Ultrasound-guided left heart injection: a safer and more efficient strategy for mouse thoracic aortic gene delivery

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Thoracic aortic disease poses a significant threat due to its high mortality rates and genetic underpinnings. While gene therapy holds promise for cures, the challenge lies in achieving effective and safe gene delivery to the thoracic aorta. Tail vein injection (TI), is hindered by off-target effects and hepatotoxicity, and traditional blinded percutaneous left heart injection (TLI) carries a heightened risk of bleeding and mortality. To address these limitations, ultrasound-guided techniques present a viable solution. Adeno-associated virus (AAV) vectors were delivered into the thoracic aorta of mice through TI, TLI, and ultrasound-guided percutaneous left heart injection(ULI).While all three injection methods can achieve gene transfection in the thoracic aorta, the ULI approach provides the optimal balance between high transduction efficiency and safety. The ULI method represents an efficient and safe strategy for targeted gene delivery to the mouse thoracic aorta, providing a powerful tool for preclinical aortic gene therapy research that warrants broader application.
Full text 116,718 characters · extracted from preprint-html · click to expand
Ultrasound-guided left heart injection: a safer and more efficient strategy for mouse thoracic aortic gene delivery | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Ultrasound-guided left heart injection: a safer and more efficient strategy for mouse thoracic aortic gene delivery Dengshen Zhang, Yanmiao Yang, Kunyao Xu, Ya Yuan, Bo Huang, Shan Wei, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7412569/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Feb, 2026 Read the published version in Gene Therapy → Version 1 posted 9 You are reading this latest preprint version Abstract Thoracic aortic disease poses a significant threat due to its high mortality rates and genetic underpinnings. While gene therapy holds promise for cures, the challenge lies in achieving effective and safe gene delivery to the thoracic aorta. Tail vein injection (TI), is hindered by off-target effects and hepatotoxicity, and traditional blinded percutaneous left heart injection (TLI) carries a heightened risk of bleeding and mortality. To address these limitations, ultrasound-guided techniques present a viable solution. Adeno-associated virus (AAV) vectors were delivered into the thoracic aorta of mice through TI, TLI, and ultrasound-guided percutaneous left heart injection(ULI).While all three injection methods can achieve gene transfection in the thoracic aorta, the ULI approach provides the optimal balance between high transduction efficiency and safety. The ULI method represents an efficient and safe strategy for targeted gene delivery to the mouse thoracic aorta, providing a powerful tool for preclinical aortic gene therapy research that warrants broader application. Biological sciences/Biological techniques/Gene delivery/Genetic transduction Biological sciences/Biological techniques/Gene expression analysis ultrasound-guided left heart injection thoracic aorta adeno-associated virus gene delivery off-target effect Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Cardiovascular disease, the foremost cause of global mortality, significantly impacts health and societal progress.Thoracic aortic diseases, including aneurysm, dissection, and coarctation, present a severe challenge due to their insidious onset, swift progression, and unfavorable prognosis. Numerous studies have established a strong link between these conditions and gene mutations, underpinning the potential of gene therapy in this domain. [ 1 – 3 ] . Gene therapy offers the distinct advantage of correcting pathogenic genes at the root, thereby enabling potential cures. This approach has demonstrated broad applicability in the treatment of cardiovascular diseases. However, to translate this potential into tangible clinical efficacy, a substantial number of animal experiments in the early stage are indispensable [ 3 ] .A key challenge that must be overcome is the safe and effective delivery of genes to the thoracic aorta of mice, the most common animal model for cardiovascular disease research. This is because the thoracic aorta is deeply situated and continuously pulsating, rendering local injection a significant challenge [ 4 , 5 ] .The current gene delivery methods possess numerous limitations, which fail to meet the requirements for mouse thoracic aorta gene delivery experiments. TI is a common gene delivery method, yet it suffers from significant off-target effects. Many genes intended for the thoracic aorta are instead distributed to other organs in the right heart system, such as the liver and lungs. This misdirection not only diminishes transfection efficiency but also induces severe liver toxicity and immune damage due to the high viral load required, severely limiting its use in thoracic aortic disease research [ 6 ] .Although TLI somewhat enhances gene delivery to the thoracic aorta, it is heavily reliant on the operator's expertise for closed thoracic cavity procedures. This lack of precise control over the injection site increases the risk of bleeding and other complications, potentially resulting in fatal outcomes, thus posing significant challenges for its application in animal studies. [ 7 ] . The advent of ultrasound-guided technology offers new promise in addressing the aforementioned challenges. Ultrasound guidance enables real-time visualization of the pericardium, atrium, ventricle, valves, thoracic aorta, and surrounding anatomical structures, allowing for accurate needle placement at the target location. This approach is expected to enhance gene transfection efficiency and reduce the risk of complications, such as immune injury, hemorrhage, and mortality. Consequently, we intend to carry out experiments related to AAV transfection into thoracic aorta of mice by ULI technology. The study will systematically evaluate and compare transfection efficiency and safety of ULI with TI and TLI. The objective is to determine whether ULI can overcome the limitations of prior art, providing a superior delivery strategy for gene research targeting the mouse thoracic aorta, and thereby promoting the further development and clinical translation of gene therapy in the field of cardiovascular diseases ( Fig. 1 , a schematic diagram of transfection efficiency and safety after AAV transfection into the thoracic aorta using different injection methods). Materials and Methods Experimental animals Sixty male C57 mice (supplement Fig. 1 and table 1) were randomly assigned into four groups: normal control (NC), tail vein injection (TI), traditional left heart injection (TLI), and ultrasound-guided left heart injection (ULI), with 15 mice per group. The study received approval from the Ethics Committee for Laboratory Animal Welfare at the Affiliated Hospital of Zunyi Medical University (Project No.: zyfy-an-2024-0619). Mice were sourced and housed at the Animal Experimental Center of Zunyi Medical University (SPF grade), and all procedures adhered to ARRIVE guidelines. Reagents and instruments An AAV vector with an SMC-specific promoter (SM22α), Luc, and shRNA targeting SOD2 was supplied by Shanghai Hanheng Biotechnology Company (AAV serotype 9, virus titer 1*10^12, gene sequence: CTGCTCTAATCAGGACCCATT; see Fig. 2 for AAV vector schematic). Additional equipment included a tail vein injector (Calvin, Nanjing, China), high-resolution small animal ultrasound imaging system (Visual Sonics, Canada), stereo and fluorescence microscope (Zeiss, Germany), mouse in vivo imaging system (Tianneng, Shanghai, China), ALT and AST kits, microsurgical instruments, homogenizer, high-speed centrifuge, microplate reader, and a complete PCR and WB equipment set. Methods In the NC group, mice were maintained on a standard diet without any experimental intervention. In the TI group, mice were restrained in a cylinder, and their tail veins were exposed using a light source. The needle was inserted horizontally at a 5–10° downward angle, to a depth of approximately 2–3 mm, and the viral suspension was slowly injected at a rate of 10–20 µL/s. Following administration, the blood vessels in the tail changed from a dark red to a transparent appearance, with a total volume of 100 µL injected per mouse (Fig. 3 A). In the TLI group, mice were anesthetized with 3% isoflurane inhalation (induction at 2–3 L/min, maintenance at 1–2 L/min) until complete muscle relaxation was achieved and shallow reflexes were absent, maintaining a heart rate of 60 beats per minute. Following the application of depilatory cream to remove chest hair, mice were transferred to the operating platform with limbs secured horizontally. They were connected to a ventilator with supplemental oxygen via a mask. The operator palpated the most pronounced apical pulsation with the index finger at the left sternal edge between the third and fourth ribs to establish a positioning mark. After disinfection, a vertical negative pressure needle was inserted approximately 5–7 mm until bright red blood reflux was observed. The injection was administered slowly at a rate of 10–20 µL/s, totaling 100 µL. Upon completion, the needle was rotated and withdrawn, and the site was compressed with a cotton ball for 20–30 seconds to achieve hemostasis. Ultrasound was performed 24 hours later to assess for pericardial or thoracic hemorrhage (Fig. 3 B). In the ULI group, anesthesia, fixation, disinfection, and other procedures mirrored those of the traditional left heart group. Under ultrasound guidance, the left heart was visualized, and the needle was inserted approximately 5–7 mm below the left heart chamber. The position of the needle tip within the left heart was confirmed sonographically. A controlled drug administration (10–20 µL/s, total 100 µL) was then performed, followed by needle rotation and withdrawal. Compression with cotton balls was applied to achieve hemostasis. After 24 hours, ultrasound examination was conducted to assess for the presence of pericardial or thoracic hemorrhage (Fig. 3 C). Bioluminescence imaging (BLI) Three weeks after adeno-associated virus (AAV) injection, mice were anesthetized with isoflurane (induction: 2–3 L/min, maintenance: 1–2 L/min). D-fluorescein potassium salt was administered intraperitoneally at 0.15 mg/g body weight. Following a 15-minute wait and removal of chest and abdominal hair, the mice were placed in the dark chamber of an in vivo imaging system. Anesthesia was maintained via mask inhalation of isoflurane, and fluorescence distribution and intensity in the heart and aorta were observed and recorded according to bioluminescence parameters. Detection of gene expression level (SOD2 knockdown) After in vivo imaging, the mice were euthanized, and various tissue samples were collected for subsequent analyses. Venous blood was drawn for biochemical assays, and the heart, liver, lung, and aorta were perfused with PBS to remove blood. The liver,lung, heart, and thoracic aorta were then dissected and preserved for immunofluorescence, PCR, and Western blot analyses, respectively.The tissue collection and processing steps were carried out with meticulous care to ensure the integrity and quality of the samples for downstream molecular analyses. The use of appropriate fixation, storage, and preservation methods for the different tissue types and analytical techniques demonstrates the researchers' attention to detail and adherence to standard operating procedures in this comprehensive experimental workflow.A 15–20 mg sample was thoroughly homogenized in 1 mL of Trizol solution at 4°C. The sample was then lysed on ice for approximately 15 minutes. Subsequently, 200 µL of chloroform was added, and the mixture was vortexed and allowed to stand for 10 minutes at room temperature. The sample was then centrifuged at high speed, and 400 µL of the supernatant was transferred to a new tube. An equal volume (400 µL) of isopropanol was added, and the sample was centrifuged. The resulting precipitate was washed with 1 mL of 75% ethanol, centrifuged, and air-dried for 20 minutes. Finally, the precipitate was resuspended in 20 µL of DEPC-treated water.RNA quantification was performed using a nucleic acid detector. cDNA was synthesized using Oligo(dT) and reverse transcriptase, with a ratio of 500 µg/10 µL. Mouse GAPDH was used as the internal reference, and SYBR probes were used for real-time quantitative PCR. The PCR conditions were as follows: denaturation at 95°C for 5 s, annealing at 58°C for 20 s, and extension at 72°C for 30 s, for 40 cycles. The melting curve analysis showed a single peak, and the standard error of the Cq value was less than 0.5, indicating that the PCR quality control was satisfactory. Relative quantification was performed using the 2-ΔΔCt method.The primer sequences used were: SOD2, forward: GGTTGGTATCTGGGCT, reverse: CGTGACGTTCAGGTTGTTC; GAPDH, forward: GGAGTCCACTGGCGTCTTCA, reverse: GTCATGAGTCCTTCCACGATACC. Detection of protein expression level (SOD2 knockdown) Immunofluorescence(IF) Specimens fixed in 4% paraformaldehyde were rinsed with PBS, dehydrated in high glucose, embedded in OCT, and quickly frozen with the aorta perpendicular to the mold. They were then sectioned transversely (5–8 µm), placed in sodium citrate buffer and trypsin for antigen retrieval, and transferred to Triton-X-100 and BSA for permeabilization and blocking. The samples were incubated overnight at 4°C in the dark, rinsed, incubated with a secondary antibody for 1 hour (protected from light), and stained with DAPI. The SOD2 primary antibody was diluted 1:100 (Abcam), and the HRP-conjugated Goat anti-Rabbit IgG (H + L) was diluted 1:500 (AS014). Western Blot(WB) Tissue samples were retrieved from liquid nitrogen storage, weighed, and transferred to a 2 mL centrifuge tube. The samples were then cut into 1 mm pieces on ice and combined with a tissue lysis buffer (RIPA:PMSF = 100:1) at 100 mg/mL. Steel beads were added, and the mixture was homogenized at 4°C. The lysate was incubated on ice for 20–30 minutes, then centrifuged at 12 000 g for 15 minutes at 4°C. The supernatant was transferred to a new centrifuge tube, and the protein concentration was determined using the BCA method. Absorbance was measured at 562 nm using a microplate reader, and a standard curve was generated to calculate the sample concentrations. Protein samples were prepared at a concentration of 1 µg/µL, denatured by boiling at 100°C for 15 minutes, and then separated by 12.5% SDS-PAGE. Proteins were transferred to a PVDF membrane, which was blocked with 5% skim milk for 2–3 hours. Primary antibodies were incubated overnight at 4°C, followed by three 10-minute washes in TBST. Secondary antibodies were then incubated for 1 hour with horizontal shaking, followed by three additional 10-minute TBST washes. Protein bands were visualized, and their intensities were quantified using ImageJ software.(SOD2 primary antibody diluted 1:1 000, ab137037, Abcam; IL6 primary antibody diluted 1:1000, ab233706, Abcam; secondary antibody HRP-conjugated Goat anti-Rabbit lgG (H + L) diluted 1:5 000, AS014, ABclonal;Gapdh primary antibody diluted 1:5 000, AC033,ABclonal, β-Actin primary antibody diluted 1:100 000, AC038,ABclonal; secondary antibody HRP-conjugated Goat anti-Mouse lgG (H + L) diluted 1:5 000, AS003, ABclonal.) Detection of ALT and AST Murine venous blood samples were centrifuged at 1500g for 10 minutes at 4°C, and the supernatant plasma layer was reserved for subsequent analysis. Fifty microliters of a pre-warmed (37°C, 5 minutes) ALT and AST enzyme substrate working solution were combined with 5 µL of the plasma sample, mixed thoroughly, and incubated at 37°C for 3 minutes. The absorbance of the sample was then measured at 340 nm using a spectrophotometer. Duplicate wells were prepared for each sample, and the enzyme concentration (U/L) was calculated based on the mean value. Statistical method The measurement data are presented as mean ± standard deviation. Normality of the data was assessed prior to statistical analysis. Comparisons between two groups were conducted using Student's t-test, while one-way ANOVA was employed for comparisons among multiple groups. Statistical significance was defined as p < 0.05. All analyses were performed using SPSS 29.0 and GraphPad Prism (USA), with p-values reported as follows: p < 0.05 = *, p < 0.01 = **, p < 0.001 = ***, and p < 0.0 001 = ****. Results Safety evaluation(Bleeding, death, immune inflammation and liver toxicity) No mice in the NC and TI groups died during the study. In the TLI group, four mice experienced pericardial or intrathoracic hemorrhage, resulting in three deaths. One mouse in the ULI group showed minor pericardial effusion, but no deaths occurred. The TLI group exhibited a significantly higher bleeding rate (26.7%) and mortality (20%) compared to the NC and TI groups, both of which had a bleeding rate of 6.7% and zero mortality. Statistical analysis revealed a significant difference in bleeding incidence across the four groups (χ²=8.36, p = .039). Pairwise comparisons indicated that the TLI group had a significantly higher bleeding risk than the ULI group (χ²=4.8, p = .028). Additionally, the TLI group's mortality rate was significantly greater than that of the ULI group (Fisher's exact test, p = .031) (Fig. 4).The expression of the inflammatory cytokine interleukin-6 (IL-6) was assessed in the heart, aorta, liver, and lungs of the experimental groups. IL-6 levels were significantly elevated in the TI group compared to the TLI and ULI groups ( p < 0.05), while no significant differences were observed between the TLI, ULI, and NC groups. Additionally, no significant differences in IL-6 expression were detected across the groups in the heart, aorta, and lungs (Fig. 5). Serum ALT and AST levels, markers of liver injury, were significantly higher in the TI group compared to the other groups, while the TLI and ULI groups exhibited liver enzyme levels consistent with the NC group (Fig. 6). Assessment of transfection efficiency through in vivo imaging The NC group did not exhibit any fluorescence expression. In the TI group, three cases showed negative in vivo imaging, while one case in the TLI group had a negative imaging result, indicating a failure in virus injection-mediated transfection. Conversely, the remaining experimental groups demonstrated successful transfection. The visualization of the heart and aorta regions was possible, with the fluorescence intensity notably weaker in the TI group compared to the TLI and ULI groups. The fluorescence intensity in the TLI and ULI groups was 2.36 times and 2.87 times higher, respectively, than that in the TI group ( p < .05). Notably, there was no significant difference observed between the TLI and ULI groups ( Fig. 7). Comparison of gene knockdown efficiency Gene knockdown efficiency was compared by analyzing PCR results of heart and aorta tissues. The normal expression of the SOD2 gene was observed in the NC group, whereas decreased expression was evident in the other experimental groups. Utilizing the 2-δδ method, it was determined that the knockdown of the SOD2 gene was less pronounced in the TI group compared to the TLI and ULI groups. Specifically, the TI group exhibited a 50% down-regulation, whereas the TLI and ULI groups showed approximately 80% down-regulation, with no significant difference between the TLI and ULI groups. Conversely, PCR analysis of liver and lung tissues revealed normal SOD2 gene expression in the NC group, while decreased expression was observed in the other experimental groups. Notably, the degree of down-regulation of the SOD2 gene in the TI group surpassed that in the TLI and ULI groups ( p < .05), with no significant variance in gene down-regulation between the TLI and ULI groups (Fig. 8). Expression of protein(SOD2 knockdown) Immunofluorescence In heart tissue, SOD2 exhibited red fluorescence, while the NC group displayed normal expression. The intensity of red fluorescence decreased in the other experimental groups, with the TI group showing higher levels compared to both the TLI and ULI groups. Additionally, the TLI group exhibited higher levels than the ULI group, with statistical significance at p < .05. In aorta tissue, the NC group demonstrated normal expression, whereas the red fluorescence decreased in the other experimental groups. Similar to the heart tissue results, the TI group showed higher levels compared to both the TLI and ULI groups, with statistical significance at p < .05. Notably, there was no significant difference in fluorescence intensity between the TLI and ULI groups in the aorta tissue.In liver and lung tissues, the NC group displayed normal expression with a uniform distribution of red fluorescence. Conversely, the other experimental groups exhibited reduced red fluorescence, primarily concentrated around the vascular lumen (as indicated by the green circle mark in Fig. 9G). The TI group showed lower levels compared to both the TLI and ULI groups, with statistical significance at p < .05. Moreover, there was no significant disparity in fluorescence intensity between the TLI and ULI groups in the liver and lung tissues (Fig. 9). Western blot (WB) In heart tissue, the expression of SOD 2 was normal in the NC group but decreased in the other experimental groups. Specifically, the expression in the TI group was higher than in the TLI and ULI groups, with the TLI group showing higher expression than the ULI group ( p < .05). In aortic tissue, SOD2 expression was within normal levels in the NC group but exhibited a decrease in the other experimental groups. Specifically, the expression in the TI group was higher than in both the TLI and ULI groups ( p < .05), with no significant variance observed between the TLI and ULI groups.In the liver and lung tissues, the expression of SOD2 was normal in the NC group but decreased in the other experimental groups. Specifically, the expression of SOD2 in the TI group was significantly lower than that in both the TLI and ULI groups ( p < .05).Notably, there was no significant difference in fluorescence intensity between the TLI and ULI groups ( Fig. 10). Discussion Through a comparative analysis of bleeding rate, mortality, immune damage, hepatotoxicity, and the expression of target genes and proteins following various methods of AAV injection, our study demonstrates that ultrasound-guided left heart injection technology is a safe and efficient approach for delivering therapeutic genes into the thoracic aorta of mice. The rising prevalence of aortic disease poses a significant threat to human health, resembling a fatal ailment. Genetic factors closely correlate with the onset of aortic disease, prompting exploration into gene intervention therapy for thoracic aortic conditions [ 1 , 8 , 9 ] .The vascular wall's primary constituents—endothelial cells, vascular smooth muscle cells, and extracellular matrix—significantly influence aortic disease progression [ 1 , 10 ] .Hence, targeted manipulation of these components in animal studies stands as a crucial approach to combat aortic diseases. Compared to other viral and non-viral vectors, adeno-associated virus (AAV) exhibits low immunogenicity, high transfection efficiency, precise targeting, and sustains in vivo expression for over 2 years. Consequently, AAV has emerged as the predominant gene vector for in vivo studies [ 11 – 13 ] .AAV can be administered through in situ or systemic injection methods [ 14 ] ,The aorta undergoes continuous pulsation, making percutaneous in situ injection challenging. While in situ AAV injection post-thoracotomy and aortic fixation is feasible in rodents and certain primates, the procedure presents challenges in larger animals due to their weight, necessitating higher virus dosages and incurring elevated research costs. Moreover, the deep positioning of the aorta and the high risk of thoracotomy-related trauma further complicate routine applications [ 15 , 16 ] .Systemic administration of AAV is the primary approach for gene targeting in aortic diseases. Nevertheless, the deep location and rapid blood flow in the thoracic aorta pose challenges for conventional gene delivery techniques to achieve efficient transfection. The optimal gene delivery method for the mouse thoracic aorta remains a topic of ongoing debate. The development of a precise, effective, and safe AAV delivery technique remains a pressing issue in cardiovascular disease gene research. Ultrasound-guided technology enhances the safety and accuracy of injections in the study and treatment of joint diseases by providing visualization of anatomy and precise injection site localization [ 17 , 18 ] . In gene therapy research, ultrasound-guided delivery of AAV to various organs, including the heart, liver, muscle, and placenta, demonstrates high transfection efficiency and minimal toxicity. [ 19 – 21 ] .Additionally, the combination of ultrasound with microbubble blasting technology enhances the effectiveness of AAV gene delivery in superficial arteries, such as the carotid artery, in mice [ 22 ] ,Some researchers propose the use of ultrasound microbubbles to target the abdominal aorta for the treatment of abdominal aortic aneurysm [ 23 ] .However, the potential of this approach to improve targeted gene delivery in the thoracic aorta, which is surrounded by bony structures and located deep within the body, requires further investigation. Conventional left heart injection relies heavily on the operator's proficiency in viral injection techniques. Performing the procedure without direct visualization increases the likelihood of inadvertently puncturing the heart or causing damage to the coronary artery due to needle misalignment, which can lead to bleeding or fatality in mice.Conversely, ultrasound-guided technology enables real-time adjustment of the needle trajectory with precision, thereby mitigating or preventing the risk of bleeding [ 24 ] .In this investigation, only one subject exhibited a minor pericardial effusion under ultrasound guidance, whereas the bleeding and mortality rates associated with conventional methods stood at 26.7% and 20%, respectively. Although the TI group did not exhibit injury, bleeding, or mortality, AAV administered via the tail vein traversed the liver via the venous blood flow, where it was sequestered by Kupffer cells. This led to an escalation in the release of liver enzymes and inflammatory mediators, resulting in immune-mediated liver injury [ 25 , 26 ] .Notably, the levels of ALT, AST, and IL-6 in the TLI and ULI groups were comparable to those in the NC group following equimolar AAV administration. Immunofluorescence analysis of cardiac tissue revealed uniform distribution of red fluorescence, confirming the absence of intramyocardial injection during the delivery process. This observation further validates the precision of ultrasound-guided drug administration. Consequently, ULI demonstrates distinct advantages in terms of precision and safety when juxtaposed with conventional methods of gene delivery to the cardiovascular system. Following tail vein injection, AAV traverses the inferior vena cava, right atrium, tricuspid valve, right ventricle, pulmonary artery, pulmonary capillary network, pulmonary vein, left atrium, left ventricle, and ultimately reaches the thoracic aorta. Immunofluorescence analysis reveals a decrease in red fluorescence surrounding the blood vessels of the liver and lungs post-injection, suggesting a non-specific transfection of AAV in these organs, akin to the "first-pass effect" observed with drugs. The peripheral administration via the tail vein results in an unintended delivery to the liver and lungs due to their high blood perfusion rates. Consequently, the transfection efficacy in the intended target tissues is compromised. Augmenting the viral dosage can enhance transfection efficacy to some extent; however, this approach exacerbates immune responses, organ toxicity, neurological impairments, and escalates research expenses [ 27 ] .The findings indicated that modifying the CAP gene of the virus could enhance its tropism for specific tissues and improve transfection efficacy in target tissues [ 20 , 28 , 29 ] .Additionally, altering the AAV promoter could increase the virus's ability to bind to particular cells. Previous research has demonstrated that using the TIE2 promoter with AAV can notably enhance transfection efficiency in pulmonary artery endothelial cells [ 30 ] . In our investigation, we concurrently modified the capsid protein and promoter of AAV. Specifically, we integrated the SM22 α promoter at the 5' end of AAV and switched to AAV serotype 9, known for its affinity for the heart and large blood vessels. This adjustment enabled the viral vector to selectively bind to receptors expressed in vascular smooth muscle cells, facilitating efficient transfection [ 31 , 32 ] .In vivo imaging analysis confirmed a significant accumulation of luciferase-carrying AAV in the heart and aorta regions of the TLI and ULI groups, as evidenced by the emission of green fluorescence. In contrast, the fluorescence signal observed in the TI group was notably weaker in these areas. Specifically, the fluorescence intensity in the TLI and ULI groups was 2.36 and 2.87 times greater, respectively, compared to the TI group.Following direct injection into the left heart, the AAV particles were delivered into the ascending aorta, where they adhered to the vascular wall under conditions of high shear stress. This targeted delivery approach bypasses the prolonged circulation and nonspecific degradation that can occur with AAV administration via the tail vein, thereby significantly enhancing transfection efficiency [ 33 ] .The strategic modification of AAV and the localized injection technique closely resembling in situ delivery collectively contribute to the heightened efficacy of the viral vector in achieving precise transfection of thoracic aorta tissues and cells. The development of thoracic aortic disease is intricately linked to local gene regulation. However, existing gene delivery approaches have exhibited limitations in terms of safety and efficacy [ 34 , 35 ] .This investigation pioneers the utilization of ultrasound technology for gene delivery to the mouse thoracic aorta. This novel approach enables precise, safe, and efficient administration of therapeutic genes, thereby revitalizing research efforts and therapeutic strategies for profound aortic pathologies.The limitation of this study is that it utilized the AAV9 serotype, which specifically targets smooth muscle cells, while other serotypes like AAV DJ, which targets endothelial cells, were not investigated.The IF and WB analyses revealed a higher expression level of the SOD2 protein in the TLI group compared to the ULI group. However, no significant difference was observed in the gene expression level of SOD2 between the two groups. The presence of tissue-specific expression, protein translation levels, or post-translational modifications remains to be elucidated. Enhancing gene vectors, minimizing their immunogenicity, improving the specific binding affinity of vectors to aortic smooth muscle cells or endothelial cells, optimizing virus transfection efficiency, and ensuring the safety of gene delivery represent key avenues for future gene therapy research in aortic diseases. Conclusion This study introduces a novel targeted gene delivery system for AAV injection into mouse thoracic aorta via the left heart under ultrasound guidance. This approach addresses the limitations of conventional delivery methods, which struggle with the deep location of the thoracic aorta, resulting in challenges in safe and accurate delivery. By prioritizing the avoidance of hepatotoxicity and off-target effects while ensuring safety, this method significantly enhances the transfection efficiency of the thoracic aorta.The findings of this study not only present a reliable tool for gene research in the thoracic aorta but also underscore the importance of real-time ultrasound image guidance for the safe delivery of cardiovascular genes. Furthermore, this approach holds promise for extension to other systemic circulatory vascular systems such as the renal artery, cerebrovascular system, and gastrointestinal artery. This advancement can facilitate the development of animal models for cardiovascular diseases, mechanism exploration, gene therapy, drug screening, and other in-depth investigations. Moreover, it paves the way for progression to larger animal models and eventual clinical applications. Abbreviations NC normal control TI Tail vein injection TLI traditional percutaneous left heart injection Declarations Acknowlegdements We express our gratitude to China Shanghai Hanheng Biotechnology Co., Ltd. for their assistance in preparing the adeno-associated virus. Additionally, we extend our thanks to Professor Wang Xiaosong from the Animal Experiment Center of Zunyi Medical University for his valuable guidance and support in mouse breeding and modeling procedures. Author Contributions Conceptualization:Dengshen Zhang,Jianguo Liu,Daxing Liu Methodology:Yanmiao Yang,Kunyao Xu,Ya Yuan,Bo Huang,Shan Wei,Yi Zhao,Yang Song Investigation:Yanmiao Yang,Kunyao Xu,Ya Yuan,Shan Wei,Yi Zhao,Yang Song Funding acquisition:Dengshen Zhang,Jianguo Liu,Liu,Daxing Liu Writing-original draft:Yanmiao Yang,Kunyao Xu,Ya Yuan,Shan Wei,Yi Zhao,Yang Song Writing-review & editing:Yanmiao Yang,Dengshen Zhang,Jianguo Liu,Liu,Daxing Liu All authors have read and approved the final version of this manuscript. We confirm that this work is original and has not been published elsewhere,nor is it currently under consideration for publication in another journal. Funding This work was supported by the following funds. National Natural Science Foundation of China Project No. 82360086. National Natural Science Foundation of China Project No. 82160060. Guizhou Province Health High-quality Development Medical Research Foundation Project No. 2024GZYXKYJXM 0022. Guizhou Province Health Commission Project No. gzwkj2023-157. Science and Technology Plan Project of Guizhou Province Project No. ZK[2022] YB652. Ethics Approval All animal experiments were conducted in accordance with the guidelines and regulations and were approved by Institutional Animal Care and Use Committee(IACUC) of the Affiliated Hospital of Zunyi Medical University(Project No.: zyfy-an-2024-0619). Competing Interests The authors have declared that no competing interests exist. References CHOU E, PIRRUCCELLO J P, ELLINOR P T, et al. Genetics and mechanisms of thoracic aortic disease [J]. Nat Rev Cardiol. 2023;20(3):168–80. CALDERON-MARTINEZ E, VELASCO W V, GUO D, et al. Differences in Arterial Events in Vascular Ehlers-Danlos, Loeys-Dietz, and Marfan Syndrome [J]. J Am Coll Cardiol. 2025;85(24):2355–67. KIM Y, LANDSTROM A P, SHAH S H, et al. Gene Therapy in Cardiovascular Disease: Recent Advances and Future Directions in Science: A Science Advisory From the American Heart Association [J]. Circulation. 2024;150(23):e471–80. BOUCHERAT O, AGRAWAL V. The Latest in Animal Models of Pulmonary Hypertension and Right Ventricular Failure [J]. Circ Res. 2022;130(9):1466–86. GOLLEDGE J, KRISHNA S M, WANG Y. Mouse models for abdominal aortic aneurysm [J]. Br J Pharmacol. 2022;179(5):792–810. DROUYER M, MERJANE J, NAZARETH D, et al. Development of CNS tropic AAV1-like variants with reduced liver-targeting following systemic administration in mice [J]. Mol Ther. 2024;32(3):818–36. SCHWARTZ A J, JOBES D R, ELLISON N. Are intracardiac injections proved safe? [J]. JAMA. 1981;246(7):735. DE LA FUENTE-ALONSO A, TORAL M, ALFAYATE A, et al. Aortic disease in Marfan syndrome is caused by overactivation of sGC-PRKG signaling by NO [J]. Nat Commun. 2021;12(1):2628. ASANO K, CANTALUPO A, SEDES L et al. Pathophysiology and Therapeutics of Thoracic Aortic Aneurysm in Marfan Syndrome [J]. Biomolecules, 2022, 12(1). QIE B, TUO J, CHEN F et al. Gene therapy for genetic diseases: challenges and future directions [J]. MedComm (2020), 2025, 6(2): e70091. LING Q, HERSTINE J A, BRADBURY A, et al. AAV-based in vivo gene therapy for neurological disorders [J]. Nat Rev Drug Discov. 2023;22(10):789–806. WANG JH, GESSLER D J, ZHAN W, et al. Adeno-associated virus as a delivery vector for gene therapy of human diseases [J]. Signal Transduct Target Ther. 2024;9(1):78. YIN H, KANASTY R L, ELTOUKHY A A, et al. Non-viral vectors for gene-based therapy [J]. Nat Rev Genet. 2014;15(8):541–55. PUPO A, FERNáNDEZ A, LOW S H, et al. AAV vectors: The Rubik's cube of human gene therapy [J]. Mol Ther. 2022;30(12):3515–41. BANSKOTA DAVISJR, LEVY S. Efficient prime editing in mouse brain, liver and heart with dual AAVs [J]. Nat Biotechnol. 2024;42(2):253–64. GAO Q, XU Q, CAO X et al. Precision Ultrasound-guided Stem Cell Delivery for Vascular Repair in Aortic Diseases [J]. J Vis Exp, 2025, (220). WANG S, CHEN K, WANG Y, et al. Cardiac-targeted delivery of nuclear receptor RORα via ultrasound targeted microbubble destruction optimizes the benefits of regular dose of melatonin on sepsis-induced cardiomyopathy [J]. Biomater Res. 2023;27(1):41. MOOSMAYER S, EKEBERG O M, HALLGREN H B, et al. Ultrasound guided lavage with corticosteroid injection versus sham lavage with and without corticosteroid injection for calcific tendinopathy of shoulder: randomised double blinded multi-arm study [J]. BMJ. 2023;383:e076447. RAD I J CHAPMANL, TUPALLY K R, et al. A systematic review of ultrasound-mediated drug delivery to the eye and critical insights to facilitate a timely path to the clinic [J]. Theranostics. 2023;13(11):3582–638. EID F E, CHEN A T, CHAN K Y, et al. Systematic multi-trait AAV capsid engineering for efficient gene delivery [J]. Nat Commun. 2024;15(1):6602. DI DONFRANCESCO A, ADELIZZI A, GIRI A, et al. Transabdominal ultrasound guided AAV9-GFP delivery in fetal pigs: a translational and minimally invasive model for in utero fetal gene therapy [J]. Gene Ther; 2025. LIU R, QU S, XU Y, et al. Spatial control of robust transgene expression in mouse artery endothelium under ultrasound guidance [J]. Signal Transduct Target Ther. 2022;7(1):225. SHAMLOO A, BOROUMAND A, EBRAHIMI S, et al. Modeling of an Ultrasound System in Targeted Drug Delivery to Abdominal Aortic Aneurysm: A Patient-Specific in Silico Study Based on Ligand-Receptor Binding [J]. IEEE Trans Ultrason Ferroelectr Freq Control. 2022;69(3):967–74. CHRISTENSEN G, MINAMISAWA S. High-efficiency, long-term cardiac expression of foreign genes in living mouse embryos and neonates [J]. Circulation. 2000;101(2):178–84. HASSAN R. Kupffer cells in hepatotoxicity [J]. Excli j. 2020;19:1156–7. COSTA-VERDERA H, UNZU C et al. VALERI E,. Understanding and Tackling Immune Responses to Adeno-Associated Viral Vectors [J]. Hum Gene Ther, 2023, 34(17–18): 836 – 52. TAHA E A, LEE J. Delivery of CRISPR-Cas tools for in vivo genome editing therapy: Trends and challenges [J]. J Control Release. 2022;342:345–61. SHIOHAMA Y, FUJITA R, SONOKAWA M, et al. Elimination of Off-Target Effect by Chemical Modification of 5'-End of siRNA [J]. Nucleic Acid Ther. 2022;32(5):438–47. ZHOU X, LIU J. Adeno-Associated Virus Engineering and Load Strategy for Tropism Modification, Immune Evasion and Enhanced Transgene Expression [J]. Int J Nanomed. 2024;19:7691–708. SANGAM S, SUN X, SCHWANTES-AN T, H, et al. SOX17 Deficiency Mediates Pulmonary Hypertension: At the Crossroads of Sex, Metabolism, and Genetics [J]. Am J Respir Crit Care Med. 2023;207(8):1055–69. RAPTI K, GRIMM D. AAV vector engineering for human aorta transduction: becoming a smooth operator [J]. Gene Ther. 2025;32(4):331–2. SCHRöDER LC, HüTTERMANN L, KLIESOW REMES A, et al. AAV library screening identifies novel vector for efficient transduction of human aorta [J]. Gene Ther. 2025;32(2):154–62. PALALAY JS, SIMSEK A N, REED JL, et al. Shear force enhances adhesion of Pseudomonas aeruginosa by counteracting pilus-driven surface departure [J]. Proc Natl Acad Sci U S A. 2023;120(41):e2307718120. PIRRUCCELLO J P, RäMö JT, CHOI SH, et al. The Genetic Determinants of Aortic Distention [J]. J Am Coll Cardiol. 2023;81(14):1320–35. BERGER T, DUMFARTH J, KREIBICH M, et al. Thoracic aortic aneurysm [J]. Nat Rev Dis Primers. 2025;11(1):34. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files Supplementtable1MouseBasicInformationXXX48wlengthandweightXXX.xlsx Supplement table 1 SupplementFigure1Basicinformationregardingtheexperimentalmice.tif Supplement Figure 1 Cite Share Download PDF Status: Published Journal Publication published 28 Feb, 2026 Read the published version in Gene Therapy → Version 1 posted Editorial decision: revise 09 Oct, 2025 Review # 2 received at journal 03 Oct, 2025 Reviewer # 2 agreed at journal 21 Sep, 2025 Review # 1 received at journal 10 Sep, 2025 Reviewer # 1 agreed at journal 05 Sep, 2025 Reviewers invited by journal 26 Aug, 2025 Editor assigned by journal 22 Aug, 2025 Submission checks completed at journal 22 Aug, 2025 First submitted to journal 19 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7412569","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":506058192,"identity":"e3cfaf3b-417c-49f0-918e-920847d45a4d","order_by":0,"name":"Dengshen Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIie3QsQqCQBzH8YuDo+Eft4Ui6CucuDQIvYqHYGuPYAi29ABKSK/QIygHTYFr0BIETQ03Ogh1c4ReW8N95/9n+P8QMpn+MoIQoBAoxnUtO32SuPaW8Kbc6RMRsBYCMSUagF2SWD57zFMBUijs0Xk9TOwiqf0qJ3yTzY5ivUB+uY+GCXVWaTxLgWdYkQJQxK4jhCgioLd4juEmgGgQ6iRNBoQFgNUIWsQ+POJJlUeuhQlTI1vjv7DzKVCLvWDZiruUXehRZ4R8Zv12bjKZTKbvvQHLkEN0tYzNkQAAAABJRU5ErkJggg==","orcid":"","institution":"Affiliated Hospital of Zunyi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Dengshen","middleName":"","lastName":"Zhang","suffix":""},{"id":506058193,"identity":"f0b36dec-efb1-4cfc-89ef-629b61455843","order_by":1,"name":"Yanmiao Yang","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanmiao","middleName":"","lastName":"Yang","suffix":""},{"id":506058194,"identity":"f2a232a0-af18-4077-aa42-43377bad9d8a","order_by":2,"name":"Kunyao Xu","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kunyao","middleName":"","lastName":"Xu","suffix":""},{"id":506058195,"identity":"a5ba34dd-1fb6-466b-ac12-4f493c720301","order_by":3,"name":"Ya Yuan","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ya","middleName":"","lastName":"Yuan","suffix":""},{"id":506058196,"identity":"ee23a425-dad2-47b5-aab2-21d4f9233424","order_by":4,"name":"Bo Huang","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Huang","suffix":""},{"id":506058197,"identity":"9c4895b4-75da-4f06-9cd4-689e5cb86d5d","order_by":5,"name":"Shan Wei","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shan","middleName":"","lastName":"Wei","suffix":""},{"id":506058198,"identity":"8d933fc8-ff59-4303-b533-12ffe1f1a4be","order_by":6,"name":"Yi Zhao","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Zhao","suffix":""},{"id":506058199,"identity":"8688f5bf-21b4-4dbe-8338-0f631f63098f","order_by":7,"name":"Yang Song","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Song","suffix":""},{"id":506058200,"identity":"00b872be-e913-46d1-b542-fb78ea6856f2","order_by":8,"name":"Daxing Liu","email":"","orcid":"","institution":"Affiliated Hospital of Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Daxing","middleName":"","lastName":"Liu","suffix":""},{"id":506058201,"identity":"d25cb249-f28c-4cf1-af1c-20f19b6b2f69","order_by":9,"name":"Jianguo Liu","email":"","orcid":"","institution":"Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jianguo","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-08-20 02:15:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7412569/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7412569/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41434-026-00603-7","type":"published","date":"2026-02-28T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90533883,"identity":"9e45c73c-d32b-4e80-ad42-35b6a8afadef","added_by":"auto","created_at":"2025-09-03 19:16:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2786194,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic diagram of AAV transfection into thoracic aorta by different injection methods.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e, virus circulation route after tail vein injection: liver-inferior vena cava-right atria-tricuspid valve-right ventricle-pulmonary artery-pulmonary capillary network-pulmonary vein-left atria-left ventricle-thoracic aorta, a large number of AAV non-specific binding in liver and lung, thoracic aorta transfection efficiency is low;\u003cstrong\u003eB\u003c/strong\u003e, traditional left heart injection virus circulation route: left atria-left ventricle-thoracic aorta, thoracic aorta transfection efficiency is acceptable, but the operation accuracy is insufficient, coronary artery or myocardium may be damaged, resulting in pericardial hemorrhage; \u003cstrong\u003eC\u003c/strong\u003e, ultrasound-guided left heart injection virus circulation path: left atrium-left ventricle-thoracic aorta, accurate and safe injection of AAV into the left heart, thoracic aorta transfection efficiency, reducing non-specific binding of virus in liver or other parts. \u003cimg alt=\"病毒\" height=\"13\" src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABUAAAATCAMAAABIkLa5AAAAAXNSR0IArs4c6QAAAoJQTFRFHfBMM/hfPfZmPfpnO/lmNvhhTfhzXO59W/V+S/dyTfZzVvN5XPh/V/19WPt9UO90WP1+TPRxTfVzVfh6Uvx5S+5wWvV9T/V0R/JtT/Z1UPV1TvR0RPdtS/hyUvd3RvFtT/Z0S/RxUPZ1Vvp7Uvd4SfJwTvRyVPl5RvRuRPJrVfp7U/d4TvV0VPh6WP9+XvJ/T+5yTPt0Uvl4Te9xV/h7SfhwQvlrWv9/Xu9/XPZ/WvZ9W/l+X/+DW/yAX/+EXP6BXfyBXf2BY/qEdPGQfvOZefSUYvCBaPCHdPSQYfKCYf+FY/+GY/+HafKIdPWRe/WWYf6EaPOHevGVYfaDZ/GGdfCRYv+FZ/eIcvKPYPaCcfWPZf+IY/GDYv+GZvGFePmVf/WZa/SKYfOBYfCBYvCCYPCBcfmPhvSfgvmdhPqfgfecgfmcgvOcg/Wbgvack/mqifeih/WglPerkPanjPmliPagivejj/WmlvqsivmiivWinPaviviilvusmvivlvisj/qnlvirmPquivSik/apmPiulPqrrve+rfm/rfa+qPm6rvm+ove1rfe9qvm8o/q2svvCsvzCtPjDu/rJsPvBuvvIu/fItfjDsffBwvvPx/vT1Pvcxf3RxfvSxfbQz/nYz/zZ0vfa1P3dwfzO1vreyfjU2/ni3v3l2v3i2f3h3/3m3Pvj2vzi/P78//7//f79/v7+6/3v+P756vzu+v779P337vzx4vzo8Pzy/f/+5v3r6f3t6/vu//7+7P3w+P76/v3+5Pzp9f/49v746/zv8P7z8/714f3n5f3r/P/9/f3+4/zo+f76//3/4P7n6Pvs8//28f70/v/++//88f3z////RFkG7AAAAAlwSFlzAAAWJQAAFiUBSVIk8AAAABl0RVh0U29mdHdhcmUATWljcm9zb2Z0IE9mZmljZX/tNXEAAAFQSURBVChTY7gKA2vXwZlXGUDM9RuuXt3oNOHqppmbITJg0Vn5W65uZZt4dVvBbCTR7ZN27NxVOHn3sj1QQ4Bq1627ure9KJ3d2aV4+dWr+/ZDTMgoOTDH1Y2Dk4vbvXTFQcYpENFMnjIPT14vbx8bPl+/rOyVUNv2+vML2AoKCQeIMIl2wN2wKkfMTlxCUkpahjmw/NBVoDMZDm/cNDdI1ltOXkFRSdgmOGTe/IpdVxkWVC7sDFUOU1GVUlMXtg+PWH1k6tGrDMeOXz1RFWmnoamlraOrp199Eua3U1EGDiwMhtGOXkbGNafPQNxQa1KXG2NqFutlLhxX38VaAQwloGhD/NlFCRaJllZJyY3nrjYthrp33dV107qbU1JbepYgwuHq1aPTz1+9MKP30Jala5DCbHnexatX06yvXu1rRRK9dPnS1av9bVevbroCEQUATsTqzexAwrEAAAAASUVORK5CYII=\" width=\"14\"/\u003e: AAV virus particle.\u003c/p\u003e","description":"","filename":"Fig.1SchematicdiagramofAAVtransfectionintothoracicaortabydifferentinjectionmethods..png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/b940e77c4a3b0930580d7d53.png"},{"id":90534236,"identity":"b8fe76fa-1169-4f6c-b18f-db748248d173","added_by":"auto","created_at":"2025-09-03 19:24:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1067791,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConstruction of the engineered adeno-associated virus (AAV) \u003c/strong\u003e. The 5' terminus of the AAV genome is fused with the SM22 alpha promoter, which is specific to vascular smooth muscle cells, and the luciferase reporter gene. Within the AAV vector, the gene encoding the small interfering RNA targeting SOD2 is inserted, with the specific gene sequence being CTGCTCTAATCAGGACCCATT.\u003c/p\u003e","description":"","filename":"Figure2ConstructionoftheengineeredadenoassociatedvirusAAV.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/df86ee62bad03fe2af0c6e96.png"},{"id":90533891,"identity":"d543e22d-caf5-43f6-a45c-521a0e7ff50d","added_by":"auto","created_at":"2025-09-03 19:16:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5688669,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThree methods of AAV injection.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e, tail vein injection;\u003cstrong\u003e B\u003c/strong\u003e, percutaneous left heart injection with traditional body surface positioning; \u003cstrong\u003eC\u003c/strong\u003e, left heart injection guided by ultrasound, ensuring precise placement of the needle tip within the left heart under ultrasound guidance.\u003c/p\u003e","description":"","filename":"Figure3ThreemethodsofAAVinjection.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/4c6ae9b20b4a22bc60720feb.png"},{"id":90533887,"identity":"9530c062-0134-458d-b398-f448a598a93e","added_by":"auto","created_at":"2025-09-03 19:16:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1699500,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe hemorrhage and mortality rates of mice subjected to various injection methods.\u003c/strong\u003ePanel \u003cstrong\u003eA\u003c/strong\u003edepicts a normal pericardial ultrasound showing minimal fluid density shadows in the pericardial cavity. Panel \u003cstrong\u003eB\u003c/strong\u003edisplays a pericardial hemorrhage ultrasound characterized by a substantial presence of fluid density shadows in the pericardial cavity, resulting in cardiac compression and diastolic restriction.Panel \u003cstrong\u003eC\u003c/strong\u003ereveals the statistical analysis of bleeding events and mortality among the different groups: In the NC and TI groups, there were no instances of bleeding or death among the 15 mice in each group. In the TLI group, there were 4 cases (26.7%) of bleeding and 3 cases (20%) of death. The ULI group had 1 case (6.7%) of bleeding with no reported deaths. A significant discrepancy in bleeding events was observed among the four groups (χ2= 8.36, \u003cem\u003ep\u003c/em\u003e = .039). Pairwise comparisons indicated a notably higher bleeding risk in the TLI group compared to the ULI group (χ2= 4.8, \u003cem\u003ep\u003c/em\u003e = .028). Furthermore, the mortality rate in the TLI group was significantly higher than that in the ULI group, as determined by Fisher's exact probability method (\u003cem\u003ep\u003c/em\u003e = .031).\u003c/p\u003e","description":"","filename":"Figure4Thehemorrhageandmortalityratesofmicesubjectedtovariousinjectionmethods..png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/49d1c51b7ac8dd2a5b2c8e62.png"},{"id":90534237,"identity":"457c59d5-d3cc-4c1e-89fc-9fbf6408d9f7","added_by":"auto","created_at":"2025-09-03 19:24:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2910646,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of IL-6 in various organs.\u003c/strong\u003e IL-6 expression in the heart (\u003cstrong\u003eA\u003c/strong\u003e, \u003cstrong\u003eB\u003c/strong\u003e) and thoracic aorta (\u003cstrong\u003eC\u003c/strong\u003e, \u003cstrong\u003eD\u003c/strong\u003e) did not show significant differences. In contrast, IL-6 expression of the liver (\u003cstrong\u003eE\u003c/strong\u003e, \u003cstrong\u003eF\u003c/strong\u003e) in TI group was significantly higher compared to the other groups (\u003cem\u003ep\u003c/em\u003e \u0026lt; .05). Similarly, IL-6 expression in the lung (\u003cstrong\u003eG\u003c/strong\u003e, \u003cstrong\u003eH\u003c/strong\u003e) did not exhibit any significant differences.\u003c/p\u003e","description":"","filename":"Figure5TheexpressionofIL6invariousorgans.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/0deadca1b1c9d53bee12e0ad.png"},{"id":90533888,"identity":"1dbf3ed4-f26a-41a1-bd2f-96fdefba7ed4","added_by":"auto","created_at":"2025-09-03 19:16:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":444280,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe levels of liver enzymes ALT and AST. A\u003c/strong\u003e,the ALT levels in the TI group were significantly elevated compared to the other groups (\u003cem\u003ep\u003c/em\u003e\u0026lt;.01), while there was no significant difference in AST levels between the TLI and ULI groups compared to the NC group.\u003cstrong\u003eB\u003c/strong\u003e,the AST levels in the TI group were also significantly higher than in the other groups (\u003cem\u003ep\u003c/em\u003e\u0026lt;.001). However, there was no significant difference in AST levels between the TLI and ULI groups compared to the NC group.\u003c/p\u003e","description":"","filename":"Figure6ThelevelsofliverenzymesALTandAST.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/bfe5fae621ff3518db198771.png"},{"id":90533892,"identity":"0b799492-9459-4cf1-bd3c-e244f28355e5","added_by":"auto","created_at":"2025-09-03 19:16:32","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":5730061,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIn vivo imaging.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e,the fluorescence intensity in the heart and aorta regions following virus transfection was assessed by bioluminescence. \u003cstrong\u003eB\u003c/strong\u003e,the fluorescence intensity was quantified and presented in a statistical map. The NC group exhibited no fluorescence signal, while the TI group showed weak green fluorescence. In contrast, the TLI and ULI groups displayed strong red-green fluorescence. Notably, the fluorescence intensity in both the TLI and ULI groups was significantly higher than that in the TI group (\u003cem\u003ep\u003c/em\u003e \u0026lt; .01), with no significant difference observed between the TLI and ULI groups.\u003c/p\u003e","description":"","filename":"Figure7Invivoimaging.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/ff5b96576661a533dd8f0a43.png"},{"id":90533890,"identity":"9008d287-d4c7-46ad-937c-45de4d1a8d90","added_by":"auto","created_at":"2025-09-03 19:16:32","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":780106,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of SOD2 gene(PCR).\u003c/strong\u003e In the heart (\u003cstrong\u003eA\u003c/strong\u003e) and thoracic aorta (\u003cstrong\u003eB\u003c/strong\u003e), the expression of the SOD2 gene was down-regulated in the TI group, TLI group, and ULI group. Notably, the TLI group and ULI group exhibited a significantly higher down-regulation compared to the TI group (\u003cem\u003ep\u003c/em\u003e\u0026lt;.05). Similarly, in the liver (\u003cstrong\u003eC\u003c/strong\u003e) and lung (\u003cstrong\u003eD\u003c/strong\u003e), the SOD2 gene expression was down-regulated in the TI group, TLI group, and ULI group. Remarkably, the TI group showed a significantly higher down-regulation compared to the TLI group and ULI group (\u003cem\u003ep\u003c/em\u003e\u0026lt;.05).\u003c/p\u003e","description":"","filename":"Figure8TheexpressionofSOD2genePCR.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/8940ea9ea917403cf80384d1.png"},{"id":90534244,"identity":"40c52d02-dab9-46f4-9923-f92691e2f041","added_by":"auto","created_at":"2025-09-03 19:24:32","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":6449524,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRed fluorescence intensity in different groups(IF).\u003c/strong\u003e In the heart (\u003cstrong\u003eA\u003c/strong\u003e, \u003cstrong\u003eB\u003c/strong\u003e), the red fluorescence was weaker in the TI, TLI, and ULI groups compared to the normal group. The ULI group exhibited weaker fluorescence than the TLI group, and the TLI group showed weaker fluorescence than the TI group (\u003cem\u003ep\u003c/em\u003e \u0026lt; .05). In the thoracic aorta (\u003cstrong\u003eC\u003c/strong\u003e, \u003cstrong\u003eD\u003c/strong\u003e), the red fluorescence intensity in the TI, TLI, and ULI groups was weaker than in the normal group. Both the ULI and TLI groups had significantly weaker fluorescence compared to the TI group, with no significant difference between the TLI and ULI groups (\u003cem\u003ep\u003c/em\u003e \u0026lt; .05). In the liver (\u003cstrong\u003eE\u003c/strong\u003e, \u003cstrong\u003eF\u003c/strong\u003e) and lung (\u003cstrong\u003eG\u003c/strong\u003e, \u003cstrong\u003eH\u003c/strong\u003e), the red fluorescence intensity was significantly lower in the TI group compared to the TLI and ULI groups. The most pronounced decrease in fluorescence was observed around blood vessels (\u003cem\u003ep\u003c/em\u003e\u0026lt; .05).\u003c/p\u003e","description":"","filename":"Figure9RedfluorescenceintensityindifferentgroupsIF.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/8e0ce526895aee139e30bd96.png"},{"id":90534247,"identity":"6ef4f4b6-969d-4d3f-abd7-50e4b734df30","added_by":"auto","created_at":"2025-09-03 19:24:32","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":4078529,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSOD2 protein expression levels among different groups of tissues(WB).\u003c/strong\u003eIn the heart (panels\u003cstrong\u003e A\u003c/strong\u003e and \u003cstrong\u003eB\u003c/strong\u003e), the ULI group exhibited the lowest expression, followed by the TLI group and then the TI group, with statistical significance (\u003cem\u003ep\u003c/em\u003e\u0026lt;.05). Moving on to the thoracic aorta (panels \u003cstrong\u003eC\u003c/strong\u003e and \u003cstrong\u003eD\u003c/strong\u003e), all treatment groups (TI, TLI, and ULI) displayed decreased SOD2 protein expression compared to the normal group. Both the TLI and ULI groups showed significantly lower expression levels than the TI group (\u003cem\u003ep\u003c/em\u003e\u0026lt;.05), while there was no significant difference between the TLI and ULI groups. In the liver (panel \u003cstrong\u003eE\u003c/strong\u003e and \u003cstrong\u003eF\u003c/strong\u003e) and lung (panels \u003cstrong\u003eG\u003c/strong\u003eand \u003cstrong\u003eH\u003c/strong\u003e), the down-regulation of SOD2 protein in the TI group was notably more pronounced than in the TLI and ULI groups, with no significant difference between the TLI and ULI groups (\u003cem\u003ep\u003c/em\u003e\u0026lt;.05).\u003c/p\u003e","description":"","filename":"Figure10SOD2proteinexpressionlevelsamongdifferentgroupsoftissuesWB.png","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/ca07bec8feb6488be6b03710.png"},{"id":103680238,"identity":"0fd5c221-0508-40e8-b113-704b6f4aa866","added_by":"auto","created_at":"2026-03-01 08:06:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":30071601,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/7b6a3bf8-f02d-4533-83fd-fe7493dbd82e.pdf"},{"id":90533885,"identity":"8a127086-99c8-474d-ad68-4de68aabf4b0","added_by":"auto","created_at":"2025-09-03 19:16:31","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":12722,"visible":true,"origin":"","legend":"Supplement table 1","description":"","filename":"Supplementtable1MouseBasicInformationXXX48wlengthandweightXXX.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/ce137b39af9653a077da5556.xlsx"},{"id":90534238,"identity":"aaaab6f3-f8a6-4713-9399-f8e4a0f38d80","added_by":"auto","created_at":"2025-09-03 19:24:32","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":17583504,"visible":true,"origin":"","legend":"Supplement Figure 1","description":"","filename":"SupplementFigure1Basicinformationregardingtheexperimentalmice.tif","url":"https://assets-eu.researchsquare.com/files/rs-7412569/v1/75a5e608f55290379924d289.tif"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Ultrasound-guided left heart injection: a safer and more efficient strategy\r\nfor mouse thoracic aortic gene delivery","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCardiovascular disease, the foremost cause of global mortality, significantly impacts health and societal progress.Thoracic aortic diseases, including aneurysm, dissection, and coarctation, present a severe challenge due to their insidious onset, swift progression, and unfavorable prognosis. Numerous studies have established a strong link between these conditions and gene mutations, underpinning the potential of gene therapy in this domain.\u003csup\u003e[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eGene therapy offers the distinct advantage of correcting pathogenic genes at the root, thereby enabling potential cures. This approach has demonstrated broad applicability in the treatment of cardiovascular diseases. However, to translate this potential into tangible clinical efficacy, a substantial number of animal experiments in the early stage are indispensable\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e.A key challenge that must be overcome is the safe and effective delivery of genes to the thoracic aorta of mice, the most common animal model for cardiovascular disease research. This is because the thoracic aorta is deeply situated and continuously pulsating, rendering local injection a significant challenge\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.The current gene delivery methods possess numerous limitations, which fail to meet the requirements for mouse thoracic aorta gene delivery experiments.\u003c/p\u003e\u003cp\u003eTI is a common gene delivery method, yet it suffers from significant off-target effects. Many genes intended for the thoracic aorta are instead distributed to other organs in the right heart system, such as the liver and lungs. This misdirection not only diminishes transfection efficiency but also induces severe liver toxicity and immune damage due to the high viral load required, severely limiting its use in thoracic aortic disease research\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e.Although TLI somewhat enhances gene delivery to the thoracic aorta, it is heavily reliant on the operator's expertise for closed thoracic cavity procedures. This lack of precise control over the injection site increases the risk of bleeding and other complications, potentially resulting in fatal outcomes, thus posing significant challenges for its application in animal studies.\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe advent of ultrasound-guided technology offers new promise in addressing the aforementioned challenges. Ultrasound guidance enables real-time visualization of the pericardium, atrium, ventricle, valves, thoracic aorta, and surrounding anatomical structures, allowing for accurate needle placement at the target location. This approach is expected to enhance gene transfection efficiency and reduce the risk of complications, such as immune injury, hemorrhage, and mortality. Consequently, we intend to carry out experiments related to AAV transfection into thoracic aorta of mice by ULI technology. The study will systematically evaluate and compare transfection efficiency and safety of ULI with TI and TLI. The objective is to determine whether ULI can overcome the limitations of prior art, providing a superior delivery strategy for gene research targeting the mouse thoracic aorta, and thereby promoting the further development and clinical translation of gene therapy in the field of cardiovascular diseases ( Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a schematic diagram of transfection efficiency and safety after AAV transfection into the thoracic aorta using different injection methods).\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eExperimental animals\u003c/h2\u003e\u003cp\u003eSixty male C57 mice (supplement Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and table 1) were randomly assigned into four groups: normal control (NC), tail vein injection (TI), traditional left heart injection (TLI), and ultrasound-guided left heart injection (ULI), with 15 mice per group. The study received approval from the Ethics Committee for Laboratory Animal Welfare at the Affiliated Hospital of Zunyi Medical University (Project No.: zyfy-an-2024-0619). Mice were sourced and housed at the Animal Experimental Center of Zunyi Medical University (SPF grade), and all procedures adhered to ARRIVE guidelines.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eReagents and instruments\u003c/h3\u003e\n\u003cp\u003eAn AAV vector with an SMC-specific promoter (SM22α), Luc, and shRNA targeting SOD2 was supplied by Shanghai Hanheng Biotechnology Company (AAV serotype 9, virus titer 1*10^12, gene sequence: CTGCTCTAATCAGGACCCATT; see Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e for AAV vector schematic). Additional equipment included a tail vein injector (Calvin, Nanjing, China), high-resolution small animal ultrasound imaging system (Visual Sonics, Canada), stereo and fluorescence microscope (Zeiss, Germany), mouse in vivo imaging system (Tianneng, Shanghai, China), ALT and AST kits, microsurgical instruments, homogenizer, high-speed centrifuge, microplate reader, and a complete PCR and WB equipment set.\u003c/p\u003e\n\u003ch3\u003eMethods\u003c/h3\u003e\n\u003cp\u003eIn the NC group, mice were maintained on a standard diet without any experimental intervention.\u003c/p\u003e\u003cp\u003eIn the TI group, mice were restrained in a cylinder, and their tail veins were exposed using a light source. The needle was inserted horizontally at a 5\u0026ndash;10\u0026deg; downward angle, to a depth of approximately 2\u0026ndash;3 mm, and the viral suspension was slowly injected at a rate of 10\u0026ndash;20 \u0026micro;L/s. Following administration, the blood vessels in the tail changed from a dark red to a transparent appearance, with a total volume of 100 \u0026micro;L injected per mouse (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003eIn the TLI group, mice were anesthetized with 3% isoflurane inhalation (induction at 2\u0026ndash;3 L/min, maintenance at 1\u0026ndash;2 L/min) until complete muscle relaxation was achieved and shallow reflexes were absent, maintaining a heart rate of 60 beats per minute. Following the application of depilatory cream to remove chest hair, mice were transferred to the operating platform with limbs secured horizontally. They were connected to a ventilator with supplemental oxygen via a mask. The operator palpated the most pronounced apical pulsation with the index finger at the left sternal edge between the third and fourth ribs to establish a positioning mark. After disinfection, a vertical negative pressure needle was inserted approximately 5\u0026ndash;7 mm until bright red blood reflux was observed. The injection was administered slowly at a rate of 10\u0026ndash;20 \u0026micro;L/s, totaling 100 \u0026micro;L. Upon completion, the needle was rotated and withdrawn, and the site was compressed with a cotton ball for 20\u0026ndash;30 seconds to achieve hemostasis. Ultrasound was performed 24 hours later to assess for pericardial or thoracic hemorrhage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eIn the ULI group, anesthesia, fixation, disinfection, and other procedures mirrored those of the traditional left heart group. Under ultrasound guidance, the left heart was visualized, and the needle was inserted approximately 5\u0026ndash;7 mm below the left heart chamber. The position of the needle tip within the left heart was confirmed sonographically. A controlled drug administration (10\u0026ndash;20 \u0026micro;L/s, total 100 \u0026micro;L) was then performed, followed by needle rotation and withdrawal. Compression with cotton balls was applied to achieve hemostasis. After 24 hours, ultrasound examination was conducted to assess for the presence of pericardial or thoracic hemorrhage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\n\u003ch3\u003eBioluminescence imaging (BLI)\u003c/h3\u003e\n\u003cp\u003eThree weeks after adeno-associated virus (AAV) injection, mice were anesthetized with isoflurane (induction: 2\u0026ndash;3 L/min, maintenance: 1\u0026ndash;2 L/min). D-fluorescein potassium salt was administered intraperitoneally at 0.15 mg/g body weight. Following a 15-minute wait and removal of chest and abdominal hair, the mice were placed in the dark chamber of an in vivo imaging system. Anesthesia was maintained via mask inhalation of isoflurane, and fluorescence distribution and intensity in the heart and aorta were observed and recorded according to bioluminescence parameters.\u003c/p\u003e\n\u003ch3\u003eDetection of gene expression level (SOD2 knockdown)\u003c/h3\u003e\n\u003cp\u003eAfter in vivo imaging, the mice were euthanized, and various tissue samples were collected for subsequent analyses. Venous blood was drawn for biochemical assays, and the heart, liver, lung, and aorta were perfused with PBS to remove blood. The liver,lung, heart, and thoracic aorta were then dissected and preserved for immunofluorescence, PCR, and Western blot analyses, respectively.The tissue collection and processing steps were carried out with meticulous care to ensure the integrity and quality of the samples for downstream molecular analyses. The use of appropriate fixation, storage, and preservation methods for the different tissue types and analytical techniques demonstrates the researchers' attention to detail and adherence to standard operating procedures in this comprehensive experimental workflow.A 15\u0026ndash;20 mg sample was thoroughly homogenized in 1 mL of Trizol solution at 4\u0026deg;C. The sample was then lysed on ice for approximately 15 minutes. Subsequently, 200 \u0026micro;L of chloroform was added, and the mixture was vortexed and allowed to stand for 10 minutes at room temperature. The sample was then centrifuged at high speed, and 400 \u0026micro;L of the supernatant was transferred to a new tube. An equal volume (400 \u0026micro;L) of isopropanol was added, and the sample was centrifuged. The resulting precipitate was washed with 1 mL of 75% ethanol, centrifuged, and air-dried for 20 minutes. Finally, the precipitate was resuspended in 20 \u0026micro;L of DEPC-treated water.RNA quantification was performed using a nucleic acid detector. cDNA was synthesized using Oligo(dT) and reverse transcriptase, with a ratio of 500 \u0026micro;g/10 \u0026micro;L. Mouse GAPDH was used as the internal reference, and SYBR probes were used for real-time quantitative PCR. The PCR conditions were as follows: denaturation at 95\u0026deg;C for 5 s, annealing at 58\u0026deg;C for 20 s, and extension at 72\u0026deg;C for 30 s, for 40 cycles. The melting curve analysis showed a single peak, and the standard error of the Cq value was less than 0.5, indicating that the PCR quality control was satisfactory. Relative quantification was performed using the 2-ΔΔCt method.The primer sequences used were: SOD2, forward: GGTTGGTATCTGGGCT, reverse: CGTGACGTTCAGGTTGTTC; GAPDH, forward: GGAGTCCACTGGCGTCTTCA, reverse: GTCATGAGTCCTTCCACGATACC.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eDetection of protein expression level (SOD2 knockdown)\u003c/h2\u003e\u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\u003ch2\u003eImmunofluorescence(IF)\u003c/h2\u003e\u003cp\u003eSpecimens fixed in 4% paraformaldehyde were rinsed with PBS, dehydrated in high glucose, embedded in OCT, and quickly frozen with the aorta perpendicular to the mold. They were then sectioned transversely (5\u0026ndash;8 \u0026micro;m), placed in sodium citrate buffer and trypsin for antigen retrieval, and transferred to Triton-X-100 and BSA for permeabilization and blocking. The samples were incubated overnight at 4\u0026deg;C in the dark, rinsed, incubated with a secondary antibody for 1 hour (protected from light), and stained with DAPI. The SOD2 primary antibody was diluted 1:100 (Abcam), and the HRP-conjugated Goat anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) was diluted 1:500 (AS014).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eWestern Blot(WB)\u003c/h3\u003e\n\u003cp\u003eTissue samples were retrieved from liquid nitrogen storage, weighed, and transferred to a 2 mL centrifuge tube. The samples were then cut into 1 mm pieces on ice and combined with a tissue lysis buffer (RIPA:PMSF\u0026thinsp;=\u0026thinsp;100:1) at 100 mg/mL. Steel beads were added, and the mixture was homogenized at 4\u0026deg;C. The lysate was incubated on ice for 20\u0026ndash;30 minutes, then centrifuged at 12 000 g for 15 minutes at 4\u0026deg;C. The supernatant was transferred to a new centrifuge tube, and the protein concentration was determined using the BCA method. Absorbance was measured at 562 nm using a microplate reader, and a standard curve was generated to calculate the sample concentrations. Protein samples were prepared at a concentration of 1 \u0026micro;g/\u0026micro;L, denatured by boiling at 100\u0026deg;C for 15 minutes, and then separated by 12.5% SDS-PAGE. Proteins were transferred to a PVDF membrane, which was blocked with 5% skim milk for 2\u0026ndash;3 hours. Primary antibodies were incubated overnight at 4\u0026deg;C, followed by three 10-minute washes in TBST. Secondary antibodies were then incubated for 1 hour with horizontal shaking, followed by three additional 10-minute TBST washes. Protein bands were visualized, and their intensities were quantified using ImageJ software.(SOD2 primary antibody diluted 1:1 000, ab137037, Abcam; IL6 primary antibody diluted 1:1000, ab233706, Abcam; secondary antibody HRP-conjugated Goat anti-Rabbit lgG (H\u0026thinsp;+\u0026thinsp;L) diluted 1:5 000, AS014, ABclonal;Gapdh primary antibody diluted 1:5 000, AC033,ABclonal, β-Actin primary antibody diluted 1:100 000, AC038,ABclonal; secondary antibody HRP-conjugated Goat anti-Mouse lgG (H\u0026thinsp;+\u0026thinsp;L) diluted 1:5 000, AS003, ABclonal.)\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eDetection of ALT and AST\u003c/h2\u003e\u003cp\u003eMurine venous blood samples were centrifuged at 1500g for 10 minutes at 4\u0026deg;C, and the supernatant plasma layer was reserved for subsequent analysis. Fifty microliters of a pre-warmed (37\u0026deg;C, 5 minutes) ALT and AST enzyme substrate working solution were combined with 5 \u0026micro;L of the plasma sample, mixed thoroughly, and incubated at 37\u0026deg;C for 3 minutes. The absorbance of the sample was then measured at 340 nm using a spectrophotometer. Duplicate wells were prepared for each sample, and the enzyme concentration (U/L) was calculated based on the mean value.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eStatistical method\u003c/h2\u003e\u003cp\u003eThe measurement data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Normality of the data was assessed prior to statistical analysis. Comparisons between two groups were conducted using Student's t-test, while one-way ANOVA was employed for comparisons among multiple groups. Statistical significance was defined as \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All analyses were performed using SPSS 29.0 and GraphPad Prism (USA), with p-values reported as follows: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 = *, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 = **, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 = ***, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0 001 = ****.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003eSafety evaluation(Bleeding, death, immune inflammation and liver toxicity)\u003c/h2\u003e\n \u003cp\u003eNo mice in the NC and TI groups died during the study. In the TLI group, four mice experienced pericardial or intrathoracic hemorrhage, resulting in three deaths. One mouse in the ULI group showed minor pericardial effusion, but no deaths occurred. The TLI group exhibited a significantly higher bleeding rate (26.7%) and mortality (20%) compared to the NC and TI groups, both of which had a bleeding rate of 6.7% and zero mortality. Statistical analysis revealed a significant difference in bleeding incidence across the four groups (\u0026chi;\u0026sup2;=8.36, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;.039). Pairwise comparisons indicated that the TLI group had a significantly higher bleeding risk than the ULI group (\u0026chi;\u0026sup2;=4.8, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;.028). Additionally, the TLI group\u0026apos;s mortality rate was significantly greater than that of the ULI group (Fisher\u0026apos;s exact test, p\u0026thinsp;=\u0026thinsp;.031) (Fig.\u0026nbsp;4).The expression of the inflammatory cytokine interleukin-6 (IL-6) was assessed in the heart, aorta, liver, and lungs of the experimental groups. IL-6 levels were significantly elevated in the TI group compared to the TLI and ULI groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while no significant differences were observed between the TLI, ULI, and NC groups. Additionally, no significant differences in IL-6 expression were detected across the groups in the heart, aorta, and lungs (Fig.\u0026nbsp;5). Serum ALT and AST levels, markers of liver injury, were significantly higher in the TI group compared to the other groups, while the TLI and ULI groups exhibited liver enzyme levels consistent with the NC group (Fig.\u0026nbsp;6).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003eAssessment of transfection efficiency through in vivo imaging\u003c/h2\u003e\n \u003cp\u003eThe NC group did not exhibit any fluorescence expression. In the TI group, three cases showed negative in vivo imaging, while one case in the TLI group had a negative imaging result, indicating a failure in virus injection-mediated transfection. Conversely, the remaining experimental groups demonstrated successful transfection. The visualization of the heart and aorta regions was possible, with the fluorescence intensity notably weaker in the TI group compared to the TLI and ULI groups. The fluorescence intensity in the TLI and ULI groups was 2.36 times and 2.87 times higher, respectively, than that in the TI group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05). Notably, there was no significant difference observed between the TLI and ULI groups ( Fig.\u0026nbsp;7).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\"\u003e\n \u003ch2\u003eComparison of gene knockdown efficiency\u003c/h2\u003e\n \u003cp\u003eGene knockdown efficiency was compared by analyzing PCR results of heart and aorta tissues. The normal expression of the SOD2 gene was observed in the NC group, whereas decreased expression was evident in the other experimental groups. Utilizing the 2-\u0026delta;\u0026delta; method, it was determined that the knockdown of the SOD2 gene was less pronounced in the TI group compared to the TLI and ULI groups. Specifically, the TI group exhibited a 50% down-regulation, whereas the TLI and ULI groups showed approximately 80% down-regulation, with no significant difference between the TLI and ULI groups. Conversely, PCR analysis of liver and lung tissues revealed normal SOD2 gene expression in the NC group, while decreased expression was observed in the other experimental groups. Notably, the degree of down-regulation of the SOD2 gene in the TI group surpassed that in the TLI and ULI groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05), with no significant variance in gene down-regulation between the TLI and ULI groups (Fig.\u0026nbsp;8).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\"\u003e\n \u003ch2\u003eExpression of protein(SOD2 knockdown)\u003c/h2\u003e\n \u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003eImmunofluorescence\u003c/h2\u003e\n \u003cp\u003eIn heart tissue, SOD2 exhibited red fluorescence, while the NC group displayed normal expression. The intensity of red fluorescence decreased in the other experimental groups, with the TI group showing higher levels compared to both the TLI and ULI groups. Additionally, the TLI group exhibited higher levels than the ULI group, with statistical significance at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05. In aorta tissue, the NC group demonstrated normal expression, whereas the red fluorescence decreased in the other experimental groups. Similar to the heart tissue results, the TI group showed higher levels compared to both the TLI and ULI groups, with statistical significance at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05. Notably, there was no significant difference in fluorescence intensity between the TLI and ULI groups in the aorta tissue.In liver and lung tissues, the NC group displayed normal expression with a uniform distribution of red fluorescence. Conversely, the other experimental groups exhibited reduced red fluorescence, primarily concentrated around the vascular lumen (as indicated by the green circle mark in Fig.\u0026nbsp;9G). The TI group showed lower levels compared to both the TLI and ULI groups, with statistical significance at p\u0026thinsp;\u0026lt;\u0026thinsp;.05. Moreover, there was no significant disparity in fluorescence intensity between the TLI and ULI groups in the liver and lung tissues (Fig.\u0026nbsp;9).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\"\u003e\n \u003ch2\u003eWestern blot (WB)\u003c/h2\u003e\n \u003cp\u003eIn heart tissue, the expression of SOD 2 was normal in the NC group but decreased in the other experimental groups. Specifically, the expression in the TI group was higher than in the TLI and ULI groups, with the TLI group showing higher expression than the ULI group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05). In aortic tissue, SOD2 expression was within normal levels in the NC group but exhibited a decrease in the other experimental groups. Specifically, the expression in the TI group was higher than in both the TLI and ULI groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05), with no significant variance observed between the TLI and ULI groups.In the liver and lung tissues, the expression of SOD2 was normal in the NC group but decreased in the other experimental groups. Specifically, the expression of SOD2 in the TI group was significantly lower than that in both the TLI and ULI groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05).Notably, there was no significant difference in fluorescence intensity between the TLI and ULI groups ( Fig. 10).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThrough a comparative analysis of bleeding rate, mortality, immune damage, hepatotoxicity, and the expression of target genes and proteins following various methods of AAV injection, our study demonstrates that ultrasound-guided left heart injection technology is a safe and efficient approach for delivering therapeutic genes into the thoracic aorta of mice.\u003c/p\u003e\n\u003cp\u003eThe rising prevalence of aortic disease poses a significant threat to human health, resembling a fatal ailment. Genetic factors closely correlate with the onset of aortic disease, prompting exploration into gene intervention therapy for thoracic aortic conditions\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e.The vascular wall\u0026apos;s primary constituents\u0026mdash;endothelial cells, vascular smooth muscle cells, and extracellular matrix\u0026mdash;significantly influence aortic disease progression\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e.Hence, targeted manipulation of these components in animal studies stands as a crucial approach to combat aortic diseases.\u003c/p\u003e\n\u003cp\u003eCompared to other viral and non-viral vectors, adeno-associated virus (AAV) exhibits low immunogenicity, high transfection efficiency, precise targeting, and sustains in vivo expression for over 2 years. Consequently, AAV has emerged as the predominant gene vector for in vivo studies\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.AAV can be administered through in situ or systemic injection methods\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e,The aorta undergoes continuous pulsation, making percutaneous in situ injection challenging. While in situ AAV injection post-thoracotomy and aortic fixation is feasible in rodents and certain primates, the procedure presents challenges in larger animals due to their weight, necessitating higher virus dosages and incurring elevated research costs. Moreover, the deep positioning of the aorta and the high risk of thoracotomy-related trauma further complicate routine applications\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e.Systemic administration of AAV is the primary approach for gene targeting in aortic diseases. Nevertheless, the deep location and rapid blood flow in the thoracic aorta pose challenges for conventional gene delivery techniques to achieve efficient transfection. The optimal gene delivery method for the mouse thoracic aorta remains a topic of ongoing debate. The development of a precise, effective, and safe AAV delivery technique remains a pressing issue in cardiovascular disease gene research.\u003c/p\u003e\n\u003cp\u003eUltrasound-guided technology enhances the safety and accuracy of injections in the study and treatment of joint diseases by providing visualization of anatomy and precise injection site localization\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. In gene therapy research, ultrasound-guided delivery of AAV to various organs, including the heart, liver, muscle, and placenta, demonstrates high transfection efficiency and minimal toxicity.\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e.Additionally, the combination of ultrasound with microbubble blasting technology enhances the effectiveness of AAV gene delivery in superficial arteries, such as the carotid artery, in mice\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e,Some researchers propose the use of ultrasound microbubbles to target the abdominal aorta for the treatment of abdominal aortic aneurysm\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e.However, the potential of this approach to improve targeted gene delivery in the thoracic aorta, which is surrounded by bony structures and located deep within the body, requires further investigation.\u003c/p\u003e\n\u003cp\u003eConventional left heart injection relies heavily on the operator\u0026apos;s proficiency in viral injection techniques. Performing the procedure without direct visualization increases the likelihood of inadvertently puncturing the heart or causing damage to the coronary artery due to needle misalignment, which can lead to bleeding or fatality in mice.Conversely, ultrasound-guided technology enables real-time adjustment of the needle trajectory with precision, thereby mitigating or preventing the risk of bleeding\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e.In this investigation, only one subject exhibited a minor pericardial effusion under ultrasound guidance, whereas the bleeding and mortality rates associated with conventional methods stood at 26.7% and 20%, respectively.\u003c/p\u003e\n\u003cp\u003eAlthough the TI group did not exhibit injury, bleeding, or mortality, AAV administered via the tail vein traversed the liver via the venous blood flow, where it was sequestered by Kupffer cells. This led to an escalation in the release of liver enzymes and inflammatory mediators, resulting in immune-mediated liver injury \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.Notably, the levels of ALT, AST, and IL-6 in the TLI and ULI groups were comparable to those in the NC group following equimolar AAV administration. Immunofluorescence analysis of cardiac tissue revealed uniform distribution of red fluorescence, confirming the absence of intramyocardial injection during the delivery process. This observation further validates the precision of ultrasound-guided drug administration. Consequently, ULI demonstrates distinct advantages in terms of precision and safety when juxtaposed with conventional methods of gene delivery to the cardiovascular system.\u003c/p\u003e\n\u003cp\u003eFollowing tail vein injection, AAV traverses the inferior vena cava, right atrium, tricuspid valve, right ventricle, pulmonary artery, pulmonary capillary network, pulmonary vein, left atrium, left ventricle, and ultimately reaches the thoracic aorta. Immunofluorescence analysis reveals a decrease in red fluorescence surrounding the blood vessels of the liver and lungs post-injection, suggesting a non-specific transfection of AAV in these organs, akin to the \u0026quot;first-pass effect\u0026quot; observed with drugs. The peripheral administration via the tail vein results in an unintended delivery to the liver and lungs due to their high blood perfusion rates. Consequently, the transfection efficacy in the intended target tissues is compromised. Augmenting the viral dosage can enhance transfection efficacy to some extent; however, this approach exacerbates immune responses, organ toxicity, neurological impairments, and escalates research expenses\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e.The findings indicated that modifying the CAP gene of the virus could enhance its tropism for specific tissues and improve transfection efficacy in target tissues\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e.Additionally, altering the AAV promoter could increase the virus\u0026apos;s ability to bind to particular cells. Previous research has demonstrated that using the TIE2 promoter with AAV can notably enhance transfection efficiency in pulmonary artery endothelial cells\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. In our investigation, we concurrently modified the capsid protein and promoter of AAV. Specifically, we integrated the SM22 \u0026alpha; promoter at the 5\u0026apos; end of AAV and switched to AAV serotype 9, known for its affinity for the heart and large blood vessels. This adjustment enabled the viral vector to selectively bind to receptors expressed in vascular smooth muscle cells, facilitating efficient transfection\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e.In vivo imaging analysis confirmed a significant accumulation of luciferase-carrying AAV in the heart and aorta regions of the TLI and ULI groups, as evidenced by the emission of green fluorescence. In contrast, the fluorescence signal observed in the TI group was notably weaker in these areas. Specifically, the fluorescence intensity in the TLI and ULI groups was 2.36 and 2.87 times greater, respectively, compared to the TI group.Following direct injection into the left heart, the AAV particles were delivered into the ascending aorta, where they adhered to the vascular wall under conditions of high shear stress. This targeted delivery approach bypasses the prolonged circulation and nonspecific degradation that can occur with AAV administration via the tail vein, thereby significantly enhancing transfection efficiency\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e.The strategic modification of AAV and the localized injection technique closely resembling in situ delivery collectively contribute to the heightened efficacy of the viral vector in achieving precise transfection of thoracic aorta tissues and cells.\u003c/p\u003e\n\u003cp\u003eThe development of thoracic aortic disease is intricately linked to local gene regulation. However, existing gene delivery approaches have exhibited limitations in terms of safety and efficacy\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e.This investigation pioneers the utilization of ultrasound technology for gene delivery to the mouse thoracic aorta. This novel approach enables precise, safe, and efficient administration of therapeutic genes, thereby revitalizing research efforts and therapeutic strategies for profound aortic pathologies.The limitation of this study is that it utilized the AAV9 serotype, which specifically targets smooth muscle cells, while other serotypes like AAV DJ, which targets endothelial cells, were not investigated.The IF and WB analyses revealed a higher expression level of the SOD2 protein in the TLI group compared to the ULI group. However, no significant difference was observed in the gene expression level of SOD2 between the two groups. The presence of tissue-specific expression, protein translation levels, or post-translational modifications remains to be elucidated. Enhancing gene vectors, minimizing their immunogenicity, improving the specific binding affinity of vectors to aortic smooth muscle cells or endothelial cells, optimizing virus transfection efficiency, and ensuring the safety of gene delivery represent key avenues for future gene therapy research in aortic diseases.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study introduces a novel targeted gene delivery system for AAV injection into mouse thoracic aorta via the left heart under ultrasound guidance. This approach addresses the limitations of conventional delivery methods, which struggle with the deep location of the thoracic aorta, resulting in challenges in safe and accurate delivery. By prioritizing the avoidance of hepatotoxicity and off-target effects while ensuring safety, this method significantly enhances the transfection efficiency of the thoracic aorta.The findings of this study not only present a reliable tool for gene research in the thoracic aorta but also underscore the importance of real-time ultrasound image guidance for the safe delivery of cardiovascular genes. Furthermore, this approach holds promise for extension to other systemic circulatory vascular systems such as the renal artery, cerebrovascular system, and gastrointestinal artery. This advancement can facilitate the development of animal models for cardiovascular diseases, mechanism exploration, gene therapy, drug screening, and other in-depth investigations. Moreover, it paves the way for progression to larger animal models and eventual clinical applications.\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNC\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003enormal control\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTI\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTail vein injection\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTLI\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003etraditional percutaneous left heart injection\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowlegdements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe express our gratitude to China Shanghai Hanheng Biotechnology Co., Ltd. for their assistance in preparing the adeno-associated virus. Additionally, we extend our thanks to Professor Wang Xiaosong from the Animal Experiment Center of Zunyi Medical University for his valuable guidance and support in mouse breeding and modeling procedures.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization:Dengshen Zhang,Jianguo Liu,Daxing Liu\u003c/p\u003e\n\u003cp\u003eMethodology:Yanmiao Yang,Kunyao Xu,Ya Yuan,Bo Huang,Shan Wei,Yi Zhao,Yang Song\u003c/p\u003e\n\u003cp\u003eInvestigation:Yanmiao Yang,Kunyao Xu,Ya Yuan,Shan Wei,Yi Zhao,Yang Song\u003c/p\u003e\n\u003cp\u003eFunding acquisition:Dengshen Zhang,Jianguo Liu,Liu,Daxing Liu\u003c/p\u003e\n\u003cp\u003eWriting-original draft:Yanmiao Yang,Kunyao Xu,Ya Yuan,Shan Wei,Yi Zhao,Yang Song\u003c/p\u003e\n\u003cp\u003eWriting-review \u0026amp; editing:Yanmiao Yang,Dengshen Zhang,Jianguo Liu,Liu,Daxing Liu\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the final version of this manuscript.\u003c/p\u003e\n\u003cp\u003eWe confirm that this work is original and has not been published elsewhere,nor is it currently under consideration for publication in another journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the following funds.\u003c/p\u003e\n\u003col\u003e\n \u003cli\u003eNational Natural Science Foundation of China Project No. 82360086.\u003c/li\u003e\n \u003cli\u003eNational Natural Science Foundation of China Project No. 82160060.\u003c/li\u003e\n \u003cli\u003eGuizhou Province Health High-quality Development Medical Research Foundation Project No. 2024GZYXKYJXM 0022.\u003c/li\u003e\n \u003cli\u003eGuizhou Province Health Commission Project No. gzwkj2023-157.\u003c/li\u003e\n \u003cli\u003eScience and Technology Plan Project of Guizhou Province Project No. ZK[2022] YB652.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003e\u003cstrong\u003eEthics \u0026nbsp; Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were conducted in accordance with the guidelines and regulations and were approved by Institutional Animal Care and Use Committee(IACUC) of\u0026nbsp;the Affiliated Hospital of Zunyi Medical University(Project No.: zyfy-an-2024-0619).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no competing interests exist.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCHOU E, PIRRUCCELLO J P, ELLINOR P T, et al. Genetics and mechanisms of thoracic aortic disease [J]. Nat Rev Cardiol. 2023;20(3):168\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCALDERON-MARTINEZ E, VELASCO W V, GUO D, et al. Differences in Arterial Events in Vascular Ehlers-Danlos, Loeys-Dietz, and Marfan Syndrome [J]. J Am Coll Cardiol. 2025;85(24):2355\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKIM Y, LANDSTROM A P, SHAH S H, et al. Gene Therapy in Cardiovascular Disease: Recent Advances and Future Directions in Science: A Science Advisory From the American Heart Association [J]. Circulation. 2024;150(23):e471\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBOUCHERAT O, AGRAWAL V. The Latest in Animal Models of Pulmonary Hypertension and Right Ventricular Failure [J]. Circ Res. 2022;130(9):1466\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGOLLEDGE J, KRISHNA S M, WANG Y. Mouse models for abdominal aortic aneurysm [J]. Br J Pharmacol. 2022;179(5):792\u0026ndash;810.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDROUYER M, MERJANE J, NAZARETH D, et al. Development of CNS tropic AAV1-like variants with reduced liver-targeting following systemic administration in mice [J]. Mol Ther. 2024;32(3):818\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSCHWARTZ A J, JOBES D R, ELLISON N. Are intracardiac injections proved safe? [J]. JAMA. 1981;246(7):735.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDE LA FUENTE-ALONSO A, TORAL M, ALFAYATE A, et al. Aortic disease in Marfan syndrome is caused by overactivation of sGC-PRKG signaling by NO [J]. Nat Commun. 2021;12(1):2628.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eASANO K, CANTALUPO A, SEDES L et al. Pathophysiology and Therapeutics of Thoracic Aortic Aneurysm in Marfan Syndrome [J]. Biomolecules, 2022, 12(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQIE B, TUO J, CHEN F et al. Gene therapy for genetic diseases: challenges and future directions [J]. MedComm (2020), 2025, 6(2): e70091.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLING Q, HERSTINE J A, BRADBURY A, et al. AAV-based in vivo gene therapy for neurological disorders [J]. Nat Rev Drug Discov. 2023;22(10):789\u0026ndash;806.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG JH, GESSLER D J, ZHAN W, et al. Adeno-associated virus as a delivery vector for gene therapy of human diseases [J]. Signal Transduct Target Ther. 2024;9(1):78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYIN H, KANASTY R L, ELTOUKHY A A, et al. Non-viral vectors for gene-based therapy [J]. Nat Rev Genet. 2014;15(8):541\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePUPO A, FERN\u0026aacute;NDEZ A, LOW S H, et al. AAV vectors: The Rubik's cube of human gene therapy [J]. Mol Ther. 2022;30(12):3515\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBANSKOTA DAVISJR, LEVY S. Efficient prime editing in mouse brain, liver and heart with dual AAVs [J]. Nat Biotechnol. 2024;42(2):253\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGAO Q, XU Q, CAO X et al. Precision Ultrasound-guided Stem Cell Delivery for Vascular Repair in Aortic Diseases [J]. J Vis Exp, 2025, (220).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG S, CHEN K, WANG Y, et al. Cardiac-targeted delivery of nuclear receptor RORα via ultrasound targeted microbubble destruction optimizes the benefits of regular dose of melatonin on sepsis-induced cardiomyopathy [J]. Biomater Res. 2023;27(1):41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMOOSMAYER S, EKEBERG O M, HALLGREN H B, et al. Ultrasound guided lavage with corticosteroid injection versus sham lavage with and without corticosteroid injection for calcific tendinopathy of shoulder: randomised double blinded multi-arm study [J]. BMJ. 2023;383:e076447.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRAD I J CHAPMANL, TUPALLY K R, et al. A systematic review of ultrasound-mediated drug delivery to the eye and critical insights to facilitate a timely path to the clinic [J]. Theranostics. 2023;13(11):3582\u0026ndash;638.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEID F E, CHEN A T, CHAN K Y, et al. Systematic multi-trait AAV capsid engineering for efficient gene delivery [J]. Nat Commun. 2024;15(1):6602.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDI DONFRANCESCO A, ADELIZZI A, GIRI A, et al. Transabdominal ultrasound guided AAV9-GFP delivery in fetal pigs: a translational and minimally invasive model for in utero fetal gene therapy [J]. Gene Ther; 2025.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLIU R, QU S, XU Y, et al. Spatial control of robust transgene expression in mouse artery endothelium under ultrasound guidance [J]. Signal Transduct Target Ther. 2022;7(1):225.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSHAMLOO A, BOROUMAND A, EBRAHIMI S, et al. Modeling of an Ultrasound System in Targeted Drug Delivery to Abdominal Aortic Aneurysm: A Patient-Specific in Silico Study Based on Ligand-Receptor Binding [J]. IEEE Trans Ultrason Ferroelectr Freq Control. 2022;69(3):967\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCHRISTENSEN G, MINAMISAWA S. High-efficiency, long-term cardiac expression of foreign genes in living mouse embryos and neonates [J]. Circulation. 2000;101(2):178\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHASSAN R. Kupffer cells in hepatotoxicity [J]. Excli j. 2020;19:1156\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCOSTA-VERDERA H, UNZU C et al. VALERI E,. Understanding and Tackling Immune Responses to Adeno-Associated Viral Vectors [J]. Hum Gene Ther, 2023, 34(17\u0026ndash;18): 836\u0026thinsp;\u0026ndash;\u0026thinsp;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTAHA E A, LEE J. Delivery of CRISPR-Cas tools for in vivo genome editing therapy: Trends and challenges [J]. J Control Release. 2022;342:345\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSHIOHAMA Y, FUJITA R, SONOKAWA M, et al. Elimination of Off-Target Effect by Chemical Modification of 5'-End of siRNA [J]. Nucleic Acid Ther. 2022;32(5):438\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHOU X, LIU J. Adeno-Associated Virus Engineering and Load Strategy for Tropism Modification, Immune Evasion and Enhanced Transgene Expression [J]. Int J Nanomed. 2024;19:7691\u0026ndash;708.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSANGAM S, SUN X, SCHWANTES-AN T, H, et al. SOX17 Deficiency Mediates Pulmonary Hypertension: At the Crossroads of Sex, Metabolism, and Genetics [J]. Am J Respir Crit Care Med. 2023;207(8):1055\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRAPTI K, GRIMM D. AAV vector engineering for human aorta transduction: becoming a smooth operator [J]. Gene Ther. 2025;32(4):331\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSCHR\u0026ouml;DER LC, H\u0026uuml;TTERMANN L, KLIESOW REMES A, et al. AAV library screening identifies novel vector for efficient transduction of human aorta [J]. Gene Ther. 2025;32(2):154\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePALALAY JS, SIMSEK A N, REED JL, et al. Shear force enhances adhesion of Pseudomonas aeruginosa by counteracting pilus-driven surface departure [J]. Proc Natl Acad Sci U S A. 2023;120(41):e2307718120.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePIRRUCCELLO J P, R\u0026auml;M\u0026ouml; JT, CHOI SH, et al. The Genetic Determinants of Aortic Distention [J]. J Am Coll Cardiol. 2023;81(14):1320\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBERGER T, DUMFARTH J, KREIBICH M, et al. Thoracic aortic aneurysm [J]. Nat Rev Dis Primers. 2025;11(1):34.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"gene-therapy","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"gt","sideBox":"Learn more about [Gene Therapy](http://www.nature.com/gt/)","snPcode":"41434","submissionUrl":"https://mts-gt.nature.com/cgi-bin/main.plex","title":"Gene Therapy","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"ultrasound-guided left heart injection, thoracic aorta, adeno-associated virus, gene delivery, off-target effect","lastPublishedDoi":"10.21203/rs.3.rs-7412569/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7412569/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThoracic aortic disease poses a significant threat due to its high mortality rates and genetic underpinnings. While gene therapy holds promise for cures, the challenge lies in achieving effective and safe gene delivery to the thoracic aorta. Tail vein injection (TI), is hindered by off-target effects and hepatotoxicity, and traditional blinded percutaneous left heart injection (TLI) carries a heightened risk of bleeding and mortality. To address these limitations, ultrasound-guided techniques present a viable solution. Adeno-associated virus (AAV) vectors were delivered into the thoracic aorta of mice through TI, TLI, and ultrasound-guided percutaneous left heart injection(ULI).While all three injection methods can achieve gene transfection in the thoracic aorta, the ULI approach provides the optimal balance between high transduction efficiency and safety. The ULI method represents an efficient and safe strategy for targeted gene delivery to the mouse thoracic aorta, providing a powerful tool for preclinical aortic gene therapy research that warrants broader application.\u003c/p\u003e","manuscriptTitle":"Ultrasound-guided left heart injection: a safer and more efficient strategy\nfor mouse thoracic aortic gene delivery","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 19:16:26","doi":"10.21203/rs.3.rs-7412569/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-10-09T08:52:41+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-10-03T13:58:28+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-21T13:16:52+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-09-10T09:10:06+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-05T08:52:03+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-08-26T22:36:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-22T08:51:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-22T08:51:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Gene Therapy","date":"2025-08-20T02:10:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"gene-therapy","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"gt","sideBox":"Learn more about [Gene Therapy](http://www.nature.com/gt/)","snPcode":"41434","submissionUrl":"https://mts-gt.nature.com/cgi-bin/main.plex","title":"Gene Therapy","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"844bdfe9-dffe-4927-850f-e3dc54da95af","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":53754420,"name":"Biological sciences/Biological techniques/Gene delivery/Genetic transduction"},{"id":53754421,"name":"Biological sciences/Biological techniques/Gene expression analysis"}],"tags":[],"updatedAt":"2026-03-01T08:05:54+00:00","versionOfRecord":{"articleIdentity":"rs-7412569","link":"https://doi.org/10.1038/s41434-026-00603-7","journal":{"identity":"gene-therapy","isVorOnly":false,"title":"Gene Therapy"},"publishedOn":"2026-02-28 05:00:00","publishedOnDateReadable":"February 28th, 2026"},"versionCreatedAt":"2025-09-03 19:16:26","video":"","vorDoi":"10.1038/s41434-026-00603-7","vorDoiUrl":"https://doi.org/10.1038/s41434-026-00603-7","workflowStages":[]},"version":"v1","identity":"rs-7412569","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7412569","identity":"rs-7412569","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00