Zfp521 prolonged expression partially relaunches the generic neuronal genes in U87MG glioblastoma cells: a primitive study

Zfp521 prolonged expression partially relaunches the generic neuronal genes in U87MG glioblastoma cells: a primitive study | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Zfp521 prolonged expression partially relaunches the generic neuronal genes in U87MG glioblastoma cells: a primitive study Vafa Rahimi-Movaghar, Sara Mirsadeghi, Yasaman Heidary, Seyed Danial Alizadeh, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4505201/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Study Design: An experimental in-vitro and in-vivo parallel group study. Objectives: To investigate the prolonged effects of Zfp521 on gene expression in the U87MG glioma cell line and assess its in vivo impact on animal movement post-transplantation into spinal cord injury (SCI). Setting: Royan Institute for Stem Cell Biology and Technology Laboratory. Methods : U87MG cells were transduced with Zfp521-IRES-GFP and maintained in neural inductive medium for over 3 weeks. Gene expression of Gfap , Itga6 , Pax6 , nestin , Sox1 , Tubb3 , and Olig2 was analyzed. Transplanted cells' impact on locomotor capacity in SCI was assessed using the Basso-Beattie-Bresnahan (BBB) scale and footprint analysis. Results : Zfp521 overexpression induced morphological changes and aggregated formation in U87MG cells, with a transfection rate of 26%. Significant upregulation of Pax6 , Tubb3 , and Olig2 and decreasing of Sox1 were observed, while Gfap , Itga6 , and nestin showed non-significant changes. In SCI animals, U87-Zfp521 exhibited substantial recovery in hindlimb motor coordination (BBB score of 12) and weight support. Moreover, gait analysis revealed increased step length, stride angle, and step width in U87-Zfp521 animalsduring a five-week treatment. While plantar application showed no significant improvement. Conclusions : Controlling Zfp521 expression level prominently enables the neuronal and oligodendrocyte lineage alley in the glioblastoma cell line that can be the potential therapy for promoting recovery in GBM and SCIs, highlighting its role as a promising target for further exploration in neural regeneration strategies. Sponsorship : This work was funded by Tehran University of Medical Sciences with grant number 97-02-38-39408. Biological sciences/Biological techniques/Biological models/Cancer models Biological sciences/Neuroscience/Genetics of the nervous system Health sciences/Medical research/Genetics research Health sciences/Medical research/Experimental models of disease Figures Figure 1 Figure 2 Introduction Among numerous operators regulating neural differentiation, zinc finger protein 521 (Zfp521) is appraised to be associated with neural differentiation by encouraging embryonic epidermal cells toward neural progenitor cells [ 1 , 2 ], along with modulating adult astrocytic genetic core to neural stem cells (NSCs) derivations [ 3 ]. Moreover, Zfp521 revealed the capability to convert adult human fibroblast cells into NSCs when fostering in a permissive habitat [ 4 ]. Indeed, Zfp521 mainly enhances sonic hedgehog signaling molecule (SHH) pathway activity, which leads to the development of both normal cerebellum and medulloblastoma [ 5 ]. Zfp521 may play alternative roles in brain tumors as well, e.g., it contributes to medulloblastoma proliferation and progressiveness [ 6 ]. Of course, Zfps, in general, mostly appear to play enormously contradictory or versatile roles during cancer progression [ 7 – 10 ] or even in its suppression [ 11 , 12 ]. However, Zfp521’s role in modifying or driving the genomic consequences of glioblastoma multiforme (GBM) remained undiscovered. GBM, also termed grade 4 astrocytoma, has been identified as the most common and severe form of brain and spinal cord tumors [ 13 ]. GBM is comprised of an NSC-like subpopulation with the ability to self-renewal and differentiate into neurons, astrocytes, and oligodendrocytes, which can also be expanded in vitro as stable cell lines, allowing for more extensive characterizations [ 14 ]. GBM cell lines overall bear similarities [ 15 ], yet with irregularities [ 16 , 17 ], to NSCs, i.e., parallel cellular pathways may result in divergent outcomes in NSC and GBM cell lines attitudes. For instance, although epidermal and fibroblast growth factors promote adequate length of stemness and proliferation in NSCs, they underlie an extraordinary proliferation rate in GBM [ 18 ] as well as medulloblastoma [ 19 ]. U87MG is a well-established glioma cell line that has been employed in a myriad of studies over the past four decades [ 20 ]. A wide range of biological information is known about this cell line, e.g., the U87MG cell line contains tumorigenic neural precursors [ 21 ], owns a highly aberrant gene structure [ 22 ], and nevertheless is capable of differentiation into cholinergic neurons [ 23 ]. Moreover, U87MG, as a reliable cell model, has been employed for the evaluation of genome editing technologies in GBM for further in vivo manipulation [ 24 ]. Accordingly, the U87MG cell line is an authentic, available platform for in vitro identifications such as drug discoveries [ 25 ] or signaling pathway investigations [ 8 ]. Therefore, on account of Zfp521’s reputation for mastering the NSCs-dedicated genetic core in adult astrocytes in addition to embryonic epidermal cells and also due to its consequence in medulloblastoma progression, we aim to investigate its prolonged and excessive effect on the U87MG gene expression pattern. To achieve this goal, the in vitro expression pattern of selective genes, namely: glial fibrillary acidic protein ( Gfap ), integrin subunit alpha 6 ( Itga6 ), paired box 6 ( Pax6 ), nestin , SRY-box transcription factor 1 ( Sox1 ), tubulin beta 3 class III ( Tubb3 ), and oligodendrocyte transcription factor 2 ( Olig2 ), was addressed via real-time polymerase chain reaction (RT-PCR) in U87-Zfp521 cells. Additionally, we transplanted U87-Zfp521 cells to the spinal cord injury (SCI) in order to determine the in vivo influence of these cells on animal movement following the in vitro manipulation. Methods Cell maintenance and transduction Astrocytoma grade 4 cell line (U87MG), obtained from the Iranian Biological Resource Center, was expanded and passaged five times in Dulbecco's modified eagle medium/nutrient mixture F-12 (DMEM/F12) supplemented with 10% fetal bovine serum, 1% non-essential amino acids, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (1%) (all from Invitrogen, CA, USA). P3–P5 astrocytoma was transduced via Zfp521-IRES-GFP constructs in the experimental group and CMV-GFP constructs in the mock group, as described in our previous reports [ 3 , 26 ]. Transduced cells (U87-Zfp521 and U87-GFP) were cultivated on 0·001% poly-L-ornithine (P4707; Sigma-Aldrich, MO, USA) and 10 mg/ml laminin (L2020; Sigma-Aldrich, MO, USA) beds and were maintained in NSC medium (NSCM) containing DMEM/F12 supplemented with 2% B27, 1% N2, 0·5% ITS (1 mg/ml insulin, 0·55 mg/ml transferrin, and 0·67 mg/ml selenium), 10% knockout serum replacement, 1% non-essential amino acids, 2 mM L-glutamine, 1% penicillin 100 U/ml and streptomycin 100 µg/ml (all from Invitrogen, CA, USA), 20 ng/ml basic fibroblast growth factors (F0291; Sigma-Aldrich, MO, USA) and 20 ng/ml epidermal growth factors (E9644; Sigma-Aldrich, MO, USA). RT-PCR Total mRNA from U87-Zfp521 and Mock were extracted five weeks after induction by NSCM using a RNeasy® Plus Universal Mini Kit (73404; QIAGEN LLC, MD, USA), followed by 2 µg complementary DNA synthesis using an Easy™ complementary DNA Synthesis Kit with random hexamer primer (A101161; Parstous Biotechnology, Iran) according to the manufacturer’s instructions. RT-PCR was performed by a SYBR® Green Master Mix (DQ385; BioFact™, South Korea) via StepOne™ (Applied Biosystems™, Thermo Fisher Scientific, MA, USA) for selective genes (Table 1 ). mRNA levels were normalized to glyceraldehyde-3-phosphate dehydrogenase as an internal control using the 2 –ΔΔCT method. Table 1 Primer names and sequences that used for real-time polymerase chain reaction. Gene name Forward primer (5'–3') Reverse primer (5'–3') Gapdh AGGGTCTCTCTCTTCCTCTTGTGCTCT CCAGGTGGTCTCCTCTGACTTCAACAG Gfap GAGATGCGGGATGGAGAG TAGGGACAGAGGAGGGAG Itga6 TTTATCGGTCTCGGGAGTTG GGCCACTGAATGTTCAAGGT Pax6 TTCAGCACCAGTGTCTACCAAC GCTGACTGTTCATGTGTGTCTG Sox1 CCTCCGTCCATCCTCTG AAAGCATCAAACAACCTCAAG nestin CTCCAGAAACTCAAGCACC TCCTGATTCTCCTCTTCCA Tubb3 GGAGAACACGGATGAGACCTA AAGGTGGAGGACATCTTGAGG Olig2 CCAGAGCCCGATGACCTTTTT CACTGCCTCCTAGCTTGTCC Gapdh: glyceraldehyde-3-phosphate dehydrogenase, Gfap: glial fibrillary acidic protein, Itga6: integrin alpha 6, Olig2: oligodendrocyte transcription factor 2, Pax6: paired box 6, Sox1: sex determining region Y-box 1, Tubb3: tubulin, beta 3 class III. SCI modeling and cell transplantation Adult male wild-type Wistar rats weighing 250–280 g were used in this study according to Royan Institute ethical guidelines as well as animal research: reporting of in vivo experiments (ARRIVE) guidelines [ 27 ]. Animals were anesthetized through intraperitoneal injections of 100 mg/kg ketamine and 10 mg/kg xylazine. The contusion model of SCI was established by dropping a 10 g rod weight vertically to the spinal cord from a height of 25 mm using an NYU-impactor device. Following the SCI, each animal received 5 mg/kg of Enrofloxacin intramuscularly once a day for a week. Daily bladder discharge was performed manually as long as the animal required it. One week posterior to SCI, at the sub-acute phase of injury, almost 2 × 10 6 cells diluted in 30 µL PBS – were transplanted into the injury site via an automated micro-injector device (Stoelting Co., IL, USA). In order to address the in vitro induction impact on the Zfp521 function, animals were grouped as 5–10 animals in each group as follows: U87-Zfp521 and Mock. In U87-Zfp521, transduced cells were maintained in an induction medium for five weeks. For immune response suppression subsequent to cell transplantation, subcutaneous injections of 10 mg/kg Cyclosporine-A were administered to animals in all groups two days before transplantation (day 5) throughout the whole study. Locomotor capacity evaluation To assess the weekly motor function improvement in animals, we employed the well-established Basso-Beattie-Bresnahan (BBB) locomotor rating scale system on freely moving animals throughout four weeks that includes 0–21 points. The method comprehensively assesses rat motor function by measuring hindlimb joint movement, coordination between front and rear limbs, trunk position, load-bearing capacity, paw placement, and tail movement. The BBB score of all animals was determined to be 21 prior to the SCI. After weight-drop contusion, all animals BBB became zero from the first day after surgery to at least seven days. Footprint analysis Gait and motor coordination were weekly evaluated in all animals as well. The rats were allowed to walk on a narrow paper-covered corridor while their metatarsus was colored to leave footprint traces. At least 4–5 sequential steps were used to determine the mean values for each measurement, including stride angle, stride length, foot length, step width, toe spread, and paw area. Statistics analysis Total numerical data belonging to in vitro investigations are reported as the mean (± standard error) of three independent experiments. An independent sample t-test was used to compare the gene expression pattern between U87-Zfp521 and mock cells. ANOVA and Tukey’s post hoc test were considered for comparisons as within means for behavioral assessments. The p -value of < 0·05 was reflected as statistically significant. All data were analyzed by SPSS version 16 (SPSS Inc., IL, USA). Results Excessive expression of Zfp521 propels aggregate formation in U87MG Two populations of U87MG, owning a flat and bipolar phenotype (Fig. 1 . D1 and E1), were transfected with Zfp521-IRES-GFP (U87-Zfp521) as well as CMV-GFP (U87-GFP) while maintaining in NSCM for five weeks. U87-ZFP21 cells underwent an immediate morphological conversion and became smaller and confined after three days post-transduction (Fig. 1 . D2). U87-Zfp521 became susceptible to gathering around and initiating the formation of aggregates during the first week post-transduction (WPT); besides, they also hesitated to proliferate (Fig. 1 . D3). They actually settled inside the aggregates throughout the experiment timeline (Fig. 1 . B2). In comparison with U87-Zfp521, U87-GFP cells retained bipolar and proliferative activity over the whole process with preserved dispersion (Fig. 1 . A, E2, and E3). The transfection rate yielded 26% in U87-Zfp521, which is almost half of what we measured in U87-GFP (Fig. 1 . C). Prolonged overexpression of Zfp521 upregulated hindlimb neuronal marker expression in U87MG The gene expression pattern of U87-Zfp521 cells was compared with U87-GFP five WPT using an independent sample t-test (Fig. 1 . F). According to GFP measurement, the vector was consistently functional in both cell populations—i.e., the ZPF521 was excessively expressed in U87-MG throughout the whole experiment—while, of course, the transfection rate was significantly larger in U87-GFP (as depicted in Fig. 1 . A, B, and C) from the beginning ( p < 0·001). Gfap— a NSC marker that is usually overexpressed in GBM cells; Itga6 —a receptor for ECM laminin that is under-regulated in GBM cells; and nestin —a marker for proliferative neural progenitor and GBM cells—revealed non-significant changes ( p > 0·05) during five WPT in NSCM. However, Sox1 —the earliest transcription factor of neurogenesis in proliferative NSCs—showed a considerable down-regulation ( p < 0·01). On the other hand, we found a substantial increase in Pax6— the earliest neuronal marker—( p < 0·001), Tubb3 —a neuronal marker—( p < 0·01), and Olig2 —the earliest motor neuron and oligodendrocyte marker—( p < 0·001) expression in U87-Zfp521 cells compared with U87-GFP. Zfp521-U87MG cells allow slight behavioral improvement in SCI animals The locomotor ability of animals was evaluated in five WPTs via the BBB test through a two-way ANOVA. Total animals displayed gradual improvements in hind-limb motor coordination and joint movements; however, U87-Zfp521 animals revealed substantial recovery with a score of 12 compared with mock ( p < 0·001) and control ( p < 0·001) (Fig. 2 . A). Weight support was significantly ameliorated in these animals, while plantar application was not considerably restored (Fig. 2 . B and C). According to the BBB score, the animals’ motor ability was elevated by almost half of what intact animals show. Besides BBB grading, gating capabilities were monitored for a more detailed view of their movement. Consistent with BBB results, remarkable enhancement was observed in both the right and left feet of U87-Zfp521 animals’ gaiting during a five-week period. Animals' step length was significantly increased in U87-Zfp521 at the fifth ( p < 0·01) WPT. The stride angle in right feet was measured higher at weeks three and four ( p < 0·01). The step width was substantially greater at week three in both right ( p < 0·01) and left rears ( p < 0·001), while a significant increase was observed at 4 WPT in only left feet ( p < 0·01). The toe spread, only in the right feet, was remarkably elevated during the fifth WPT in U87-Zfp521 animals, in comparison with the mock ( p < 0·01). Discussion The in vivo conversion or trans-differentiation of resident astrocytes, developed by SCI and multiple sclerosis, offers a promising strategy to overcome the prolonged devastating consequences of glial scars. Numerous studies reported prosperous in vivo conversion of unfavorable astrocytes into oligodendrocytes [ 28 , 29 ] in addition to neural cells [ 26 ], using chemicals or master-regulating transcription factors such as Sox10 for oligodendrogenesis and Zfp521 for NSC generation [ 30 ]. Cell identity manipulation is an encouraging method to be considered for astrocytoma and GBM treatment, besides the common surgical or chemotherapy approach [ 31 ]. In this study, we also took advantage of the Zfp521 power in neurogenesis to determine if it is exclusively capable of modulating the gene expression pattern in U87-GM, a popular GBM-derived cell line [ 22 ]. The excessive expression of Zfp521 caused morphological changes in the astrocytoma population from bipolar and proliferative to smaller and aggregate-forming during 5 WPT in NSCM. The expression patterns of Gfap , Itga6 , and nestin remained unchanged, whereas Sox1 expression was significantly decreased, which is consistent with the observed proliferation decline in U87-Zfp521 during in vitro cultivation. However, the unchanged level of expression in Gfap and Itga6 can imply that an unstable state is still present in these cells. The remarkable up-regulation of Pax6 , Tubb3 , and Olig2 in U87-Zfp521, compared with U87-GFP, reflected the Zfp521 potential in activating the neuronal lineage genes, even in the most aberrant astrocytoma cell line. Moreover, Olig2 elevation suggests that Zfp521 is able to facilitate both oligodendrocyte and motoneuron generation in U87-GM. The U87-GM was determined to be capable of neuron generation via direct reprogramming using small molecules [ 32 ] or chemicals [ 23 ] in previous studies as well. Therefore, we propose that the combination of Zfp521 with chemicals may exclusively lead the U87-GM to neurons. Our findings revealed that prolonged expression of Zfp521 in a GBM cell line simultaneously ceases the cell's proliferation and propels the neuronal genes to express while cultivating in NSCM. Indeed, it seems that Zfp521 alone is not capable of creating expandable NSCs from astrocytoma. The mentioned conclusion actually advocates that tuning the Zfp521 expression can be a reliable method for in vivo conversion of astrocytoma directly into neurons, bypassing the NSC proliferative stage. In order to address the Zfp521, along with the NSCM, consequences on U87-GM in vivo function, we transplanted U87-Zfp521 cells to SCI animals after 5 WPT. In fact, we aimed to uncover if U87, as a GBM cell line, still owns its ameliorative secretome and impacts the CNS. The controversial impression of the GBM secretome has been long investigated as multimodal, comprising neuroprotective [ 33 ] and tumorigenic effects [ 34 ], leading us to raise the mentioned question. The BBB scores and gaiting evaluations uncover the moderate ameliorative effect of U87-Zfp521 in comparison with U87-GFP. Although Zfp521 overexpression in glial scars in vivo was determined to be more impactful in SCI improvement in our previous report [ 26 ], our findings here also insinuate that U87-Zfp521 constructed notable enhancements in animal movement. We indeed employed the SCI model here as well to compare the Zfp521 consequences on U87, the most severely mutated cell line, and on glial scar astrocytes. Overall, direct reprogramming of the glioblastoma cells is a growing trend that can pave the way for us to create the most deleterious situation. Transcription factor-based gene therapy for GBM has nominated neurogenic differentiation 1 and neurogenin 2 as efficient for glutamatergic neuron production, while achaete-scute family bHLH transcription factor 1 promotes GABAergic fate in GBM [ 30 , 35 ]. These strategies can first inhibit glioblastoma progression and then modify their cell components from unfavorable astrocytes to valuable and dedicated neurons [ 36 ]. Herein, we briefly report the Zfp521 transcription factor prolong effect on the U78-GM gene expression pattern. Accordingly, Zfp521, as a neural lineage initiator, allows early neuronal and oligodendrocyte markers to be enriched in the most aberrant astrocytoma cell line, continuing to have an acceptable impact on SCI recovery. The tumorigenicity of ZNF521 or Zfp521 has been explored in various cancers, revealing diverse roles in different contexts. In medulloblastoma, a complex regulatory network is revealed by the SHH pathway, where ZNF521 cooperatively interacts with GLI family zinc finger 1 and 2 proteins, stimulating SHH target genes. This interaction, particularly with the nucleosome remodeling and deacetylase complex, contributes to the tumorigenic effects of ZNF521 in medulloblastoma [ 5 ]. Another study extended these findings to various medulloblastoma subgroups, demonstrating ZNF521's role in promoting cell growth, clonogenicity, and migration, especially in the SHH subgroup and Group 4 medulloblastomas [ 6 ]. Contrastingly, in hepatocellular carcinoma (HCC), ZNF521 was identified as a tumor suppressor. Low expression of ZNF521 is correlated with larger tumor size, advanced stage, and poor prognosis in people with HCC. Functional assays revealed that ZNF521 inhibited cell proliferation and colony formation and promoted apoptosis in HCC cells, both in vitro and in vivo . These effects were linked to the antagonism of RUNX family transcription factor 2 transcriptional activity and the regulation of AKT phosphorylation [ 37 ]. In B-cell biology and leukemia, ZNF521 or Zfp521's evolutionary, regulatory, and functional aspects were explored. Originating from a gene duplication event, ZNF521 or Zfp521's transcriptional regulators, Spi-1 proto-oncogene and homeobox C13, cooperatively enhanced its expression. The transgenic mice and cyclin D1 cells experiment demonstrated their cooperative regulatory role in B-cell biology, suggesting potential implications for leukemia [ 38 ]. The findings from Wei et al.'s study on amniotic fluid stem cells (AFSCs) and this study on Zfp521 overexpression in U87MG glioma cells highlight intriguing parallels and potential implications for regenerative medicine. Wei et al. characterized AFSCs by identifying surface markers indicative of mesenchymal and pluripotent stem cells, demonstrating their neural differentiation potential, and identifying SOX9 as a key predictive marker for neurogenesis. Similarly, this study observed significant morphological changes and aggregate formation in response to Zfp521 overexpression in glioma cells, accompanied by alterations in gene expression favoring neurogenic features. Importantly, both studies suggest a potential role for specific molecular markers— SOX9 in AFSCs and Zfp521 in glioma cells—in promoting neural characteristics, with in vivo experiments indicating therapeutic benefits for neurological conditions like SCI. These parallel findings underscore the broader implications of stem cell biology and gene regulation in advancing regenerative therapies and highlight the need for further investigation into the functional roles and clinical applications of these markers in neurology and regenerative medicine [ 39 ]. Our study has some limitations. First, there is a lack of quantification for neural differentiation and proliferation in U87-Zfp521 cells. The primary cells utilized in this study were derived from the U87MG astrocytoma cell line, a well-established model system. Despite their utility, U87MG cells are known to harbor multiple genetic mutations, presenting inherent challenges in maintaining cellular health and viability during experimental procedures. Efforts to perform techniques such as immunocytochemistry and cell counting for data quantification were hindered by the difficulty of sustaining cell adherence and viability over prolonged culture periods. Despite repeated attempts, achieving robust statistical analysis through these traditional methods proved unattainable. Consequently, we opted for an RT-PCR-based strategy to analyze gene expression changes induced by Zfp521 overexpression, providing qualitative insights into cellular responses. While this approach allowed for qualitative interpretation of gene expression alterations, the lack of quantitative data remains a limitation of this study. Second, this study did not directly address the tumorigenicity of transplanted cells in the spinal cord, but the behavioral assessments suggest that U87-Zfp521 cells did not exhibit tumorigenic behavior in this context. Third, there is no verification of changes in stemness and reprogrammed fate induced by Zfp521, and there is the absence of evidence demonstrating the non-tumorigenicity of transplanted cells in vivo . While providing valuable insights, caution is advised in interpreting the findings, given these limitations. Future research could address these gaps for a more comprehensive understanding of Zfp521's role in GBM. In conclusion, our study revealed the varied roles of Zfp521 in GBM using the U87MG glioma cell line. Zfp521 overexpression induced morphological changes and aggregated formation in U87MG cells, accompanied by a shift in phenotype. Gene expression analysis showed a significant upregulation of neuronal markers, indicating Zfp521's potential to activate neuronal lineage genes even in the most aberrant astrocytoma cell line. Transplantation of U87-Zfp521 cells into SCI animals demonstrated a moderate improvement in locomotor function, suggesting Zfp521's potential for promoting recovery. Notably, our findings suggested that controlling the Zfp521 expression level in GBM could be a reliable approach for generating both neurons and oligodendrocytes. This study enhanced our understanding of Zfp521's diverse roles, emphasizing its potential as a marker for neural differentiation and its implications for tumorigenic and tumor-suppressive effects in various cancer contexts. The complexity of Zfp521's functions underscored the need for further exploration to harness its therapeutic potential in GBM treatment and neural regeneration strategies. Declarations Data Availability Statement All data generated or analyzed during this study is included in this published article. Acknowledgment and Funding This work was acknowledged and funded by Tehran University of Medical Sciences [grant number is 97-02-38-39408]. Author Contributions SM made substantial contributions to data acquisition such as cell culture, microscopy, RT-PCR, and data analysis, wrote the manuscript, and prepared the figures; YH established the SCI model, performed evaluations, and contributed to substantial parts of the data acquisition. SA contributed significantly to writing and editing the manuscript. ZG and JH were involved in revising the manuscript and providing critical feedback. VR, SG, and SK were innovators of the hypothesis, prepared grant sources, supervised the whole project, and are the corresponding authors. Competing Interests The authors declare no conflicts of interest. Ethical Approval The Ethics Committee of the Sina Trauma and Surgery Research Center, Tehran University of Medical Sciences, approved the study with the reference number IR.TUMS.VCR.REC.1398.321. References Kamiya D, Banno S, Sasai N, Ohgushi M, Inomata H, Watanabe K, et al. Intrinsic transition of embryonic stem-cell differentiation into neural progenitors. Nature. 2011;470(7335):503–9. Shen S, Pu J, Lang B, McCaig CD. A zinc finger protein Zfp521 directs neural differentiation and beyond. Stem Cell Res Ther. 2011;2(2):20. Zarei-Kheirabadi M, Hesaraki M, Shojaei A, Kiani S, Baharvand H. Generation of neural stem cells from adult astrocytes by using a single reprogramming factor. J Cell Physiol. 2019;234(10):18697–706. Shahbazi E, Moradi S, Nemati S, Satarian L, Basiri M, Gourabi H, et al. Conversion of Human Fibroblasts to Stably Self-Renewing Neural Stem Cells with a Single Zinc-Finger Transcription Factor. Stem Cell Reports. 2016;6(4):539–51. Scicchitano S, Giordano M, Lucchino V, Montalcini Y, Chiarella E, Aloisio A, et al. The stem cell-associated transcription co-factor, ZNF521, interacts with GLI1 and GLI2 and enhances the activity of the Sonic hedgehog pathway. Cell Death Dis. 2019;10(10):715. Spina R, Filocamo G, Iaccino E, Scicchitano S, Lupia M, Chiarella E, et al. Critical role of zinc finger protein 521 in the control of growth, clonogenicity and tumorigenic potential of medulloblastoma cells. Oncotarget. 2013;4(8):1280–92. Fang X, Huang Z, Zhou W, Wu Q, Sloan AE, Ouyang G, et al. The zinc finger transcription factor ZFX is required for maintaining the tumorigenic potential of glioblastoma stem cells. Stem Cells. 2014;32(8):2033–47. Russo R, Russo V, Cecere F, Valletta M, Gentile MT, Colucci-D'Amato L, et al. ZBTB2 protein is a new partner of the Nucleosome Remodeling and Deacetylase (NuRD) complex. Int J Biol Macromol. 2021;168:67–76. Schuster A, Klein E, Neirinckx V, Knudsen AM, Fabian C, Hau AC, et al. AN1-type zinc finger protein 3 (ZFAND3) is a transcriptional regulator that drives Glioblastoma invasion. Nat Commun. 2020;11(1):6366. Zhang L, Zhang W, Li Y, Alvarez A, Li Z, Wang Y, et al. SHP-2-upregulated ZEB1 is important for PDGFRalpha-driven glioma epithelial-mesenchymal transition and invasion in mice and humans. Oncogene. 2016;35(43):5641–52. Zhang C, Zhu Q, He H, Jiang L, Qiang Q, Hu L, et al. RIZ1: a potential tumor suppressor in glioma. BMC Cancer. 2015;15:990. Zhang J, Luo J, Jiang H, Xie T, Zheng J, Tian Y, et al. The Tumor Suppressor Role of Zinc Finger Protein 671 (ZNF671) in Multiple Tumors Based on Cancer Single-Cell Sequencing. Front Oncol. 2019;9:1214. Moinuddin FM, Alvi MA, Kerezoudis P, Wahood W, Meyer J, Lachance DH, et al. Variation in management of spinal gliobastoma multiforme: results from a national cancer registry. J Neurooncol. 2019;141(2):441–7. Pollard SM, Yoshikawa K, Clarke ID, Danovi D, Stricker S, Russell R, et al. Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. Cell Stem Cell. 2009;4(6):568–80. Kawamura Y, Takouda J, Yoshimoto K, Nakashima K. New aspects of glioblastoma multiforme revealed by similarities between neural and glioblastoma stem cells. Cell Biol Toxicol. 2018;34(6):425–40. Bakhshinyan D, Savage N, Salim SK, Venugopal C, Singh SK. The Strange Case of Jekyll and Hyde: Parallels Between Neural Stem Cells and Glioblastoma-Initiating Cells. Front Oncol. 2020;10:603738. Sandberg CJ, Altschuler G, Jeong J, Stromme KK, Stangeland B, Murrell W, et al. Comparison of glioma stem cells to neural stem cells from the adult human brain identifies dysregulated Wnt- signaling and a fingerprint associated with clinical outcome. Exp Cell Res. 2013;319(14):2230–43. Neftel C, Laffy J, Filbin MG, Hara T, Shore ME, Rahme GJ, et al. An Integrative Model of Cellular States, Plasticity, and Genetics for Glioblastoma. Cell. 2019;178(4):835–49 e21. Bodey B, Kaiser HE, Siegel SE. Epidermal growth factor receptor (EGFR) expression in childhood brain tumors. In Vivo. 2005;19(5):931–41. Ponten J, Macintyre EH. Long term culture of normal and neoplastic human glia. Acta Pathol Microbiol Scand. 1968;74(4):465–86. Galli R, Binda E, Orfanelli U, Cipelletti B, Gritti A, De Vitis S, et al. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res. 2004;64(19):7011–21. Clark MJ, Homer N, O'Connor BD, Chen Z, Eskin A, Lee H, et al. U87MG decoded: the genomic sequence of a cytogenetically aberrant human cancer cell line. PLoS Genet. 2010;6(1):e1000832. Liu H, Xia J, Wang T, Li W, Song Y, Tan G. Differentiation of human glioblastoma U87 cells into cholinergic neuron. Neurosci Lett. 2019;704:1–7. Zhang S, Shen J, Li D, Cheng Y. Strategies in the delivery of Cas9 ribonucleoprotein for CRISPR/Cas9 genome editing. Theranostics. 2021;11(2):614–48. Pruteanu LL, Kopanitsa L, Modos D, Kletnieks E, Samarova E, Bender A, et al. Transcriptomics predicts compound synergy in drug and natural product treated glioblastoma cells. PLoS One. 2020;15(9):e0239551. Zarei-Kheirabadi M, Hesaraki M, Kiani S, Baharvand H. In vivo conversion of rat astrocytes into neuronal cells through neural stem cells in injured spinal cord with a single zinc-finger transcription factor. Stem Cell Res Ther. 2019;10(1):380. Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020;18(7):e3000410. Liu X, Li C, Li J, Xie L, Hong Z, Zheng K, et al. EGF signaling promotes the lineage conversion of astrocytes into oligodendrocytes. Mol Med. 2022;28(1):50. Mokhtarzadeh Khanghahi A, Satarian L, Deng W, Baharvand H, Javan M. In vivo conversion of astrocytes into oligodendrocyte lineage cells with transcription factor Sox10; Promise for myelin repair in multiple sclerosis. PLoS One. 2018;13(9):e0203785. Alizadeh SD, Jalalifar MR, Ghodsi Z, Sadeghi-Naini M, Malekzadeh H, Rahimi G, et al. Reprogramming of astrocytes to neuronal-like cells in spinal cord injury: a systematic review. Spinal Cord. 2024;62(4):133–42. Zhang H, Wang R, Yu Y, Liu J, Luo T, Fan F. Glioblastoma Treatment Modalities besides Surgery. J Cancer. 2019;10(20):4793–806. Lee C, Robinson M, Willerth SM. Direct Reprogramming of Glioblastoma Cells into Neurons Using Small Molecules. ACS Chem Neurosci. 2018;9(12):3175–85. Broekman ML, Maas SLN, Abels ER, Mempel TR, Krichevsky AM, Breakefield XO. Multidimensional communication in the microenvirons of glioblastoma. Nat Rev Neurol. 2018;14(8):482–95. Okawa S, Gagrica S, Blin C, Ender C, Pollard SM, Krijgsveld J. Proteome and Secretome Characterization of Glioblastoma-Derived Neural Stem Cells. Stem Cells. 2017;35(4):967–80. Wang X, Pei Z, Hossain A, Bai Y, Chen G. Transcription factor-based gene therapy to treat glioblastoma through direct neuronal conversion. Cancer Biol Med. 2021;18(3):860–74. Cheng X, Tan Z, Huang X, Yuan Y, Qin S, Gu Y, et al. Inhibition of Glioma Development by ASCL1-Mediated Direct Neuronal Reprogramming. Cells. 2019;8(6). Yang N, Wang L, Chen T, Liu R, Liu Z, Zhang L. ZNF521 which is downregulated by miR-802 suppresses malignant progression of Hepatocellular Carcinoma through regulating Runx2 expression. J Cancer. 2020;11(19):5831–9. Yu M, Al-Dallal S, Al-Haj L, Panjwani S, McCartney AS, Edwards SM, et al. Transcriptional regulation of the proto-oncogene Zfp521 by SPI1 (PU.1) and HOXC13. Genesis. 2016;54(10):519–33. Wei PC, Chao A, Peng HH, Chao AS, Chang YL, Chang SD, et al. SOX9 as a Predictor for Neurogenesis Potentiality of Amniotic Fluid Stem Cells. Stem Cells Transl Med. 2014;3(10):1138–47. Additional Declarations There is no duality of interest Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4505201","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":313013417,"identity":"d2d37151-a795-4248-bc68-b865c9dfa09e","order_by":0,"name":"Vafa Rahimi-Movaghar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIie2Rrw7CMBCHb2lSTMnsmvHnFY40ISwIXoU9AUgUmRpmySwvgZ0umUDOLpkBg0KQYJYwwVoMpgOJ6Keuze/LXXsAFsufQgCBueBEn5fed4VHWsFfFZWVusau4BuU/ctjvc4Gosjjcw1NeEilc69htjIrPeHvsWLTMtxNEsAwK5eEJ+AFkUHhEQWfacWJPaYVAL99i3HEViFPpYj0GPNGKYUkzy7FBUp1F4Qw9nUXuaSdXZQyV4pXtsoAhcjaIkjQrFCgpGJNtXDT05XfNqNhVuR5WW+25u8enz9POqd2+sN+LBaLxWLmBbhISBJdQTS/AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-7347-8767","institution":"Tehran University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Vafa","middleName":"","lastName":"Rahimi-Movaghar","suffix":""},{"id":313013418,"identity":"45b539d6-e607-423f-8a6d-b78af14f615d","order_by":1,"name":"Sara Mirsadeghi","email":"","orcid":"https://orcid.org/0000-0001-7086-075X","institution":"Department of Brain and Cognitive Sciences, Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran","correspondingAuthor":false,"prefix":"","firstName":"Sara","middleName":"","lastName":"Mirsadeghi","suffix":""},{"id":313013419,"identity":"960aab3f-1592-4be6-874e-d609067df5ad","order_by":2,"name":"Yasaman Heidary","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yasaman","middleName":"","lastName":"Heidary","suffix":""},{"id":313013420,"identity":"fa93077f-beb2-4c9d-aad3-d20c6d7a5d0d","order_by":3,"name":"Seyed Danial Alizadeh","email":"","orcid":"https://orcid.org/0000-0001-5461-6511","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Danial","lastName":"Alizadeh","suffix":""},{"id":313013421,"identity":"c87a55a9-c522-496c-8e42-32417ab513fa","order_by":4,"name":"Zahra Ghodsi","email":"","orcid":"https://orcid.org/0000-0001-8662-2342","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Ghodsi","suffix":""},{"id":313013422,"identity":"b3486020-7266-483d-8032-8def5b9164ed","order_by":5,"name":"James Harrop","email":"","orcid":"https://orcid.org/0000-0002-0943-3406","institution":"Thomas Jefferson University","correspondingAuthor":false,"prefix":"","firstName":"James","middleName":"","lastName":"Harrop","suffix":""},{"id":313013423,"identity":"bd45480e-e0db-4a21-b8b9-7f31519090ae","order_by":6,"name":"Seyed Mohammad Ghodsi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Mohammad","lastName":"Ghodsi","suffix":""},{"id":313013424,"identity":"6109dca6-1636-4350-b589-ce9d79e03c5d","order_by":7,"name":"Sahar Kiani","email":"","orcid":"","institution":"ROYAN Institute","correspondingAuthor":false,"prefix":"","firstName":"Sahar","middleName":"","lastName":"Kiani","suffix":""}],"badges":[],"createdAt":"2024-05-30 21:50:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4505201/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4505201/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59085601,"identity":"bbd99e20-4788-4354-ae95-b8adc81810f8","added_by":"auto","created_at":"2024-06-26 07:53:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1006106,"visible":true,"origin":"","legend":"\u003cp\u003eThe morphological changes and gene expression pattern of U87-Zfp521. A, B1-2, and C) Both transfected U87-GM cell populations were found to be GFP+ from the third DPI, although the transfection rate measured was greater in U87-GFP. D1-3) U87-Zfp521 morphologies were changed from bipolar, extended, and proliferative to smaller and aggregate-forming during a five-week induction. E1-3) U87-GFP (mock) maintained bipolarity, dispersion, and proliferation throughout the whole experiment. F) GFP expression was significantly larger in U87-GFP and maintained detectability throughout the whole study in both groups. No significant changes were observed in the expression levels of \u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eItga6\u003c/em\u003e, and \u003cem\u003enestin\u003c/em\u003ebetween U87-Zfp521 and U87-GFP. On the other hand, \u003cem\u003ePax6\u003c/em\u003e (p \u0026lt; 0·001), \u003cem\u003eTubb3\u003c/em\u003e(p \u0026lt; 0·01), and \u003cem\u003eOlig2\u003c/em\u003e (p \u0026lt; 0·001) revealed a substantial increase in U87-Zfp521. \u003cem\u003eSox1\u003c/em\u003e expression decreased in U87-Zfp521 (p \u0026lt; 0·01). The data is presented as mean ± standard error and analyzed via a student sample t-test.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4505201/v1/7446b48d677e0df08565ad2f.png"},{"id":59085603,"identity":"8701d4be-24b0-4201-b93f-bee778e9e20f","added_by":"auto","created_at":"2024-06-26 07:53:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":427452,"visible":true,"origin":"","legend":"\u003cp\u003eThe open-field and footprint assessments. A) The U87-Zfp521 animals showed a significant improvement in coordinate movement, weight support, and hind-limb mobility by reaching almost 12 scales, compared with control (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·001) and U87-GFP (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·01). Although U87-GFP revealed notable ameliorated mobility, they still show less improvement in comparison to U87-Zfp521. B and C) The step length was significantly increased in both the left (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·001) and right (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·01) rear at 5 WPT compared with the control. Stride angle was improved in the right feet during the third and fourth WPTs (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·05). Step width displays remarkable elevation in the left feet at the third (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·001) and fourth (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·01) WPT, as well as the right feet at the third WPT (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·01). Toe spread was substantially larger in the right hind limb in the five WPT (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0·01). The data were analyzed using two-way ANOVA and Tukey’s post-hoc test.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4505201/v1/f021e22d1e46b5551f107b1c.png"},{"id":59476941,"identity":"37d773f3-ccfa-4fe6-9451-7473b087a8a4","added_by":"auto","created_at":"2024-07-02 09:08:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2141929,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4505201/v1/89265e1c-0b22-4e5b-ab52-d603479cca5d.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"Zfp521 prolonged expression partially relaunches the generic neuronal genes in U87MG glioblastoma cells: a primitive study","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAmong numerous operators regulating neural differentiation, zinc finger protein 521 (Zfp521) is appraised to be associated with neural differentiation by encouraging embryonic epidermal cells toward neural progenitor cells [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], along with modulating adult astrocytic genetic core to neural stem cells (NSCs) derivations [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Moreover, Zfp521 revealed the capability to convert adult human fibroblast cells into NSCs when fostering in a permissive habitat [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Indeed, Zfp521 mainly enhances sonic hedgehog signaling molecule (SHH) pathway activity, which leads to the development of both normal cerebellum and medulloblastoma [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Zfp521 may play alternative roles in brain tumors as well, e.g., it contributes to medulloblastoma proliferation and progressiveness [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Of course, Zfps, in general, mostly appear to play enormously contradictory or versatile roles during cancer progression [\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] or even in its suppression [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, Zfp521\u0026rsquo;s role in modifying or driving the genomic consequences of glioblastoma multiforme (GBM) remained undiscovered.\u003c/p\u003e \u003cp\u003eGBM, also termed grade 4 astrocytoma, has been identified as the most common and severe form of brain and spinal cord tumors [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. GBM is comprised of an NSC-like subpopulation with the ability to self-renewal and differentiate into neurons, astrocytes, and oligodendrocytes, which can also be expanded \u003cem\u003ein vitro\u003c/em\u003e as stable cell lines, allowing for more extensive characterizations [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. GBM cell lines overall bear similarities [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], yet with irregularities [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], to NSCs, i.e., parallel cellular pathways may result in divergent outcomes in NSC and GBM cell lines attitudes. For instance, although epidermal and fibroblast growth factors promote adequate length of stemness and proliferation in NSCs, they underlie an extraordinary proliferation rate in GBM [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] as well as medulloblastoma [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eU87MG is a well-established glioma cell line that has been employed in a myriad of studies over the past four decades [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. A wide range of biological information is known about this cell line, e.g., the U87MG cell line contains tumorigenic neural precursors [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], owns a highly aberrant gene structure [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and nevertheless is capable of differentiation into cholinergic neurons [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, U87MG, as a reliable cell model, has been employed for the evaluation of genome editing technologies in GBM for further \u003cem\u003ein vivo\u003c/em\u003e manipulation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Accordingly, the U87MG cell line is an authentic, available platform for \u003cem\u003ein vitro\u003c/em\u003e identifications such as drug discoveries [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] or signaling pathway investigations [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTherefore, on account of Zfp521\u0026rsquo;s reputation for mastering the NSCs-dedicated genetic core in adult astrocytes in addition to embryonic epidermal cells and also due to its consequence in medulloblastoma progression, we aim to investigate its prolonged and excessive effect on the U87MG gene expression pattern. To achieve this goal, the \u003cem\u003ein vitro\u003c/em\u003e expression pattern of selective genes, namely: glial fibrillary acidic protein (\u003cem\u003eGfap\u003c/em\u003e), integrin subunit alpha 6 (\u003cem\u003eItga6\u003c/em\u003e), paired box 6 (\u003cem\u003ePax6\u003c/em\u003e), \u003cem\u003enestin\u003c/em\u003e, SRY-box transcription factor 1 (\u003cem\u003eSox1\u003c/em\u003e), tubulin beta 3 class III (\u003cem\u003eTubb3\u003c/em\u003e), and oligodendrocyte transcription factor 2 (\u003cem\u003eOlig2\u003c/em\u003e), was addressed via real-time polymerase chain reaction (RT-PCR) in U87-Zfp521 cells. Additionally, we transplanted U87-Zfp521 cells to the spinal cord injury (SCI) in order to determine the \u003cem\u003ein vivo\u003c/em\u003e influence of these cells on animal movement following the \u003cem\u003ein vitro\u003c/em\u003e manipulation.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell maintenance and transduction\u003c/h2\u003e \u003cp\u003eAstrocytoma grade 4 cell line (U87MG), obtained from the Iranian Biological Resource Center, was expanded and passaged five times in Dulbecco's modified eagle medium/nutrient mixture F-12 (DMEM/F12) supplemented with 10% fetal bovine serum, 1% non-essential amino acids, 2 mM L-glutamine, 100 U/ml penicillin, and 100 \u0026micro;g/ml streptomycin (1%) (all from Invitrogen, CA, USA). P3\u0026ndash;P5 astrocytoma was transduced via \u003cem\u003eZfp521-IRES-GFP\u003c/em\u003e constructs in the experimental group and CMV-GFP constructs in the mock group, as described in our previous reports [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Transduced cells (U87-Zfp521 and U87-GFP) were cultivated on 0\u0026middot;001% poly-L-ornithine (P4707; Sigma-Aldrich, MO, USA) and 10 mg/ml laminin (L2020; Sigma-Aldrich, MO, USA) beds and were maintained in NSC medium (NSCM) containing DMEM/F12 supplemented with 2% B27, 1% N2, 0\u0026middot;5% ITS (1 mg/ml insulin, 0\u0026middot;55 mg/ml transferrin, and 0\u0026middot;67 mg/ml selenium), 10% knockout serum replacement, 1% non-essential amino acids, 2 mM L-glutamine, 1% penicillin 100 U/ml and streptomycin 100 \u0026micro;g/ml (all from Invitrogen, CA, USA), 20 ng/ml basic fibroblast growth factors (F0291; Sigma-Aldrich, MO, USA) and 20 ng/ml epidermal growth factors (E9644; Sigma-Aldrich, MO, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRT-PCR\u003c/h2\u003e \u003cp\u003eTotal mRNA from U87-Zfp521 and Mock were extracted five weeks after induction by NSCM using a RNeasy\u0026reg; Plus Universal Mini Kit (73404; QIAGEN LLC, MD, USA), followed by 2 \u0026micro;g complementary DNA synthesis using an Easy\u0026trade; complementary DNA Synthesis Kit with random hexamer primer (A101161; Parstous Biotechnology, Iran) according to the manufacturer\u0026rsquo;s instructions. RT-PCR was performed by a SYBR\u0026reg; Green Master Mix (DQ385; BioFact\u0026trade;, South Korea) via StepOne\u0026trade; (Applied Biosystems\u0026trade;, Thermo Fisher Scientific, MA, USA) for selective genes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). mRNA levels were normalized to glyceraldehyde-3-phosphate dehydrogenase as an internal control using the 2\u003csup\u003e\u0026ndash;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer names and sequences that used for real-time polymerase chain reaction.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5'\u0026ndash;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5'\u0026ndash;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGTCTCTCTCTTCCTCTTGTGCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGGTGGTCTCCTCTGACTTCAACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGfap\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGATGCGGGATGGAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGGGACAGAGGAGGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eItga6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTATCGGTCTCGGGAGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCACTGAATGTTCAAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePax6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCAGCACCAGTGTCTACCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGACTGTTCATGTGTGTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSox1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTCCGTCCATCCTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAGCATCAAACAACCTCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enestin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCAGAAACTCAAGCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTGATTCTCCTCTTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTubb3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGAACACGGATGAGACCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGGTGGAGGACATCTTGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOlig2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGAGCCCGATGACCTTTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACTGCCTCCTAGCTTGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eGapdh: glyceraldehyde-3-phosphate dehydrogenase, Gfap: glial fibrillary acidic protein, Itga6: integrin alpha 6, Olig2: oligodendrocyte transcription factor 2, Pax6: paired box 6, Sox1: sex determining region Y-box 1, Tubb3: tubulin, beta 3 class III.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSCI modeling and cell transplantation\u003c/h2\u003e \u003cp\u003eAdult male wild-type Wistar rats weighing 250\u0026ndash;280 g were used in this study according to Royan Institute ethical guidelines as well as animal research: reporting of \u003cem\u003ein vivo\u003c/em\u003e experiments (ARRIVE) guidelines [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Animals were anesthetized through intraperitoneal injections of 100 mg/kg ketamine and 10 mg/kg xylazine. The contusion model of SCI was established by dropping a 10 g rod weight vertically to the spinal cord from a height of 25 mm using an NYU-impactor device. Following the SCI, each animal received 5 mg/kg of Enrofloxacin intramuscularly once a day for a week. Daily bladder discharge was performed manually as long as the animal required it. One week posterior to SCI, at the sub-acute phase of injury, almost 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells diluted in 30 \u0026micro;L PBS\u003csup\u003e\u0026ndash;\u003c/sup\u003e were transplanted into the injury site via an automated micro-injector device (Stoelting Co., IL, USA). In order to address the \u003cem\u003ein vitro\u003c/em\u003e induction impact on the Zfp521 function, animals were grouped as 5\u0026ndash;10 animals in each group as follows: U87-Zfp521 and Mock. In U87-Zfp521, transduced cells were maintained in an induction medium for five weeks. For immune response suppression subsequent to cell transplantation, subcutaneous injections of 10 mg/kg Cyclosporine-A were administered to animals in all groups two days before transplantation (day 5) throughout the whole study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eLocomotor capacity evaluation\u003c/h2\u003e \u003cp\u003eTo assess the weekly motor function improvement in animals, we employed the well-established Basso-Beattie-Bresnahan (BBB) locomotor rating scale system on freely moving animals throughout four weeks that includes 0\u0026ndash;21 points. The method comprehensively assesses rat motor function by measuring hindlimb joint movement, coordination between front and rear limbs, trunk position, load-bearing capacity, paw placement, and tail movement. The BBB score of all animals was determined to be 21 prior to the SCI. After weight-drop contusion, all animals BBB became zero from the first day after surgery to at least seven days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eFootprint analysis\u003c/h2\u003e \u003cp\u003eGait and motor coordination were weekly evaluated in all animals as well. The rats were allowed to walk on a narrow paper-covered corridor while their metatarsus was colored to leave footprint traces. At least 4\u0026ndash;5 sequential steps were used to determine the mean values for each measurement, including stride angle, stride length, foot length, step width, toe spread, and paw area.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistics analysis\u003c/h2\u003e \u003cp\u003eTotal numerical data belonging to \u003cem\u003ein vitro\u003c/em\u003e investigations are reported as the mean (\u0026plusmn;\u0026thinsp;standard error) of three independent experiments. An independent sample t-test was used to compare the gene expression pattern between U87-Zfp521 and mock cells. ANOVA and Tukey\u0026rsquo;s post hoc test were considered for comparisons as within means for behavioral assessments. The \u003cem\u003ep\u003c/em\u003e-value of \u0026lt;\u0026thinsp;0\u0026middot;05 was reflected as statistically significant. All data were analyzed by SPSS version 16 (SPSS Inc., IL, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eExcessive expression of Zfp521 propels aggregate formation in U87MG\u003c/h2\u003e \u003cp\u003eTwo populations of U87MG, owning a flat and bipolar phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. D1 and E1), were transfected with \u003cem\u003eZfp521-IRES-GFP\u003c/em\u003e (U87-Zfp521) as well as CMV-GFP (U87-GFP) while maintaining in NSCM for five weeks. U87-ZFP21 cells underwent an immediate morphological conversion and became smaller and confined after three days post-transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. D2). U87-Zfp521 became susceptible to gathering around and initiating the formation of aggregates during the first week post-transduction (WPT); besides, they also hesitated to proliferate (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. D3). They actually settled inside the aggregates throughout the experiment timeline (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. B2). In comparison with U87-Zfp521, U87-GFP cells retained bipolar and proliferative activity over the whole process with preserved dispersion (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A, E2, and E3). The transfection rate yielded 26% in U87-Zfp521, which is almost half of what we measured in U87-GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eProlonged overexpression of Zfp521 upregulated hindlimb neuronal marker expression in U87MG\u003c/h2\u003e \u003cp\u003eThe gene expression pattern of U87-Zfp521 cells was compared with U87-GFP five WPT using an independent sample t-test (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. F). According to GFP measurement, the vector was consistently functional in both cell populations\u0026mdash;i.e., the ZPF521 was excessively expressed in U87-MG throughout the whole experiment\u0026mdash;while, of course, the transfection rate was significantly larger in U87-GFP (as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A, B, and C) from the beginning (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;001). \u003cem\u003eGfap\u0026mdash;\u003c/em\u003ea NSC marker that is usually overexpressed in GBM cells; \u003cem\u003eItga6\u003c/em\u003e\u0026mdash;a receptor for ECM laminin that is under-regulated in GBM cells; and \u003cem\u003enestin\u003c/em\u003e\u0026mdash;a marker for proliferative neural progenitor and GBM cells\u0026mdash;revealed non-significant changes (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0\u0026middot;05) during five WPT in NSCM. However, \u003cem\u003eSox1\u003c/em\u003e\u0026mdash;the earliest transcription factor of neurogenesis in proliferative NSCs\u0026mdash;showed a considerable down-regulation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01). On the other hand, we found a substantial increase in \u003cem\u003ePax6\u0026mdash;\u003c/em\u003ethe earliest neuronal marker\u0026mdash;(\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;001), \u003cem\u003eTubb3\u003c/em\u003e\u0026mdash;a neuronal marker\u0026mdash;(\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01), and \u003cem\u003eOlig2\u003c/em\u003e\u0026mdash;the earliest motor neuron and oligodendrocyte marker\u0026mdash;(\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;001) expression in U87-Zfp521 cells compared with U87-GFP.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eZfp521-U87MG cells allow slight behavioral improvement in SCI animals\u003c/h2\u003e \u003cp\u003eThe locomotor ability of animals was evaluated in five WPTs via the BBB test through a two-way ANOVA. Total animals displayed gradual improvements in hind-limb motor coordination and joint movements; however, U87-Zfp521 animals revealed substantial recovery with a score of 12 compared with mock (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;001) and control (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A). Weight support was significantly ameliorated in these animals, while plantar application was not considerably restored (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. B and C). According to the BBB score, the animals\u0026rsquo; motor ability was elevated by almost half of what intact animals show. Besides BBB grading, gating capabilities were monitored for a more detailed view of their movement. Consistent with BBB results, remarkable enhancement was observed in both the right and left feet of U87-Zfp521 animals\u0026rsquo; gaiting during a five-week period. Animals' step length was significantly increased in U87-Zfp521 at the fifth (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01) WPT. The stride angle in right feet was measured higher at weeks three and four (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01). The step width was substantially greater at week three in both right (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01) and left rears (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;001), while a significant increase was observed at 4 WPT in only left feet (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01). The toe spread, only in the right feet, was remarkably elevated during the fifth WPT in U87-Zfp521 animals, in comparison with the mock (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0\u0026middot;01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe \u003cem\u003ein vivo\u003c/em\u003e conversion or trans-differentiation of resident astrocytes, developed by SCI and multiple sclerosis, offers a promising strategy to overcome the prolonged devastating consequences of glial scars. Numerous studies reported prosperous \u003cem\u003ein vivo\u003c/em\u003e conversion of unfavorable astrocytes into oligodendrocytes [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] in addition to neural cells [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], using chemicals or master-regulating transcription factors such as \u003cem\u003eSox10\u003c/em\u003e for oligodendrogenesis and Zfp521 for NSC generation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Cell identity manipulation is an encouraging method to be considered for astrocytoma and GBM treatment, besides the common surgical or chemotherapy approach [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In this study, we also took advantage of the Zfp521 power in neurogenesis to determine if it is exclusively capable of modulating the gene expression pattern in U87-GM, a popular GBM-derived cell line [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe excessive expression of Zfp521 caused morphological changes in the astrocytoma population from bipolar and proliferative to smaller and aggregate-forming during 5 WPT in NSCM. The expression patterns of \u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eItga6\u003c/em\u003e, and \u003cem\u003enestin\u003c/em\u003e remained unchanged, whereas \u003cem\u003eSox1\u003c/em\u003e expression was significantly decreased, which is consistent with the observed proliferation decline in U87-Zfp521 during \u003cem\u003ein vitro\u003c/em\u003e cultivation. However, the unchanged level of expression in \u003cem\u003eGfap\u003c/em\u003e and \u003cem\u003eItga6\u003c/em\u003e can imply that an unstable state is still present in these cells. The remarkable up-regulation of \u003cem\u003ePax6\u003c/em\u003e, \u003cem\u003eTubb3\u003c/em\u003e, and \u003cem\u003eOlig2\u003c/em\u003e in U87-Zfp521, compared with U87-GFP, reflected the Zfp521 potential in activating the neuronal lineage genes, even in the most aberrant astrocytoma cell line. Moreover, \u003cem\u003eOlig2\u003c/em\u003e elevation suggests that Zfp521 is able to facilitate both oligodendrocyte and motoneuron generation in U87-GM. The U87-GM was determined to be capable of neuron generation via direct reprogramming using small molecules [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] or chemicals [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] in previous studies as well. Therefore, we propose that the combination of Zfp521 with chemicals may exclusively lead the U87-GM to neurons. Our findings revealed that prolonged expression of Zfp521 in a GBM cell line simultaneously ceases the cell's proliferation and propels the neuronal genes to express while cultivating in NSCM. Indeed, it seems that Zfp521 alone is not capable of creating expandable NSCs from astrocytoma. The mentioned conclusion actually advocates that tuning the Zfp521 expression can be a reliable method for \u003cem\u003ein vivo\u003c/em\u003e conversion of astrocytoma directly into neurons, bypassing the NSC proliferative stage.\u003c/p\u003e \u003cp\u003eIn order to address the Zfp521, along with the NSCM, consequences on U87-GM \u003cem\u003ein vivo\u003c/em\u003e function, we transplanted U87-Zfp521 cells to SCI animals after 5 WPT. In fact, we aimed to uncover if U87, as a GBM cell line, still owns its ameliorative secretome and impacts the CNS. The controversial impression of the GBM secretome has been long investigated as multimodal, comprising neuroprotective [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and tumorigenic effects [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], leading us to raise the mentioned question. The BBB scores and gaiting evaluations uncover the moderate ameliorative effect of U87-Zfp521 in comparison with U87-GFP. Although Zfp521 overexpression in glial scars \u003cem\u003ein vivo\u003c/em\u003e was determined to be more impactful in SCI improvement in our previous report [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], our findings here also insinuate that U87-Zfp521 constructed notable enhancements in animal movement. We indeed employed the SCI model here as well to compare the Zfp521 consequences on U87, the most severely mutated cell line, and on glial scar astrocytes.\u003c/p\u003e \u003cp\u003eOverall, direct reprogramming of the glioblastoma cells is a growing trend that can pave the way for us to create the most deleterious situation. Transcription factor-based gene therapy for GBM has nominated neurogenic differentiation 1 and neurogenin 2 as efficient for glutamatergic neuron production, while achaete-scute family bHLH transcription factor 1 promotes GABAergic fate in GBM [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. These strategies can first inhibit glioblastoma progression and then modify their cell components from unfavorable astrocytes to valuable and dedicated neurons [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Herein, we briefly report the Zfp521 transcription factor prolong effect on the U78-GM gene expression pattern. Accordingly, Zfp521, as a neural lineage initiator, allows early neuronal and oligodendrocyte markers to be enriched in the most aberrant astrocytoma cell line, continuing to have an acceptable impact on SCI recovery.\u003c/p\u003e \u003cp\u003eThe tumorigenicity of ZNF521 or Zfp521 has been explored in various cancers, revealing diverse roles in different contexts. In medulloblastoma, a complex regulatory network is revealed by the SHH pathway, where ZNF521 cooperatively interacts with GLI family zinc finger 1 and 2 proteins, stimulating SHH target genes. This interaction, particularly with the nucleosome remodeling and deacetylase complex, contributes to the tumorigenic effects of ZNF521 in medulloblastoma [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Another study extended these findings to various medulloblastoma subgroups, demonstrating ZNF521's role in promoting cell growth, clonogenicity, and migration, especially in the SHH subgroup and Group 4 medulloblastomas [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eContrastingly, in hepatocellular carcinoma (HCC), ZNF521 was identified as a tumor suppressor. Low expression of ZNF521 is correlated with larger tumor size, advanced stage, and poor prognosis in people with HCC. Functional assays revealed that ZNF521 inhibited cell proliferation and colony formation and promoted apoptosis in HCC cells, both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. These effects were linked to the antagonism of RUNX family transcription factor 2 transcriptional activity and the regulation of AKT phosphorylation [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn B-cell biology and leukemia, ZNF521 or Zfp521's evolutionary, regulatory, and functional aspects were explored. Originating from a gene duplication event, ZNF521 or Zfp521's transcriptional regulators, Spi-1 proto-oncogene and homeobox C13, cooperatively enhanced its expression. The transgenic mice and cyclin D1 cells experiment demonstrated their cooperative regulatory role in B-cell biology, suggesting potential implications for leukemia [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe findings from Wei et al.'s study on amniotic fluid stem cells (AFSCs) and this study on Zfp521 overexpression in U87MG glioma cells highlight intriguing parallels and potential implications for regenerative medicine. Wei et al. characterized AFSCs by identifying surface markers indicative of mesenchymal and pluripotent stem cells, demonstrating their neural differentiation potential, and identifying \u003cem\u003eSOX9\u003c/em\u003e as a key predictive marker for neurogenesis. Similarly, this study observed significant morphological changes and aggregate formation in response to Zfp521 overexpression in glioma cells, accompanied by alterations in gene expression favoring neurogenic features. Importantly, both studies suggest a potential role for specific molecular markers\u0026mdash;\u003cem\u003eSOX9\u003c/em\u003e in AFSCs and Zfp521 in glioma cells\u0026mdash;in promoting neural characteristics, with \u003cem\u003ein vivo\u003c/em\u003e experiments indicating therapeutic benefits for neurological conditions like SCI. These parallel findings underscore the broader implications of stem cell biology and gene regulation in advancing regenerative therapies and highlight the need for further investigation into the functional roles and clinical applications of these markers in neurology and regenerative medicine [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur study has some limitations. First, there is a lack of quantification for neural differentiation and proliferation in U87-Zfp521 cells. The primary cells utilized in this study were derived from the U87MG astrocytoma cell line, a well-established model system. Despite their utility, U87MG cells are known to harbor multiple genetic mutations, presenting inherent challenges in maintaining cellular health and viability during experimental procedures. Efforts to perform techniques such as immunocytochemistry and cell counting for data quantification were hindered by the difficulty of sustaining cell adherence and viability over prolonged culture periods. Despite repeated attempts, achieving robust statistical analysis through these traditional methods proved unattainable. Consequently, we opted for an RT-PCR-based strategy to analyze gene expression changes induced by Zfp521 overexpression, providing qualitative insights into cellular responses. While this approach allowed for qualitative interpretation of gene expression alterations, the lack of quantitative data remains a limitation of this study. Second, this study did not directly address the tumorigenicity of transplanted cells in the spinal cord, but the behavioral assessments suggest that U87-Zfp521 cells did not exhibit tumorigenic behavior in this context. Third, there is no verification of changes in stemness and reprogrammed fate induced by Zfp521, and there is the absence of evidence demonstrating the non-tumorigenicity of transplanted cells \u003cem\u003ein vivo\u003c/em\u003e. While providing valuable insights, caution is advised in interpreting the findings, given these limitations. Future research could address these gaps for a more comprehensive understanding of Zfp521's role in GBM.\u003c/p\u003e \u003cp\u003eIn conclusion, our study revealed the varied roles of Zfp521 in GBM using the U87MG glioma cell line. Zfp521 overexpression induced morphological changes and aggregated formation in U87MG cells, accompanied by a shift in phenotype. Gene expression analysis showed a significant upregulation of neuronal markers, indicating Zfp521's potential to activate neuronal lineage genes even in the most aberrant astrocytoma cell line. Transplantation of U87-Zfp521 cells into SCI animals demonstrated a moderate improvement in locomotor function, suggesting Zfp521's potential for promoting recovery. Notably, our findings suggested that controlling the Zfp521 expression level in GBM could be a reliable approach for generating both neurons and oligodendrocytes. This study enhanced our understanding of Zfp521's diverse roles, emphasizing its potential as a marker for neural differentiation and its implications for tumorigenic and tumor-suppressive effects in various cancer contexts. The complexity of Zfp521's functions underscored the need for further exploration to harness its therapeutic potential in GBM treatment and neural regeneration strategies.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study is included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment and Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was acknowledged and funded by\u0026nbsp;Tehran University of Medical Sciences [grant number is 97-02-38-39408].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSM made substantial contributions to data acquisition such as cell culture, microscopy, RT-PCR, and data analysis, wrote the manuscript, and prepared the figures; YH established the SCI model, performed evaluations, and contributed to substantial parts of the data acquisition. SA contributed significantly to writing and editing the manuscript. ZG and JH were involved in revising the manuscript and providing critical feedback. VR, SG, and SK were innovators of the hypothesis, prepared grant sources, supervised the whole project, and are the corresponding authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of the Sina Trauma and Surgery Research Center, Tehran University of Medical Sciences, approved the study with the reference number IR.TUMS.VCR.REC.1398.321.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKamiya D, Banno S, Sasai N, Ohgushi M, Inomata H, Watanabe K, et al. Intrinsic transition of embryonic stem-cell differentiation into neural progenitors. Nature. 2011;470(7335):503\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen S, Pu J, Lang B, McCaig CD. A zinc finger protein Zfp521 directs neural differentiation and beyond. Stem Cell Res Ther. 2011;2(2):20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZarei-Kheirabadi M, Hesaraki M, Shojaei A, Kiani S, Baharvand H. Generation of neural stem cells from adult astrocytes by using a single reprogramming factor. J Cell Physiol. 2019;234(10):18697\u0026ndash;706.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahbazi E, Moradi S, Nemati S, Satarian L, Basiri M, Gourabi H, et al. Conversion of Human Fibroblasts to Stably Self-Renewing Neural Stem Cells with a Single Zinc-Finger Transcription Factor. Stem Cell Reports. 2016;6(4):539\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScicchitano S, Giordano M, Lucchino V, Montalcini Y, Chiarella E, Aloisio A, et al. The stem cell-associated transcription co-factor, ZNF521, interacts with GLI1 and GLI2 and enhances the activity of the Sonic hedgehog pathway. Cell Death Dis. 2019;10(10):715.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpina R, Filocamo G, Iaccino E, Scicchitano S, Lupia M, Chiarella E, et al. Critical role of zinc finger protein 521 in the control of growth, clonogenicity and tumorigenic potential of medulloblastoma cells. Oncotarget. 2013;4(8):1280\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang X, Huang Z, Zhou W, Wu Q, Sloan AE, Ouyang G, et al. The zinc finger transcription factor ZFX is required for maintaining the tumorigenic potential of glioblastoma stem cells. Stem Cells. 2014;32(8):2033\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRusso R, Russo V, Cecere F, Valletta M, Gentile MT, Colucci-D'Amato L, et al. ZBTB2 protein is a new partner of the Nucleosome Remodeling and Deacetylase (NuRD) complex. Int J Biol Macromol. 2021;168:67\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchuster A, Klein E, Neirinckx V, Knudsen AM, Fabian C, Hau AC, et al. AN1-type zinc finger protein 3 (ZFAND3) is a transcriptional regulator that drives Glioblastoma invasion. Nat Commun. 2020;11(1):6366.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Zhang W, Li Y, Alvarez A, Li Z, Wang Y, et al. SHP-2-upregulated ZEB1 is important for PDGFRalpha-driven glioma epithelial-mesenchymal transition and invasion in mice and humans. Oncogene. 2016;35(43):5641\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang C, Zhu Q, He H, Jiang L, Qiang Q, Hu L, et al. RIZ1: a potential tumor suppressor in glioma. BMC Cancer. 2015;15:990.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Luo J, Jiang H, Xie T, Zheng J, Tian Y, et al. The Tumor Suppressor Role of Zinc Finger Protein 671 (ZNF671) in Multiple Tumors Based on Cancer Single-Cell Sequencing. Front Oncol. 2019;9:1214.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoinuddin FM, Alvi MA, Kerezoudis P, Wahood W, Meyer J, Lachance DH, et al. Variation in management of spinal gliobastoma multiforme: results from a national cancer registry. J Neurooncol. 2019;141(2):441\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePollard SM, Yoshikawa K, Clarke ID, Danovi D, Stricker S, Russell R, et al. Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. Cell Stem Cell. 2009;4(6):568\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawamura Y, Takouda J, Yoshimoto K, Nakashima K. New aspects of glioblastoma multiforme revealed by similarities between neural and glioblastoma stem cells. Cell Biol Toxicol. 2018;34(6):425\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakhshinyan D, Savage N, Salim SK, Venugopal C, Singh SK. The Strange Case of Jekyll and Hyde: Parallels Between Neural Stem Cells and Glioblastoma-Initiating Cells. Front Oncol. 2020;10:603738.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandberg CJ, Altschuler G, Jeong J, Stromme KK, Stangeland B, Murrell W, et al. Comparison of glioma stem cells to neural stem cells from the adult human brain identifies dysregulated Wnt- signaling and a fingerprint associated with clinical outcome. Exp Cell Res. 2013;319(14):2230\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeftel C, Laffy J, Filbin MG, Hara T, Shore ME, Rahme GJ, et al. An Integrative Model of Cellular States, Plasticity, and Genetics for Glioblastoma. Cell. 2019;178(4):835\u0026ndash;49 e21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBodey B, Kaiser HE, Siegel SE. Epidermal growth factor receptor (EGFR) expression in childhood brain tumors. In Vivo. 2005;19(5):931\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePonten J, Macintyre EH. Long term culture of normal and neoplastic human glia. Acta Pathol Microbiol Scand. 1968;74(4):465\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalli R, Binda E, Orfanelli U, Cipelletti B, Gritti A, De Vitis S, et al. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res. 2004;64(19):7011\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClark MJ, Homer N, O'Connor BD, Chen Z, Eskin A, Lee H, et al. U87MG decoded: the genomic sequence of a cytogenetically aberrant human cancer cell line. PLoS Genet. 2010;6(1):e1000832.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Xia J, Wang T, Li W, Song Y, Tan G. Differentiation of human glioblastoma U87 cells into cholinergic neuron. Neurosci Lett. 2019;704:1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Shen J, Li D, Cheng Y. Strategies in the delivery of Cas9 ribonucleoprotein for CRISPR/Cas9 genome editing. Theranostics. 2021;11(2):614\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePruteanu LL, Kopanitsa L, Modos D, Kletnieks E, Samarova E, Bender A, et al. Transcriptomics predicts compound synergy in drug and natural product treated glioblastoma cells. PLoS One. 2020;15(9):e0239551.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZarei-Kheirabadi M, Hesaraki M, Kiani S, Baharvand H. In vivo conversion of rat astrocytes into neuronal cells through neural stem cells in injured spinal cord with a single zinc-finger transcription factor. Stem Cell Res Ther. 2019;10(1):380.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePercie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020;18(7):e3000410.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Li C, Li J, Xie L, Hong Z, Zheng K, et al. EGF signaling promotes the lineage conversion of astrocytes into oligodendrocytes. Mol Med. 2022;28(1):50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMokhtarzadeh Khanghahi A, Satarian L, Deng W, Baharvand H, Javan M. In vivo conversion of astrocytes into oligodendrocyte lineage cells with transcription factor Sox10; Promise for myelin repair in multiple sclerosis. PLoS One. 2018;13(9):e0203785.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlizadeh SD, Jalalifar MR, Ghodsi Z, Sadeghi-Naini M, Malekzadeh H, Rahimi G, et al. Reprogramming of astrocytes to neuronal-like cells in spinal cord injury: a systematic review. Spinal Cord. 2024;62(4):133\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Wang R, Yu Y, Liu J, Luo T, Fan F. Glioblastoma Treatment Modalities besides Surgery. J Cancer. 2019;10(20):4793\u0026ndash;806.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee C, Robinson M, Willerth SM. Direct Reprogramming of Glioblastoma Cells into Neurons Using Small Molecules. ACS Chem Neurosci. 2018;9(12):3175\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroekman ML, Maas SLN, Abels ER, Mempel TR, Krichevsky AM, Breakefield XO. Multidimensional communication in the microenvirons of glioblastoma. Nat Rev Neurol. 2018;14(8):482\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkawa S, Gagrica S, Blin C, Ender C, Pollard SM, Krijgsveld J. Proteome and Secretome Characterization of Glioblastoma-Derived Neural Stem Cells. Stem Cells. 2017;35(4):967\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Pei Z, Hossain A, Bai Y, Chen G. Transcription factor-based gene therapy to treat glioblastoma through direct neuronal conversion. Cancer Biol Med. 2021;18(3):860\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng X, Tan Z, Huang X, Yuan Y, Qin S, Gu Y, et al. Inhibition of Glioma Development by ASCL1-Mediated Direct Neuronal Reprogramming. Cells. 2019;8(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang N, Wang L, Chen T, Liu R, Liu Z, Zhang L. ZNF521 which is downregulated by miR-802 suppresses malignant progression of Hepatocellular Carcinoma through regulating Runx2 expression. J Cancer. 2020;11(19):5831\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu M, Al-Dallal S, Al-Haj L, Panjwani S, McCartney AS, Edwards SM, et al. Transcriptional regulation of the proto-oncogene Zfp521 by SPI1 (PU.1) and HOXC13. Genesis. 2016;54(10):519\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei PC, Chao A, Peng HH, Chao AS, Chang YL, Chang SD, et al. SOX9 as a Predictor for Neurogenesis Potentiality of Amniotic Fluid Stem Cells. Stem Cells Transl Med. 2014;3(10):1138\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4505201/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4505201/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eStudy Design: \u003c/strong\u003eAn experimental \u003cem\u003ein-vitro\u003c/em\u003eand \u003cem\u003ein-vivo\u003c/em\u003e parallel group study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjectives: \u003c/strong\u003eTo investigate the prolonged effects of Zfp521 on gene expression in the U87MG glioma cell line and assess its \u003cem\u003ein vivo\u003c/em\u003e impact on animal movement post-transplantation into spinal cord injury (SCI).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSetting: \u003c/strong\u003eRoyan Institute for Stem Cell Biology and Technology Laboratory.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: U87MG cells were transduced with Zfp521-IRES-GFP and maintained in neural inductive medium for over 3 weeks. Gene expression of \u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eItga6\u003c/em\u003e, \u003cem\u003ePax6\u003c/em\u003e, \u003cem\u003enestin\u003c/em\u003e, \u003cem\u003eSox1\u003c/em\u003e, \u003cem\u003eTubb3\u003c/em\u003e, and \u003cem\u003eOlig2\u003c/em\u003e was analyzed. Transplanted cells' impact on locomotor capacity in SCI was assessed using the Basso-Beattie-Bresnahan (BBB) scale and footprint analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: Zfp521 overexpression induced morphological changes and aggregated formation in U87MG cells, with a transfection rate of 26%. Significant upregulation of \u003cem\u003ePax6\u003c/em\u003e, \u003cem\u003eTubb3\u003c/em\u003e, and \u003cem\u003eOlig2\u003c/em\u003e and decreasing of \u003cem\u003eSox1\u003c/em\u003e were observed, while \u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eItga6\u003c/em\u003e, and \u003cem\u003enestin\u003c/em\u003e showed non-significant changes. In SCI animals, U87-Zfp521 exhibited substantial recovery in hindlimb motor coordination (BBB score of 12) and weight support. Moreover, gait analysis revealed increased step length, stride angle, and step width in U87-Zfp521 animalsduring a five-week treatment. While plantar application showed no significant improvement.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e: Controlling Zfp521 expression level prominently enables the neuronal and oligodendrocyte lineage alley in the glioblastoma cell line that can be the potential therapy for promoting recovery in GBM and SCIs, highlighting its role as a promising target for further exploration in neural regeneration strategies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSponsorship\u003c/strong\u003e: This work was funded by Tehran University of Medical Sciences with grant number 97-02-38-39408.\u003c/p\u003e","manuscriptTitle":"Zfp521 prolonged expression partially relaunches the generic neuronal genes in U87MG glioblastoma cells: a primitive study","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-26 07:53:51","doi":"10.21203/rs.3.rs-4505201/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dd5be7fd-471f-49a9-a96c-b1c0746b2f49","owner":[],"postedDate":"June 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":33089892,"name":"Biological sciences/Biological techniques/Biological models/Cancer models"},{"id":33089893,"name":"Biological sciences/Neuroscience/Genetics of the nervous system"},{"id":33089894,"name":"Health sciences/Medical research/Genetics research"},{"id":33089895,"name":"Health sciences/Medical research/Experimental models of disease"}],"tags":[],"updatedAt":"2024-07-02T09:00:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-26 07:53:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4505201","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4505201","identity":"rs-4505201","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}