BET inhibition revealed varying MYC addiction mechanisms independent of gene alterations in aggressive B-cell lymphomas.

BET inhibition revealed varying MYC addiction mechanisms independent of gene alterations in aggressive B-cell lymphomas. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article BET inhibition revealed varying MYC addiction mechanisms independent of gene alterations in aggressive B-cell lymphomas. Loris Delrieu, Sieme Hamaidia, Emilie Montaut, Andrea Garcia-Sandoval, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4647617/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Dec, 2024 Read the published version in Clinical Epigenetics → Version 1 posted 9 You are reading this latest preprint version Abstract Background. MYC-driven lymphomas are a subset of B-cell lymphomas characterized by genetic alterations that dysregulate the expression of the MYC oncogene. When overexpressed, typically through chromosomal translocations, amplifications, or other mechanisms, MYC can drive uncontrolled cell growth and contribute to cancer development. MYC-driven lymphomas are described as aggressive entities which require intensive treatment approaches and can be associated with poor prognosis. In the absence of direct MYC-targeting therapy, epigenetic drugs called BET inhibitors (BETi), were shown to reduce MYC levels by disrupting BRD4-dependent transcription associated with the expression of MYC , as well as other oncogenes. Here, we used BETi as molecular tools to better understand oncogenic dependencies in a panel of cell line models of MYC-driven B-cell lymphoma selected to represent their genetic heterogeneity. Results. We first showed that, in these models, MYC expression level does not strictly correlate to the presence of gene alterations. Our data also demonstrated that BETi induces similar growth arrest in all lymphoma cell lines independently of MYC mutational status or expression level. In contrast, BETi-induced cell death was only observed in two cell lines presenting the highest level of MYC protein. This suggest that some MYC-driven lymphoma could present a stronger dependency on MYC for their survival which cannot be predicted on the sole basis on their genetics. This hypothesis was confirmed by gene invalidation experiments, which showed that MYC loss recapitulates the effect on BETi treatment on both cell proliferation and survival, confirming MYC oncogene addiction in these specific models. In contrast, the growth arrest observed in cell lines resistant to BETi-induced apoptosis is not mediated through MYC, but rather through alternative pro-proliferative or oncogenic pathways. Gene expression profiling revealed the basal activation of a specific non-canonical Wnt/Hippo pathway in cell death-resistant cell lines that could be targeted in combination therapy to restore BETi cytotoxicity. Conclusion. This work brings new insights into the complexity of MYC dependencies and unravels a novel targetable oncogenic pathway in aggressive B-cell lymphomas. MYC BET inhibition B-Cell Lymphoma oncogene addiction Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background B-cell lymphomas enclose a diverse group of hematological malignancies arising from B lymphocytes, with varying clinical presentations and prognoses. These highly heterogeneous pathologies are categorized based on their histological, immunophenotypic, and genetic features, covering a wide range of distinct entities​ ( 1 ). The dysregulation of MYC oncogene has emerged as a critical factor in the pathogenesis of several subtypes of B cell lymphomas such as Diffuse Large B Cell Lymphoma (DLBCL) and Burkitt Lymphoma (BL) ( 2 ). MYC is a central hub in the growth regulatory signaling networks and its dysregulation has been shown to severely impact growth regulatory signaling leading to uncontrolled cell growth and contributing to lymphoma development ( 3 ). MYC alterations, including translocations, amplifications or mutations, are frequently observed in B-cell Lymphomas, leading to MYC overexpression and oncogenic activity. Chromosomal translocations involving MYC and immunoglobulin (IG) loci, such as t(8;14)(q24;q32) /IGH:: MYC , t(8;22)(q24;q11)/IGL:: MYC and t(2;8;)(p11;q24)/IGK:: MYC , are characteristic of BL and sometimes observed in DLBCL, resulting in MYC activation by IG enhancers ( 4 ). In addition, the amplification of the MYC locus or alterations in its regulatory elements contribute to MYC overexpression in various lymphoma subtypes ( 2 ). The overexpression of MYC in DLBCL is associated with an aggressive clinical behavior and a poor prognosis, especially when co-occurring with BCL2 in subcategories defined as “double expressors” and representing 20–30% of cases. In addition, B-cell lymphomas harboring dual MYC and BCL2 rearrangements have been described as particularly aggressive and treatment-refractory ( 5 , 6 ). This entity, presenting features of both DLBCL and BL, previously referred as “Double Hit Lymphoma” (DHL), has been recently reassigned as “High-grade B-cell lymphoma with MYC and BCL2 rearrangements” (HGBL MYC/BCL2 ) in the current WHO of hematolymphoid tumors ( 7 ). HGBL also encompasses rare cases with a triple rearrangement “triple hit” MYC/BCL2/BCL6 ( 7 ). A DHL-specific gene expression signature has been described and associated with disease aggressivity and averse clinical outcome ( 8 ). Noteworthy, it can be found in absence of any detectable MYC rearrangement suggesting that DHL signature can be activated independently of chromosomal translocations ( 8 ). MYC-driven lymphomas, and especially HGBL, frequently exhibit high proliferative index, resistance to conventional therapies, and increased risk of relapse. Targeting MYC would clearly represent an attracting therapeutical strategy, but the development of direct MYC inhibitors has been challenging due to its transcriptional nature and lack of druggable binding sites. BET (Bromodomain and Extra-Terminal domain) inhibition emerged as a potent epigenetic therapy for MYC-driven malignancies ( 9 ). It is based on the development of small inhibitory molecules targeting BET proteins ( 10 , 11 ), a family of chromatin readers that include four members in humans: BRD2, BRD3, BRD4 and a testis-specific variant BRDT. BET proteins share the same structure with two bromodomains modules (BD1 and BD2) and an extra-terminal (ET) domain in their C-terminal moiety. BET bromodomains recognize acetylated lysines on histone and non-histone proteins, whereas the ET domain can interact with other nuclear proteins, creating a molecular platform that can modulate epigenetic signaling ( 12 ). BRD4, the most extensively studied family member, has been shown to be involved in Polymerase II-mediated transcription by recruiting several transcriptional regulators, including the Mediator complex and activating transcription elongation factor b (P-TEFb) to gene promoters and enhancers ( 12 ). BET inhibitors (BETi) anti-tumor activity has initially been attributed to their repressive effect on MYC transcription in MYC-driven malignancies, such as multiple myeloma ( 13 ), acute myeloid leukemia and Burkitt lymphoma ( 14 ). Later on, two major studies revealed that BETi preferentially suppress BRD4-dependent transcription mediated by super-enhancers in multiple myeloma ( 15 ) and lymphoma ( 16 ) affecting oncogenic and lineage-specific transcriptional circuits. BETi therapeutic activity can therefore be attributed to specific subsets of target genes whose expression would be “hypersensitive” to BET inhibition in a cell-specific context. This has raised hope about the potential of BETi to treat DLBCL or HGBL where MYC, or other oncogene expression, is placed under the control of BRD4-dependant super-enhancers, such as IG regulatory regions. The cellular response to diverse BETi chemical scaffolds has largely been studied in aggressive B-Cell lymphoma ( 14 , 16 – 23 ) using various cellular and mice models of DLBCL, BL and/or HGBL. A large majority of lymphoma cells displayed a G1 cell cycle arrest correlated with a decrease in MYC expression upon BETi treatment. This observation is expected when chromosomal rearrangements place MYC under the control of BET-dependent regulatory sequences, like IG super-enhancers, but is also observed in cellular models with wild-type MYC gene locus ( 14 , 16 , 17 , 23 ). Moreover, a reduction in MYC expression does not always correlate with BET inhibition’s impact on cell proliferation ( 14 ). BETi have also been reported to induce cell apoptosis or senescence in several B-cell lymphoma models ( 14 , 16 – 18 , 23 ), but whether this cytotoxicity depends on MYC status remains unclear. Despite the promising results obtained mainly in blood cancers, BETi clinical development has been impeded by high toxicity levels, potentially caused by off-target effects related to their lack of selectivity towards the 8 human BET BDs ( 24 ). Indeed, this first-generation of BET inhibitors, referred to as pan-BETi, can bind all 8 BET bromodomains. Recent studies have demonstrated the potential of a new generation of inhibitors selective towards BET BD1 or BD2 domains as anti-tumor or anti-inflammatory agents ( 25 , 26 ). These compounds have not yet been evaluated in the context of B-Cell Lymphoma. Nowadays, BETi clinical potential is mostly evaluated in combination therapy rather than single agent, but the severe side effects, modest response rates and lack of biomarkers to predict which patients could benefit from this therapy compromise the future of these molecules to treat hematological malignancies, as well as solid tumors ( 24 ). However, BETi remain powerful molecular tools to study oncogenic and particularly MYC-dependencies in B-cell lymphoma and better understand their biological impact in relation with their genetic alterations. In this setting, we performed an extensive genetic characterization of a panel of HGBL, DLBCL and BL cell lines using cutting-edge genomics technologies. We then used both pan- and selective BETi to modulate MYC and correlate the associated molecular and cellular response to MYC mutational status and expression profiles. This revealed strong MYC oncogene dependencies in some models that could be predicted by higher MYC protein level rather than any other parameters. Gene expression profiling was performed to identify oncogenic pathways that could contribute to MYC-driven lymphoma pathogenesis, leading to the identification of a non canonical Wnt/Hippo pathway that can be targeted in a combination therapeutic strategy to restore BETi sensitivity in resistant MYC-driven lymphoma. Methods Cell lines and culture conditions - OCI-Ly1, OCI-Ly18, SUDHL-6, SUDHL-4, HT, HBL-1, NUDUL-1 (DLBCL), RAJI and RAMOS (BL) cell lines were purchased from DSMZ. B593 DLBCL cell line was developed in house ( 27 ). NUDUL-1, OCI-Ly18, RAMOS cell lines were cultured in RPMI 1640 medium supplemented with 20% fetal bovine serum (FBS), 1% glutamine, 100 mg/mL penicillin/streptomycin. SUDHL-4, SUDHL-6, HT, B593 and RAJI cell lines were cultured in RPMI Glutamax supplemented with 20% FBS, 1 mM sodium pyruvate, 1% minimum essential medium non-essential amino acids (MEM NEAA) and 100 mg/mL penicillin/streptomycin. OCI-Ly1 cell line was grown in IMDM medium with 20% FBS and 100 mg/mL penicillin/streptomycin. Cell culture reagents were purchased from Gibco. All cells were grown at 37°C, 5% CO 2 . Karyotype and FISH – B593, OCI-Ly18, OCI-Ly1, SUDHL-6, SUDHL-4, HT, HBL-1 and NUDUL-1 were prepared in a supplemented cell culture medium for cytogenetic analyses including RPMI, 15% FBS, 1% L-glutamine and 1% penicillin. Karyotype was performed on cell suspension following 17h unstimulated culture. Metaphase preparation slides for chromosome banding analysis were stained to reveal R-banding patterns. Karyotypes were described according to the current version of International System for Human Cytogenetic Nomenclature ( 28 ). Metaphase and interphase fluorescence hybridization (FISH) studies were performed on cytogenetic pellet using Dual Color breakapart probes ( BCL2 , BCL6 and c-MYC , Cytocell) to detect the presence of BCL2 , BCL6 and/or MYC rearrangement. The detection of IGH::MYC rearrangement was performed using a dual color dual fusion probe (XL IGH::MYC DF, Metasystems). Slides were fixed in methanol/acetic acid 3:1 for 30 min, air dried and dehydrated through graded alcohols. Both FISH probes and target DNA were denatured simultaneously for 1 min at 73°C, and incubated for 20h at 37°C. The post-hybridization washes were performed according to the manufacturer’s instructions (Cytocell, Metasystems). A total of 100 nuclei were analyzed for each slide. FISH results on metaphases were interpreted with the karyotype for all cell lines tested. Optical genome mapping (OGM) - OGM was performed for the following cell lines: B593, NUDUL-1, SUDHL4, SUDHL6, OCI-Ly1, OCI-Ly18 and HT. DNA extraction and direct enzymatic labelling - Ultra-high-molecular-weight genomic DNA (UHMW gDNA) was extracted manually from 1.5 million cells using the Prep SP Frozen Cell Pellet DNA Isolation kit according to the manufacturer’s instructions (Bionano Genomics). Briefly, the samples were lysed and digested with Proteinase K, RNase A and Lysis and Binding buffer. DNA was precipitated with isopropanol and bound to a nanobind magnetic disk. Subsequently, DNA was resuspended in the elution buffer and quantified with Qubit Broad Range double-stranded DNA assay kits (ThermoFisher Scientific). UHMW gDNA was incubated for 48h at room temperature for homogenization. DNA labelling was performed following manufacturer’s protocols (Bionano Genomics). Standard Direct Label Enzyme 1 (DLE-1) reaction was carried out using 750 ng of UHMW gDNA. DNA was labelled at a sequence-specific motif (CTTAAG) with DL-green fluorophores. Thereafter, DLE- 1 enzyme was digested using puregene proteinase K (Qiagen) and excess DL-green fluorophores were removed with an adsorption membrane in a microtiter plate. The labelled DNA were counterstained (blue backbone staining) and homogenized for 48h at room temperature before quantification using Qubit High Sensitivity double-stranded DNA assay kits (ThermoFisher Scientific). Data collection and quality metrics - The labelled DNA molecules were loaded on a Saphyr G2.3 chip and molecules were imaged using the Saphyr instrument (Bionano GenomicsSingle linearized DNA molecules travel through nanochannels by electrophoretic migration. For each cell line, multiple cycles were run to collect 800 Gb of data per cell line and reach an average genome coverage of 180X that is sufficient for accurate genomic analysis of a cell line. Specific quality control parameters were evaluated for each cell line to achieve a valid OGM analysis, namely, a map rate ≥ 70%, a label density of 14 to 17 (labels per 100 kbp) and an appropriate labeled DNA length (N50) ≥ 230 kbp of filtered DNA (> 150 kbp) with ≥ 9 labeled sites, according to the manufacturer's instructions. OGM variant calling and data filtering - The capture images were converted to a barcode pattern and aligned to the human genome reference (GRCh38) for annotation. Data were analyzed using Bionano Access software. We applied the two methods provided by the supplier to identify both structural variants (SV) and copy number variants (CNV): i) the Rare Variant Analysis (RVA) pipeline detects SV on the basis of the differences between aligned barcode patterns and the reference genome; this RVA pipeline enables to identify SV and CNV occurring at low frequency (about 10%) and is therefore largely recommended for hematological neoplasms, ii) The De Novo Assembly (DN) pipeline consists of a first reconstruction of the sample genome, which is subsequently compared to the reference genome; this DN pipeline is commonly used to identify germline chromosomal abnormalities but offers three advantages in a context of B-cell lymphoma cell lines: first, a high resolution, enabling detection of fine, cryptic or subtelomeric anomalies (like IGH/14q32.3 rearrangements); second, the capacity of detection of copy neutral loss of heterozygosity (cn-LOH); third, as a complementary and confirmation method together with the RVA pipeline. RNA extraction & RT-qPCR - Total RNA was extracted from 3 million cells with NucleoSpin RNA extraction kit (Macherey-Nagel) according to manufacturer’s instructions. Reverse transcription was carried out following RT SuperscriptTM III kit (Invitrogen RT) from 1µg extracted RNA. Target genes were amplified using PCR primers (MYCforw GGCTCCTGGCAAAAGGTCA, MYCrev CTGCGTAGTTGTGCTGATGT, BCL2forw, GTGGATGACTGAGTACCTGAAC, BCL2rev GAGACAGCCAGGAGAAATCAA, BCL6forw TCTGGAGAGAAGCCCTACAA, BCL6rev CCACAGATTTCACAGGGATAGG, GAPDHforw CCACTCCTCCACCTTTGAC, GAPDHrev ACCCTGTTGCTGTAGCCA) and quantified by qPCR on a thermocycler CF384 Touch Real-Time PCR (Bio-Rad). Ct values (cycle threshold) were analyzed with CFX ManagerTM Software (Bio-Rad) and normalized to GAPDH. RNA sequencing – Cell lines were treated with 500 nM JQ1 for 24h. Total RNA was extracted and purified according to the procedure mentioned in the RNA extraction & qPCR section. RNA paired-ended sequencing and stranded library were performed by BGI Genomics or GenomEast (IGBMC, Strasbourg, France) sequencing facilities from 500ng total RNA. Sequencing depth was at least 30 million reads per sample. Reads were quality-checked using FastQC. Reads were then aligned to H. sapiens genome build hg38 using STAR 2.7.1a (Dobin et al., 2013). Raw read counts for each gene were calculated using HTSeqCount 0.11.2 using defaults parameters ( 29 ). Read count data was normalized using RPM normalization and DESeq2 1.32. ( 30 ). Analyses were performed with R release 4.1.0. DESeq2 normalized read counts were used to identify differentially expressed genes with an adjusted p-value < 0.05 and a fold change below − 1.5 or above 1.5. Enrichment analysis were performed using GSEA software ( 31 ) and Cluster Profiler R package ( 32 ). Western blot – Proteins were extracted from 5 million cells with 100 µL of RIPA buffer (150 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1% NP-40). Lysates were incubated 30 min at 4°C under agitation. Samples were then sonicated with VibraCell sonicator (15 sec ON/OFF for 1 min per sample). Then, samples were centrifuged 20 min at 16,000g and 4°C to clear insoluble material and quantified with Bradford protein assay. 10 µg of each sample was loaded on a gradient gel NuPAGE 4–12% Bis-Tris (Invitrogen) and run in MES buffer (Invitrogen). The proteins were transferred on an activated PVDF membrane for 1h at 100V at 4°C in Tris Glycine 10% ethanol. Membranes were blocked in either 5% milk or BSA in PBS-Tween (PBST) or TBS-Tween (TBST) for 1 hour, and incubated overnight with primary antibodies under constant rotation at 4°C. The following primary antibodies were used: anti-MYC 1/1,000 TBST 5% BSA (rabbit, #A9169, Cell Signaling), anti-BCL2 1/1,000 PBST 5% milk (mouse, #sc-7382, Santa-Cruz Biotechnology), anti-BCL6 1/2,000 PBST 5% milk (mouse, #sc-7388, Santa-Cruz Biotechnology), anti-BRD4 1/1,000 PBST 5% milk (rabbit, # A301-985A, Bethyl laboratories), anti-BRD3 1/1,000 PBST 5% milk (rabbit, #A302-368A, Bethyl laboratories), anti-BRD2 1/2,000 PBST 5% milk (rabbit, #A302-583A, Bethyl laboratories), anti-αTubulin 1/5,000 PBST 5% milk (mouse, #T5168, Merck), anti-H4 1/5,000 PBST 5% milk (rabbit, #05-858, Upstate). The membranes were washed three times in PBST or TBST, incubated with the following secondary antibody: goat anti-rabbit IgG peroxidase 1/10,000 (#A9169-2ML, Merck) or polyclonal rabbit anti-mouse IgG peroxidase 1/2,000 (#P026002-2, Agilent) for 1h at room temperature, washed three times and revealed with Luminol/peroxidase mix Clarity Western ECL (Biorad). Acquisitions were realized using Vilber imaging system. Signal quantification was performed with ImageJ. Establishment of inducible MYC knock-down cell lines – shRNA sequences either targeting MYC (shMYCA: GCAATCACCTATGAACTTGTT and shMYCB: GACGACGAGACC TTCATCAAA) ( 33 ) or non-targeting (shControl: CCTAAGGTTAAGTCGCCCTCG) were used. Oligos were annealed and ligated by T4 ligase with the pLKO Tet-On inducible plasmid previously digested with AgeI/EcoRI ( 34 ). Lentiviral particles were produced by the ANIRA platform (ENS Lyon, France). B593, SUDHL-4 and OCI-Ly1 cell lines were transduced with lentiviral particles at multiplicity of infection (MOI) of 10, and NUDUL-1 with a MOI of 20. Viral particles were washed away after 24h. 1 µg/mL of puromycin was added at day 3 post-infection. Induction was performed with doxycycline at 200ng/mL during 72h for B593, SUDHL-4 and OCI-Ly1 or with 500 ng/mL during 72h for NUDUL-1. Knockdown efficiency was assessed by Western Blot. Cell cycle analysis – 1 million cells were harvested and washed with PBS. Cell pellets were resuspended in 100µL PBS and fixed with 900µL of cold ethanol (70%) added drop by drop under constant agitation of the sample collection tube. After 30 min, the samples were stored at -20°C for some days. The day of the analysis, samples were slowly thawed at 4°C and then centrifuged (2,000 rpm, 10 min). Cell pellets were resuspended in 1 mL of PBS in order to complete rehydration of the fixed samples during 4h at 4°C. After rehydration, cells were collected by centrifugation (2,000 rpm, 5 min) and resuspended in 1 mL PBS, 10 µg/mL of RNAse A (Sigma Aldrich) and 10 µg/mL propidium iodide (Sigma Aldrich). Samples were incubated at room temperature in the dark during 30 min before being analyzed by flow cytometry (LSRII, BD Biosciences). Data were analyzed using ModFit LT software. Assessment of cell proliferation and cell death – Cell viability and proliferation were determined by dual Annexin V-FITC (BD Biosciences) and propidium iodide (Sigma Aldrich) staining and by numeration of the absolute count of fluorescent beads (Precision count beads, Biolegends) and cells ratio. 0.1µg/mL Annexin V was diluted in Binding buffer solution (0.1 M HEPES pH7.4, 1.4 M NaCl, 25 mM CaCl 2 ). Next, cells were harvested and washed with PBS and stained in 100 µL of Annexin V staining mix at room temperature for 10 min in the dark. Then, 100 µL of Binding Buffer 1X and 50 µL of Precision count beads were added. Finally, 5 µg/mL propidium iodide is added at the last minute before flow cytometry analysis (10,000 events analyzed per condition). Live cells, apoptotic cells, and fluorescent beads populations were gated in order to get the number of events for each population. Cell viability was determined by the ratio of the number of alive cells events (AnV-/IP-) and that of apoptotic cells events (AnV+/IP-, AnV+/IP+) comparing to the total number of events. Cell proliferation was determined based on absolute cell counts calculated as follow: absolute cell count (cells/µl) = (cell count/”precision count beads” counts) x ”precision count beads” concentration (beads/µl). Data were acquired using LSRII (BD Biosciences) or Attune NxT (Thermo Fisher Scientific) flow cytometer. BET inhibitors treatments – Dose response experiments were performed on all DLBCL and BL cell lines in order to determine IC50 of 6 BET inhibitors of different selectivity. JQ1 was synthesized as described previously ( 35 ). I-BET726, I-BET762 and RVX-208 have been purchased from Selleckchem. GSK-046 has been purchased from Chemietek and ABBV-744 from Abmole. All compounds were dissolved in DMSO. Cell lines were treated for 6h to 72h at the indicated doses. Statistics - Statistical analyses and graphical representations were performed with R (release 4.1.0) or GraphPad Prism (v10) as indicated Mixed nonlinear statistical modeling - The general specification of models is: Mij = b0 + b1 Treatmentij + b2 Gene_Levelij + b3 Treatmentij X Gene_Levelij + uj, where Mij is the number of dead cells of data i within cell line j, beta0 is the fixed intercept term, b1 is the fixed coefficient of the covariate Gene_Level (RNA-seq corresponding to gene expression), b2 is the fixed coefficient of the covariate Treatment representing the effect of JQ1 treatment versus control DMSO, b3 represents the fixed effect associated with the Treatment by Gene_Level interaction and uj is the random effect associated with the intercept for cell line j. Nonlinear relationship between cell mortality and Gene_Level was explored by restricted cubic spline (RCS) modeling. Models were fitted via restricted maximum log likelihood (REML). All statistical analyses from models were performed after non-parametric bootstrap data resampling with replacement (2,000 replicates) with bootstrap samples taken independently within each cell line considered as stratum. The overall statistical significance of the interaction terms between Treatment covariate and RCS covariates evaluating the nonlinearity hypothesis was tested by a Wald test. A REML-based likelihood ratio test was used to test the variance of the random cell line effects. Both nonlinearity of models and random effects were retained with p < 0.001. Statistical significance of predicted JQ1/DMSO ratios of cell mortality number at various percentiles of Gene_Level (percentile 10th to percentile 100th) were performed by a Wald test. Elasticity (E) was used to compare the effect of different genes on cell mortality M. The elasticity of M with respect to Gene_Level is the proportional (%) change in M for a proportional (1%) change in Gene_Level. Data were analyzed using Stata 16.1. Estimate margin effects (predicted mortality) in models using transformed gene level data with RCS was obtained by the f_able post-estimation command. Results Genetic and expression profiling of B-Cell lymphoma model cell lines We first performed an extensive characterization of gene alterations in a panel of 10 B-cell lymphoma cell lines, selected to reflect disease heterogeneity. We have tested 5 HGBL (High grade B-cell Lymphoma) and 3 DLBCL (Diffuse Large B Cell Lymphoma) cell lines, as well as 2 Burkitt lymphoma (BL) cell lines, characterized by an IG::MYC gene rearrangement. First, karyotyping and FISH analyses were performed using probes covering MYC , BCL2 and BCL6 loci (Fig. 1 A and S1A). Involvement of IG gene loci together with MYC or BCL2 was also specifically investigated using dual-fusion FISH probes (Fig. 1 A and S1A). Concomitant MYC and BCL2 gene rearrangements were confirmed for 4 cell lines (namely B593, OCI-Ly18, OCI-Ly1 and SUDHL6), confirming their HGBL status. SUDHL-4 was also identified as a triple-hit with non- IG::MYC , non- IG::BCL6 and IG::BCL2 gene rearrangement. OGM was also performed to fully characterize gene rearrangements and copy number variants for all cell lines (Fig. 1 A, S1B) and further confirmed the above observations derived from conventional cytogenetic methods. Targeted sequencing using a panel of 20 genes frequently mutated in lymphoma revealed mutations in BCL2 , EZH2 or TP53 in 4 out of the 8 HGBL/DLBCL cell lines ( Fig S1 C ) consistently with previous reports ( 36 , 37 ). In addition, the mutational status of MYC second exon, presenting frequent occurrence of clustered mutations, was explored by Sanger sequencing. This analysis revealed the presence of a stabilizing T58 substitution ( 38 ) in NUDUL-1 cell line ( Fig S1 C ), as well as other MYC somatic variants in B593 and OCI-Ly18 lines. The impact of these genetic alterations on mRNA and protein levels has been assessed for MYC, BCL2, BCL6. They appear very heterogeneous among cell lines (Fig. 1 B-D). Of note, whereas mRNA and protein levels correlate for BCL2 (Fig. 1 C), this is not the case for MYC (Fig. 1 B) and BCL6 (Fig. 1 D), most likely due to post-transcriptional regulation events. For MYC , the presence of IG or non-IG rearrangement does not systematically drive high mRNA expression (Fig. 1 E, left ). Of note, IG::MYC gene rearrangement, especially when co-occurring with MYC stabilizing mutations can still translate into very high MYC protein levels as observed for NUDUL-1 cell line (Fig. 1 B). Similarly, if most IG::BCL2 rearranged cells have higher mRNA and protein expression, BCL2 remains low in B593 line (Fig. 1 E, middle ). No such correlation between gene rearrangement and expression level could be observed for BCL6 (Fig. 1 E, right ). Altogether, this systematic analysis of MYC , BLC2 and BCL6 rearrangements, mutational status and expression levels showed that IG and non-IG rearrangements are not always associated with higher protein levels in lymphoma lines. Particularly for MYC, additional stabilizing mutations or post-transcriptional events can also affect protein levels and mitigate the functional impact of chromosomal rearrangements, which contribute to explain why cannot be used at sole indicators of MYC-signaling activation. Evaluation of lymphoma cells response to pan- and BD2-selective BET inhibitors These 10 model cell lines were then subjected to BETi treatment. We chose to evaluate both pan-BETi (JQ1, IBET-762 and IBET-726) and BD2-selective compounds (RVX-208, GSK-046 and ABBV-744) of different chemical scaffolds. In vitro IC50 towards BD1 and BD2 are represented in Fig. 2 A. Dose-response experiments were conducted on 5 HGBL, 2 DLBCL and 2 BL cell lines to determine the impact of each of these inhibitors on cell proliferation and viability (Fig. 2 B). Data could not be obtained for HBL-1 cell line due to high spontaneous mortality rate. Analysis of cell proliferation revealed a globally similar growth arrest of pan-BETi across all cell lines (Fig. 2 C and S2) with IC50 in the 100 nM – 1 µM range. In comparison, BD2-selective compounds exhibited a modest effect on cell proliferation except for ABBV-744 (Fig. 2 C and S2). This could be expected since ABBV-744 was described to have anti-tumor activity in prostate cancer models ( 25 ), whereas RVX-208 and GSK-046 were essentially reported for their anti-inflammatory effect ( 26 , 39 , 40 ). Of note, the cytostatic activity of BETi compounds on lymphoma cells seems to be related to their in vitro inhibitory activity towards BD1 bromodomains (Fig. 2 A and 2 C) independently of their molecular scaffold or activity towards BD2. In contrast, analysis of cell viability revealed heterogeneous responses across the different cell lines, with B593 and NUDUL-1 showing a high sensitivity to BETi-induced cell death (Fig. 2 D). As observed for cell proliferation, ABBV-744 was the only BD2-selective BETi impacting lymphoma cell viability (Fig. 2 C), even though in a lesser extent compared to pan-BETi. Again, this is most likely due to ABB-744 higher residual activity towards BD1 compared to other BD2-selective compounds. Altogether these results show that pan-BETi, as well as ABBV-744, have a similar cytostatic activity in DLBCL and BL cell models independently of MYC mutational status. However, their cytotoxic activity differs between cell lines models, defining 2 classes of lymphomas lines, either sensitive or resistant to BET-induced cell death. We next investigate which molecular determinants could drive these phenotypes and whether they could be related to MYC oncogenic dependency. BETi cytotoxicity correlates to MYC basal protein level First, we tested whether BET protein basal levels could explain how lymphoma cells respond to BETi. Western blot analysis of BRD2-4 protein levels, revealed rather constant level of BRD4, where BRD2 and BRD3 present heterogeneous protein profiles across cell lines ( Fig S3A ). However, no significant association could be observed between BRD2-4 levels and BETi-induced cell death. We then questioned whether BETi could induce distinct BRD4 chromatin binding between cell death sensitive (B593 and NUDUL-1) and resistant cellular models (SUDHL4 and OCY-Ly1). BRD4 levels were quantified in chromatin, as well as in nuclear and cyto-soluble fractions ( Fig S3B ). These data confirmed that JQ1 induces a massive release of chromatin-bound BRD4, with a relocalization into soluble fractions. As expected from previously published data ( 25 ), BRD4 remains mostly associated to chromatin upon ABBV-744 BD2-selective treatment ( Fig S3B ), most likely because the action BRD4 BD1 is sufficient to anchor it to chromatin. In any case, we could not highlight any association between BET release from chromatin and response to BETi these models. To further explore MYC, BCL2 and BCL6 involvement in BETi response in DLBCL cell lines, we treated B593 and NUDUL-1 (cell death sensitive) as well as SUDHL-4 and OCI-Ly1 (cell death resistant) cell lines with 500nM of JQ1 and ABBV-744 for 6h and 24h and evaluated MYC, BCL2 and BCL6 protein levels by western blot. The results showed that JQ1 induces a similar decrease in MYC protein level in both BETi sensitive and resistant cell lines ( Fig S3C ). This indicates that MYC downregulation could not be as central as thought in the BETi anti-tumor effects. Moreover, MYC decrease is not higher in MYC -rearranged cells as it could be expected. Interestingly, we also noticed that the BD2-selective compound ABBV-744 induced a decrease in MYC expression only in SUDHL-4 and OCI-Ly1 cell death-resistant models. This suggests a distinct mechanism of action of BD2-selective compounds between these models. No change in BCL2 or BCL6 could be detected under these conditions of BETi treatment, suggesting they do not play a role in response to BET inhibition in this setting. Next, we investigated whether lymphoma subtype, MYC or BCL2 rearrangement or mutation status could influence BETi-induced cell death, without being able to link any of these parameters to BETi cytotoxicity (Fig. 3 A). Several other determinants have been previously suspected to be related to response to BETi, including BRD4, MYC and BCL2 protein levels, MYC/BCL2 ratio and MYC/BCL2 fold decrease upon treatment ( Fig. 3 B, left) . Correlation analyses revealed that MYC protein level is the only determinant that is strongly correlated (R 2 = 0.93, p < 0.001) to BET cytotoxicity ( Fig. 3 B right) , independently of any genetic defects ( Fig. 3 A ) or any of the parameters evaluated here ( Fig. 3 B left and S3) . These data suggest that high MYC basal protein level is the main driver of BETi-induced cell death and could be used, rather than MYC rearrangements or mutations, to predict MYC dependency in B-cell lymphoma. BETi-induced cell death is restricted to MYC-addicted lymphoma cell lines To further characterize MYC involvement in BETi-induced lymphoma cell death, we compared the respective impact of MYC knockdown and JQ1 treatment on cell proliferation and cell cycle for B593, NUDUL-1, SUDHL-4 and OCI-Ly1 cell lines. Similar levels of MYC downregulation were achieved with both approaches except for NUDUL-1 cell line in which knock-down efficacy was limited ( Fig S4 ). This might be explained by the stabilizing T58 mutation present in this cell line. Follow-up of cell proliferation for 72h showed that, as described above (Fig. 2 C), JQ1 induces a growth arrest in all four cell lines (Fig. 4 A). In contrast, MYC knockdown reduces proliferation only in B593 and, to a lesser extend, to NUDUL-1. These data suggest that MYC is not mediating the growth arrest observed upon BETi treatment in SUDHL-4 and OCI-Ly1. This was further confirmed by cell cycle analysis, that revealed that the G1 arrest induced by JQ1 can only be recapitulated in B593 and, to a lesser extend in NUDUL-1 cells. In cell viability assessment, MYC knockdown also phenocopy JQ1-induced apoptotic cell death in B593. The same tendency is observed for NUDUL-1, even if statistical significance was not reached. In contrast, no apoptosis could be detected neither for SUDHL-4 and OCI-Ly1 upon MYC knock-down (Fig. 4 C). Taken together, these results show that B593 and NUDUL-1 sensitivity to BETi-induced cell death could be explained by their addiction to MYC oncogene. Moreover, the growth arrest observed in models resistant to BETi-induced cell death does not seem to be mediated through MYC, but rather through alternative pro-proliferative or oncogenic pathways. This suggests that MYC-driven lymphomas exhibit different levels of activation and dependency on MYC signaling, even though they present similar genetic alterations. Resistance to BETi cytotoxicity is associated with innate activation of non-canonical WNT pathway and activation of YAP/TEAD To get a global view of the genes and pathways affected upon BETi treatment, we performed gene expression profiling for the 9 HGBL, DLBCL and BL cell lines using RNA sequencing. First, we compared changes in gene expression profiles between control and JQ1-treated cells. Numbers of commonly affected genes between cell lines are detailed for downregulated ( Fig S5A, left ) and upregulated ( Fig S5A, right ) genes. Few genes were commonly affected by BETi between cell lines regardless of whether they present similar MYC alterations or sensitivity to BETi cytotoxicity. On the other hand, a gene set enrichment analysis (GSEA) revealed that global cellular responses were very similar for all cell lines with alteration of pathways related to inflammation and MYC signaling as previously reported ( Fig S5B ). Here, again no specific pathways could be related to MYC addiction or sensitivity to BETi cytotoxicity. We then compared for each cell line, genes affected by copy-number variants (CNV) or chromosomal rearrangement and genes impacted by JQ1 treatment to determine whether they would represent preferential BETi-target genes ( Fig S5C ). However, no such association could be found from this set of data. We next investigated basal gene expression profiles between MYC dependent, which are sensitive to BETi cytotoxicity, and resistant cell line models. This revealed downregulation of 362 and up-regulation of 1741 genes in cell lines resistant to BETi-induced cytotoxicity ( Table S1 ). Using GSEA and gene ontology analyses, we showed an enrichment in MYC targets ( Fig. 5 A, up) , as well as increase ribosomal and protein biosynthesis activity associated with MYC signaling ( Fig. 5 A, down) , further confirming the link between BETi-induced cytotoxicity and MYC dependency. On the other hand, genes related to Wnt signalling are largely enriched in MYC-independent cell lines resistant to BETi-induced cell death (Fig. 5 A, up ). Interestingly, these same signatures were also observed when comparing the two groups after JQ1 treatment, indicating that they still contribute to differentiate them post-treatment ( Fig S5C ). Gene ontology analyses revealed enrichment in membrane receptor signalling and cell fate commitment genes (Fig. 5 A, down ) that could be related to Wnt pathway. We then investigated more specifically which members of this pathway were affected. We could not detect any difference between effectors of the canonical Wnt pathway at the transcriptional level, as exemplified by DVL1, AXIN1 or beta-catenin (CTNNB1) (Fig. 5 B, up ). However, one very specific non-canonical Wnt pathway connected with Hippo signaling described in MEF cells ( 41 ) and breast cancer ( 42 ) seems to be activated in cells resistant to BETi-induced cytotoxicity as shown by WNT5A and WNT5B (Fig. 5 B, down ) increased expression. Accordingly, the downstream transcription factors YAP and TEAD family transcription were restricted to MYC independent cell lines (Fig. 5 C). Intrinsic activation of this signaling pathway, which has been described as connected to stemness and drug resistance could therefore represent a novel oncogenic pathway in MYC-driven lymphoma that do not present a MYC addiction. The opposite effect of MYC and WNT5B/TEAD3-4 on BETi sensitivity was further confirm by mathematical modeling using mixed linear models and elasticity assessment (Fig. 5 D and Fig S5E). This was further supported by the inverse correlation between MYC and YAP in the NCICCR-DLBCL TBGA DLBCL patient cohort (Fig. 5 E). To further confirm the cooperation of MYC and Hippo pathway, we evaluated the YAP/TEAD small molecule inhibitor, CA-3. Low doses CA-3 treatment did not impact cell viability in any of the models tested. However, combining JQ1 and CA-3 (YAP/TEAD inhibitor) can restore JQ1 cytotoxicity in MYC-independent cell lines (Fig. 5 F). Discussion MYC-driven lymphomas represent an heterogenous groups of B-cell lymphoma characterized by diverse alterations leading to MYC oncogene overexpression ( 2 ). Although these pathologies are generally viewed as aggressive and treatment refractory entities, the type of MYC alterations, together with the presence of additional genetic defects, can influence lymphoma progression and patient prognosis ( 3 ) ( 43 ). However, the actual MYC activity and dependency in each specific context remains unclear. Chromosomal translocations involving MYC locus have been reported to be associated with inferior outcomes especially together with concurrent BCL2/BCL6 gene rearrangements defining the HGBL subtype ( 43 ). When MYC rearrangements involve IG as partner genes, MYC expression can be placed under the control of BET-dependant super-enhancers present on IG regulatory regions leading to particularly elevated MYC protein levels. This provides an obvious rational to use BET inhibition as a therapeutic strategy in this specific context. During the past 10 years, response to BETi has been the focus of a large effort in both pre-clinical and clinical research, showing that BETi possess significant antitumor activity in various cancers. Their potential to treat hematological malignancies, and particularly MYC driven blood cancers, has been clearly demonstrated in mechanistical and pre-clinical studies in B-Cell lymphoma including DLBCL, BL and HGBL ( 16 , 44 – 51 ) and myeloma ( 13 , 14 , 52 ) and as well as clinical studies ( 53 – 58 ). However, molecular, cellular and clinical responses to BETi treatment are highly variable, presumably due to the high degree of genetic and biological heterogeneity found even within one single subtype of these pathologies. In addition, BETi have been shown to be associated with a high level of toxicity and induce severe side effects that hamper their clinical development ( 59 ). These studies nevertheless revealed that BETi leads to a G1 cell cycle arrest, concomitant with a decrease in MYC expression, in a large majority of lymphoma cell lines ( 14 , 16 – 23 ), as in several other types of hematological malignancies and solid tumors. Cell apoptosis was also described upon BETi treatment in some lymphoma models ( 14 , 16 – 18 , 23 ) but could not be associated to any specific entity or gene alteration. Interestingly, these responses are not restricted to cellular models where chromosomal rearrangements place MYC under the control of BET-dependent regulatory sequences, such as super-enhancers, but were also observed in cellular models with other types of MYC gene alterations or even wild-type MYC gene locus ( 14 , 16 , 17 , 23 ). Moreover, reduction in MYC expression does not always correlate with BET inhibition’s impact on cell proliferation (Mertz et al., 2011). Altogether, this suggests that MYC downregulation by itself may not be as central as thought mediating response to BETi. This could also imply that lymphoma cells could present elevated MYC activity, and subsequent high dependency on MYC for their survival independently of MYC gene alteration. To elucidate these aspects, we examined MYC regulation, activity and signaling using various pan- and BD2-selective BET inhibitors as molecular tools in a panel of B-cell lymphoma cell lines presenting diverse MYC alterations and concurrent oncogene expression. First, we performed a detailed genetic characterization of aggressive B-Cell Lymphoma cellular models, including HGBL, DLBCL and BL, to unambiguously characterize their mutational profiles, including both structural and sequence alterations. Our data first showed that MYC , BCL2 or BCL6 gene rearrangements, including those involving IG regulatory regions, frequent in B-cell lymphomas, do not always translate in an increased gene expression, consistently with recently published studies ( 43 , 60 ). However, it should be noted that these data have been obtained from model cell lines with very complex karyotypes that might not reflect genetic abnormalities in patient material. We then tested BETi with different scaffold and selectivity and showed that cellular responses were very similar for pan-BETi of different scaffold and mainly dependent of their activity towards BD1. This is in line with a recent report showing the preferential efficacy of BD2-selective on induced gene expression such as immune response, rather than on oncogene expression ( 26 ). This led us to focus the rest of our study on the prominent and largely studied JQ1 pan-BETi. We have shown that BETi exhibit similar cytostatic profiles, but different cytotoxicity profiles across the model cell lines tested. Among all gene alterations and expression profiles evaluated, MYC protein expression was the only parameter strictly correlated to BETi-induced cell death, suggesting it could be used as a surrogate marker for MYC dependency. Of note, evaluation of MYC level by immunohistochemistry is not correlated to patient prognosis in DLBCL ( 61 ). This apparent discrepancy could be due to either: i) immunohistochemistry lacking the quantitative precision to distinguish very high levels of MYC expression, or ii) MYC dependency not being indicative of treatment response. Invalidation of MYC expression in models sensitive to BETi cytotoxicity confirm their addiction to MYC expression for both cell growth and cell survival. In contrast, in models resistant to BETi cytotoxicity, the cytostatic effect observed does not seem to be mediated through MYC, even in presence of MYC rearrangement, which was thought be a major indicator of MYC dependency. By analyzing JQ1 global impact on gene expression, we showed that the response to BETi is very different between cell lines, with few commonly impacted genes. None of them could be specifically associated with BETi-induced cell death in MYC-dependent cell lines. Analysis of changes in gene expression profiles does not therefore seem to be efficient to identify drivers of BETi cytotoxicity besides MYC addiction. We could neither correlate JQ1-induced changes in gene expression with any CNV or chromosomal alterations determined by OGM. This suggest that genes affected by structural variations, including chromosomal rearrangements involving the IG loci, are not preferential transcriptional targets of JQ1. However, the sample size used here may not be sufficient to draw a definite conclusion. However, this set of data allowed to highlight the innate activation of Wnt pathway related to a stemness signature. Wnt pathway was already connected to BET inhibitors resistance, but in the context of acquired resistance in leukemia stem cells ( 62 ). A detailed analysis of gene expression data suggested that, effectors of canonical Wnt pathway were not different between the 2 groups of lymphoma cell lines. In contrast, our data revealed a specific alternative pathway involving WNT5A and WNTB ligand and downstream Hippo pathway through YAP and TEAD transcription factors, that form, when co-expressed, a transcriptionally active complex controlling pro-proliferative programs. This pathway was previously described in breast cancer and related to altered cell migration and differentiation phenotypes ( 41 ) but has never been described in another context to our knowledge. Even, if our conclusions are only drawn from gene expression data, mathematical modeling confirmed the involvement of WNT5B and TEAD in driving resistance to JQ1-induced cytotoxicity in MYC independent models. Several studies have already related Hippo transcriptional regulators and co-activators YAP, TAZ and TEAD resistance to chemotherapy, but also to several types of targeted therapies (hormone, small molecules inhibitors, inhibitors of immune checkpoint) ( 63 , 64 ). Interestingly, two recent papers report several connections between YAP/TAZ and BET proteins in lung and breast cancer ( 65 , 66 ). These papers show that i) YAP/TAZ and TEAD are directly regulated by BRD4 and ii) a direct interaction of BRD4 on the promoter of YAP/TAZ target genes. Accordingly, YAP signaling can therefore be inhibited by BETi. In the context of lymphoma cells, we showed that YAP/TEAD are still expressed upon BETi treatment and might contribute to resistance to BET inhibition in MYC independent cellular models. Our data strongly suggest that Wnt/Hippo crosstalk could represent a novel oncogenic pathway in B-Cell lymphoma associated with innate BETi resistance in MYC-independent models, and confirmed it represents a novel therapeutic vulnerability to design combination therapy. In conclusion, our study provides new insight into the complexity of the molecular mechanisms underlying MYC and related oncogenic signaling in B-cell lymphoma. Our findings also pave the way for the development of rationalized combination therapies strategies that could be validated in further preclinical and clinical studies. Declarations Ethics approval and consent to participate Non applicable Consent for publication Non applicable Competing interests The authors declare that they have no competing interests. Funding This work is supported by the French National Research Agency in the framework of the "Investissements d’avenir” program (ANR-15-IDEX-02) that provided PhD studentship to LD. This work has also been supported by CBH-EUR-GS (ANR-17-EURE-0003) and Grenoble University Hospital Innovative Research Fund (AO Interne CHUGA). CL has been supported by ARAMIS association and Grenoble University Hospital Innovative Research Fund to develop OGM. Author Contribution LD, SH, AGS and CT performed cellular experiments and analyzed data. SC and CL performed genomics (OGM and targeted NGS) experiment and analyzed data. EM, PBF and TB performed bioinformatics and biostatistics analysis. TB, SC, RG, CL, JG and AE conceived and designed the study. JG and AE coordinated the study. All authors reviewed the manuscript. Acknowledgement We acknowledge the contribution of SFR Biosciences (UAR3444/CNRS, US8/Inserm, ENS de Lyon, UCBL) facilities especially AniRA lentivectors production facility from the CELPHEDIA Infrastructure (Gisèle Froment, Didier Nègre and Caroline Costa). We thank the Microcell core facility of the Institute for Advanced Biosciences (UGA - Inserm U1209 - CNRS 5309), especially Mylene Pezet and Solenne Dufour, for their help with flow cytometry experiments. This facility belongs to the IBISA-ISdV platform, member of the national infrastructure France-BioImaging supported by the French National Research Agency (ANR-10-INBS-04). Data Availability Gene expression (RNaseq) data generated and analysed during the current study are available in the GEO repository (pending accession number). List of differentially expressed genes between cell lines sensitive and resistant to BETi-induced cell death are presented in Table S1. OGM and targeted sequencing raw and processed data are available from the corresponding author on reasonable request. References Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, et al. The 2016 revision of the World Health Organization classification of lymphoid neoplasms. Blood. 19 mai 2016;127(20):2375–90. Bisso A, Sabò A, Amati B. MYC in Germinal Center-derived lymphomas: Mechanisms and therapeutic opportunities. Immunol Rev. 2019;288(1):178–97. Ott G, Rosenwald A, Campo E. Understanding MYC-driven aggressive B-cell lymphomas: pathogenesis and classification. 2013; Xia Y, Zhang X. The Spectrum of MYC Alterations in Diffuse Large B-Cell Lymphoma. Acta Haematol. 19 févr 2020;143(6):520–8. Sarkozy C, Traverse-Glehen A, Coiffier B. Double-hit and double-protein-expression lymphomas: aggressive and refractory lymphomas. Lancet Oncol. 1 nov 2015;16(15):e555–67. Scott DW, King RL, Staiger AM, Ben-Neriah S, Jiang A, Horn H, et al. High-grade B-cell lymphoma with MYC and BCL2 and/or BCL6 rearrangements with diffuse large B-cell lymphoma morphology. Blood. 3 mai 2018;131(18):2060–4. Alaggio R, Amador C, Anagnostopoulos I, Attygalle AD, Araujo IB de O, Berti E, et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Lymphoid Neoplasms. Leukemia. juill 2022;36(7):1720–48. Ennishi D, Jiang A, Boyle M, Collinge B, Grande BM, Ben-Neriah S, et al. Double-Hit Gene Expression Signature Defines a Distinct Subgroup of Germinal Center B-Cell-Like Diffuse Large B-Cell Lymphoma. J Clin Oncol. 20 janv 2019;37(3):190–201. Cochran AG, Conery AR, Sims RJ. Bromodomains: a new target class for drug development. Nat Rev Drug Discov. août 2019;18(8):609–28. Filippakopoulos P, Qi J, Picaud S, Shen Y, Smith WB, Fedorov O, et al. Selective inhibition of BET bromodomains. Nature. déc 2010;468(7327):1067–73. Nicodeme E, Jeffrey KL, Schaefer U, Beinke S, Dewell S, Chung C wa, et al. Suppression of inflammation by a synthetic histone mimic. Nature. déc 2010;468(7327):1119–23. Filippakopoulos P, Knapp S. Targeting bromodomains: epigenetic readers of lysine acetylation. Nat Rev Drug Discov. mai 2014;13(5):337–56. Delmore JE, Issa GC, Lemieux ME, Rahl PB, Shi J, Jacobs HM, et al. BET Bromodomain Inhibition as a Therapeutic Strategy to Target c-Myc. Cell. sept 2011;146(6):904–17. Mertz JA, Conery AR, Bryant BM, Sandy P, Balasubramanian S, Mele DA, et al. Targeting MYC dependence in cancer by inhibiting BET bromodomains. Proc Natl Acad Sci U S A. 4 oct 2011;108(40):16669–74. Lovén J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al. Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell. 11 avr 2013;153(2):320–34. Chapuy B, McKeown MR, Lin CY, Monti S, Roemer MGM, Qi J, et al. Discovery and Characterization of Super-Enhancer-Associated Dependencies in Diffuse Large B Cell Lymphoma. Cancer Cell. déc 2013;24(6):777–90. Boi M, Gaudio E, Bonetti P, Kwee I, Bernasconi E, Tarantelli C, et al. The BET Bromodomain Inhibitor OTX015 Affects Pathogenetic Pathways in Preclinical B-cell Tumor Models and Synergizes with Targeted Drugs. Clin Cancer Res. 1 avr 2015;21(7):1628–38. Ceribelli M, Kelly PN, Shaffer AL, Wright GW, Xiao W, Yang Y, et al. Blockade of oncogenic IκB kinase activity in diffuse large B-cell lymphoma by bromodomain and extraterminal domain protein inhibitors. Proc Natl Acad Sci. 5 août 2014;111(31):11365–70. Cummin TEC, Cox KL, Murray TD, Turaj AH, Dunning L, English VL, et al. BET inhibitors synergize with venetoclax to induce apoptosis in MYC-driven lymphomas with high BCL-2 expression. Blood Adv. 28 juill 2020;4(14):3316–28. Esteve-Arenys A, Valero JG, Chamorro-Jorganes A, Gonzalez D, Rodriguez V, Dlouhy I, et al. The BET bromodomain inhibitor CPI203 overcomes resistance to ABT-199 (venetoclax) by downregulation of BFL-1/A1 in in vitro and in vivo models of MYC+/BCL2 + double hit lymphoma. Oncogene. avr 2018;37(14):1830–44. Hogg SJ, Newbold A, Vervoort SJ, Cluse LA, Martin BP, Gregory GP, et al. BET Inhibition Induces Apoptosis in Aggressive B-Cell Lymphoma via Epigenetic Regulation of BCL-2 Family Members. Mol Cancer Ther. 1 sept 2016;15(9):2030–41. Li W, Gupta SK, Han W, Kundson RA, Nelson S, Knutson D, et al. Targeting MYC activity in double-hit lymphoma with MYC and BCL2 and/or BCL6 rearrangements with epigenetic bromodomain inhibitors. J Hematol OncolJ Hematol Oncol. déc 2019;12(1):73. Trabucco SE, Gerstein RM, Evens AM, Bradner JE, Shultz LD, Greiner DL, et al. Inhibition of Bromodomain Proteins for the Treatment of Human Diffuse Large B-cell Lymphoma. Clin Cancer Res. 1 janv 2015;21(1):113–22. Shorstova T, Foulkes WD, Witcher M. Achieving clinical success with BET inhibitors as anti-cancer agents. Br J Cancer. 27 avr 2021;124(9):1478–90. Faivre EJ, McDaniel KF, Albert DH, Mantena SR, Plotnik JP, Wilcox D, et al. Selective inhibition of the BD2 bromodomain of BET proteins in prostate cancer. Nature. 13 févr 2020;578(7794):306–10. Gilan O, Rioja I, Knezevic K, Bell MJ, Yeung MM, Harker NR, et al. Selective targeting of BD1 and BD2 of the BET proteins in cancer and immunoinflammation. Science. 24 avr 2020;368(6489):387–94. Callanan MB, Le Baccon P, Mossuz P, Duley S, Bastard C, Hamoudi R, et al. The IgG Fc receptor, FcgammaRIIB, is a target for deregulation by chromosomal translocation in malignant lymphoma. Proc Natl Acad Sci U S A. 4 janv 2000;97(1):309–14. ISCN 2020 | Karger Book [Internet]. [cité 12 janv 2023]. Disponible sur: https://www.karger.com/Book/Home/279152 Putri GH, Anders S, Pyl PT, Pimanda JE, Zanini F. Analysing high-throughput sequencing data in Python with HTSeq 2.0. Bioinformatics. 13 mai 2022;38(10):2943–5. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. déc 2014;15(12):1–21. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 25 oct 2005;102(43):15545–50. Wu T, Hu E, Xu S, Chen M, Guo P, Dai Z, et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. The Innovation. 28 août 2021;2(3):100141. Zippo A, De Robertis A, Serafini R, Oliviero S. PIM1-dependent phosphorylation of histone H3 at serine 10 is required for MYC-dependent transcriptional activation and oncogenic transformation. Nat Cell Biol. août 2007;9(8):932–44. Wiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, et al. Single-vector inducible lentiviral RNAi system for oncology target validation. Cell Cycle Georget Tex. 1 févr 2009;8(3):498–504. Emadali A, Rousseaux S, Bruder-Costa J, Rome C, Duley S, Hamaidia S, et al. Identification of a novel BET bromodomain inhibitor-sensitive, gene regulatory circuit that controls Rituximab response and tumour growth in aggressive lymphoid cancers. EMBO Mol Med. août 2013;5(8):1180–95. Chapuy B, Stewart C, Dunford AJ, Kim J, Kamburov A, Redd RA, et al. Molecular Subtypes of Diffuse Large B-cell Lymphoma are Associated with Distinct Pathogenic Mechanisms and Outcomes. Nat Med. mai 2018;24(5):679–90. Reddy A, Zhang J, Davis NS, Moffitt AB, Love CL, Waldrop A, et al. Genetic and Functional Drivers of Diffuse Large B Cell Lymphoma. Cell. 5 oct 2017;171(2):481–494.e15. Sears RC. The Life Cycle of C-Myc: From Synthesis to Degradation. Cell Cycle. 9 sept 2004;3(9):1131–5. Nicodeme E, Jeffrey KL, Schaefer U, Beinke S, Dewell S, Chung C wa, et al. Suppression of inflammation by a synthetic histone mimic. Nature. déc 2010;468(7327):1119–23. Picaud S, Wells C, Felletar I, Brotherton D, Martin S, Savitsky P, et al. RVX-208, an inhibitor of BET transcriptional regulators with selectivity for the second bromodomain. Proc Natl Acad Sci. 3 déc 2013;110(49):19754–9. Park HW, Kim YC, Yu B, Moroishi T, Mo JS, Plouffe SW, et al. Alternative Wnt Signaling Activates YAP/TAZ. Cell. 13 août 2015;162(4):780–94. Samanta S, Guru S, Elaimy AL, Amante JJ, Ou J, Yu J, et al. IMP3 Stabilization of WNT5B mRNA Facilitates TAZ Activation in Breast Cancer. Cell Rep. 29 mai 2018;23(9):2559–67. Collinge B, Ben-Neriah S, Chong L, Boyle M, Jiang A, Miyata-Takata T, et al. The impact of MYC and BCL2 structural variants in tumors of DLBCL morphology and mechanisms of false-negative MYC IHC. Blood. 22 avr 2021;137(16):2196–208. Boi M, Gaudio E, Bonetti P, Kwee I, Bernasconi E, Tarantelli C, et al. The BET Bromodomain Inhibitor OTX015 Affects Pathogenetic Pathways in Preclinical B-cell Tumor Models and Synergizes with Targeted Drugs. Clin Cancer Res. 31 mars 2015;21(7):1628–38. Ceribelli M, Kelly PN, Shaffer AL, Wright GW, Xiao W, Yang Y, et al. Blockade of oncogenic IκB kinase activity in diffuse large B-cell lymphoma by bromodomain and extraterminal domain protein inhibitors. Proc Natl Acad Sci U S A. 5 août 2014;111(31):11365–70. Cummin TEC, Cox KL, Murray TD, Turaj AH, Dunning L, English VL, et al. BET inhibitors synergize with venetoclax to induce apoptosis in MYC-driven lymphomas with high BCL-2 expression. Blood Adv. 27 juill 2020;4(14):3316–28. Esteve-Arenys A, Valero JG, Chamorro-Jorganes A, Gonzalez D, Rodriguez V, Dlouhy I, et al. The BET bromodomain inhibitor CPI203 overcomes resistance to ABT-199 (venetoclax) by downregulation of BFL-1/A1 in in vitro and in vivo models of MYC+/BCL2 + double hit lymphoma. Oncogene. avr 2018;37(14):1830–44. Hogg SJ, Newbold A, Vervoort SJ, Cluse LA, Martin BP, Gregory GP, et al. BET Inhibition Induces Apoptosis in Aggressive B-Cell Lymphoma via Epigenetic Regulation of BCL-2 Family Members. Mol Cancer Ther. 1 sept 2016;15(9):2030–41. Li W, Gupta SK, Han W, Kundson RA, Nelson S, Knutson D, et al. Targeting MYC activity in double-hit lymphoma with MYC and BCL2 and/or BCL6 rearrangements with epigenetic bromodomain inhibitors. J Hematol OncolJ Hematol Oncol. déc 2019;12(1):1–13. Mertz JA, Conery AR, Bryant BM, Sandy P, Balasubramanian S, Mele DA, et al. Targeting MYC dependence in cancer by inhibiting BET bromodomains. Proc Natl Acad Sci. 4 oct 2011;108(40):16669–74. Trabucco SE, Gerstein RM, Evens AM, Bradner JE, Shultz LD, Greiner DL, et al. Inhibition of Bromodomain Proteins for the Treatment of Human Diffuse Large B-cell Lymphoma. Clin Cancer Res. 5 janv 2015;21(1):113–22. Lovén J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al. Selective Inhibition of Tumor Oncogenes by Disruption of Super-Enhancers. Cell. 11 avr 2013;153(2):320–34. Abedin SM, Boddy CS, Munshi HG. BET inhibitors in the treatment of hematologic malignancies: current insights and future prospects. OncoTargets Ther. 28 sept 2016;9:5943–53. Amorim S, Stathis A, Gleeson M, Iyengar S, Magarotto V, Leleu X, et al. Bromodomain inhibitor OTX015 in patients with lymphoma or multiple myeloma: a dose-escalation, open-label, pharmacokinetic, phase 1 study. Lancet Haematol. 1 avr 2016;3(4):e196–204. Blum KA, Supko JG, Maris MB, Flinn IW, Goy A, Younes A, et al. A Phase I Study of Pelabresib (CPI-0610), a Small-Molecule Inhibitor of BET Proteins, in Patients with Relapsed or Refractory Lymphoma. Cancer Res Commun. 11 août 2022;2(8):795–805. Falchook G, Rosen S, LoRusso P, Watts J, Gupta S, Coombs CC, et al. Development of 2 Bromodomain and Extraterminal Inhibitors With Distinct Pharmacokinetic and Pharmacodynamic Profiles for the Treatment of Advanced Malignancies. Clin Cancer Res. 13 mars 2020;26(6):1247–57. Moreno V, Sepulveda JM, Vieito M, Hernández-Guerrero T, Doger B, Saavedra O, et al. Phase I study of CC-90010, a reversible, oral BET inhibitor in patients with advanced solid tumors and relapsed/refractory non-Hodgkin’s lymphoma. Ann Oncol. 1 juin 2020;31(6):780–8. Moreno V, Vieito M, Sepulveda JM, Galvao V, Hernández-Guerrero T, Doger B, et al. BET inhibitor trotabresib in heavily pretreated patients with solid tumors and diffuse large B-cell lymphomas. Nat Commun. 13 mars 2023;14(1):1359. Shorstova T, Foulkes WD, Witcher M. Achieving clinical success with BET inhibitors as anti-cancer agents. Br J Cancer. 27 avr 2021;124(9):1478–90. Zhang C, Stelloo E, Barrans S, Cucco F, Jiang D, Tzioni MM, et al. Non-IG::MYC in diffuse large B-cell lymphoma confers variable genomic configurations and MYC transactivation potential. Leukemia. 6 janv 2024;1–9. Johnson NA, Slack GW, Savage KJ, Connors JM, Ben-Neriah S, Rogic S, et al. Concurrent Expression of MYC and BCL2 in Diffuse Large B-Cell Lymphoma Treated With Rituximab Plus Cyclophosphamide, Doxorubicin, Vincristine, and Prednisone. J Clin Oncol. 1 oct 2012;30(28):3452–9. Fong CY, Gilan O, Lam EYN, Rubin AF, Ftouni S, Tyler D, et al. BET inhibitor resistance emerges from leukaemia stem cells. Nature. 24 sept 2015;525(7570):538–42. Keren-Paz A, Emmanuel R, Samuels Y. YAP and the drug resistance highway. Nat Genet. mars 2015;47(3):193–4. Reggiani F, Gobbi G, Ciarrocchi A, Ambrosetti DC, Sancisi V. Multiple roles and context-specific mechanisms underlying YAP and TAZ-mediated resistance to anti-cancer therapy. Biochim Biophys Acta BBA - Rev Cancer. 1 janv 2020;1873(1):188341. Gobbi G, Donati B, Do Valle IF, Reggiani F, Torricelli F, Remondini D, et al. The Hippo pathway modulates resistance to BET proteins inhibitors in lung cancer cells. Oncogene. oct 2019;38(42):6801–17. Zanconato F, Battilana G, Forcato M, Filippi L, Azzolin L, Manfrin A, et al. Transcriptional addiction in cancer cells is mediated by YAP/TAZ through BRD4. Nat Med. oct 2018;24(10):1599–610. Additional Declarations No competing interests reported. Supplementary Files Supplementalmaterialall.pdf Cite Share Download PDF Status: Published Journal Publication published 19 Dec, 2024 Read the published version in Clinical Epigenetics → Version 1 posted Editorial decision: Revision requested 25 Jul, 2024 Reviews received at journal 25 Jul, 2024 Reviews received at journal 18 Jul, 2024 Reviewers agreed at journal 15 Jul, 2024 Reviewers agreed at journal 03 Jul, 2024 Reviewers invited by journal 02 Jul, 2024 Editor assigned by journal 28 Jun, 2024 Submission checks completed at journal 28 Jun, 2024 First submitted to journal 27 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4647617","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":329479103,"identity":"61162964-9a2b-4843-8179-28a4da65f6fd","order_by":0,"name":"Loris Delrieu","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Loris","middleName":"","lastName":"Delrieu","suffix":""},{"id":329479105,"identity":"d8963281-ab8d-4e22-92b7-4824ac70492a","order_by":1,"name":"Sieme Hamaidia","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Sieme","middleName":"","lastName":"Hamaidia","suffix":""},{"id":329479106,"identity":"2f878b3e-b81f-4224-8ee2-7bb65e43a5f5","order_by":2,"name":"Emilie Montaut","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Emilie","middleName":"","lastName":"Montaut","suffix":""},{"id":329479107,"identity":"1fbd27d3-366e-42b4-a7c8-cbb5ba641d95","order_by":3,"name":"Andrea Garcia-Sandoval","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Garcia-Sandoval","suffix":""},{"id":329479108,"identity":"159ad7b1-210b-417c-a416-5a9c457aec8b","order_by":4,"name":"Camille Teste","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Camille","middleName":"","lastName":"Teste","suffix":""},{"id":329479110,"identity":"6f7d1a89-7379-49e8-950a-b7c9de905f96","order_by":5,"name":"Patricia Betton-Fraisse","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Patricia","middleName":"","lastName":"Betton-Fraisse","suffix":""},{"id":329479112,"identity":"d9ec3e3a-bac6-4437-a2ba-b966fe60a583","order_by":6,"name":"Thierry Bonnefoix","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Thierry","middleName":"","lastName":"Bonnefoix","suffix":""},{"id":329479114,"identity":"024036ba-4ed0-4984-bb76-eb1052c1f2e1","order_by":7,"name":"Sylvain Carras","email":"","orcid":"","institution":"Hematology, Oncogenetics and Immunology Unit, Grenoble Alpes University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Sylvain","middleName":"","lastName":"Carras","suffix":""},{"id":329479116,"identity":"c1876f06-20bb-4b0d-a081-d16b4b23f983","order_by":8,"name":"Rémy Gressin","email":"","orcid":"","institution":"Department of Clinical Hematology, Grenoble Alpes University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Rémy","middleName":"","lastName":"Gressin","suffix":""},{"id":329479120,"identity":"f7560ff8-19bf-43af-8f22-b9a021854c18","order_by":9,"name":"Christine Lefebvre","email":"","orcid":"","institution":"Hematology, Oncogenetics and Immunology Unit, Grenoble Alpes University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Christine","middleName":"","lastName":"Lefebvre","suffix":""},{"id":329479121,"identity":"f2ee0263-12b3-4081-be5c-c576c0f1d78d","order_by":10,"name":"Jérôme Govin","email":"","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Jérôme","middleName":"","lastName":"Govin","suffix":""},{"id":329479124,"identity":"561a3aaa-5ac4-4f23-886b-24580c7c8995","order_by":11,"name":"Anouk Emadali","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABX0lEQVRIie3Rv0rDQBwH8As/uC7FrClI8goXCpai+CIuFwLt0kjBJUPBK4F26QMElPYV0sX55CAuAdcIGdIlix3qIh1EzUXFK6W7YL7D7/5wH365HEJ16vzRaKwaqMapjxD+2SYNWYfVifwAQZwmKoGqygLkINEmyvYhot8EcStEZxf61M35ai4ujwwKz76fmR0AjrYkMy0GePNLjCzutSLU88KkINy5E1fYoLibJEW7G2CqzUjRJhwgVNqkg5NWjoTHUloRZ9J8fLXHE+FEotnZNkk5QbpQhPVFPrxF2t9w51YSju3xuyT6Rnsj4nrBANQ7ShIh7kXpoOzCStJgsBqzqguCskv5W3aInfbcbkhcb5msh5zGfUmwxmIh70LgmBR2JHaImbr3TzP/3Js/9Jer7ejUWQQIXthImJ1GkGtrP7OsaaCS78/bXWJDWfDyWfbAXkB5BUnq1KlT55/nE4KTiS0c/rgZAAAAAElFTkSuQmCC","orcid":"","institution":"Univ. Grenoble Alpes, Inserm, CNRS, Institute for Advanced Biosciences","correspondingAuthor":true,"prefix":"","firstName":"Anouk","middleName":"","lastName":"Emadali","suffix":""}],"badges":[],"createdAt":"2024-06-27 10:02:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4647617/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4647617/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13148-024-01788-7","type":"published","date":"2024-12-19T15:57:44+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60838439,"identity":"3ae03d47-b29c-4a32-abff-6ccc91ada512","added_by":"auto","created_at":"2024-07-22 16:38:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":660548,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenetics and gene expression profiles of lymphoma model cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Summary of karyotyping, FISH (Fluorescent In-Situ Hybridization) and optical genome mapping (OGM) cytogenetics analyses for the 10 lymphoma cell lines as indicated, CA: number of cytogenetics anomalies determined using Optical Genome Mapping (OGM), nd: non determined. \u003cstrong\u003e(B-D)\u003c/strong\u003e \u003cem\u003eMYC\u003c/em\u003e, \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eBLC6\u003c/em\u003e gene (RT-qPCR data normalized to GAPDH represented as histograms, upper panels) and protein (representative western blot images, lower panels) expression levels for the 10 lymphoma cell lines as indicated (n=3). Coomassie staining was used as western blot loading control. Inserts in the upper right represent correlation between mRNA and protein expression (mutational status, circle: non mutated, star: mutated). R and p value were derived from a Pearson correlation test. \u003cstrong\u003e(E)\u003c/strong\u003e \u003cem\u003eMYC\u003c/em\u003e,\u003cem\u003e BCL2 \u003c/em\u003eand\u003cem\u003e BCL6 \u003c/em\u003eprotein expression level according to their rearrangement and mutational (circle: non mutated, star: mutated) status.\u003c/p\u003e","description":"","filename":"Fig1final.png","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/8e5b364f70338d7b8ce3f173.png"},{"id":60839060,"identity":"1d3d5b18-dc77-4a1c-bbea-d6e74c9c555b","added_by":"auto","created_at":"2024-07-22 16:46:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":582192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of BETi anti-tumor activity on lymphoma lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Plot of \u003cem\u003ein vitro\u003c/em\u003e IC50 towards BD1 and BD2 for tested BETi compounds (data derived from supplier datasheets). \u003cstrong\u003e(B)\u003c/strong\u003e Schematic representation of the experimental strategy for evaluation of BETi activity towards lymphoma growth arrest and cell death \u003cstrong\u003e(C-D)\u003c/strong\u003e. Heatmap (left) and scatter plot (right) representation of IC50 for the 6 BETi tested across cell lines for growth arrest (C) and cell death (D). On the scatter plots each dot represent one cell line.\u003c/p\u003e","description":"","filename":"Fig2final.png","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/fa6782ece909ce9ad655a5bd.png"},{"id":60838441,"identity":"646f2ab3-9fc1-4433-9cb4-285179f2f813","added_by":"auto","created_at":"2024-07-22 16:38:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":400782,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePotential determinants of BETi-induced cytotoxicity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Violin plots showing JQ1-induced cell death (IC50) according to lymphoma subtype (upper left), \u003cem\u003eMYC\u003c/em\u003e (middle) and \u003cem\u003eBCL2\u003c/em\u003e(left) rearrangement (upper) and mutational status (lower). p values are derived from Mann-Whitney tests. \u003cstrong\u003e(B)\u003c/strong\u003e Pearson correlation analysis between JQ1-induced cell death (IC50) and several parameters suspected to be involved in BETi response as indicated (left) and correlation plot between JQ1-induced cell death (IC50) and MYC protein levels (right). R and p value were derived from a Pearson correlation test.\u003c/p\u003e","description":"","filename":"Fig3final.png","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/edf7729e8e30e72c0497d9c1.png"},{"id":60838440,"identity":"7042e813-8d2e-48a0-a001-b91e43ed17e2","added_by":"auto","created_at":"2024-07-22 16:38:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":362105,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResponse to BETi is related to MYC oncogene addiction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Follow up of proliferation for B593, NUDUL-1, SUDHL-4 and OCI-Ly1 after 500nM JQ1 treatment or MYC doxycycline-inducible shRNA knock-down using 2 distinct MYC-targeting sequences (shMYCA and shMYCB) (n=4). (\u003cstrong\u003eB\u003c/strong\u003e) Cell cycle analysis for B593, NUDUL-1, SUDHL-4 and OCI-Ly1 measured 48h after 500nM JQ1 treatment or MYC doxycycline-inducible shRNA knock-down using 2 distinct MYC-targeting sequences (shMYCA and shMYCB) (n=4). (\u003cstrong\u003eC\u003c/strong\u003e) Apoptosis detection by Annexin V-FITC/IP staining for B593, NUDUL-1, SUDHL-4 and OCI-Ly1 measured 75h after 500nM JQ1 treatment or MYC doxycycline-inducible shRNA knock-down using 2 distinct MYC-targeting sequences (shMYCA and shMYCB) (n=4)\u003c/p\u003e","description":"","filename":"Fig4final.png","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/f00e622e73f8a381345a2b8d.png"},{"id":60838442,"identity":"0e8a3367-a340-4b94-a67d-cfd59feced6a","added_by":"auto","created_at":"2024-07-22 16:38:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":652612,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene expression profiling revealed activation of Wnt/Hippo non canonical pathway in cell lines resistant to BETi-induced cell death\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e GSEA enrichment plots (up) for the most significantly enriched signatures in MYC-dependent sensitive to BETi cytotoxicity (MYC dpt, sens) compared to resistant to BETi cytotoxicity (res) cell lines and bubble plot (down) showing most significantly affected ontologies (ClusterProfiler) between the 2 groups of cell lines as indicated. \u003cstrong\u003e(B)\u003c/strong\u003e Histograms showing difference in gene expression (logRPM+1 from RNA sequencing normalized counts) between MYC-dependent sensitive to BETi cytotoxicity (sens) compared to resistant to BETi cytotoxicity (res) cell lines for typical genes from canonical or non-canonical Wnt pathway. p values are derived from Mann-Whitney tests.\u003cstrong\u003e (C)\u003c/strong\u003e Heatmap showing YAP and TEAD expression (logRPM+1 from RNA sequencing normalized counts) across cell lines.\u003cstrong\u003e (D) \u003c/strong\u003eJQ1-to-control (DMSO) cell mortality ratio evaluated by fitting by nonlinear mixed models for \u003cem\u003eMYC\u003c/em\u003e (left) and \u003cem\u003eWNT5B\u003c/em\u003eand \u003cem\u003eTEAD3-4\u003c/em\u003e (right) genes. Overall statistical significance of each model was based on a Wald test rejecting the hypothesis that ratios are jointly equal at p\u0026lt;0.0001. \u003cstrong\u003e(E) \u003c/strong\u003ePearson correlation analysis between YAP and MYC expression in the NCICCR-DLBCL TCGA dataset. R and p value were derived from a Pearson correlation test. \u003cstrong\u003e(F)\u003c/strong\u003e Histograms showing difference in cell mortality for B593, NUDUL-1, SUDHL-4 and OCI-Ly1 after 48h of 1µM JQ1 or 100nm CA-3 individual or combined treatment. p values are derived from Mann-Whitney tests\u003c/p\u003e","description":"","filename":"Fig5final.png","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/3644d3e2cca8c98d16bd11f9.png"},{"id":72201855,"identity":"c72f4d4d-d6ae-40b8-a973-bc1fe299eddf","added_by":"auto","created_at":"2024-12-23 16:11:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3286542,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/6043cacf-a2e6-4db8-b5e3-215c30b82619.pdf"},{"id":60838444,"identity":"5754f104-7c16-42e8-b1f0-133aa51403f8","added_by":"auto","created_at":"2024-07-22 16:38:55","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":1950511,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementalmaterialall.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4647617/v1/db0a1d238fd37aa1993a7ba2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"BET inhibition revealed varying MYC addiction mechanisms independent of gene alterations in aggressive B-cell lymphomas.","fulltext":[{"header":"Background","content":"\u003cp\u003eB-cell lymphomas enclose a diverse group of hematological malignancies arising from B lymphocytes, with varying clinical presentations and prognoses. These highly heterogeneous pathologies are categorized based on their histological, immunophenotypic, and genetic features, covering a wide range of distinct entities​ (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The dysregulation of MYC oncogene has emerged as a critical factor in the pathogenesis of several subtypes of B cell lymphomas such as Diffuse Large B Cell Lymphoma (DLBCL) and Burkitt Lymphoma (BL) (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). MYC is a central hub in the growth regulatory signaling networks and its dysregulation has been shown to severely impact growth regulatory signaling leading to uncontrolled cell growth and contributing to lymphoma development (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eMYC\u003c/em\u003e alterations, including translocations, amplifications or mutations, are frequently observed in B-cell Lymphomas, leading to MYC overexpression and oncogenic activity. Chromosomal translocations involving \u003cem\u003eMYC\u003c/em\u003e and immunoglobulin (IG) loci, such as t(8;14)(q24;q32) /IGH::\u003cem\u003eMYC\u003c/em\u003e, t(8;22)(q24;q11)/IGL::\u003cem\u003eMYC\u003c/em\u003e and t(2;8;)(p11;q24)/IGK::\u003cem\u003eMYC\u003c/em\u003e, are characteristic of BL and sometimes observed in DLBCL, resulting in \u003cem\u003eMYC\u003c/em\u003e activation by \u003cem\u003eIG\u003c/em\u003e enhancers (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). In addition, the amplification of the \u003cem\u003eMYC\u003c/em\u003e locus or alterations in its regulatory elements contribute to MYC overexpression in various lymphoma subtypes (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe overexpression of MYC in DLBCL is associated with an aggressive clinical behavior and a poor prognosis, especially when co-occurring with BCL2 in subcategories defined as \u0026ldquo;double expressors\u0026rdquo; and representing 20\u0026ndash;30% of cases. In addition, B-cell lymphomas harboring dual \u003cem\u003eMYC\u003c/em\u003e and \u003cem\u003eBCL2\u003c/em\u003e rearrangements have been described as particularly aggressive and treatment-refractory (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). This entity, presenting features of both DLBCL and BL, previously referred as \u0026ldquo;Double Hit Lymphoma\u0026rdquo; (DHL), has been recently reassigned as \u0026ldquo;High-grade B-cell lymphoma with \u003cem\u003eMYC\u003c/em\u003e and \u003cem\u003eBCL2\u003c/em\u003e rearrangements\u0026rdquo; (HGBL \u003cem\u003eMYC/BCL2\u003c/em\u003e) in the current WHO of hematolymphoid tumors (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). HGBL also encompasses rare cases with a triple rearrangement \u0026ldquo;triple hit\u0026rdquo; \u003cem\u003eMYC/BCL2/BCL6\u003c/em\u003e (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). A DHL-specific gene expression signature has been described and associated with disease aggressivity and averse clinical outcome (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Noteworthy, it can be found in absence of any detectable \u003cem\u003eMYC\u003c/em\u003e rearrangement suggesting that DHL signature can be activated independently of chromosomal translocations (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMYC-driven lymphomas, and especially HGBL, frequently exhibit high proliferative index, resistance to conventional therapies, and increased risk of relapse. Targeting MYC would clearly represent an attracting therapeutical strategy, but the development of direct MYC inhibitors has been challenging due to its transcriptional nature and lack of druggable binding sites.\u003c/p\u003e \u003cp\u003eBET (Bromodomain and Extra-Terminal domain) inhibition emerged as a potent epigenetic therapy for MYC-driven malignancies (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). It is based on the development of small inhibitory molecules targeting BET proteins (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e), a family of chromatin readers that include four members in humans: BRD2, BRD3, BRD4 and a testis-specific variant BRDT. BET proteins share the same structure with two bromodomains modules (BD1 and BD2) and an extra-terminal (ET) domain in their C-terminal moiety. BET bromodomains recognize acetylated lysines on histone and non-histone proteins, whereas the ET domain can interact with other nuclear proteins, creating a molecular platform that can modulate epigenetic signaling (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). BRD4, the most extensively studied family member, has been shown to be involved in Polymerase II-mediated transcription by recruiting several transcriptional regulators, including the Mediator complex and activating transcription elongation factor b (P-TEFb) to gene promoters and enhancers (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBET inhibitors (BETi) anti-tumor activity has initially been attributed to their repressive effect on \u003cem\u003eMYC\u003c/em\u003e transcription in MYC-driven malignancies, such as multiple myeloma (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), acute myeloid leukemia and Burkitt lymphoma (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Later on, two major studies revealed that BETi preferentially suppress BRD4-dependent transcription mediated by super-enhancers in multiple myeloma (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e) and lymphoma (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) affecting oncogenic and lineage-specific transcriptional circuits. BETi therapeutic activity can therefore be attributed to specific subsets of target genes whose expression would be \u0026ldquo;hypersensitive\u0026rdquo; to BET inhibition in a cell-specific context. This has raised hope about the potential of BETi to treat DLBCL or HGBL where MYC, or other oncogene expression, is placed under the control of BRD4-dependant super-enhancers, such as \u003cem\u003eIG\u003c/em\u003e regulatory regions.\u003c/p\u003e \u003cp\u003eThe cellular response to diverse BETi chemical scaffolds has largely been studied in aggressive B-Cell lymphoma (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21 CR22\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) using various cellular and mice models of DLBCL, BL and/or HGBL. A large majority of lymphoma cells displayed a G1 cell cycle arrest correlated with a decrease in MYC expression upon BETi treatment. This observation is expected when chromosomal rearrangements place \u003cem\u003eMYC\u003c/em\u003e under the control of BET-dependent regulatory sequences, like \u003cem\u003eIG\u003c/em\u003e super-enhancers, but is also observed in cellular models with wild-type \u003cem\u003eMYC\u003c/em\u003e gene locus (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Moreover, a reduction in MYC expression does not always correlate with BET inhibition\u0026rsquo;s impact on cell proliferation (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). BETi have also been reported to induce cell apoptosis or senescence in several B-cell lymphoma models (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), but whether this cytotoxicity depends on MYC status remains unclear.\u003c/p\u003e \u003cp\u003eDespite the promising results obtained mainly in blood cancers, BETi clinical development has been impeded by high toxicity levels, potentially caused by off-target effects related to their lack of selectivity towards the 8 human BET BDs (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Indeed, this first-generation of BET inhibitors, referred to as pan-BETi, can bind all 8 BET bromodomains. Recent studies have demonstrated the potential of a new generation of inhibitors selective towards BET BD1 or BD2 domains as anti-tumor or anti-inflammatory agents (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). These compounds have not yet been evaluated in the context of B-Cell Lymphoma. Nowadays, BETi clinical potential is mostly evaluated in combination therapy rather than single agent, but the severe side effects, modest response rates and lack of biomarkers to predict which patients could benefit from this therapy compromise the future of these molecules to treat hematological malignancies, as well as solid tumors (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, BETi remain powerful molecular tools to study oncogenic and particularly MYC-dependencies in B-cell lymphoma and better understand their biological impact in relation with their genetic alterations. In this setting, we performed an extensive genetic characterization of a panel of HGBL, DLBCL and BL cell lines using cutting-edge genomics technologies. We then used both pan- and selective BETi to modulate MYC and correlate the associated molecular and cellular response to MYC mutational status and expression profiles. This revealed strong MYC oncogene dependencies in some models that could be predicted by higher MYC protein level rather than any other parameters. Gene expression profiling was performed to identify oncogenic pathways that could contribute to MYC-driven lymphoma pathogenesis, leading to the identification of a non canonical Wnt/Hippo pathway that can be targeted in a combination therapeutic strategy to restore BETi sensitivity in resistant MYC-driven lymphoma.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eCell lines and culture conditions -\u003c/b\u003e OCI-Ly1, OCI-Ly18, SUDHL-6, SUDHL-4, HT, HBL-1, NUDUL-1 (DLBCL), RAJI and RAMOS (BL) cell lines were purchased from DSMZ. B593 DLBCL cell line was developed in house (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). NUDUL-1, OCI-Ly18, RAMOS cell lines were cultured in RPMI 1640 medium supplemented with 20% fetal bovine serum (FBS), 1% glutamine, 100 mg/mL penicillin/streptomycin. SUDHL-4, SUDHL-6, HT, B593 and RAJI cell lines were cultured in RPMI Glutamax supplemented with 20% FBS, 1 mM sodium pyruvate, 1% minimum essential medium non-essential amino acids (MEM NEAA) and 100 mg/mL penicillin/streptomycin. OCI-Ly1 cell line was grown in IMDM medium with 20% FBS and 100 mg/mL penicillin/streptomycin. Cell culture reagents were purchased from Gibco. All cells were grown at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eKaryotype and FISH \u0026ndash;\u003c/b\u003e B593, OCI-Ly18, OCI-Ly1, SUDHL-6, SUDHL-4, HT, HBL-1 and NUDUL-1 were prepared in a supplemented cell culture medium for cytogenetic analyses including RPMI, 15% FBS, 1% L-glutamine and 1% penicillin. Karyotype was performed on cell suspension following 17h unstimulated culture. Metaphase preparation slides for chromosome banding analysis were stained to reveal R-banding patterns. Karyotypes were described according to the current version of International System for Human Cytogenetic Nomenclature (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Metaphase and interphase fluorescence hybridization (FISH) studies were performed on cytogenetic pellet using Dual Color breakapart probes (\u003cem\u003eBCL2\u003c/em\u003e, \u003cem\u003eBCL6\u003c/em\u003e and \u003cem\u003ec-MYC\u003c/em\u003e, Cytocell) to detect the presence of \u003cem\u003eBCL2\u003c/em\u003e, \u003cem\u003eBCL6\u003c/em\u003e and/or \u003cem\u003eMYC\u003c/em\u003e rearrangement. The detection of \u003cem\u003eIGH::MYC\u003c/em\u003e rearrangement was performed using a dual color dual fusion probe (XL IGH::MYC DF, Metasystems). Slides were fixed in methanol/acetic acid 3:1 for 30 min, air dried and dehydrated through graded alcohols. Both FISH probes and target DNA were denatured simultaneously for 1 min at 73\u0026deg;C, and incubated for 20h at 37\u0026deg;C. The post-hybridization washes were performed according to the manufacturer\u0026rsquo;s instructions (Cytocell, Metasystems). A total of 100 nuclei were analyzed for each slide. FISH results on metaphases were interpreted with the karyotype for all cell lines tested.\u003c/p\u003e \u003cp\u003e \u003cb\u003eOptical genome mapping (OGM)\u003c/b\u003e - OGM was performed for the following cell lines: B593, NUDUL-1, SUDHL4, SUDHL6, OCI-Ly1, OCI-Ly18 and HT.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eDNA extraction and direct enzymatic labelling\u003c/span\u003e - Ultra-high-molecular-weight genomic DNA (UHMW gDNA) was extracted manually from 1.5\u0026nbsp;million cells using the Prep SP Frozen Cell Pellet DNA Isolation kit according to the manufacturer\u0026rsquo;s instructions (Bionano Genomics). Briefly, the samples were lysed and digested with Proteinase K, RNase A and Lysis and Binding buffer. DNA was precipitated with isopropanol and bound to a nanobind magnetic disk. Subsequently, DNA was resuspended in the elution buffer and quantified with Qubit Broad Range double-stranded DNA assay kits (ThermoFisher Scientific). UHMW gDNA was incubated for 48h at room temperature for homogenization.\u003c/p\u003e \u003cp\u003eDNA labelling was performed following manufacturer\u0026rsquo;s protocols (Bionano Genomics). Standard Direct Label Enzyme 1 (DLE-1) reaction was carried out using 750 ng of UHMW gDNA. DNA was labelled at a sequence-specific motif (CTTAAG) with DL-green fluorophores. Thereafter, DLE- 1 enzyme was digested using puregene proteinase K (Qiagen) and excess DL-green fluorophores were removed with an adsorption membrane in a microtiter plate. The labelled DNA were counterstained (blue backbone staining) and homogenized for 48h at room temperature before quantification using Qubit High Sensitivity double-stranded DNA assay kits (ThermoFisher Scientific).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eData collection and quality metrics\u003c/span\u003e - The labelled DNA molecules were loaded on a Saphyr G2.3 chip and molecules were imaged using the Saphyr instrument (Bionano GenomicsSingle linearized DNA molecules travel through nanochannels by electrophoretic migration. For each cell line, multiple cycles were run to collect 800 Gb of data per cell line and reach an average genome coverage of 180X that is sufficient for accurate genomic analysis of a cell line. Specific quality control parameters were evaluated for each cell line to achieve a valid OGM analysis, namely, a map rate\u0026thinsp;\u0026ge;\u0026thinsp;70%, a label density of 14 to 17 (labels per 100 kbp) and an appropriate labeled DNA length (N50)\u0026thinsp;\u0026ge;\u0026thinsp;230 kbp of filtered DNA (\u0026gt;\u0026thinsp;150 kbp) with \u0026ge;\u0026thinsp;9 labeled sites, according to the manufacturer's instructions.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eOGM variant calling and data filtering\u003c/span\u003e - The capture images were converted to a barcode pattern and aligned to the human genome reference (GRCh38) for annotation. Data were analyzed using Bionano Access software. We applied the two methods provided by the supplier to identify both structural variants (SV) and copy number variants (CNV): i) the Rare Variant Analysis (RVA) pipeline detects SV on the basis of the differences between aligned barcode patterns and the reference genome; this RVA pipeline enables to identify SV and CNV occurring at low frequency (about 10%) and is therefore largely recommended for hematological neoplasms, ii) The De Novo Assembly (DN) pipeline consists of a first reconstruction of the sample genome, which is subsequently compared to the reference genome; this DN pipeline is commonly used to identify germline chromosomal abnormalities but offers three advantages in a context of B-cell lymphoma cell lines: first, a high resolution, enabling detection of fine, cryptic or subtelomeric anomalies (like IGH/14q32.3 rearrangements); second, the capacity of detection of copy neutral loss of heterozygosity (cn-LOH); third, as a complementary and confirmation method together with the RVA pipeline.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA extraction \u0026amp; RT-qPCR -\u003c/b\u003e Total RNA was extracted from 3\u0026nbsp;million cells with NucleoSpin RNA extraction kit (Macherey-Nagel) according to manufacturer\u0026rsquo;s instructions. Reverse transcription was carried out following RT SuperscriptTM III kit (Invitrogen RT) from 1\u0026micro;g extracted RNA. Target genes were amplified using PCR primers (MYCforw GGCTCCTGGCAAAAGGTCA, MYCrev CTGCGTAGTTGTGCTGATGT, BCL2forw, GTGGATGACTGAGTACCTGAAC, BCL2rev GAGACAGCCAGGAGAAATCAA, BCL6forw TCTGGAGAGAAGCCCTACAA, BCL6rev CCACAGATTTCACAGGGATAGG, GAPDHforw CCACTCCTCCACCTTTGAC, GAPDHrev ACCCTGTTGCTGTAGCCA) and quantified by qPCR on a thermocycler CF384 Touch Real-Time PCR (Bio-Rad). Ct values (cycle threshold) were analyzed with CFX ManagerTM Software (Bio-Rad) and normalized to GAPDH.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA sequencing\u003c/b\u003e \u0026ndash; Cell lines were treated with 500 nM JQ1 for 24h. Total RNA was extracted and purified according to the procedure mentioned in the RNA extraction \u0026amp; qPCR section. RNA paired-ended sequencing and stranded library were performed by BGI Genomics or GenomEast (IGBMC, Strasbourg, France) sequencing facilities from 500ng total RNA. Sequencing depth was at least 30\u0026nbsp;million reads per sample. Reads were quality-checked using FastQC. Reads were then aligned to \u003cem\u003eH. sapiens\u003c/em\u003e genome build hg38 using STAR 2.7.1a (Dobin et al., 2013). Raw read counts for each gene were calculated using HTSeqCount 0.11.2 using defaults parameters (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Read count data was normalized using RPM normalization and DESeq2 1.32. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Analyses were performed with R release 4.1.0. DESeq2 normalized read counts were used to identify differentially expressed genes with an adjusted p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and a fold change below \u0026minus;\u0026thinsp;1.5 or above 1.5. Enrichment analysis were performed using GSEA software (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) and Cluster Profiler R package (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blot\u003c/b\u003e \u0026ndash; Proteins were extracted from 5\u0026nbsp;million cells with 100 \u0026micro;L of RIPA buffer (150 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1% NP-40). Lysates were incubated 30 min at 4\u0026deg;C under agitation. Samples were then sonicated with VibraCell sonicator (15 sec ON/OFF for 1 min per sample). Then, samples were centrifuged 20 min at 16,000g and 4\u0026deg;C to clear insoluble material and quantified with Bradford protein assay. 10 \u0026micro;g of each sample was loaded on a gradient gel NuPAGE 4\u0026ndash;12% Bis-Tris (Invitrogen) and run in MES buffer (Invitrogen). The proteins were transferred on an activated PVDF membrane for 1h at 100V at 4\u0026deg;C in Tris Glycine 10% ethanol. Membranes were blocked in either 5% milk or BSA in PBS-Tween (PBST) or TBS-Tween (TBST) for 1 hour, and incubated overnight with primary antibodies under constant rotation at 4\u0026deg;C. The following primary antibodies were used: anti-MYC 1/1,000 TBST 5% BSA (rabbit, #A9169, Cell Signaling), anti-BCL2 1/1,000 PBST 5% milk (mouse, #sc-7382, Santa-Cruz Biotechnology), anti-BCL6 1/2,000 PBST 5% milk (mouse, #sc-7388, Santa-Cruz Biotechnology), anti-BRD4 1/1,000 PBST 5% milk (rabbit, # A301-985A, Bethyl laboratories), anti-BRD3 1/1,000 PBST 5% milk (rabbit, #A302-368A, Bethyl laboratories), anti-BRD2 1/2,000 PBST 5% milk (rabbit, #A302-583A, Bethyl laboratories), anti-αTubulin 1/5,000 PBST 5% milk (mouse, #T5168, Merck), anti-H4 1/5,000 PBST 5% milk (rabbit, #05-858, Upstate). The membranes were washed three times in PBST or TBST, incubated with the following secondary antibody: goat anti-rabbit IgG peroxidase 1/10,000 (#A9169-2ML, Merck) or polyclonal rabbit anti-mouse IgG peroxidase 1/2,000 (#P026002-2, Agilent) for 1h at room temperature, washed three times and revealed with Luminol/peroxidase mix Clarity Western ECL (Biorad). Acquisitions were realized using Vilber imaging system. Signal quantification was performed with ImageJ.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEstablishment of inducible MYC knock-down cell lines \u0026ndash;\u003c/b\u003e shRNA sequences either targeting MYC (shMYCA: GCAATCACCTATGAACTTGTT and shMYCB: GACGACGAGACC\u003c/p\u003e \u003cp\u003eTTCATCAAA) (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e) or non-targeting (shControl: CCTAAGGTTAAGTCGCCCTCG) were used. Oligos were annealed and ligated by T4 ligase with the pLKO Tet-On inducible plasmid previously digested with AgeI/EcoRI (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Lentiviral particles were produced by the ANIRA platform (ENS Lyon, France). B593, SUDHL-4 and OCI-Ly1 cell lines were transduced with lentiviral particles at multiplicity of infection (MOI) of 10, and NUDUL-1 with a MOI of 20. Viral particles were washed away after 24h. 1 \u0026micro;g/mL of puromycin was added at day 3 post-infection. Induction was performed with doxycycline at 200ng/mL during 72h for B593, SUDHL-4 and OCI-Ly1 or with 500 ng/mL during 72h for NUDUL-1. Knockdown efficiency was assessed by Western Blot.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell cycle analysis \u0026ndash;\u003c/b\u003e 1\u0026nbsp;million cells were harvested and washed with PBS. Cell pellets were resuspended in 100\u0026micro;L PBS and fixed with 900\u0026micro;L of cold ethanol (70%) added drop by drop under constant agitation of the sample collection tube. After 30 min, the samples were stored at -20\u0026deg;C for some days. The day of the analysis, samples were slowly thawed at 4\u0026deg;C and then centrifuged (2,000 rpm, 10 min). Cell pellets were resuspended in 1 mL of PBS in order to complete rehydration of the fixed samples during 4h at 4\u0026deg;C. After rehydration, cells were collected by centrifugation (2,000 rpm, 5 min) and resuspended in 1 mL PBS, 10 \u0026micro;g/mL of RNAse A (Sigma Aldrich) and 10 \u0026micro;g/mL propidium iodide (Sigma Aldrich). Samples were incubated at room temperature in the dark during 30 min before being analyzed by flow cytometry (LSRII, BD Biosciences). Data were analyzed using ModFit LT software.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAssessment of cell proliferation and cell death\u003c/b\u003e \u0026ndash; Cell viability and proliferation were determined by dual Annexin V-FITC (BD Biosciences) and propidium iodide (Sigma Aldrich) staining and by numeration of the absolute count of fluorescent beads (Precision count beads, Biolegends) and cells ratio. 0.1\u0026micro;g/mL Annexin V was diluted in Binding buffer solution (0.1 M HEPES pH7.4, 1.4 M NaCl, 25 mM CaCl\u003csub\u003e2\u003c/sub\u003e). Next, cells were harvested and washed with PBS and stained in 100 \u0026micro;L of Annexin V staining mix at room temperature for 10 min in the dark. Then, 100 \u0026micro;L of Binding Buffer 1X and 50 \u0026micro;L of Precision count beads were added. Finally, 5 \u0026micro;g/mL propidium iodide is added at the last minute before flow cytometry analysis (10,000 events analyzed per condition). Live cells, apoptotic cells, and fluorescent beads populations were gated in order to get the number of events for each population. Cell viability was determined by the ratio of the number of alive cells events (AnV-/IP-) and that of apoptotic cells events (AnV+/IP-, AnV+/IP+) comparing to the total number of events. Cell proliferation was determined based on absolute cell counts calculated as follow: absolute cell count (cells/\u0026micro;l) = (cell count/\u0026rdquo;precision count beads\u0026rdquo; counts) x \u0026rdquo;precision count beads\u0026rdquo; concentration (beads/\u0026micro;l). Data were acquired using LSRII (BD Biosciences) or Attune NxT (Thermo Fisher Scientific) flow cytometer.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBET inhibitors treatments\u003c/b\u003e \u0026ndash; Dose response experiments were performed on all DLBCL and BL cell lines in order to determine IC50 of 6 BET inhibitors of different selectivity. JQ1 was synthesized as described previously (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). I-BET726, I-BET762 and RVX-208 have been purchased from Selleckchem. GSK-046 has been purchased from Chemietek and ABBV-744 from Abmole. All compounds were dissolved in DMSO. Cell lines were treated for 6h to 72h at the indicated doses.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistics -\u003c/b\u003e Statistical analyses and graphical representations were performed with R (release 4.1.0) or GraphPad Prism (v10) as indicated\u003c/p\u003e \u003cp\u003e \u003cb\u003eMixed nonlinear statistical modeling\u003c/b\u003e - The general specification of models is: Mij\u0026thinsp;=\u0026thinsp;b0\u0026thinsp;+\u0026thinsp;b1 Treatmentij\u0026thinsp;+\u0026thinsp;b2 Gene_Levelij\u0026thinsp;+\u0026thinsp;b3 Treatmentij X Gene_Levelij\u0026thinsp;+\u0026thinsp;uj, where Mij is the number of dead cells of data i within cell line j, beta0 is the fixed intercept term, b1 is the fixed coefficient of the covariate Gene_Level (RNA-seq corresponding to gene expression), b2 is the fixed coefficient of the covariate Treatment representing the effect of JQ1 treatment versus control DMSO, b3 represents the fixed effect associated with the Treatment by Gene_Level interaction and uj is the random effect associated with the intercept for cell line j. Nonlinear relationship between cell mortality and Gene_Level was explored by restricted cubic spline (RCS) modeling. Models were fitted via restricted maximum log likelihood (REML). All statistical analyses from models were performed after non-parametric bootstrap data resampling with replacement (2,000 replicates) with bootstrap samples taken independently within each cell line considered as stratum. The overall statistical significance of the interaction terms between Treatment covariate and RCS covariates evaluating the nonlinearity hypothesis was tested by a Wald test. A REML-based likelihood ratio test was used to test the variance of the random cell line effects. Both nonlinearity of models and random effects were retained with p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. Statistical significance of predicted JQ1/DMSO ratios of cell mortality number at various percentiles of Gene_Level (percentile 10th to percentile 100th) were performed by a Wald test. Elasticity (E) was used to compare the effect of different genes on cell mortality M. The elasticity of M with respect to Gene_Level is the proportional (%) change in M for a proportional (1%) change in Gene_Level. Data were analyzed using Stata 16.1. Estimate margin effects (predicted mortality) in models using transformed gene level data with RCS was obtained by the f_able post-estimation command.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGenetic and expression profiling of B-Cell lymphoma model cell lines\u003c/h2\u003e \u003cp\u003eWe first performed an extensive characterization of gene alterations in a panel of 10 B-cell lymphoma cell lines, selected to reflect disease heterogeneity. We have tested 5 HGBL (High grade B-cell Lymphoma) and 3 DLBCL (Diffuse Large B Cell Lymphoma) cell lines, as well as 2 Burkitt lymphoma (BL) cell lines, characterized by an \u003cem\u003eIG::MYC\u003c/em\u003e gene rearrangement.\u003c/p\u003e \u003cp\u003eFirst, karyotyping and FISH analyses were performed using probes covering \u003cem\u003eMYC\u003c/em\u003e, \u003cem\u003eBCL2\u003c/em\u003e and \u003cem\u003eBCL6\u003c/em\u003e loci (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and S1A). Involvement of \u003cem\u003eIG\u003c/em\u003e gene loci together with \u003cem\u003eMYC\u003c/em\u003e or \u003cem\u003eBCL2\u003c/em\u003e was also specifically investigated using dual-fusion FISH probes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and S1A). Concomitant \u003cem\u003eMYC\u003c/em\u003e and \u003cem\u003eBCL2\u003c/em\u003e gene rearrangements were confirmed for 4 cell lines (namely B593, OCI-Ly18, OCI-Ly1 and SUDHL6), confirming their HGBL status. SUDHL-4 was also identified as a triple-hit with non-\u003cem\u003eIG::MYC\u003c/em\u003e, non-\u003cem\u003eIG::BCL6\u003c/em\u003e and \u003cem\u003eIG::BCL2\u003c/em\u003e gene rearrangement. OGM was also performed to fully characterize gene rearrangements and copy number variants for all cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, S1B) and further confirmed the above observations derived from conventional cytogenetic methods.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTargeted sequencing using a panel of 20 genes frequently mutated in lymphoma revealed mutations in \u003cem\u003eBCL2\u003c/em\u003e, \u003cem\u003eEZH2\u003c/em\u003e or \u003cem\u003eTP53\u003c/em\u003e in 4 out of the 8 HGBL/DLBCL cell lines (\u003cb\u003eFig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC\u003c/b\u003e) consistently with previous reports (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). In addition, the mutational status of \u003cem\u003eMYC\u003c/em\u003e second exon, presenting frequent occurrence of clustered mutations, was explored by Sanger sequencing. This analysis revealed the presence of a stabilizing T58 substitution (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e) in NUDUL-1 cell line (\u003cb\u003eFig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC\u003c/b\u003e), as well as other \u003cem\u003eMYC\u003c/em\u003e somatic variants in B593 and OCI-Ly18 lines.\u003c/p\u003e \u003cp\u003eThe impact of these genetic alterations on mRNA and protein levels has been assessed for MYC, BCL2, BCL6. They appear very heterogeneous among cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-D). Of note, whereas mRNA and protein levels correlate for BCL2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), this is not the case for MYC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and BCL6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), most likely due to post-transcriptional regulation events.\u003c/p\u003e \u003cp\u003eFor \u003cem\u003eMYC\u003c/em\u003e, the presence of \u003cem\u003eIG\u003c/em\u003e or \u003cem\u003enon-IG\u003c/em\u003e rearrangement does not systematically drive high mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cb\u003eleft\u003c/b\u003e). Of note, \u003cem\u003eIG::MYC\u003c/em\u003e gene rearrangement, especially when co-occurring with \u003cem\u003eMYC\u003c/em\u003e stabilizing mutations can still translate into very high MYC protein levels as observed for NUDUL-1 cell line (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Similarly, if most \u003cem\u003eIG::BCL2\u003c/em\u003e rearranged cells have higher mRNA and protein expression, BCL2 remains low in B593 line (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cb\u003emiddle\u003c/b\u003e). No such correlation between gene rearrangement and expression level could be observed for BCL6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cb\u003eright\u003c/b\u003e). Altogether, this systematic analysis of \u003cem\u003eMYC\u003c/em\u003e, \u003cem\u003eBLC2\u003c/em\u003e and \u003cem\u003eBCL6\u003c/em\u003e rearrangements, mutational status and expression levels showed that \u003cem\u003eIG\u003c/em\u003e and \u003cem\u003enon-IG\u003c/em\u003e rearrangements are not always associated with higher protein levels in lymphoma lines. Particularly for MYC, additional stabilizing mutations or post-transcriptional events can also affect protein levels and mitigate the functional impact of chromosomal rearrangements, which contribute to explain why cannot be used at sole indicators of MYC-signaling activation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of lymphoma cells response to pan- and BD2-selective BET inhibitors\u003c/h2\u003e \u003cp\u003eThese 10 model cell lines were then subjected to BETi treatment. We chose to evaluate both pan-BETi (JQ1, IBET-762 and IBET-726) and BD2-selective compounds (RVX-208, GSK-046 and ABBV-744) of different chemical scaffolds. \u003cem\u003eIn vitro\u003c/em\u003e IC50 towards BD1 and BD2 are represented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. Dose-response experiments were conducted on 5 HGBL, 2 DLBCL and 2 BL cell lines to determine the impact of each of these inhibitors on cell proliferation and viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Data could not be obtained for HBL-1 cell line due to high spontaneous mortality rate.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAnalysis of cell proliferation revealed a globally similar growth arrest of pan-BETi across all cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and S2) with IC50 in the 100 nM \u0026ndash; 1 \u0026micro;M range. In comparison, BD2-selective compounds exhibited a modest effect on cell proliferation except for ABBV-744 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and S2). This could be expected since ABBV-744 was described to have anti-tumor activity in prostate cancer models (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), whereas RVX-208 and GSK-046 were essentially reported for their anti-inflammatory effect (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Of note, the cytostatic activity of BETi compounds on lymphoma cells seems to be related to their \u003cem\u003ein vitro\u003c/em\u003e inhibitory activity towards BD1 bromodomains (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) independently of their molecular scaffold or activity towards BD2.\u003c/p\u003e \u003cp\u003eIn contrast, analysis of cell viability revealed heterogeneous responses across the different cell lines, with B593 and NUDUL-1 showing a high sensitivity to BETi-induced cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). As observed for cell proliferation, ABBV-744 was the only BD2-selective BETi impacting lymphoma cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), even though in a lesser extent compared to pan-BETi. Again, this is most likely due to ABB-744 higher residual activity towards BD1 compared to other BD2-selective compounds.\u003c/p\u003e \u003cp\u003eAltogether these results show that pan-BETi, as well as ABBV-744, have a similar cytostatic activity in DLBCL and BL cell models independently of MYC mutational status. However, their cytotoxic activity differs between cell lines models, defining 2 classes of lymphomas lines, either sensitive or resistant to BET-induced cell death. We next investigate which molecular determinants could drive these phenotypes and whether they could be related to MYC oncogenic dependency.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eBETi cytotoxicity correlates to MYC basal protein level\u003c/h2\u003e \u003cp\u003eFirst, we tested whether BET protein basal levels could explain how lymphoma cells respond to BETi. Western blot analysis of BRD2-4 protein levels, revealed rather constant level of BRD4, where BRD2 and BRD3 present heterogeneous protein profiles across cell lines (\u003cb\u003eFig S3A\u003c/b\u003e). However, no significant association could be observed between BRD2-4 levels and BETi-induced cell death.\u003c/p\u003e \u003cp\u003eWe then questioned whether BETi could induce distinct BRD4 chromatin binding between cell death sensitive (B593 and NUDUL-1) and resistant cellular models (SUDHL4 and OCY-Ly1). BRD4 levels were quantified in chromatin, as well as in nuclear and cyto-soluble fractions (\u003cb\u003eFig S3B\u003c/b\u003e). These data confirmed that JQ1 induces a massive release of chromatin-bound BRD4, with a relocalization into soluble fractions. As expected from previously published data (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), BRD4 remains mostly associated to chromatin upon ABBV-744 BD2-selective treatment (\u003cb\u003eFig S3B\u003c/b\u003e), most likely because the action BRD4 BD1 is sufficient to anchor it to chromatin. In any case, we could not highlight any association between BET release from chromatin and response to BETi these models.\u003c/p\u003e \u003cp\u003eTo further explore MYC, BCL2 and BCL6 involvement in BETi response in DLBCL cell lines, we treated B593 and NUDUL-1 (cell death sensitive) as well as SUDHL-4 and OCI-Ly1 (cell death resistant) cell lines with 500nM of JQ1 and ABBV-744 for 6h and 24h and evaluated MYC, BCL2 and BCL6 protein levels by western blot. The results showed that JQ1 induces a similar decrease in MYC protein level in both BETi sensitive and resistant cell lines (\u003cb\u003eFig S3C\u003c/b\u003e). This indicates that MYC downregulation could not be as central as thought in the BETi anti-tumor effects. Moreover, MYC decrease is not higher in \u003cem\u003eMYC\u003c/em\u003e-rearranged cells as it could be expected. Interestingly, we also noticed that the BD2-selective compound ABBV-744 induced a decrease in MYC expression only in SUDHL-4 and OCI-Ly1 cell death-resistant models. This suggests a distinct mechanism of action of BD2-selective compounds between these models. No change in BCL2 or BCL6 could be detected under these conditions of BETi treatment, suggesting they do not play a role in response to BET inhibition in this setting.\u003c/p\u003e \u003cp\u003eNext, we investigated whether lymphoma subtype, \u003cem\u003eMYC\u003c/em\u003e or \u003cem\u003eBCL2\u003c/em\u003e rearrangement or mutation status could influence BETi-induced cell death, without being able to link any of these parameters to BETi cytotoxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Several other determinants have been previously suspected to be related to response to BETi, including BRD4, MYC and BCL2 protein levels, MYC/BCL2 ratio and MYC/BCL2 fold decrease upon treatment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, \u003cb\u003eleft)\u003c/b\u003e. Correlation analyses revealed that MYC protein level is the only determinant that is strongly correlated (R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.93, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) to BET cytotoxicity \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003eright)\u003c/b\u003e, independently of any genetic defects \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e or any of the parameters evaluated here \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003eleft and S3)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese data suggest that high MYC basal protein level is the main driver of BETi-induced cell death and could be used, rather than \u003cem\u003eMYC\u003c/em\u003e rearrangements or mutations, to predict MYC dependency in B-cell lymphoma.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBETi-induced cell death is restricted to MYC-addicted lymphoma cell lines\u003c/h2\u003e \u003cp\u003eTo further characterize MYC involvement in BETi-induced lymphoma cell death, we compared the respective impact of MYC knockdown and JQ1 treatment on cell proliferation and cell cycle for B593, NUDUL-1, SUDHL-4 and OCI-Ly1 cell lines. Similar levels of MYC downregulation were achieved with both approaches except for NUDUL-1 cell line in which knock-down efficacy was limited (\u003cb\u003eFig S4\u003c/b\u003e). This might be explained by the stabilizing T58 mutation present in this cell line. Follow-up of cell proliferation for 72h showed that, as described above (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), JQ1 induces a growth arrest in all four cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In contrast, MYC knockdown reduces proliferation only in B593 and, to a lesser extend, to NUDUL-1. These data suggest that MYC is not mediating the growth arrest observed upon BETi treatment in SUDHL-4 and OCI-Ly1. This was further confirmed by cell cycle analysis, that revealed that the G1 arrest induced by JQ1 can only be recapitulated in B593 and, to a lesser extend in NUDUL-1 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn cell viability assessment, MYC knockdown also phenocopy JQ1-induced apoptotic cell death in B593. The same tendency is observed for NUDUL-1, even if statistical significance was not reached. In contrast, no apoptosis could be detected neither for SUDHL-4 and OCI-Ly1 upon MYC knock-down (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eTaken together, these results show that B593 and NUDUL-1 sensitivity to BETi-induced cell death could be explained by their addiction to MYC oncogene. Moreover, the growth arrest observed in models resistant to BETi-induced cell death does not seem to be mediated through MYC, but rather through alternative pro-proliferative or oncogenic pathways. This suggests that MYC-driven lymphomas exhibit different levels of activation and dependency on MYC signaling, even though they present similar genetic alterations.\u003c/p\u003e \u003cp\u003e \u003cb\u003eResistance to BETi cytotoxicity is associated with innate activation of non-canonical WNT pathway and activation of YAP/TEAD\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo get a global view of the genes and pathways affected upon BETi treatment, we performed gene expression profiling for the 9 HGBL, DLBCL and BL cell lines using RNA sequencing. First, we compared changes in gene expression profiles between control and JQ1-treated cells. Numbers of commonly affected genes between cell lines are detailed for downregulated (\u003cb\u003eFig S5A, left\u003c/b\u003e) and upregulated (\u003cb\u003eFig S5A, right\u003c/b\u003e) genes. Few genes were commonly affected by BETi between cell lines regardless of whether they present similar MYC alterations or sensitivity to BETi cytotoxicity. On the other hand, a gene set enrichment analysis (GSEA) revealed that global cellular responses were very similar for all cell lines with alteration of pathways related to inflammation and MYC signaling as previously reported (\u003cb\u003eFig S5B\u003c/b\u003e). Here, again no specific pathways could be related to MYC addiction or sensitivity to BETi cytotoxicity. We then compared for each cell line, genes affected by copy-number variants (CNV) or chromosomal rearrangement and genes impacted by JQ1 treatment to determine whether they would represent preferential BETi-target genes (\u003cb\u003eFig S5C\u003c/b\u003e). However, no such association could be found from this set of data.\u003c/p\u003e \u003cp\u003eWe next investigated basal gene expression profiles between MYC dependent, which are sensitive to BETi cytotoxicity, and resistant cell line models. This revealed downregulation of 362 and up-regulation of 1741 genes in cell lines resistant to BETi-induced cytotoxicity (\u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). Using GSEA and gene ontology analyses, we showed an enrichment in MYC targets \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cb\u003eup)\u003c/b\u003e, as well as increase ribosomal and protein biosynthesis activity associated with MYC signaling \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cb\u003edown)\u003c/b\u003e, further confirming the link between BETi-induced cytotoxicity and MYC dependency. On the other hand, genes related to Wnt signalling are largely enriched in MYC-independent cell lines resistant to BETi-induced cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cb\u003eup\u003c/b\u003e). Interestingly, these same signatures were also observed when comparing the two groups after JQ1 treatment, indicating that they still contribute to differentiate them post-treatment (\u003cb\u003eFig S5C\u003c/b\u003e). Gene ontology analyses revealed enrichment in membrane receptor signalling and cell fate commitment genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cb\u003edown\u003c/b\u003e) that could be related to Wnt pathway. We then investigated more specifically which members of this pathway were affected. We could not detect any difference between effectors of the canonical Wnt pathway at the transcriptional level, as exemplified by DVL1, AXIN1 or beta-catenin (CTNNB1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, \u003cb\u003eup\u003c/b\u003e). However, one very specific non-canonical Wnt pathway connected with Hippo signaling described in MEF cells (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e) and breast cancer (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e) seems to be activated in cells resistant to BETi-induced cytotoxicity as shown by WNT5A and WNT5B (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, \u003cb\u003edown\u003c/b\u003e) increased expression. Accordingly, the downstream transcription factors YAP and TEAD family transcription were restricted to MYC independent cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Intrinsic activation of this signaling pathway, which has been described as connected to stemness and drug resistance could therefore represent a novel oncogenic pathway in MYC-driven lymphoma that do not present a MYC addiction. The opposite effect of MYC and WNT5B/TEAD3-4 on BETi sensitivity was further confirm by mathematical modeling using mixed linear models and elasticity assessment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD \u003cb\u003eand Fig S5E).\u003c/b\u003e This was further supported by the inverse correlation between MYC and YAP in the NCICCR-DLBCL TBGA DLBCL patient cohort (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). To further confirm the cooperation of MYC and Hippo pathway, we evaluated the YAP/TEAD small molecule inhibitor, CA-3. Low doses CA-3 treatment did not impact cell viability in any of the models tested. However, combining JQ1 and CA-3 (YAP/TEAD inhibitor) can restore JQ1 cytotoxicity in MYC-independent cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMYC-driven lymphomas represent an heterogenous groups of B-cell lymphoma characterized by diverse alterations leading to MYC oncogene overexpression (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Although these pathologies are generally viewed as aggressive and treatment refractory entities, the type of MYC alterations, together with the presence of additional genetic defects, can influence lymphoma progression and patient prognosis (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). However, the actual MYC activity and dependency in each specific context remains unclear.\u003c/p\u003e \u003cp\u003eChromosomal translocations involving \u003cem\u003eMYC\u003c/em\u003e locus have been reported to be associated with inferior outcomes especially together with concurrent \u003cem\u003eBCL2/BCL6\u003c/em\u003e gene rearrangements defining the HGBL subtype (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). When \u003cem\u003eMYC\u003c/em\u003e rearrangements involve \u003cem\u003eIG\u003c/em\u003e as partner genes, MYC expression can be placed under the control of BET-dependant super-enhancers present on \u003cem\u003eIG\u003c/em\u003e regulatory regions leading to particularly elevated MYC protein levels. This provides an obvious rational to use BET inhibition as a therapeutic strategy in this specific context.\u003c/p\u003e \u003cp\u003eDuring the past 10 years, response to BETi has been the focus of a large effort in both pre-clinical and clinical research, showing that BETi possess significant antitumor activity in various cancers. Their potential to treat hematological malignancies, and particularly MYC driven blood cancers, has been clearly demonstrated in mechanistical and pre-clinical studies in B-Cell lymphoma including DLBCL, BL and HGBL (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan additionalcitationids=\"CR45 CR46 CR47 CR48 CR49 CR50\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e) and myeloma (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e) and as well as clinical studies (\u003cspan additionalcitationids=\"CR54 CR55 CR56 CR57\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). However, molecular, cellular and clinical responses to BETi treatment are highly variable, presumably due to the high degree of genetic and biological heterogeneity found even within one single subtype of these pathologies. In addition, BETi have been shown to be associated with a high level of toxicity and induce severe side effects that hamper their clinical development (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThese studies nevertheless revealed that BETi leads to a G1 cell cycle arrest, concomitant with a decrease in MYC expression, in a large majority of lymphoma cell lines (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21 CR22\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), as in several other types of hematological malignancies and solid tumors. Cell apoptosis was also described upon BETi treatment in some lymphoma models (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) but could not be associated to any specific entity or gene alteration. Interestingly, these responses are not restricted to cellular models where chromosomal rearrangements place \u003cem\u003eMYC\u003c/em\u003e under the control of BET-dependent regulatory sequences, such as super-enhancers, but were also observed in cellular models with other types of \u003cem\u003eMYC\u003c/em\u003e gene alterations or even wild-type \u003cem\u003eMYC\u003c/em\u003e gene locus (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Moreover, reduction in \u003cem\u003eMYC\u003c/em\u003e expression does not always correlate with BET inhibition\u0026rsquo;s impact on cell proliferation (Mertz et al., 2011). Altogether, this suggests that MYC downregulation by itself may not be as central as thought mediating response to BETi. This could also imply that lymphoma cells could present elevated MYC activity, and subsequent high dependency on MYC for their survival independently of MYC gene alteration.\u003c/p\u003e \u003cp\u003eTo elucidate these aspects, we examined MYC regulation, activity and signaling using various pan- and BD2-selective BET inhibitors as molecular tools in a panel of B-cell lymphoma cell lines presenting diverse MYC alterations and concurrent oncogene expression.\u003c/p\u003e \u003cp\u003eFirst, we performed a detailed genetic characterization of aggressive B-Cell Lymphoma cellular models, including HGBL, DLBCL and BL, to unambiguously characterize their mutational profiles, including both structural and sequence alterations. Our data first showed that \u003cem\u003eMYC\u003c/em\u003e, \u003cem\u003eBCL2\u003c/em\u003e or \u003cem\u003eBCL6\u003c/em\u003e gene rearrangements, including those involving \u003cem\u003eIG\u003c/em\u003e regulatory regions, frequent in B-cell lymphomas, do not always translate in an increased gene expression, consistently with recently published studies (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). However, it should be noted that these data have been obtained from model cell lines with very complex karyotypes that might not reflect genetic abnormalities in patient material.\u003c/p\u003e \u003cp\u003eWe then tested BETi with different scaffold and selectivity and showed that cellular responses were very similar for pan-BETi of different scaffold and mainly dependent of their activity towards BD1. This is in line with a recent report showing the preferential efficacy of BD2-selective on induced gene expression such as immune response, rather than on oncogene expression (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). This led us to focus the rest of our study on the prominent and largely studied JQ1 pan-BETi.\u003c/p\u003e \u003cp\u003eWe have shown that BETi exhibit similar cytostatic profiles, but different cytotoxicity profiles across the model cell lines tested. Among all gene alterations and expression profiles evaluated, MYC protein expression was the only parameter strictly correlated to BETi-induced cell death, suggesting it could be used as a surrogate marker for MYC dependency. Of note, evaluation of MYC level by immunohistochemistry is not correlated to patient prognosis in DLBCL (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). This apparent discrepancy could be due to either: i) immunohistochemistry lacking the quantitative precision to distinguish very high levels of MYC expression, or ii) MYC dependency not being indicative of treatment response.\u003c/p\u003e \u003cp\u003eInvalidation of MYC expression in models sensitive to BETi cytotoxicity confirm their addiction to MYC expression for both cell growth and cell survival. In contrast, in models resistant to BETi cytotoxicity, the cytostatic effect observed does not seem to be mediated through MYC, even in presence of \u003cem\u003eMYC\u003c/em\u003e rearrangement, which was thought be a major indicator of MYC dependency.\u003c/p\u003e \u003cp\u003eBy analyzing JQ1 global impact on gene expression, we showed that the response to BETi is very different between cell lines, with few commonly impacted genes. None of them could be specifically associated with BETi-induced cell death in MYC-dependent cell lines. Analysis of changes in gene expression profiles does not therefore seem to be efficient to identify drivers of BETi cytotoxicity besides MYC addiction. We could neither correlate JQ1-induced changes in gene expression with any CNV or chromosomal alterations determined by OGM. This suggest that genes affected by structural variations, including chromosomal rearrangements involving the \u003cem\u003eIG\u003c/em\u003e loci, are not preferential transcriptional targets of JQ1. However, the sample size used here may not be sufficient to draw a definite conclusion.\u003c/p\u003e \u003cp\u003eHowever, this set of data allowed to highlight the innate activation of Wnt pathway related to a stemness signature. Wnt pathway was already connected to BET inhibitors resistance, but in the context of acquired resistance in leukemia stem cells (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). A detailed analysis of gene expression data suggested that, effectors of canonical Wnt pathway were not different between the 2 groups of lymphoma cell lines. In contrast, our data revealed a specific alternative pathway involving WNT5A and WNTB ligand and downstream Hippo pathway through YAP and TEAD transcription factors, that form, when co-expressed, a transcriptionally active complex controlling pro-proliferative programs. This pathway was previously described in breast cancer and related to altered cell migration and differentiation phenotypes (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e) but has never been described in another context to our knowledge. Even, if our conclusions are only drawn from gene expression data, mathematical modeling confirmed the involvement of WNT5B and TEAD in driving resistance to JQ1-induced cytotoxicity in MYC independent models.\u003c/p\u003e \u003cp\u003eSeveral studies have already related Hippo transcriptional regulators and co-activators YAP, TAZ and TEAD resistance to chemotherapy, but also to several types of targeted therapies (hormone, small molecules inhibitors, inhibitors of immune checkpoint) (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). Interestingly, two recent papers report several connections between YAP/TAZ and BET proteins in lung and breast cancer (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e). These papers show that i) YAP/TAZ and TEAD are directly regulated by BRD4 and ii) a direct interaction of BRD4 on the promoter of YAP/TAZ target genes. Accordingly, YAP signaling can therefore be inhibited by BETi.\u003c/p\u003e \u003cp\u003eIn the context of lymphoma cells, we showed that YAP/TEAD are still expressed upon BETi treatment and might contribute to resistance to BET inhibition in MYC independent cellular models. Our data strongly suggest that Wnt/Hippo crosstalk could represent a novel oncogenic pathway in B-Cell lymphoma associated with innate BETi resistance in MYC-independent models, and confirmed it represents a novel therapeutic vulnerability to design combination therapy.\u003c/p\u003e \u003cp\u003eIn conclusion, our study provides new insight into the complexity of the molecular mechanisms underlying MYC and related oncogenic signaling in B-cell lymphoma. Our findings also pave the way for the development of rationalized combination therapies strategies that could be validated in further preclinical and clinical studies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003eNon applicable\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNon applicable\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work is supported by the French National Research Agency in the framework of the \"Investissements d\u0026rsquo;avenir\u0026rdquo; program (ANR-15-IDEX-02) that provided PhD studentship to LD. This work has also been supported by CBH-EUR-GS (ANR-17-EURE-0003) and Grenoble University Hospital Innovative Research Fund (AO Interne CHUGA). CL has been supported by ARAMIS association and Grenoble University Hospital Innovative Research Fund to develop OGM.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eLD, SH, AGS and CT performed cellular experiments and analyzed data. SC and CL performed genomics (OGM and targeted NGS) experiment and analyzed data. EM, PBF and TB performed bioinformatics and biostatistics analysis. TB, SC, RG, CL, JG and AE conceived and designed the study. JG and AE coordinated the study. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe acknowledge the contribution of SFR Biosciences (UAR3444/CNRS, US8/Inserm, ENS de Lyon, UCBL) facilities especially AniRA lentivectors production facility from the CELPHEDIA Infrastructure (Gis\u0026egrave;le Froment, Didier N\u0026egrave;gre and Caroline Costa). We thank the Microcell core facility of the Institute for Advanced Biosciences (UGA - Inserm U1209 - CNRS 5309), especially Mylene Pezet and Solenne Dufour, for their help with flow cytometry experiments. This facility belongs to the IBISA-ISdV platform, member of the national infrastructure France-BioImaging supported by the French National Research Agency (ANR-10-INBS-04).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eGene expression (RNaseq) data generated and analysed during the current study are available in the GEO repository (pending accession number). List of differentially expressed genes between cell lines sensitive and resistant to BETi-induced cell death are presented in Table S1. OGM and targeted sequencing raw and processed data are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSwerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, et al. The 2016 revision of the World Health Organization classification of lymphoid neoplasms. Blood. 19 mai 2016;127(20):2375\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBisso A, Sab\u0026ograve; A, Amati B. MYC in Germinal Center-derived lymphomas: Mechanisms and therapeutic opportunities. Immunol Rev. 2019;288(1):178\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtt G, Rosenwald A, Campo E. Understanding MYC-driven aggressive B-cell lymphomas: pathogenesis and classification. 2013;\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Y, Zhang X. The Spectrum of MYC Alterations in Diffuse Large B-Cell Lymphoma. Acta Haematol. 19 f\u0026eacute;vr 2020;143(6):520\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkozy C, Traverse-Glehen A, Coiffier B. Double-hit and double-protein-expression lymphomas: aggressive and refractory lymphomas. Lancet Oncol. 1 nov 2015;16(15):e555\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScott DW, King RL, Staiger AM, Ben-Neriah S, Jiang A, Horn H, et al. High-grade B-cell lymphoma with MYC and BCL2 and/or BCL6 rearrangements with diffuse large B-cell lymphoma morphology. Blood. 3 mai 2018;131(18):2060\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlaggio R, Amador C, Anagnostopoulos I, Attygalle AD, Araujo IB de O, Berti E, et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Lymphoid Neoplasms. Leukemia. juill 2022;36(7):1720\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEnnishi D, Jiang A, Boyle M, Collinge B, Grande BM, Ben-Neriah S, et al. Double-Hit Gene Expression Signature Defines a Distinct Subgroup of Germinal Center B-Cell-Like Diffuse Large B-Cell Lymphoma. J Clin Oncol. 20 janv 2019;37(3):190\u0026ndash;201.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCochran AG, Conery AR, Sims RJ. Bromodomains: a new target class for drug development. Nat Rev Drug Discov. ao\u0026ucirc;t 2019;18(8):609\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFilippakopoulos P, Qi J, Picaud S, Shen Y, Smith WB, Fedorov O, et al. Selective inhibition of BET bromodomains. Nature. d\u0026eacute;c 2010;468(7327):1067\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNicodeme E, Jeffrey KL, Schaefer U, Beinke S, Dewell S, Chung C wa, et al. Suppression of inflammation by a synthetic histone mimic. Nature. d\u0026eacute;c 2010;468(7327):1119\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFilippakopoulos P, Knapp S. Targeting bromodomains: epigenetic readers of lysine acetylation. Nat Rev Drug Discov. mai 2014;13(5):337\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelmore JE, Issa GC, Lemieux ME, Rahl PB, Shi J, Jacobs HM, et al. BET Bromodomain Inhibition as a Therapeutic Strategy to Target c-Myc. Cell. sept 2011;146(6):904\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMertz JA, Conery AR, Bryant BM, Sandy P, Balasubramanian S, Mele DA, et al. Targeting MYC dependence in cancer by inhibiting BET bromodomains. Proc Natl Acad Sci U S A. 4 oct 2011;108(40):16669\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLov\u0026eacute;n J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al. Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell. 11 avr 2013;153(2):320\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChapuy B, McKeown MR, Lin CY, Monti S, Roemer MGM, Qi J, et al. Discovery and Characterization of Super-Enhancer-Associated Dependencies in Diffuse Large B Cell Lymphoma. Cancer Cell. d\u0026eacute;c 2013;24(6):777\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoi M, Gaudio E, Bonetti P, Kwee I, Bernasconi E, Tarantelli C, et al. The BET Bromodomain Inhibitor OTX015 Affects Pathogenetic Pathways in Preclinical B-cell Tumor Models and Synergizes with Targeted Drugs. Clin Cancer Res. 1 avr 2015;21(7):1628\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCeribelli M, Kelly PN, Shaffer AL, Wright GW, Xiao W, Yang Y, et al. Blockade of oncogenic IκB kinase activity in diffuse large B-cell lymphoma by bromodomain and extraterminal domain protein inhibitors. Proc Natl Acad Sci. 5 ao\u0026ucirc;t 2014;111(31):11365\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCummin TEC, Cox KL, Murray TD, Turaj AH, Dunning L, English VL, et al. BET inhibitors synergize with venetoclax to induce apoptosis in MYC-driven lymphomas with high BCL-2 expression. Blood Adv. 28 juill 2020;4(14):3316\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsteve-Arenys A, Valero JG, Chamorro-Jorganes A, Gonzalez D, Rodriguez V, Dlouhy I, et al. The BET bromodomain inhibitor CPI203 overcomes resistance to ABT-199 (venetoclax) by downregulation of BFL-1/A1 in in vitro and in vivo models of MYC+/BCL2\u0026thinsp;+\u0026thinsp;double hit lymphoma. Oncogene. avr 2018;37(14):1830\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHogg SJ, Newbold A, Vervoort SJ, Cluse LA, Martin BP, Gregory GP, et al. BET Inhibition Induces Apoptosis in Aggressive B-Cell Lymphoma via Epigenetic Regulation of BCL-2 Family Members. Mol Cancer Ther. 1 sept 2016;15(9):2030\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Gupta SK, Han W, Kundson RA, Nelson S, Knutson D, et al. Targeting MYC activity in double-hit lymphoma with MYC and BCL2 and/or BCL6 rearrangements with epigenetic bromodomain inhibitors. J Hematol OncolJ Hematol Oncol. d\u0026eacute;c 2019;12(1):73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrabucco SE, Gerstein RM, Evens AM, Bradner JE, Shultz LD, Greiner DL, et al. Inhibition of Bromodomain Proteins for the Treatment of Human Diffuse Large B-cell Lymphoma. Clin Cancer Res. 1 janv 2015;21(1):113\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShorstova T, Foulkes WD, Witcher M. Achieving clinical success with BET inhibitors as anti-cancer agents. Br J Cancer. 27 avr 2021;124(9):1478\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaivre EJ, McDaniel KF, Albert DH, Mantena SR, Plotnik JP, Wilcox D, et al. Selective inhibition of the BD2 bromodomain of BET proteins in prostate cancer. Nature. 13 f\u0026eacute;vr 2020;578(7794):306\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilan O, Rioja I, Knezevic K, Bell MJ, Yeung MM, Harker NR, et al. Selective targeting of BD1 and BD2 of the BET proteins in cancer and immunoinflammation. Science. 24 avr 2020;368(6489):387\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCallanan MB, Le Baccon P, Mossuz P, Duley S, Bastard C, Hamoudi R, et al. The IgG Fc receptor, FcgammaRIIB, is a target for deregulation by chromosomal translocation in malignant lymphoma. Proc Natl Acad Sci U S A. 4 janv 2000;97(1):309\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eISCN 2020 | Karger Book [Internet]. [cit\u0026eacute; 12 janv 2023]. Disponible sur: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.karger.com/Book/Home/279152\u003c/span\u003e\u003cspan address=\"https://www.karger.com/Book/Home/279152\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePutri GH, Anders S, Pyl PT, Pimanda JE, Zanini F. Analysing high-throughput sequencing data in Python with HTSeq 2.0. Bioinformatics. 13 mai 2022;38(10):2943\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. d\u0026eacute;c 2014;15(12):1\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 25 oct 2005;102(43):15545\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu T, Hu E, Xu S, Chen M, Guo P, Dai Z, et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. The Innovation. 28 ao\u0026ucirc;t 2021;2(3):100141.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZippo A, De Robertis A, Serafini R, Oliviero S. PIM1-dependent phosphorylation of histone H3 at serine 10 is required for MYC-dependent transcriptional activation and oncogenic transformation. Nat Cell Biol. ao\u0026ucirc;t 2007;9(8):932\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, et al. Single-vector inducible lentiviral RNAi system for oncology target validation. Cell Cycle Georget Tex. 1 f\u0026eacute;vr 2009;8(3):498\u0026ndash;504.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmadali A, Rousseaux S, Bruder-Costa J, Rome C, Duley S, Hamaidia S, et al. Identification of a novel BET bromodomain inhibitor-sensitive, gene regulatory circuit that controls Rituximab response and tumour growth in aggressive lymphoid cancers. EMBO Mol Med. ao\u0026ucirc;t 2013;5(8):1180\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChapuy B, Stewart C, Dunford AJ, Kim J, Kamburov A, Redd RA, et al. Molecular Subtypes of Diffuse Large B-cell Lymphoma are Associated with Distinct Pathogenic Mechanisms and Outcomes. Nat Med. mai 2018;24(5):679\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReddy A, Zhang J, Davis NS, Moffitt AB, Love CL, Waldrop A, et al. Genetic and Functional Drivers of Diffuse Large B Cell Lymphoma. Cell. 5 oct 2017;171(2):481\u0026ndash;494.e15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSears RC. The Life Cycle of C-Myc: From Synthesis to Degradation. Cell Cycle. 9 sept 2004;3(9):1131\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNicodeme E, Jeffrey KL, Schaefer U, Beinke S, Dewell S, Chung C wa, et al. Suppression of inflammation by a synthetic histone mimic. Nature. d\u0026eacute;c 2010;468(7327):1119\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePicaud S, Wells C, Felletar I, Brotherton D, Martin S, Savitsky P, et al. RVX-208, an inhibitor of BET transcriptional regulators with selectivity for the second bromodomain. Proc Natl Acad Sci. 3 d\u0026eacute;c 2013;110(49):19754\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark HW, Kim YC, Yu B, Moroishi T, Mo JS, Plouffe SW, et al. Alternative Wnt Signaling Activates YAP/TAZ. Cell. 13 ao\u0026ucirc;t 2015;162(4):780\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamanta S, Guru S, Elaimy AL, Amante JJ, Ou J, Yu J, et al. IMP3 Stabilization of WNT5B mRNA Facilitates TAZ Activation in Breast Cancer. Cell Rep. 29 mai 2018;23(9):2559\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollinge B, Ben-Neriah S, Chong L, Boyle M, Jiang A, Miyata-Takata T, et al. The impact of MYC and BCL2 structural variants in tumors of DLBCL morphology and mechanisms of false-negative MYC IHC. Blood. 22 avr 2021;137(16):2196\u0026ndash;208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoi M, Gaudio E, Bonetti P, Kwee I, Bernasconi E, Tarantelli C, et al. The BET Bromodomain Inhibitor OTX015 Affects Pathogenetic Pathways in Preclinical B-cell Tumor Models and Synergizes with Targeted Drugs. Clin Cancer Res. 31 mars 2015;21(7):1628\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCeribelli M, Kelly PN, Shaffer AL, Wright GW, Xiao W, Yang Y, et al. Blockade of oncogenic IκB kinase activity in diffuse large B-cell lymphoma by bromodomain and extraterminal domain protein inhibitors. Proc Natl Acad Sci U S A. 5 ao\u0026ucirc;t 2014;111(31):11365\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCummin TEC, Cox KL, Murray TD, Turaj AH, Dunning L, English VL, et al. BET inhibitors synergize with venetoclax to induce apoptosis in MYC-driven lymphomas with high BCL-2 expression. Blood Adv. 27 juill 2020;4(14):3316\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsteve-Arenys A, Valero JG, Chamorro-Jorganes A, Gonzalez D, Rodriguez V, Dlouhy I, et al. The BET bromodomain inhibitor CPI203 overcomes resistance to ABT-199 (venetoclax) by downregulation of BFL-1/A1 in in vitro and in vivo models of MYC+/BCL2\u0026thinsp;+\u0026thinsp;double hit lymphoma. Oncogene. avr 2018;37(14):1830\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHogg SJ, Newbold A, Vervoort SJ, Cluse LA, Martin BP, Gregory GP, et al. BET Inhibition Induces Apoptosis in Aggressive B-Cell Lymphoma via Epigenetic Regulation of BCL-2 Family Members. Mol Cancer Ther. 1 sept 2016;15(9):2030\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Gupta SK, Han W, Kundson RA, Nelson S, Knutson D, et al. Targeting MYC activity in double-hit lymphoma with MYC and BCL2 and/or BCL6 rearrangements with epigenetic bromodomain inhibitors. J Hematol OncolJ Hematol Oncol. d\u0026eacute;c 2019;12(1):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMertz JA, Conery AR, Bryant BM, Sandy P, Balasubramanian S, Mele DA, et al. Targeting MYC dependence in cancer by inhibiting BET bromodomains. Proc Natl Acad Sci. 4 oct 2011;108(40):16669\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrabucco SE, Gerstein RM, Evens AM, Bradner JE, Shultz LD, Greiner DL, et al. Inhibition of Bromodomain Proteins for the Treatment of Human Diffuse Large B-cell Lymphoma. Clin Cancer Res. 5 janv 2015;21(1):113\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLov\u0026eacute;n J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al. Selective Inhibition of Tumor Oncogenes by Disruption of Super-Enhancers. Cell. 11 avr 2013;153(2):320\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbedin SM, Boddy CS, Munshi HG. BET inhibitors in the treatment of hematologic malignancies: current insights and future prospects. OncoTargets Ther. 28 sept 2016;9:5943\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmorim S, Stathis A, Gleeson M, Iyengar S, Magarotto V, Leleu X, et al. Bromodomain inhibitor OTX015 in patients with lymphoma or multiple myeloma: a dose-escalation, open-label, pharmacokinetic, phase 1 study. Lancet Haematol. 1 avr 2016;3(4):e196\u0026ndash;204.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlum KA, Supko JG, Maris MB, Flinn IW, Goy A, Younes A, et al. A Phase I Study of Pelabresib (CPI-0610), a Small-Molecule Inhibitor of BET Proteins, in Patients with Relapsed or Refractory Lymphoma. Cancer Res Commun. 11 ao\u0026ucirc;t 2022;2(8):795\u0026ndash;805.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalchook G, Rosen S, LoRusso P, Watts J, Gupta S, Coombs CC, et al. Development of 2 Bromodomain and Extraterminal Inhibitors With Distinct Pharmacokinetic and Pharmacodynamic Profiles for the Treatment of Advanced Malignancies. Clin Cancer Res. 13 mars 2020;26(6):1247\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreno V, Sepulveda JM, Vieito M, Hern\u0026aacute;ndez-Guerrero T, Doger B, Saavedra O, et al. Phase I study of CC-90010, a reversible, oral BET inhibitor in patients with advanced solid tumors and relapsed/refractory non-Hodgkin\u0026rsquo;s lymphoma. Ann Oncol. 1 juin 2020;31(6):780\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreno V, Vieito M, Sepulveda JM, Galvao V, Hern\u0026aacute;ndez-Guerrero T, Doger B, et al. BET inhibitor trotabresib in heavily pretreated patients with solid tumors and diffuse large B-cell lymphomas. Nat Commun. 13 mars 2023;14(1):1359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShorstova T, Foulkes WD, Witcher M. Achieving clinical success with BET inhibitors as anti-cancer agents. Br J Cancer. 27 avr 2021;124(9):1478\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang C, Stelloo E, Barrans S, Cucco F, Jiang D, Tzioni MM, et al. Non-IG::MYC in diffuse large B-cell lymphoma confers variable genomic configurations and MYC transactivation potential. Leukemia. 6 janv 2024;1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson NA, Slack GW, Savage KJ, Connors JM, Ben-Neriah S, Rogic S, et al. Concurrent Expression of MYC and BCL2 in Diffuse Large B-Cell Lymphoma Treated With Rituximab Plus Cyclophosphamide, Doxorubicin, Vincristine, and Prednisone. J Clin Oncol. 1 oct 2012;30(28):3452\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFong CY, Gilan O, Lam EYN, Rubin AF, Ftouni S, Tyler D, et al. BET inhibitor resistance emerges from leukaemia stem cells. Nature. 24 sept 2015;525(7570):538\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeren-Paz A, Emmanuel R, Samuels Y. YAP and the drug resistance highway. Nat Genet. mars 2015;47(3):193\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReggiani F, Gobbi G, Ciarrocchi A, Ambrosetti DC, Sancisi V. Multiple roles and context-specific mechanisms underlying YAP and TAZ-mediated resistance to anti-cancer therapy. Biochim Biophys Acta BBA - Rev Cancer. 1 janv 2020;1873(1):188341.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGobbi G, Donati B, Do Valle IF, Reggiani F, Torricelli F, Remondini D, et al. The Hippo pathway modulates resistance to BET proteins inhibitors in lung cancer cells. Oncogene. oct 2019;38(42):6801\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZanconato F, Battilana G, Forcato M, Filippi L, Azzolin L, Manfrin A, et al. Transcriptional addiction in cancer cells is mediated by YAP/TAZ through BRD4. Nat Med. oct 2018;24(10):1599\u0026ndash;610.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"clinical-epigenetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"clep","sideBox":"Learn more about [Clinical Epigenetics](http://clinicalepigeneticsjournal.biomedcentral.com/)","snPcode":"13148","submissionUrl":"https://submission.nature.com/new-submission/13148/3","title":"Clinical Epigenetics","twitterHandle":"@OAgenetics","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"MYC, BET inhibition, B-Cell Lymphoma, oncogene addiction","lastPublishedDoi":"10.21203/rs.3.rs-4647617/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4647617/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eBackground.\u003c/em\u003e MYC-driven lymphomas are a subset of B-cell lymphomas characterized by genetic alterations that dysregulate the expression of the \u003cem\u003eMYC \u003c/em\u003eoncogene. When overexpressed, typically through chromosomal translocations, amplifications, or other mechanisms, MYC can drive uncontrolled cell growth and contribute to cancer development. MYC-driven lymphomas are described as aggressive entities which require intensive treatment approaches and can be associated with poor prognosis. In the absence of direct MYC-targeting therapy, epigenetic drugs called BET inhibitors (BETi), were shown to reduce MYC levels by disrupting BRD4-dependent transcription associated with the expression of \u003cem\u003eMYC\u003c/em\u003e, as well as other oncogenes. Here, we used BETi as molecular tools to better understand oncogenic dependencies in a panel of cell line models of MYC-driven B-cell lymphoma selected to represent their genetic heterogeneity.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eResults.\u003c/em\u003e We first showed that, in these models, MYC expression level does not strictly correlate to the presence of gene alterations. Our data also demonstrated that BETi induces similar growth arrest in all lymphoma cell lines independently of \u003cem\u003eMYC\u003c/em\u003e mutational status or expression level. In contrast, BETi-induced cell death was only observed in two cell lines presenting the highest level of MYC protein. This suggest that some MYC-driven lymphoma could present a stronger dependency on MYC for their survival which cannot be predicted on the sole basis on their genetics. This hypothesis was confirmed by gene invalidation experiments, which showed that MYC loss recapitulates the effect on BETi treatment on both cell proliferation and survival, confirming MYC oncogene addiction in these specific models. In contrast, the growth arrest observed in cell lines resistant to BETi-induced apoptosis is not mediated through MYC, but rather through alternative pro-proliferative or oncogenic pathways. Gene expression profiling revealed the basal activation of a specific non-canonical Wnt/Hippo pathway in cell death-resistant cell lines that could be targeted in combination therapy to restore BETi cytotoxicity.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConclusion.\u003c/em\u003e This work brings new insights into the complexity of MYC dependencies and unravels a novel targetable oncogenic pathway in aggressive B-cell lymphomas.\u003c/p\u003e","manuscriptTitle":"BET inhibition revealed varying MYC addiction mechanisms independent of gene alterations in aggressive B-cell lymphomas.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 16:38:50","doi":"10.21203/rs.3.rs-4647617/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-25T12:27:56+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-25T12:20:25+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-18T09:17:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"253806136981066305234724815767635721431","date":"2024-07-15T11:11:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"255465151214810882221260441271678767908","date":"2024-07-04T02:39:54+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-02T10:52:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-28T17:22:03+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-28T13:15:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Clinical Epigenetics","date":"2024-06-27T10:00:55+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"clinical-epigenetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"clep","sideBox":"Learn more about [Clinical Epigenetics](http://clinicalepigeneticsjournal.biomedcentral.com/)","snPcode":"13148","submissionUrl":"https://submission.nature.com/new-submission/13148/3","title":"Clinical Epigenetics","twitterHandle":"@OAgenetics","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7072baa2-62d6-4762-9481-ead81611fe3e","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-23T16:02:23+00:00","versionOfRecord":{"articleIdentity":"rs-4647617","link":"https://doi.org/10.1186/s13148-024-01788-7","journal":{"identity":"clinical-epigenetics","isVorOnly":false,"title":"Clinical Epigenetics"},"publishedOn":"2024-12-19 15:57:44","publishedOnDateReadable":"December 19th, 2024"},"versionCreatedAt":"2024-07-22 16:38:50","video":"","vorDoi":"10.1186/s13148-024-01788-7","vorDoiUrl":"https://doi.org/10.1186/s13148-024-01788-7","workflowStages":[]},"version":"v1","identity":"rs-4647617","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4647617","identity":"rs-4647617","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}