin-embedded, sectioned, and stained with Hematoxylin and Eosin (H\u0026amp;E) or immunohistochemically for CD86, Occludin, and ZO-1 by Wuhan Pinuofei Biological Co., Ltd. (Wuhan, China). Whole-slide images were acquired using an SQS-20Pro slide scanner. The number of immunohistochemically positive cells was quantified using ImageJ software (National Institutes of Health, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Preparation of LJD-Containing Serum\u003c/h2\u003e\u003cp\u003eSix 8-week-old male Sprague Dawley (SD) rats underwent a 1-week acclimatization period. Rats were then orally administered using LJD (16.8 g/kg, twice daily) for 7 consecutive days. Two hours after the final dose, rats were anesthetized with pentobarbital, and blood was collected via abdominal aorta puncture using sterile needles. Blood was allowed to clot at room temperature for 2 hours and then centrifuged at 4,000 rpm (\u0026asymp;\u0026thinsp;2,000 \u0026times; g) for 15 min. Serum was separated, heat-inactivated at 56\u0026deg;C for 30 min, filtered through a 0.22 \u0026micro;m filter, and stored at -80\u0026deg;C until use.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Cell Experiments\u003c/h2\u003e\u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\u003ch2\u003e2.7.1. Cell Culture\u003c/h2\u003e\u003cp\u003eThe RAW 264.7 murine macrophage cell line was purchased from Xiamen Immocell Biotechnology Co., Ltd. RAW 264.7 cells were maintained in DMEM with 10% FBS and 1% penicillin/streptomycin at 37\u0026deg;C in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section3\"\u003e\u003ch2\u003e2.7.2. Polarization Stimulation\u003c/h2\u003e\u003cp\u003eCells were harvested, dissociated, counted, and seeded at appropriate densities: RAW 264.7 cells at 6\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/mL in 6-well, 12-well or 24-well plates. After 24 hours, cells were stimulated for a further 24 hours with either: LPS (10 ng/mL; InvivoGen, USA) in medium containing 10% blank rat serum, or LPS (10 ng/mL) in medium containing LJD-containing serum at final concentrations of 2.5%, 5% or 10% (supplemented with blank rat serum to maintain 10% total serum).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Quantitative Real-Time PCR (RT-qPCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from RAW 264.7 cells or colon tissue using Trizol reagent. cDNA synthesized using the EVO M-MLV RT Mix Kit with gDNA Clean (AG11728) according to the manufacturer's instructions. RT-qPCR was performed using SYBR Green Master Mix (TransGen, AQ611-04). Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Relative mRNA expression levels were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method, and normalized to β-actin.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eRT-qPCR Primer Sequences.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenes\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAACTGTTCCTGAACTCAACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCTTTTGGGGTCCGTCAACT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGCAAGAGACTTCCATCCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGTGGTATAGACAGGTCTGTTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-10\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTCTTACTGACTGGCATGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGCAGCTCTAGGAGCATGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-17A\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCAGCGTGTCCAAACACTGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGCCAAGGGAGTTAAAGACTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-17F\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAACCAGGGCATTTCTGTCCCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCATTGATGCAGCCTGAGTGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-23\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCAGCTCTCTCGGAATCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGATACGGGGCACATTATTTTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGGCGGTGCCTATGTCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGATCACCCCGAAGTTCAGTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTGF-β\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGATACGCCTGAGTGGCTGTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACAAGAGCAGTGAGCGCTGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eArg1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCCAAGCCAAAGTCCTTAGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGAGCTGTCATTAGGGACATC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eiNOS\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTTCTCAGCCCAACAATACAAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCTTTTGGGGTCCGTCAACT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eβ-Actin\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATTGCTGACAGGATGCAGAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCTGGAAGGTGGACAGTGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Enzyme-Linked Immunosorbent Assay (ELISA)\u003c/h2\u003e\u003cp\u003eBlood samples were collected, allowed to clot, and centrifuged at 12,000 \u0026times; g for 10 min to obtain serum. Absolute concentrations of serum cytokines TNF-α (ELM-TNFa-1), IL-6 (ELM-IL6-1), and IL-10 (ELM-IL10-1) were quantified using commercial ELISA kits according to the manufacturers' protocols.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e2.10. Western Blotting Analysis\u003c/h2\u003e\u003cp\u003eTotal protein was extracted from RAW 264.7 cells or colon tissue using RIPA lysis buffer containing protease inhibitors. Protein concentration was determined using a BCA assay kit (Thermo Fisher). Proteins were denatured, separated by 12% SDS-PAGE, and transferred to 0.22 \u0026micro;m nitrocellulose membranes (Merck Millipore). Membranes were blocked with 5% bovine serum albumin (BSA) and incubated overnight at 4\u0026deg;C with primary antibodies, followed by appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Affinity, CA). Protein bands were visualized using an enhanced chemiluminescence (ECL) reagent. Band intensities were quantified using ImageJ software (National Institutes of Health, USA). Expression levels were normalized to loading controls (GAPDH, β-Actin, or α-Tubulin). Antibodies used: anti-GAPDH (Proteintech, 60004-1-ig), anti-β-Actin (CST, 970S), anti-α-Tubulin (Proteintech, 6603-1-ig), anti-NF-κB p65 (CST, 8242S), anti-phospho-NF-κB p65 (Ser536) (CST, 3033S), anti-ERK1/2 (CST, 4695S), anti-phospho-ERK1/2 (Thr202/Tyr204) (CST, 4370S), anti-SAPK/JNK (CST, 9252S), anti-phospho-SAPK/JNK (Thr183/Tyr185) (CST, 4668S), anti-p38 MAPK (CST, 8690S), anti-phospho-p38 MAPK (Thr180/Tyr182) (CST, 4511S), HRP-conjugated goat anti-rabbit IgG (Affinity), HRP-conjugated goat anti-mouse IgG (Affinity).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e2.11. Flow Cytometry\u003c/h2\u003e\u003cp\u003eFor the Flow Cytometry test, Raw264.7 cells were seeded in a 12-well plate at a density of 2.4\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/ml. The remaining conditions are the same as 2.7.2. Polarization Stimulation. Cells were washed twice with FACS buffer (PBS\u0026thinsp;+\u0026thinsp;2%FBS\u0026thinsp;+\u0026thinsp;2\u0026permil; EDTA) and incubated with TruStain FcX\u0026trade; (anti-mouse CD16/32; BioLegend, 101320) for 15 min at room temperature to block Fc receptors. Without washing, cells were stained with anti-CD86 antibody (BioLegend, 105032) in FACS buffer for 30 min on ice, and protected from light. Cells were washed twice and stained with 7-AAD Viability Staining Solution (BioLegend, 420404) for 10 min. Cells were washed, resuspended in FACS buffer, and analyzed immediately using a Cytek Aurora flow cytometer (Cytek Biosciences, USA). Data analysis was performed using FlowJo software V10.8.1 (Tree Star Inc., Ashland, OR, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Statistical Analysis\u003c/h2\u003e\u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistical analysis and graphing were performed using GraphPad Prism version 9.5.0. Comparisons among multiple groups were conducted using \u003cem\u003eone-way analysis of variance\u003c/em\u003e (\u003cem\u003eANOVA\u003c/em\u003e) or \u003cem\u003etwo-way ANOVA\u003c/em\u003e followed by appropriate post-hoc tests. Statistical significance was defined as \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Chemical Composition of LJD\u003c/h2\u003e\u003cp\u003eLC-MS analysis of LJD generated positive and negative ion chromatograms (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). Database interrogation (ChemSpider, ChEBI, ChEMBL, Natural Products Database, Flavonoid Database, OTC Database, mzCloud) identified 193 chemical components, filtered for high spectral match scores and relative abundance. The top 15 compounds by abundance are listed in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC. Notably, several components-including nobiletin(Sanjay et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), tangeretin(Birong et al., 2024), glycyrrhizic acid(Yangye et al., 2022), and citric acid(Pengcheng et al., 2024) exhibit documented anti-inflammatory activity and/or intestinal protective effects.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Network Pharmacology Implicates NF-κB/MAPK Signaling in LJD\u0026rsquo;s Anti-UC Mechanism\u003c/h2\u003e\u003cp\u003eIntegrated analysis identified 2,689 UC-associated targets (GeneCards, OMIM, DisGeNET; deduplicated) and 801 potential LJD targets (TCMSP/SwissTargetPrediction; OB\u0026thinsp;\u0026ge;\u0026thinsp;30%, DL\u0026thinsp;\u0026ge;\u0026thinsp;0.18; deduplicated). Venn analysis revealed 277 overlapping targets (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), with \u003cem\u003eIl6\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, \u003cem\u003eIl1β\u003c/em\u003e, \u003cem\u003eNfkb1\u003c/em\u003e, and \u003cem\u003eMapk3\u003c/em\u003e emerging as core hubs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-D). Cytoscape 3.7.0 mapped the LJD-component-target network (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Functional enrichment (DAVID) demonstrated significant association of overlapping targets with: BPs: Inflammatory response, positive regulation of MAPK activity, NF-κB signaling, negative regulation of inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). KEGG Pathways: TNF, MAPK, and NF-κB signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e3.3. LJD Attenuates DSS-Induced UC In Vivo\u003c/h2\u003e\u003cp\u003eWe established a mouse model of DSS-induced acute colitis and in the DSS-induced UC model (experimental design: Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), LJD (LJDM/LJDH) and SSZ significantly mitigated disease phenotypes compared with MOD group, including reduced weight loss (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C), DAI scores (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), and colon shortening (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F). H\u0026amp;E staining testing revealed severe mucosal damage, goblet cell depletion, crypt distortion, and inflammatory infiltration in MOD mice. LJD groups showed preserved mucosal architecture and reduced infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG), indicating a better efficacy against colitis comparable to SSZ group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Transcriptomics Confirms Involvement of NF-κB/MAPK Pathways\u003c/h2\u003e\u003cp\u003eTo further investigate the signaling mechanisms underlying LJD's ameliorative effects on UC, we performed RNA-seq analysis on colonic tissues. Pearson correlation coefficient analysis and principal component analysis (PCA) demonstrated strong intra-group sample correlations and revealed distinct genetic profiles between the LJDH and MOD groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). Compared to the CON group, the MOD group exhibited 4331 differentially expressed genes (DEGs) (1329 upregulated, 729 downregulated). Furthermore, the LJDH group displayed 1871 DEGs relative to the MOD group (265 upregulated, 330 downregulated) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-E). Heatmaps depicting the top 100 DEGs across the three groups are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-G. Protein-protein interaction (PPI) network analysis identified \u003cem\u003eIl6\u003c/em\u003e and \u003cem\u003eIl1β\u003c/em\u003e as hub genes with the highest connectivity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAs anticipated, GO and KEGG pathway enrichment analyses yielded results largely consistent with our prior network pharmacology predictions. These analyses indicated a strong association between LJD intervention, UC alleviation, immune system responses, and the MAPK signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). Gene Set Enrichment Analysis (GSEA) further highlighted the MAPK signaling pathway as significantly enriched, a finding corroborated by numerous previous studies on IBD (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D). Analysis of Fragments Per Kilobase of transcript per Million mapped reads (FPKM) values revealed that LJDH treatment remarkably reduced the gene expression levels of inflammatory cytokines, including \u003cem\u003eLrg1, Ngp\u003c/em\u003e, and \u003cem\u003eIl6\u003c/em\u003e. Notably, we observed a significant downregulation in the gene expression of iNOS (inducible nitric oxide synthase) and Marco (macrophage receptor with collagenous structure) following LJDH treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These findings suggest that macrophages may represent a key cellular target through which LJD exerts its anti-UC effects.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\u003ch2\u003e3.5. LJD Modulates Inflammatory Mediators in Colon and Serum\u003c/h2\u003e\u003cp\u003eBased on the suggestion of RNA-Seq results, we applied RT-qPCR to detect the expression of pro-inflammatory factors and anti-inflammatory factors in colon tissue to verify the effect of LJD on UC. Compared with CON group, the expression of pro-inflammatory cytokines including IL-6, IL-17A, IL-17F, TNF-α and IL-1β in colon tissue of MOD group was remarkably increased. The expression of IL-23 in the MOD group was not significantly different from that in the CON group. However, as with other pro-inflammatory factors, the expressions of these pro-inflammatory cytokines were obviously down-regulated after administration of LJD compared to the MOD group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-F). In addition, the expressions of anti-inflammatory factors such as IL-10, TGF-β and ARG1 in colon tissue in the LJD group were obviously upregulated compared to the MOD group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-I). At the same time, we also used ELISA to test the contents of TNF-α, IL-6 and IL-10 in mouse serum, and the results were consistent with those suggested by RT-qPCR. These results suggest that LJD may protect the intestinal barrier by improving the inflammatory response in mice.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003e3.6. LJD inhibits activation of NF-κB/MAPK signaling pathway\u003c/h2\u003e\u003cp\u003eThe results of network pharmacology and RNA-seq analysis indicate that the NF-κB/MAPK is a potential signaling pathway for LJD to exert anti-inflammatory effects, so we used Western Blot to detect whether LJD exerts anti-UC effects through the NF-κB/MAPK signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Western blot results confirmed that the protein expression levels of p-NF-κB, p-JNK, p-ERk and p-P38 in the colon tissue of MOD mice were significantly higher than those in CON group. The protein expression levels of p-NF-κB, p-JNK, p-ERk and p-P38 in the colon tissue of mice in the LJDH group were significantly lower than those in the MOD group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-E). NF-κB and MAPK pathways are the core hubs of inflammatory signaling, and NF-κB mainly directly regulates the transcription of pro-inflammatory genes(Ting et al., 2017). MAPK, especially JNK/P38, plays a central role in pro-inflammatory factor production by activating transcription factors and regulating mRNA stability/translation(Hae-Young et al., 2009). Combined with Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and E results, we conclude that LJD may improve DSS-induced UC in mice by inhibiting the activation of TNF-α and IL-1β mediated NF-κB/MAPK signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\u003ch2\u003e3.7. LJD Inhibits M1 Polarization of Macrophages\u003c/h2\u003e\u003cp\u003eMacrophage polarization plays a critical role in the pathogenesis of UC. To evaluate this, we assessed the levels of CD86, a marker for M1 macrophages, in the colon tissues of UC model mice using immunohistochemical staining. As anticipated, CD86 expression was remarkably elevated in the colons of mice in the MOD group. Notably, this increase was mitigated by LJD intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). In vitro, we further examined the effects of LJD-containing serum on RAW 264.7. Flow cytometry analysis revealed that LJD-containing serum greatly reduced the proportion of CD86\u003csup\u003e+\u003c/sup\u003e macrophages induced by LPS. Importantly, 10% LJD-containing serum did not suppress the proportion of M2 macrophages. These results collectively indicate that LJD likely inhibits M1 polarization of macrophages.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec30\" class=\"Section2\"\u003e\u003ch2\u003e3.8. LJD Suppresses M1 Polarization via the NF-κB/MAPK Signaling Pathway in RAW 264.7 Cells\u003c/h2\u003e\u003cp\u003eThe NF-κB and MAPK signaling pathways represent crucial and interconnected intracellular transduction cascades that regulate immune cell activation and maturation. They play a central role in modulating macrophage polarization states. In vitro, we investigated the impact of LJD-containing serum on LPS-induced M1 polarization. As expected, LPS stimulation robustly promoted the phosphorylation (activation) of key signaling molecules, including NF-κB, JNK, ERK, and P38. Conversely, LJD-containing serum effectively suppressed this LPS-induced phosphorylation. Furthermore, RT-qPCR analysis demonstrated that LJD-containing serum inhibited the LPS-induced upregulation of pro-inflammatory cytokines TNF-α and IL-1β at the mRNA level. Additionally, 10% LJD-containing serum significantly downregulated the expression of inducible nitric oxide synthase (iNOS), a characteristic marker of M1 macrophages, consistent with the suppression of M1 polarization.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eUC, characterized by recurrent diarrhea, abdominal pain, and bloody stools, predominantly affects individuals aged 20\u0026ndash;49 years with comparable gender incidence(Wangchuket al., 2024). Although associated with low fatality, chronic UC significantly elevates colorectal neoplasia risk. Recent years have witnessed burgeoning research into TCM for UC management(Zhang et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). It has been shown that Huangqin Decoction (HQD) can alleviate UC by modulating amino acid metabolism and gut microbiota to activate the mTOR pathway, thereby suppressing colonic epithelial apoptosis(Liu et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, Linderae Radix mitigates inflammation by inhibiting the JAK-STAT pathway, preserving intestinal barrier integrity in murine models(Wang et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This study demonstrates that LJD, a classical TCM formula, significantly ameliorates DSS-induced UC in mice. Mechanistically, LJD exerts its protective effect primarily by repolarizing macrophages towards an anti-inflammatory phenotype through inhibition of the NF-κB/MAPK signaling axis.\u003c/p\u003e\u003cp\u003eOur integrated approach, combining network pharmacology and transcriptomic analysis, identified NF-κB and MAPK signaling cascades as central targets of LJD in UC. Network analysis revealed core inflammatory targets (\u003cem\u003ee.g.\u003c/em\u003e, IL6, TNF, IL1β, NFKB1 and MAPK3) within the LJD-UC interaction network and enriched these targets in TNF, NF-κB, and MAPK pathways. This prediction aligns with the well-established pro-inflammatory roles of cytokines (IL-1β, IL6, TNF-α) and signaling molecules (NF-κB and MAPK) in UC pathogenesis, which is corroborated by colonic transcriptome profiling. RNA-seq analysis further detailed distinct gene expression profiles in LJD-treated mice versus model mice, with pathway enrichment confirming LJD-mediated marked regulation of the MAPK pathway.\u003c/p\u003e\u003cp\u003eCrucially, Western blot analysis provided functional validation: LJD potently suppressed DSS-induced phosphorylation of key NF-κB and MAPK pathway components in vivo. Given the pivotal role of NF-κB in transcribing pro-inflammatory genes and the contribution of MAPK kinases (particularly JNK/ERK) to cytokine production, suppression of this signaling axis provides a coherent molecular basis for the observed attenuation of M1 macrophage polarization and the associated inflammatory cytokine storm(Hu et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The convergence of network prediction, transcriptomic data, and phosphoprotein evidence robustly establishes NF-κB/MAPK inhibition as the primary mechanism underpinning LJD's disruption of the UC inflammatory cascade.\u003c/p\u003e\u003cp\u003eAs pivotal innate immune mediators, macrophages adopt distinct functional phenotypes in response to microenvironmental cues. LPS/IFN-γ-induced M1 macrophages drive early inflammation, while M2 macrophages, critical for intestinal homeostasis, secrete anti-inflammatory factors (\u003cem\u003ee.g.\u003c/em\u003e, IL-10) to suppress inflammation and promote tissue repair(Zhang et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Studies indicate M2-derived factors (e.g., IL-10) directly upregulate intestinal tight-junction proteins (e.g., Occludin, and ZO-1), facilitating epithelial restitution. Consistently, we observed LJD reversed DSS-induced downregulation of Occludin and ZO-1 by immunohistochemistry (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Zhou et al. further reported that Yes-associated protein (YAP) impairs M2 polarization, exacerbating UC(Zhou et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eLJD specifically modulated macrophage polarization: profound downregulation of M1 genes (\u003cem\u003ee.g.\u003c/em\u003e, iNOS, IL-1β, IL-6, TNF-α and IL-17A/F) and upregulation of anti-inflammatory mediators (IL-10, TGF-β and Arg1) occurred in colon tissue. In vitro, LJD serum dose-dependently inhibited LPS-induced CD86 (M1 marker) in RAW 264.7 cells but not IL-4/IL-13-induced CD206 (M2 marker). This selective M1 suppression, coupled with inhibited M1 cytokine/iNOS expression, underscores LJD\u0026rsquo;s targeted immunomodulation. Notably, lower LJD doses showed paradoxical inhibition of some M2 markers-a finding warranting further investigation. While M2 macrophages promote epithelial repair via factors like Arg-1, LJD\u0026rsquo;s functional impact on M2-mediated restitution remains unexplored.\u003c/p\u003e\u003cp\u003eLC-MS/MS identified multiple bioactive LJD constituents (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Table\u0026nbsp;5), including compounds with established anti-inflammatory/immunomodulatory properties: Nobiletin downregulates NF-κB and IL-6 to mitigate inflammation(Sanjay et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Tangeretin suppresses chondrocyte inflammation in osteoarthritis(Peng et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Glycyrrhizic acid inhibits MMP2/MMP9 via JNK/p38 pathways, counteracting inflammatory responses(Chen et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Citric acid promotes intestinal epithelial growth and tight-junction stability(Hu et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). LJD\u0026rsquo;s efficacy likely arises from synergistic/additive actions of these components targeting the NF-κB/MAPK-macrophage axis. Such multi-target, multi-component modulation, a hallmark of TCM formulas, may offer broader efficacy and lower resistance risk than single-target biologics. Therapeutic relevance was further demonstrated by LJD\u0026rsquo;s efficacy matching first-line drug sulfasalazine (SSZ) in alleviating disease activity and preserving mucosal integrity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Crucially, LJD achieved this without suppressing beneficial M2 polarization, suggesting a nuanced immunomodulatory profile distinct from broad immunosuppression and potentially lower infection risk.\u003c/p\u003e\u003cp\u003eCurrent UC therapies (e.g., cytokine-targeting biologics) face limitations including non-response, loss of response, and adverse effects. By acting upstream via macrophage polarization through NF-κB/MAPK, LJD offers a distinct mechanistic strategy. Its multi-component nature may provide broader anti-inflammatory control and circumvent single-agent limitations. Furthermore, LJD has been traditionally applied for the treatment of Spleen and Stomach Deficiency Syndrome, whose symptoms include fatigue, anorexia, abdominal distension, which is considerable overlap with UC. This positions LJD as a promising complementary/alternative therapy, especially for patients unresponsive to conventional treatments or concerned about long-term side effects. Future studies should elucidate contributions of key LJD constituents and define LJD\u0026rsquo;s impact on M2-mediated epithelial repair.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study demonstrates that LJD effectively ameliorates DSS-induced ulcerative colitis in mice. The therapeutic efficacy is mechanistically driven by LJD's potent inhibition of the NF-κB/MAPK signaling axis, leading to a significant suppression of pro-inflammatory M1 macrophage polarization and associated cytokine storm. These findings highlight LJD's potential as a multi-target therapeutic strategy for UC, supporting further investigation into its bioactive components and clinical translation.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eUC\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eUlcerative colitis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eIBD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eInflammatory bowel disease\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLJD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLiujunzi Decoction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eSSZ\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eSulfasalazine\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTCM\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTraditional Chinese medicine\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eDAI\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDisease activity index\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eGO\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eGene Ontology\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eKEGG\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eKyoto Encyclopedia of Genes and Genomes\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eH\u0026amp;E\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eHematoxylin and eosin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePPI\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eProtein-protein interaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eELISA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eEnzyme-linked immunosorbent assay\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eRT-qPCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eReverse transcription quantitative polymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNF-κB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eNuclear Factor-kappa B\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eMAPK\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eMitogen-Activated Protein Kinase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eDSS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDextran Sulfate Sodium\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eiNOS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eInducible nitric oxide synthase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003ch3\u003eEthics approval and consent to participate\u003c/h3\u003e\n\u003cp\u003eAll procedures adhered to guidelines approved by the Center's Animal Ethics Committee (Approval No. B202302-9).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agreed with the content of the manuscript and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data associated with this study can be obtained from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no known competing financial interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by funds from the Basic and Applied Basic Research Grant of Guangdong Province (No. 2024A1515140129), University-Hospital Joint Fund Project of Guangzhou University of Chinese Medicine (No. GZYFS2024U03, GZYFS2024U01), and Fund Project of Foshan Hospital of Traditional Chinese Medicine (NO. 2024021).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQZ\u003c/strong\u003e: Writing-original draft, Writing–review and editing, Validation, Investigation, Visualization, Data curation. \u003cstrong\u003eJJ\u003c/strong\u003e: Software, Formal analysis. \u003cstrong\u003eWJ\u003c/strong\u003e: Data curation, Formal analysis, Validation. \u003cstrong\u003eHL\u003c/strong\u003e: Validation, Investigation. \u003cstrong\u003eBL\u003c/strong\u003e: Data curation, Software, Validation. \u003cstrong\u003eJZ\u003c/strong\u003e: Data curation, Formal analysis, Validation. \u003cstrong\u003eBL\u003c/strong\u003e: Investigation, Methodology. \u003cstrong\u003eDY\u003c/strong\u003e: Software, Data curation. \u003cstrong\u003eJZ\u003c/strong\u003e: Data curation, Formal analysis. \u003cstrong\u003eXC\u003c/strong\u003e: Funding acquisition, Investigation, Supervision. \u003cstrong\u003eEM\u003c/strong\u003e:\u0026nbsp;Investigation, Supervision. \u003cstrong\u003eJC\u003c/strong\u003e: Writing-review and editing, Writing-original draft, Project administration, Investigation, Conceptualization, Funding acquisition, Methodology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGraphical abstract created with Figdraw (https://www.figdraw.com/).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBen-Horin et al. \u0026ldquo;Corticosteroids and Mesalamine Versus Corticosteroids for Acute Severe Ulcerative Colitis: A Randomized Controlled Trial.\u0026rdquo; Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association vol. 20,12 (2022): 2868-2875.e1. doi:10.1016/j.cgh.2022.02.055\u003c/li\u003e\n \u003cli\u003eBisgaard, Tania H et al. \u0026ldquo;Depression and anxiety in inflammatory bowel disease: epidemiology, mechanisms and treatment.\u0026rdquo; Nature reviews. Gastroenterology \u0026amp; hepatology vol. 19,11 (2022): 717-726. doi:10.1038/s41575-022-00634-6\u003c/li\u003e\n \u003cli\u003eChen, Shanze et al. \u0026ldquo;Macrophages in immunoregulation and therapeutics.\u0026rdquo; Signal transduction and targeted therapy vol. 8,1 207. 22 May. 2023, doi:10.1038/s41392-023-01452-1\u003c/li\u003e\n \u003cli\u003eChen, Yangye et al. \u0026ldquo;Glycyrrhizic Acid Alleviates Lipopolysaccharide (LPS)-Induced Acute Lung Injury by Regulating Angiotensin-Converting Enzyme-2 (ACE2) and Caveolin-1 Signaling Pathway.\u0026rdquo; Inflammation vol. 45,1 (2022): 253-266. doi:10.1007/s10753-021-01542-8\u003c/li\u003e\n \u003cli\u003eDe Souza, Heitor S P, and Claudio Fiocchi. \u0026ldquo;Immunopathogenesis of IBD: current state of the art.\u0026rdquo; Nature reviews. Gastroenterology \u0026amp; hepatology vol. 13,1 (2016): 13-27. doi:10.1038/nrgastro.2015.186\u003c/li\u003e\n \u003cli\u003eFei, Xiaowei et al. \u0026ldquo;TRIM22 promotes the proliferation of glioblastoma cells by activating MAPK signaling and accelerating the degradation of Raf-1.\u0026rdquo;\u0026nbsp;Experimental \u0026amp; molecular medicine vol. 55,6 (2023): 1203-1217. doi:10.1038/s12276-023-01007-y\u003c/li\u003e\n \u003cli\u003eGhamangiz, Sheyda et al.\u0026nbsp;\u0026ldquo;Reprogram to heal: Macrophage phenotypes as living therapeutics.\u0026rdquo; Life sciences vol. 371 (2025): 123601. doi:10.1016/j.lfs.2025.123601\u003c/li\u003e\n \u003cli\u003eGuo, Qing et al. \u0026ldquo;NF-\u0026kappa;B in biology and targeted therapy: new insights and translational implications.\u0026rdquo; Signal transduction and targeted therapy vol. 9,1 53. 4 Mar. 2024, doi:10.1038/s41392-024-01757-9\u003c/li\u003e\n \u003cli\u003eHao, Wei et al. \u0026ldquo;Classical prescription Huanglian Decoction relieves ulcerative colitis via maintaining intestinal barrier integrity and modulating gut microbiota.\u0026rdquo; Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 107 (2022): 154468. doi:10.1016/j.phymed.2022.154468\u003c/li\u003e\n \u003cli\u003eHu, Pengcheng et al. \u0026ldquo;Citric Acid Promotes Immune Function by Modulating the Intestinal Barrier.\u0026rdquo; International journal of molecular sciences vol. 25,2 1239. 19 Jan. 2024, doi:10.3390/ijms25021239\u003c/li\u003e\n \u003cli\u003eHu, Qichao et al. \u0026ldquo;Baicalin and the liver-gut system: Pharmacological bases explaining its therapeutic effects.\u0026rdquo; Pharmacological research vol. 165 (2021): 105444. doi:10.1016/j.phrs.2021.105444\u003c/li\u003e\n \u003cli\u003eLi, Mu-Xia et al. \u0026ldquo;Huangqin decoction ameliorates DSS-induced ulcerative colitis: Role of gut microbiota and amino acid metabolism, mTOR pathway and intestinal epithelial barrier.\u0026rdquo; Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 100 (2022): 154052. doi:10.1016/j.phymed.2022.154052\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eLiu, Juan et al. \u0026ldquo;Recent advances in the treatment of IBD: Targets, mechanisms and related therapies.\u0026rdquo; Cytokine \u0026amp; growth factor reviews vol. 71-72 (2023): 1-12. doi:10.1016/j.cytogfr.2023.07.001\u003c/li\u003e\n \u003cli\u003eLiu, Runping et al. \u0026ldquo;Toxicity of traditional Chinese medicine herbal and mineral products.\u0026rdquo; Advances in pharmacology (San Diego, Calif.) vol. 87 (2020): 301-346. doi:10.1016/bs.apha.2019.08.001\u003c/li\u003e\n \u003cli\u003eLiu, Ting et al. \u0026ldquo;NF-\u0026kappa;B signaling in inflammation.\u0026rdquo; Signal transduction and targeted therapy vol. 2 (2017): 17023. doi:10.1038/sigtrans.2017.23\u003c/li\u003e\n \u003cli\u003eLiu, Yang et al. \u0026ldquo;Potential activity of Traditional Chinese Medicine against Ulcerative colitis: A review.\u0026rdquo; Journal of ethnopharmacology vol. 289 (2022): 115084. doi:10.1016/j.jep.2022.115084\u003c/li\u003e\n \u003cli\u003eLo, Chun-Han et al. \u0026ldquo;Dietary Inflammatory Potential and Risk of Crohn\u0026apos;s Disease and Ulcerative Colitis.\u0026rdquo;\u0026nbsp;Gastroenterology vol. 159,3 (2020): 873-883.e1. doi:10.1053/j.gastro.2020.05.011\u003c/li\u003e\n \u003cli\u003eLunney, P C, and R W L Leong.\u0026nbsp;\u0026ldquo;Review article: Ulcerative colitis, smoking and nicotine therapy.\u0026rdquo; Alimentary pharmacology \u0026amp; therapeutics vol. 36,11-12 (2012): 997-1008. doi:10.1111/apt.12086\u003c/li\u003e\n \u003cli\u003eMa, Jing et al. \u0026ldquo;Modified Gegen Qinlian decoction ameliorates DSS-induced chronic colitis in mice by restoring the intestinal mucus barrier and inhibiting the activation of \u0026gamma;\u0026delta;T17 cells.\u0026rdquo; Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 111 (2023): 154660. doi:10.1016/j.phymed.2023.154660\u003c/li\u003e\n \u003cli\u003eMao, Ningning et al. \u0026ldquo;Preventive effects of matrine on LPS-induced inflammation in RAW 264.7 cells and intestinal damage in mice through the TLR4/NF-\u0026kappa;B/MAPK pathway.\u0026rdquo;\u0026nbsp;International immunopharmacology vol. 143,Pt 2 (2024): 113432. doi:10.1016/j.intimp.2024.113432\u003c/li\u003e\n \u003cli\u003eMatos, Lu\u0026iacute;s Carlos et al.\u0026nbsp;\u0026ldquo;Understanding Traditional Chinese Medicine Therapeutics: An Overview of the Basics and Clinical Applications.\u0026rdquo; Healthcare (Basel, Switzerland) vol. 9,3 257. 1 Mar. 2021, doi:10.3390/healthcare9030257\u003c/li\u003e\n \u003cli\u003eMitchell, Jennifer P, and Ruaidhr\u0026iacute; J Carmody. \u0026ldquo;NF-\u0026kappa;B and the Transcriptional Control of Inflammation.\u0026rdquo; International review of cell and molecular biology vol. 335 (2018): 41-84. doi:10.1016/bs.ircmb.2017.07.007\u003c/li\u003e\n \u003cli\u003eMoens, Ugo et al. \u0026ldquo;The Role of Mitogen-Activated Protein Kinase-Activated Protein Kinases (MAPKAPKs) in Inflammation.\u0026rdquo; Genes vol. 4,2 101-33. 26 Mar. 2013, doi:10.3390/genes4020101\u003c/li\u003e\n \u003cli\u003eNakase, Hiroshi et al. \u0026ldquo;The influence of cytokines on the complex pathology of ulcerative colitis.\u0026rdquo; Autoimmunity reviews vol. 21,3 (2022): 103017. doi:10.1016/j.autrev.2021.103017\u003c/li\u003e\n \u003cli\u003eNiu, Chun et al. \u0026ldquo;Pulsatilla decoction improves DSS-induced colitis via modulation of fecal-bacteria-related short-chain fatty acids and intestinal barrier integrity.\u0026rdquo; Journal of ethnopharmacology vol. 300 (2023): 115741. doi:10.1016/j.jep.2022.115741\u003c/li\u003e\n \u003cli\u003ePenagini, Francesca et al. \u0026ldquo;Biological therapy in pediatric age.\u0026rdquo; Pharmacological research vol. 161 (2020): 105120. doi:10.1016/j.phrs.2020.105120\u003c/li\u003e\n \u003cli\u003ePeng, Birong et al. \u0026ldquo;Tangeretin alleviates inflammation and oxidative response induced by spinal cord injury by activating the Sesn2/Keap1/Nrf2 pathway.\u0026rdquo; Phytotherapy research : PTR vol. 38,9 (2024): 4555-4569. doi:10.1002/ptr.8294\u003c/li\u003e\n \u003cli\u003ePeng, Yuan et al. \u0026ldquo;Regulatory Mechanism of M1/M2 Macrophage Polarization in the Development of Autoimmune Diseases.\u0026rdquo; Mediators of inflammation vol. 2023 8821610. 8 Jun. 2023, doi:10.1155/2023/8821610\u003c/li\u003e\n \u003cli\u003eQuaglio, Ana Elisa Valencise et al. \u0026ldquo;Gut microbiota, inflammatory bowel disease and colorectal cancer.\u0026rdquo; World journal of gastroenterology vol. 28,30 (2022): 4053-4060. doi:10.3748/wjg.v28.i30.4053\u003c/li\u003e\n \u003cli\u003eSanjay et al. \u0026ldquo;Nobiletin regulates intracellular Ca2+ levels via IP3R and ameliorates neuroinflammation in A\u0026beta;42-induced astrocytes.\u0026rdquo; Redox biology vol. 73 (2024): 103197. doi:10.1016/j.redox.2024.103197\u003c/li\u003e\n \u003cli\u003eShi, Ruipeng et al. \u0026ldquo;Jiegeng Gancao Decoction Ameliorates Ulcerative Colitis: An Integrative Approach Combining Network Pharmacology and Proteomics via in silico and in vivo studies.\u0026rdquo; Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 145 (2025): 156972. doi:10.1016/j.phymed.2025.156972\u003c/li\u003e\n \u003cli\u003eSingh, Siddharth et al. \u0026ldquo;AGA Living Clinical Practice Guideline on Pharmacological Management of Moderate-to-Severe Ulcerative Colitis.\u0026rdquo; Gastroenterology vol. 167,7 (2024): 1307-1343. doi:10.1053/j.gastro.2024.10.001\u003c/li\u003e\n \u003cli\u003eSu, Jianan et al. \u0026ldquo;Efficacy and safety of the integration of traditional Chinese medicine and western medicine in the treatment of diabetes-associated cognitive decline: a systematic review and meta-analysis.\u0026rdquo; Frontiers in pharmacology vol. 14 1280736. 22 Nov. 2023, doi:10.3389/fphar.2023.1280736\u003c/li\u003e\n \u003cli\u003eTatiya-Aphiradee, Nitima et al. \u0026ldquo;Immune response and inflammatory pathway of ulcerative colitis.\u0026rdquo; Journal of basic and clinical physiology and pharmacology vol. 30,1 (2018): 1-10. doi:10.1515/jbcpp-2018-0036\u003c/li\u003e\n \u003cli\u003eUhlig, Holm H et al. \u0026ldquo;The diagnostic approach to monogenic very early onset inflammatory bowel disease.\u0026rdquo;\u0026nbsp;Gastroenterology vol. 147,5 (2014): 990-1007.e3. doi:10.1053/j.gastro.2014.07.023\u003c/li\u003e\n \u003cli\u003eUngaro, Ryan et al. \u0026ldquo;Ulcerative colitis.\u0026rdquo; Lancet (London, England) vol. 389,10080 (2017): 1756-1770. doi:10.1016/S0140-6736(16)32126-2\u003c/li\u003e\n \u003cli\u003eWang, Jing et al. \u0026ldquo;Forsythiaside A alleviates acute lung injury by inhibiting inflammation and epithelial barrier damages in lung and colon through PPAR-\u0026gamma;/RXR-\u0026alpha; complex.\u0026rdquo; Journal of advanced research vol. 60 (2024): 183-200. doi:10.1016/j.jare.2023.08.006\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang, Yingying et al. \u0026ldquo;Linderae Radix extract attenuates ulcerative colitis by inhibiting the JAK/STAT signaling pathway.\u0026rdquo; Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 132 (2024): 155868. doi:10.1016/j.phymed.2024.155868\u003c/li\u003e\n \u003cli\u003eWang, Zhiwang et al. \u0026ldquo;Therapeutic mechanism of Jinshui Liujunzi Decoction in treating COPD: targeting the PI3K/Akt signaling pathway.\u0026rdquo; Journal of ethnopharmacology vol. 351 (2025): 120070. doi:10.1016/j.jep.2025.120070\u003c/li\u003e\n \u003cli\u003eWangchuk, Phurpa et al. \u0026ldquo;Ulcerative colitis: clinical biomarkers, therapeutic targets, and emerging treatments.\u0026rdquo; Trends in pharmacological sciences vol. 45,10 (2024): 892-903. doi:10.1016/j.tips.2024.08.003\u003c/li\u003e\n \u003cli\u003eWei, Peng et al. \u0026ldquo;Baitouweng decoction alleviates dextran sulfate sodium-induced ulcerative colitis by suppressing leucine-related mTORC1 signaling and reducing oxidative stress.\u0026rdquo; Journal of ethnopharmacology vol. 304 (2023): 116095. doi:10.1016/j.jep.2022.116095\u003c/li\u003e\n \u003cli\u003eWei, Yuan-Yuan et al. \u0026ldquo;Shaoyao decoction attenuates DSS-induced ulcerative colitis, macrophage and NLRP3 inflammasome activation through the MKP1/NF-\u0026kappa;B pathway.\u0026rdquo; Phytomedicine : international journal of phytotherapy and phytopharmacology vol. 92 (2021): 153743. doi:10.1016/j.phymed.2021.153743\u003c/li\u003e\n \u003cli\u003eWirtz, Stefan et al. \u0026ldquo;Chemically induced mouse models of acute and chronic intestinal inflammation.\u0026rdquo; Nature protocols vol. 12,7 (2017): 1295-1309. doi:10.1038/nprot.2017.044\u003c/li\u003e\n \u003cli\u003eWu, Xie-Ning. \u0026ldquo;Current concept of Spleen-Stomach theory and Spleen deficiency syndrome in TCM.\u0026rdquo; World journal of gastroenterology vol. 4,1 (1998): 2-6. doi:10.3748/wjg.v4.i1.2\u003c/li\u003e\n \u003cli\u003eXu, Qinglei et al. \u0026ldquo;Acidifiers Attenuate Diquat-Induced Oxidative Stress and Inflammatory Responses by Regulating NF-\u0026kappa;B/MAPK/COX-2 Pathways in IPEC-J2 Cells.\u0026rdquo; Antioxidants (Basel, Switzerland) vol. 11,10 2002. 10 Oct. 2022, doi:10.3390/antiox11102002\u003c/li\u003e\n \u003cli\u003eYong, Hae-Young et al. \u0026ldquo;The p38 MAPK inhibitors for the treatment of inflammatory diseases and cancer.\u0026rdquo; Expert opinion on investigational drugs vol. 18,12 (2009): 1893-905. doi:10.1517/13543780903321490\u003c/li\u003e\n \u003cli\u003eYu, Hui et al. \u0026ldquo;Targeting NF-\u0026kappa;B pathway for the therapy of diseases: mechanism and clinical study.\u0026rdquo; Signal transduction and targeted therapy vol. 5,1 209. 21 Sep. 2020, doi:10.1038/s41392-020-00312-6\u003c/li\u003e\n \u003cli\u003eZhan, Jiaguo et al. \u0026ldquo;A comparative pharmacological study of three Chinese traditional medicines found Blautia to be the key functional bacterium of Coptis chinensis Franch. and Phellodendri chinensis Cortex against colitis.\u0026rdquo; Frontiers in pharmacology vol. 16 1587119. 18 Jun. 2025, doi:10.3389/fphar.2025.1587119\u003c/li\u003e\n \u003cli\u003eZhang, Kun et al. \u0026ldquo;Macrophage polarization in inflammatory bowel disease.\u0026rdquo; Cell communication and signaling : CCS vol. 21,1 367. 21 Dec. 2023, doi:10.1186/s12964-023-01386-9\u003c/li\u003e\n \u003cli\u003eZhang, Lechang et al. \u0026ldquo;Colorectal cancer risk in ulcerative colitis: an updated population-based systematic review and meta-analysis.\u0026rdquo; EClinicalMedicine vol. 84 103269. 22 May. 2025, doi:10.1016/j.eclinm.2025.103269\u003c/li\u003e\n \u003cli\u003eZhang, Maorun et al. \u0026ldquo;Roles of macrophages on ulcerative colitis and colitis-associated colorectal cancer.\u0026rdquo; Frontiers in immunology vol. 14 1103617. 16 Mar. 2023, doi:10.3389/fimmu.2023.1103617\u003c/li\u003e\n \u003cli\u003eZhou, Xin et al. \u0026ldquo;YAP Aggravates Inflammatory Bowel Disease by Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis.\u0026rdquo; Cell reports vol. 27,4 (2019): 1176-1189.e5. doi:10.1016/j.celrep.2019.03.028\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Ulcerative Colitis, Traditional Chinese Medicine, Liujunzi Decoction, Inflammation, Macrophage","lastPublishedDoi":"10.21203/rs.3.rs-7486667/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7486667/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLiujunzi Decoction is a traditional Chinese medicine prescription, which is made by decocting six herbs:\u003cem\u003eCitrus reticulata Blanco (Family Rutaceae)\u003c/em\u003e, \u003cem\u003ePinellia ternata (Thunb.) Makino (Family Araceae)\u003c/em\u003e, \u003cem\u003ePanax ginseng C. A. Meyer (Family Araliaceae)\u003c/em\u003e, \u003cem\u003eAtractylodes macrocephala Koidz. (Family Compositae)\u003c/em\u003e, \u003cem\u003ePoria cocos (Schw.) Wolf (Family Polyporaceae) \u003c/em\u003eand \u003cem\u003eGlycyrrhiza glabra L. (Family Leguminosae)\u003c/em\u003e. It is mainly used to treat\u0026nbsp; Spleen-Stomach deficiency syndrome.\u003cbr\u003e\n\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNetwork pharmacology and transcriptomics (RNA-seq) identified LJD’s potential targets and pathways. A DSS-induced mouse colitis model assessed LJD efficacy including symptom severity, colon length, histology. In vitro, RAW 264.7 macrophages stimulated with LPS + LJD-containing serum were analyzed via flow cytometry (CD86), RT-qPCR (cytokines), and Western blot (NF-κB P65, ERK, JNK, P38 phosphorylation). LC-MS/MS characterized LJD components.\u003cbr\u003e\n\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLJD significantly alleviated DSS-induced colitis, reducing disease activity, colon shortening, and histopathological damage. Network and transcriptomic analyses converged on NF-κB/MAPK pathway inhibition. LJD downregulated pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and suppressed M1 macrophage polarization \u003cem\u003ein vivo\u003c/em\u003e (reduced CD86\u003csup\u003e+\u003c/sup\u003e) and \u003cem\u003ein vitro\u003c/em\u003e (reduced CD86\u003csup\u003e+\u003c/sup\u003e cells and iNOS). Mechanistically, LJD inhibited phosphorylation of NF-κB, ERK, JNK and P38 in colonic tissue and LPS-stimulated macrophages.\u003cbr\u003e\n\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLJD ameliorates UC by inhibiting NF-κB/MAPK signaling, thereby suppressing pathogenic M1 macrophage polarization and inflammation. This supports LJD’s potential as a complementary UC therapy targeting macrophage plasticity.\u003c/p\u003e","manuscriptTitle":"Liujunzi Decoction Ameliorates Ulcerative Colitis by Suppression of M1 Macrophage via the NF-κB/MAPK Pathway in DSS mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-20 11:19:30","doi":"10.21203/rs.3.rs-7486667/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8605b08b-0cef-49b0-bede-ccf0caff5471","owner":[],"postedDate":"October 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-24T09:39:06+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-20 11:19:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7486667","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7486667","identity":"rs-7486667","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00