A wheat stripe rust adult plant resistant gene YrJ262 mapping within a spontaneous terminal deletion in the short arm of chromosome 3B | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A wheat stripe rust adult plant resistant gene YrJ262 mapping within a spontaneous terminal deletion in the short arm of chromosome 3B Xiaoxue Zeng, Jianbo Li, Guangrong Li, Wenping Gong, Chunhao Fang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7543105/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Wheat stripe (or yellow) rust, caused by Puccinia striiformis f. sp. tritici , imposes one of the gravest constraints to wheat production. While race-specific seedling resistance genes can be effective in controlling this disease, those which confer resistance at the adult stage typically protect the host from infection by a broad spectrum of the pathogen, and tend to be more durable. But the durable resistance such as that expressed by the recently developed Chinese cultivar (cv.) Jimai 262 is poorly understood. Based on the identification of a spontaneous loss-of-function mutant, a genetic analysis indicated that cv. Jimai 262’s adult plant resistance to stripe rust is conferred by the presence of a single dominant gene, tentatively designated YrJ262 . Bulk segregant exome sequencing implied that the distal end of chromosome arm 3BS of the mutant lacked a ~ 73 Mbp segment which was present in cv. Jimai 262, thereby placing YrJ262 within this segment. The presence of this deletion was confirmed by a fluorescence in situ hybridization-based analysis. The flanking sequences of the Yr30 candidate region were identical between plants carrying Yr30 and cv. Jimai 262, consistent with the hypothesis that Yr30 and YrJ262 co-locate within the same locus. The YrJ262 was complemented by resistant alleles at the QTL on chromosomes 1B and 4B for sufficient adult plant resistance in Jimai 262. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Bread wheat ( Triticum aestivum ), one of the world’s most important crops, is a major supplier of both calories and protein in the human diet (Shiferaw et al. 2013). Both its yield and end-use quality are compromised by a range of pathogens, among which the fungus Puccinia striiformis f. sp. tritici ( Pst ), the causative agent of stripe (or yellow) rust, can be especially damaging (Beddow et al. 2015 ; Chen 2020 ). While the crop can be protected by the use of fungicidal spays, the incorporation of resistance genes offers a more practical and environmentally sustainable control method. Two types of resistance genes against fungi, including Pst , have been recognized: the first (referred to as ‘adult plant resistance’ [APR]) protects against infection at the adult plant stage, but not at its seedling stage, while the other protects the plant throughout its life cycle, but only against a specific physiological race(s) of the pathogen. Pst populations typically co-evolve with plants, thereby imposing a significant risk of sudden failure when race-specific resistance genes are deployed (Schwessinger 2017 ). In contrast, since APR is generally non-race specific, the resistance tends to be more durable; as a result, this class of genes has been increasingly exploited by crop breeders (Bhavani et al. 2022 ). As many as 86 Pst resistance genes have been recognized in wheat (Zhu et al. 2023 ), of which at least 30 confer APR (Fu et al. 2009 ; Krattinger et al. 2009 ; Moore et al. 2015 ; Nsabiyera et al. 2018 ; Singh et al. 2000a ; Singh et al. 2000b ; Zhu et al. 2023 ). As yet, just three Pst APR genes have been isolated (Fu et al. 2009 ; Krattinger et al. 2009 ; Moore et al. 2015 ): Yr18 has been shown to encode an ABC transporter (Krattinger et al. 2009 ), Yr36 a wheat kinase start 1 (WKS1) protein (Fu et al. 2009 ) and Yr46 a hexose transporter (Moore et al. 2015 ). The APR gene Yr30 , mapping to a location on chromosome arm 3BS, was originally identified in cv. Opata 85 (Singh et al. 2000). Subsequently, its presence has been associated with durable resistance against Pst , although its effectiveness is genetic background dependent (Wang et al. 2024). The level of host resistance conferred by Yr30 can be enhanced by its combination with either of the two major genes Yr29 (mapping to chromosome arm 1BL) and Yr31 (chromosome arm 2BS) (Suenaga et al. 2003 ; Yang et al. 2013 ), or with the QTL QYrFDC12 (chromosome arm 4BL) (Liu et al. 2022 ). Although Wang et al. (2024) fine-mapped Yr30 to within a 617 kbp region, no candidate gene has yet been identified. Durable resistance against Pst has become a priority breeding goal of wheat improvement programs worldwide in recent years. The variety Chinese cultivar (cv.) Jimai 262, a selection from the cross cv. Linmai 2 × cv. Yannong 19, features a pronounced level of drought tolerance, as well as expressing APR against Pst (Li et al. 2021 ). The isolation of a spontaneous mutant (262S), lacking the Pst APR, among field grown plants of cv, Jimai 262 has allowed the present study to show not only that a major gene mapping to the distal end of chromosome arm 3BS is responsible for the Pst resistance phenotype of cv. Jimai 262, but also that its APR is enhanced by the presence of two QTL, one mapping to chromosome 1B and the other to chromosome 4B. Materials and methods Plant materials Seeds of cv. Jimai 262 was obtained from Wheat Breeding Group, Crop Research Institute, Shandong Academy of Agricultural Sciences. The Pst susceptible spontaneous mutant discovered and named 262S was crossed as male with cv. Jimai 262, and the resulting F 1 hybrid was self-pollinated to produce an F 2 population and a series of F 2:3 lines. Doubled haploid (DH) lines were created from the cross between Jimai 262 (as female) and Yannong 24 (as male). Assessment of Pst resistance The assessment of host reaction to Pst infection was carried out at the Sichuan Academy of Sciences Xindu Experiment Station in Chengdu. A set of 20 progeny from each F 2:3 line was sown in duplicate, across two different fields in the year of 2021. Following Wu et al. ( 2015 ), the inoculum comprised a mixture of three Pst races (CYR32, CYR33 and CYR34). The host response was assessed at both the seedling and the heading stages, coinciding with sporulation occurring on susceptible controls. Infection types (ITs) were assigned a score based on a 0–9 scale. Bulked segregant exome capture sequencing (BSE-Seq) Two DNA bulks were created from phenotyped cv. Jimai 262 x 262S F 2 individuals: the resistant (wild type) bulk was formed from 30 plants scoring IT = 2, while the susceptible (mutant type) one combined 26 plants with an IT of 6 or 7. Genomic DNA was extracted from young leaves of each bulk and each of the two parental lines, using a CTAB-based method (Porebski et al. 1997 ). The process of exome capture sequencing was performed according to Dong et al. ( 2020 ). Read quality was filtered using Fastp v0.12.4 software (Chen et al. 2018 ) to remove low quality reads and adapter sequences. The short-read alignment software package BWA (Li and Durbin 2009 ) was used to align the filtered reads to the IWGSC RefSeq v2.1 Chinese Spring genome assembly (Zhu et al. 2021 ) applying default parameters. SAMtools software (Li et al. 2009 ) was used to convert, remove PCR duplicated reads, sort and index the resulting bam files. Single nucleotide polymorphisms (SNPs) were called using Bcftools software (Narasimhan et al. 2016 ), with the minimum-mapping-quality parameter set at 30 and the minimum-depth parameter at 5. According to the bam files acquired from the two bulks, a Euclidean distance metric (ED) was calculated to identify the candidate regions of the genome associated with the presence of a Pst -resistant gene(s) (Hill et al. 2013 ): the relevant formula was: where A, C, G, T refer to the frequency of each base in either the mutant type (mut) or wild type (wt) bulk. As suggested by Hill et al. ( 2013 ), ED raised to the fourth power (ED 4 ) was used to eliminate background noise. A count of those reads able to be mapped onto the reference genome was achieved using the HTSeq 2.0 tool (Putri et al. 2022 ). Fluorescence in situ hybridization analysis (FISH) The processing of seedling root tips and the preparation of mitotic cells were achieved following methods given by Han et al. ( 2006 ), and the FISH procedure followed that given by Tang et al. ( 2014 ). The Oligo-pSc119.2-1 probe (5'-CCGTTTTGTGGACTATTACTCACCGCTTTGGGGTCCCATAGCTAT) was 5′-labeled with 6-carboxyfluorescein while Oligo-pTa535-1 (5′- AAAAACTTGACGCACGTCACGTACAAATTGGACAAACTCTTTCGGAGTATCAGGGTTTC) was labeled with 6-carboxytetramethylrhodamine. ZEN 2.3 software was used to analyze images generated by an Axio Observer microscope equipped with an AxioCam camera (Carl Zeiss AG, Oberkochen, Germany). Root tips of the two genotypes, homozygous resistant and homozygous susceptible, from three or four different lines for each genotype (one seed per line) were observed. The physical location of sites hybridizing to each probe was performed using a local B2DSC web server (Lang et al., 2018), based on the criteria “% identical matches > 85%” and “query coverage per subject > 80%”, the counts of the repeats per Mbp were counted. Kompetitive allele-specific PCR (KASP) assays Two SNP markers ( AX-110053948 and YM3B-3 ), known to co-segregate with Yr30 (Wang et al. 2024b ), were used for a KASP assay. Each 5 µL reaction contained 2.5 µL HiGeno 2 × Probe Mix B (JasonGen, Beijing, China), 0.0448 µL primer (100 µM), 200 ng genomic DNA and 1.4552 µL ddH 2 O. The reactions were run using a CFX96 Real-Time PCR detection device (Bio-Rad, Hercules, CA, USA): the reaction protocol was 94°C/15 min, followed by ten touchdown cycles of 94°C/20 s, annealing temperature/60 s (starting at 65°C, reducing by 0.8°C per cycle), followed by 30 cycles of 94°C/20 s, 57°C/60 s. Fluorescence was detected using a PHERAstar microplate reader supported by KlusterCaller genotyping software (BMG Labtech, Ortenberg, Germany). QTL mapping The DH population was grown in four replicates as the year of 2022 (two different fields) and the year of 2023 (two different fields) and ten plants per DH line were assessed for their reaction to Pst infection in the spring of the following years. The 55k single nucleotide polymorphism (SNP) assay was used for genotyping the DH population and parents by Compass Biotechnology (Beijing, China). Linkage map construction and QTL analysis were conducted by IciMapping 4.1 ( https://www.isbreeding.net/software ). The SNP markers distinguished between parents were selected (the genotypes of Jimai 262 were “2” while that of Yannong 24 were “0”) and filtered using the function of “BIN”. The Kosambi mapping function was used to estimate the genetic distances. The QTL detection was implemented by the biparental population (BIP) module using the method of Inclusive Composite Interval Mapping with the additive tool (ICIM-ADD). A minimum logarithm of odds (LOD) threshold value was set as 3. The proportion of phenotypic variance explained and the additive effect by the QTL was calculated. Results Genetic basis of the Pst susceptibility shown by the 262S mutant Over the seasons from 2019 to 2022 growing seasons, seedlings of both cv. Jimai 262 and 262S were scored as Pst susceptible (IT = 6–7), but while cv. Jimai 262 plants at the heading stage were resistant (IT = 2), those of 262S were susceptible (IT = 6–7) (Fig. 1 ) as supported by their scores (Table S1 ). At the heading stage, the 145 F 2 progeny bred from the cross cv. Jimai 262 × 262S segregated as 119 resistant (IT = 1–3) and 26 susceptible (IT = 6–7) (Fig. S1 ), a ratio consistent with the presence of a single recessive locus for Pst susceptibility (χ 2 p-value 0.049, see Table 1). The ITs of 145 F 2:3 lines scored at the adult plant stage (Table S1 , Fig. S1 ) showed that the F 2 progeny homozygous resistant, heterozygous and homozygous susceptible segregated to fit a 1:2:1 ratio (Table 1). The implication is that the Pst susceptibility of 262S results from the loss of the single dominant gene responsible for the Pst APR expressed by cv. Jimai 262 - this gene is here tentatively designated YrJ262 . The YrJ262 locus lies within a 73 Mbp segment of chromosome arm 3BS BSE-Seq approach was adopted in order to identify the genomic region(s) harboring YrJ262 . Two bulk DNAs were prepared: one (F2-R) comprised DNA extracted from 30 Pst resistant F 2 individuals, and the other (F2-S) from the DNA of 26 Pst susceptible ones. These bulk DNAs were processed for sequencing, along with DNA prepared from cv. Jimai 262 and 262S. Between 130 and 321 million clean paired-end reads were generated (Table S2 ). An ED analysis carried out on the two bulks detected three discriminating regions, one mapping to chromosome 3A, one to 3B and one to 4B (Fig. 2 ); based on its loess fitted ED 4 value of 0.62, the strongest candidate region for YrJ262 was the 73 Mbp segment lying close to the terminus of chromosome arm 3BS (Fig. S2 b). The DNAs of 262S and F2-S featured sites along this section of chromosome arm 3BS in which the read count was nearly zero (this region corresponds exactly to the one detected by the ED analysis), while the equivalent region in both cv. Jimai 262 and F2-R harbored a substantial number of occurrences (Table S3 ). This result provides strong support to the notion that YrJ262 lies within the 73 Mbp distal region of chromosome arm 3BS. While sequences lying within the 73 Mbp segment present in the Chinese Spring (CS) whole genome sequence were represented in the DNA of both cv. Jimai 262 and F2-R, they were rare in the DNA of either 262S or F2-S (Fig. 3 ); in the latter DNAs, they may be present on a different homeologous group 3 chromosome or, less likely, on a non-homeologous chromosome. FISH analysis confirms the absence in 262S of the key 3BS terminal segment FISH analysis was conducted to characterize the status of chromosome 3B in 262S. The resulting karyotyping showed that the distal end of chromosome arm 3BS in homozygous Pst resistant F 2:3 individuals (line #16) harbored two sites hybridizing with the Oligo-pSc119.2-1 sequence, with the stronger site being the more distal one (Fig. 4 a). While the distal site contained > 2,300 copies of pSc119.2-1 spanning some 0–18 Mbp region, the more proximal site contained only about 230 copies distributed across the 74–75 Mbp region of chromosome 3BS (Table S4 ). The former site was absent in F 2:3 plants (line #79) classified as homozygous Pst susceptible, while the latter one was retained (Fig. 4 b), indicating that the key deletion in the 262S mutant lay distal to the segment weakly hybridizing to pSc119.2-1. Fluorescence of Oligo-pTa535-1 was detected at the distal end of chromosome arm 3BL. The presence of fluorescing pTa535-1 together with that of fluorescing pSc119.2-1 indicated the identity of the chromosome arms of 3B following the result formerly presented (Gong et al. 2016 ). The allelic relationship between YrJ262 and Yr30 The physical location of Yr30 has been delimited to an interval harboring five candidate genes, namely TraesCS3B03G0022700, 3B03G0022800, 3B03G0027400, 3B03G0027700 and 3B03G0028100 (Wang et al. 2024a , b ). Between six and 323 occurrences of these sequences were recovered from the genomic DNA of both cv. Jimai 262 and F2-R, but only 0–2 from that 262S and F2-S (Table S3 ), providing a clear indication of the location of the five candidate genes within the 73 Mbp segment deleted in 262S. A haplotype comparison, based on these five genes, resulted in identity between cv. Jimai 262 and four Yr30 carriers and non-identity between cv. Jimai 262 and four non-carriers (Table S5 ), thereby establishing a high likelihood of similarity between cv. Jimai 262 and carriers of Yr30 . The genetic relationship between YrJ262 and Yr30 was examined by a genotypic comparison based on the two KASP markers ( AX-110053948 and YM3B-3 ) (Fig. S3 ) reportedly linked to Yr30 (Wang et al. 2024b ). The same AX-110053948 - B allele (FAM) was present in cv. Jimai 262, homozygous Pst resistant F 2:3 plants and the Yr30 carrier YM91R, while null allele was present in 262S and homozygous Pst susceptible F 2:3 plants, and a third allele AX-110053948 - A (HEX) was present in YM91S ( Yr30 non-carrier) and CS (Table S6 ). The result showed the presence of AX-110053948 - B allele was consistent with the Pst resistance. YM3B-3 - A (HEX) was monomorphic between cv. Jimai 262, 262S, homozygous Pst resistant F 2:3 plants, homozygous Pst susceptible F 2:3 plants and YM91R, but a different allele YM3B-3 - B (FAM) was present in YM91S and CS. This monomorphism (Fig. S3 ) was probably due to the presence of a homologous sequence on chromosome 3D, an assumption supported by the identification of three related sequences (YM3B-262_3A, _3B and _3D) in cv. Jimai 262, but only two (YM3B-262_3A and _3D) in 262S (Fig. S4 ). The lack of polymorphism between cv. Jimai 262 and 262S resulted from the presence of identical SNP variants in YM3B-262_3B and _3D. As a result, it is not possible to exclude the possibility that cv. Jimai 262 carries a Yr gene allelic to Yr30 . YrJ262 complemented with two QTL in the DH population Across both the 2022 and 2023 growing seasons, cv. Jimai 262 expressed a high level of Pst APR: its IT score ranged from 3 to 5. In contrast, cv. Yannong 24 plants were susceptible (IT score of 6–7) (Table S7 ). The IT score distribution across the DH population was continuous in 2023 whereas rather bimodal in 2024 (Fig. S5 ), although the responses of the separate replicates were significantly correlated with one another (Table S8 ). A total of 18 QTL, mapping to 11 different chromosomes, was detected. Two major QTL were repeatedly detected in all replicates and seasons (Fig. 5 ). One of these (LOD score 6.1–9.7) mapped to a 5.3 Mbp chromosome 1B interval flanked by markers AX-110019040 (670487316, 277.8 cM) and AX-110017315 (675816489, 288.2 cM) (Table 2). This locus explained 4.1–13.2% of the phenotypic variance. The second QTL (LOD score 9.8–44.2, 12.7–64.6% of the phenotypic variance) mapped within an 82.4 Mbp segment of chromosome 4B, flanked by markers AX-110544397 (520577684, 176.7 cM) and AX-110013985 (602964022, 191.6 cM) (Table 2). At both these QTL, the resistant allele was harbored by cv. Jimai 262. The remaining QTL were detected in just one replicate: these comprised four sites on chromosome 2B, three on chromosome 3A, two on chromosome 3B, two on chromosome 4D and one on each of chromosomes 1A, 5D, 6D, 7B and 7D; individually, these loci explained 1.9–25.5% of the phenotypic variance (Table 2). The QTL located on chromosome 3BS mapped to a region flanked by markers AX-111121461 (24477966, 29.7 cM) and AX-109998593 (27633515, 38.9 cM), explaining 2.0% of the phenotypic variance. The failure to detect a chromosome arm 3BS QTL in the DH population bred from the cross cv. Yannong 24 × cv. Jimai 262 implies either that both parents carry the same YrJ262 allele, or that another Yr gene lies too closely linked to YrJ262 to allow for the recovery of any recombinants in the mapping population. Since the haplotype of cv. Yannong 24 is the same as that of other cultivars known to carry Yr30 (Wang et al. 2024b ), it is likely that the Yr gene (i.e., YrJ262 ) harbored by cv. Yannong 24 is identical to Yr30 (Fig. 6 ). Discussion The loss of a terminal segment of chromosome arm 3BS is responsible for the Pst susceptibility of mutant 262S The hexaploidy of bread wheat allows it to tolerate a wide range of chromosome abnormalities (including segmental deletions and even nullisomy), but in some cases aneuploidy does have a significant phenotypic effect, because the missing genes cannot be adequately compensated by the presence of homeoloci on the unaltered chromosomes (Sears 1954 ). In some recent examples, it has been shown that a ~ 110 Mbp deletion on chromosome arm 2DS induces a malformed spike (Du et al. 2021 ), while a 36 Mbp deletion in the distal region of chromosome arm 2AL results in a semi-dwarf phenotype (Wu et al. 2021 ). Here it has been shown that the 262S mutant, identified by its loss of Pst resistance, lacks a ~ 73 Mbp segment mapping to the distal end of chromosome arm 3BS, and that the absence of YrJ262 was not complemented by any genes harbored by either of chromosome 3B’s homeologs. No QTL conferring APR for Pst was detectable within the candidate region of Yr30 on chromosome 3BS in the DH population bred from the cross cv. Jimai 262 × cv. Yannong 24, presumably because the two parents are monomorphic at YrJ262 carrying most similar genes. A genotypic analysis indicated that the two cultivars shared the same haplotype as Yr30 carriers (Wang et al. 2024b ), lending support to the notion that YrJ262 is present in both cvs Jimai 262 and Yannong 24. YrJ262 may be allelic to or identical with Yr30 Four Pst resistance genes are known to map to chromosome arm 3BS, namely Yr4 , Yr30 , Yr57 and Yr58 (Bansal et al. 2009 ; Chhetri et al. 2016 ; Randhawa et al. 2015 ; Singh et al. 2000a ; Singh et al. 2000b ) and the present study has demonstrated that all four of these genes lie within the key 73 Mbp terminal segment of chromosome arm 3BS. YrJ262 is unlikely to be an allele of either Yr4 , Yr57 or Yr58 , since these genes each protect seedling, rather than encoding APR (Bansal et al. 2009 ; Chhetri et al. 2016 ; Randhawa et al. 2015 ). In contrast, Yr30 is recognized as an APR gene; it is known to lies within a 617 kbp segment bounded by markers AX-110053948 and YM3B-3 (Wang et al. 2024b ). For both these markers, the allele carried by cv. Jimai 262 did not differ genotypically from that carried by Yr30 carriers. Moreover, at nucleotide sites within each of the five Yr30 candidate genes, the cv. Jimai 262 sequence is identical to that of Yr30 carriers. A formal allelism test between the two dominant genes YrJ262 and Yr30 has not been attempted as yet, as this would require a substantial commitment of both time and resource. Thus it has not been possible to reject the hypothesis that cv. Jimai 262 carries a Yr gene allelic with Yr30 . Other APR genes are present in cv. Jimai 262 Two stable QTL associated with Pst resistance were mapped – one to chromosome arm 1BL and the other to chromosome arm 4BL; in each case, the allele contributed by cv. Jimai 262 contributed positively to resistance. The former locus lies adjacent to the site of the Pst APR gene Yr29 ( Qyr.nwafu-1BL.5 ) (Xiang et al. 2024), while the latter site has been associated with several Pst QTL, including Yr68 (Xiang et al. 2024), QYr.humai15-4BL (Yuan et al. 2018 ) and QYr.nwafu-4BL.3 (Xiang et al. 2024). That the cv. Jimai 262 alleles at these two QTL were, on their own, unable to confer the level of resistance shown by cv. Jimai 262, can be inferred from the full Pst susceptibility of the 262S mutant. However, it is plausible to suggest that they act to enhance the strength and/or durability of the resistance conferred by YrJ262 . Durable resistance conferred by complementary multiple genes in cv. Jimai 262 Pedigree analysis has shown that the parents of cv. Jimai 262 were cv. Linmai 2 and cv. Yannong 19 (Li et al. 2021 ), even though both these cultivars are Pst susceptible (Wang et al. 2024b ). This raises the question of the origin of cv. Jimai 262’s Pst resistance. The YM3B-3 genotype of both parental cultivars implies that both are Yr30 carriers, and their SNP haplotype within the key genomic interval is the same as that of cultivars known to harbor Yr30 (Wang et al. 2024b ). A possible hypothesis is that, in addition to YrJ262 , the presence of two complementary genes at QTL mapped to chromosomes 1B and 4B is required for the expression of Pst APR (Fig. 6 ). Such a scenario is consistent with the observation that APR genes typically confer at best a partial level of resistance, implying that the overall level of a host’s resistance may be enhanced by the addition of one or more of complementary genes (Huang et al. 2022 ; Singh et al. 2000a ; Wang et al. 2023 ). Here, the gene(s) present within the two QTL mapped to chromosomes 1B and 4B could be candidates for such complementary genes. The suggestion is that cv. Yannong 24 is Pst susceptible because it carries ineffective alleles at the chromosome 1B and chromosome 4B QTL, in contrast to cv. Jimai 262, which carries effective alleles at both loci. Declarations Supplementary Information The online version contains supplementary material available at https: Acknowledgements The authors thank Ennian Yang (Sichuan Academy of Agricultural Sciences), Zhijian Chang and Xin Li (Shanxi Agricultural University) for helping with the assessment of stripe rust. Author contribution statement XZ, TK and CL conceptualized the research, XZ and TK designed experiments, XZ, JL, GL, CF and XL performed resistance experiments, XZ performed molecular mapping of genes, WG performed cytological experiments, HL produced mapping populations, XZ and TK analyzed the data and wrote the manuscript. All authors approved the manuscript. Funding This study was funded by the National Key R&D Plan (2023YFD1201005) to CL, Agricultural scientific and technological innovation project of Shandong Academy of Agricultural Sciences (CXGC2023G01) to TK, China Postdoctoral Science Foundation (2022M711971) to XZ, Shandong Province Key R&D Plan (2022LZG002-4) to CL, Shandong Province Wheat Industry Technology System (SDAIT-01-01) to CL, and Shandong Province Key R&D Program for Shandong (China)-Israel Cooperation Program (2023KJHZ003) to TK. Data, Materials, and Software Availability The data are available in the manuscript, the supplementary files, or at publicly accessible repositories. The raw exome sequencing data are deposited in NCBI under the accession number of PRJNA1159985. Conflict of interest The authors declare that no commercial or financial relationships could be construed as representing any potential conflict of interest. Consent to participate All of the named authors have agreed to the carrying out of this research. Consent for publication All of the named authors have agreed to the publication of this research in TAG. References Bansal UK, Hayden MJ, Gill MB, Bariana HS (2009) Chromosomal location of an uncharacterised stripe rust resistance gene in wheat. Euphytica 171:121–127 Beddow JM, Pardey PG, Chai Y, Hurley TM, Kriticos DJ, Braun H-J, Park RF, Cuddy WS, Yonow T (2015) Research investment implications of shifts in the global geography of wheat stripe rust. Nat Plants 1:15132 Bhavani S, Singh RP, Hodson DP, Huerta-Espino J, Randhawa MS (2022) Wheat Rusts: Current Status, Prospects of Genetic Control and Integrated Approaches to Enhance Resistance Durability. In: Reynolds MP, Braun H-J (eds) Wheat Improvement: Food Security in a Changing Climate. Springer International Publishing, Cham, pp 125–141 Chen S, Zhou Y, Chen Y, Gu J (2018) fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884–i890 Chen X (2020) Pathogens which threaten food security: Puccinia striiformis, the wheat stripe rust pathogen. Food Secur 12:239–251 Chhetri M, Bariana H, Kandiah P, Bansal U (2016) Yr58: A New Stripe Rust Resistance Gene and Its Interaction with Yr46 for Enhanced Resistance. Phytopathology 106:1530–1534 Dong C, Zhang L, Chen Z, Xia C, Gu Y, Wang J, Li D, Xie Z, Zhang Q, Zhang X, Gui L, Liu X, Kong X (2020) Combining a New Exome Capture Panel With an Effective varBScore Algorithm Accelerates BSA-Based Gene Cloning in Wheat. Front Plant Sci 11:1249 Du D, Zhang D, Yuan J, Feng M, Li Z, Wang Z, Zhang Z, Li X, Ke W, Li R, Chen Z, Chai L, Hu Z, Guo W, Xing J, Su Z, Peng H, Xin M, Yao Y, Sun Q, Liu J, Ni Z (2021) FRIZZY PANICLE defines a regulatory hub for simultaneously controlling spikelet formation and awn elongation in bread wheat. New Phytol 231:814–833 Fu D, Uauy C, Distelfeld A, Blechl A, Epstein L, Chen X, Sela H, Fahima T, Dubcovsky J (2009) A Kinase-START Gene Confers Temperature-Dependent Resistance to Wheat Stripe Rust. Science 323:1357–1360 Gong W, Li G, Han R, Song J, Li H, Liu A, Cao X, Yang Z, Liu C, Zhao Z, Liu J (2016) Fluorescence in situ hybridization analysis of jimai serial wheat. Shandong Agricultural Sci 48(1):16–20 Han F, Lamb JC, Birchler JA (2006) High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proceedings of the National Academy of Sciences 103:3238–3243 Hill JT, Demarest BL, Bisgrove BW, Gorsi B, Su YC, Yost HJ (2013) MMAPPR: mutation mapping analysis pipeline for pooled RNA-seq. Genome Res 23:687–697 Huang S, Zhang Y, Ren H, Li X, Zhang X, Zhang Z, Zhang C, Liu S, Wang X, Zeng Q, Wang Q, Singh RP, Bhavani S, Wu J, Han D, Kang Z (2022) Epistatic interaction effect between chromosome 1BL (Yr29) and a novel locus on 2AL facilitating resistance to stripe rust in Chinese wheat Changwu 357-9. Theor Appl Genet 135:2501–2513 Krattinger SG, Lagudah ES, Spielmeyer W, Singh RP, Huerta-Espino J, McFadden H, Bossolini E, Selter LL, Keller B (2009) A Putative ABC Transporter Confers Durable Resistance to Multiple Fungal Pathogens in Wheat. Science 323:1360–1363 Li H, Cheng D, Liu C, Han R, Song J, Liu A, Cao X, Guo J, Wang C, Liu J, Zhao Z, Zhai S, Zi Y (2021) Drought-resistant and water-saving wheat variety ‘Jimai 262’: breeding experience. J Agric 11(12):24–27 Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754–1760 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Genome Project Data Processing S (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078–2079 Line RF, Qayoum A (1992) Virulence, aggressiveness, evolution, and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-87. Technical bulletin-United States Department of Agriculture Liu S, Wang X, Zhang Y, Jin Y, Xia Z, Xiang M, Huang S, Qiao L, Zheng W, Zeng Q, Wang Q, Yu R, Singh RP, Bhavani S, Kang Z, Han D, Wang C, Wu J (2022) Enhanced stripe rust resistance obtained by combining Yr30 with a widely dispersed, consistent QTL on chromosome arm 4BL. Theor Appl Genet 135:351–365 Moore JW, Herrera-Foessel S, Lan C, Schnippenkoetter W, Ayliffe M, Huerta-Espino J, Lillemo M, Viccars L, Milne R, Periyannan S, Kong X, Spielmeyer W, Talbot M, Bariana H, Patrick JW, Dodds P, Singh R, Lagudah E (2015) A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet 47:1494–1498 Narasimhan V, Danecek P, Scally A, Xue Y, Tyler-Smith C, Durbin R (2016) BCFtools/RoH: a hidden Markov model approach for detecting autozygosity from next-generation sequencing data. Bioinformatics 32:1749–1751 Nsabiyera V, Bariana HS, Qureshi N, Wong D, Hayden MJ, Bansal UK (2018) Characterisation and mapping of adult plant stripe rust resistance in wheat accession Aus27284. Theor Appl Genet 131:1459–1467 Porebski S, Bailey LG, Baum BR (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biology Report 15:8–15 Putri GH, Anders S, Pyl PT, Pimanda JE, Zanini F (2022) Analysing high-throughput sequencing data in Python with HTSeq 2.0. Bioinformatics 38:2943–2945 Randhawa MS, Bariana HS, Mago R, Bansal UK (2015) Mapping of a new stripe rust resistance locus Yr57 on chromosome 3BS of wheat. Molecular Breeding 35 Schwessinger B (2017) Fundamental wheat stripe rust research in the 21(st) century. New Phytol 213:1625–1631 Sears ER (1954) The aneuploids of common wheat. University of Missouri, College of Agriculture, Agricultural Experiment Station Singh R, Huerta-Espino J, Rajaram S (2000a) Achieving near-immunity to leaf and stripe rusts in wheat by combining slow rusting resistance genes Singh RP, Nelson JC, Sorrells ME (2000b) Mapping Yr28 and Other Genes for Resistance to Stripe Rust in Wheat. Crop Sci 40:1148–1155 Suenaga K, Singh RP, Huerta-Espino J, William HM (2003) Microsatellite markers for genes Lr34/Yr18 and other quantitative trait loci for leaf rust and stripe rust resistance in bread wheat. Phytopathology 93:881–890 Tang Z, Yang Z, Fu S (2014) Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J Appl Genet 55:313–318 Wang F, Zhang M, Hu Y, Gan M, Jiang B, Hao M, Ning S, Yuan Z, Chen X, Chen X, Zhang L, Wu B, Liu D, Huang L (2023) Pyramiding of Adult-Plant Resistance Genes Enhances All-Stage Resistance to Wheat Stripe Rust. Plant Dis 107:879–885 Wang W, Li H, Qiu L, Wang H, Pan W, Yang Z, Wei W, Liu N, Sun J, Hu Z, Ma J, Ni Z, Li Y, Sun Q, Xie C (2024a) Fine-mapping of LrN3B on wheat chromosome arm 3BS, one of the two complementary genes for adult-plant leaf rust resistance. Theor Appl Genet 137:203 Wang X, Xiang M, Li H, Li X, Mu K, Huang S, Zhang Y, Cheng X, Yang S, Yuan X, Singh RP, Bhavani S, Zeng Q, Wu J, Kang Z, Liu S, Han D (2024b) High-density mapping of durable and broad-spectrum stripe rust resistance gene Yr30 in wheat. Theor Appl Genet 137:152 Wu L, Xia X, Rosewarne GM, Zhu H, Li S, Zhang Z, He Z, Miedaner T (2015) Stripe rust resistance gene Yr18 and its suppressor gene in Chinese wheat landraces. Plant Breeding 134:634–640 Wu Q, Chen Y, Xie J, Dong L, Wang Z, Lu P, Wang R, Yuan C, Zhang Y, Liu Z (2021) A 36 Mb terminal deletion of chromosome 2BL is responsible for a wheat semi-dwarf mutation. Crop J 9:873–881 Yang EN, Rosewarne GM, Herrera-Foessel SA, Huerta-Espino J, Tang ZX, Sun CF, Ren ZL, Singh RP (2013) QTL analysis of the spring wheat ‘‘Chapio’’ identifies stable stripe rust resistance despite inter-continental genotype 3 environment interactions. Theor Appl Genet 126:1721–1732 Yuan F, Zeng Q, Wu J, Wang Q, Yang Z, Liang B, Kang Z, Chen X, Han D (2018) QTL Mapping and validation of adult plant resist- ance to stripe rust in Chinese wheat landrace Humai 15. Front Plant Sci 9:968 Zhu T, Wang L, Rimbert H, Rodriguez JC, Deal KR, De Oliveira R, Choulet F, Keeble-Gagnere G, Tibbits J, Rogers J, Eversole K, Appels R, Gu YQ, Mascher M, Dvorak J, Luo MC (2021) Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J 107:303–314 Zhu Z, Cao Q, Han D, Wu J, Wu L, Tong J, Xu X, Yan J, Zhang Y, Xu K, Wang F, Dong Y, Gao C, He Z, Xia X, Hao Y (2023) Molecular characterization and validation of adult-plant stripe rust resistance gene Yr86 in Chinese wheat cultivar Zhongmai 895. Theor Appl Genet 136:142 Tables Table 1 and 2 are available in the Supplementary Files section. Supplementary Files 20250827.Yuki.Yr.Table1.xlsx Table 1. The segregation in cv. Jimai 262 x 262S F 2 and F 2:3 plants of host reaction to exposure to Pst at the adult plant stage. 20250827.Yuki.Yr.Table2.tk.xlsx Table 2. The quantitative trait loci underlying the score of adult plant resistance to stripe rust detected in the Jimai 262 x Yannong 24 DH population. 20250827.Yuki.Yr.TableS1.xlsx Table S1. The reaction (IT score) of the F 2:3 population to stripe rust at adult plant stage. 20250827.Yuki.Yr.TableS2.xlsx Table S2. Statistics and sequence alignments derived from the exome-sequencing data acquired from the DNA of cv. Jimai 262, the 262S mutant, bulked Pst resistant F 2:3 individuals (F2-R) and bulked Pst susceptible F 2:3 individuals (F2-S). 20250827.Yuki.Yr.TableS3.xlsx Table S3. Counts of reads mapping to genes annotated as lying on chromosome 3B of CS. 20250827.Yuki.Yr.TableS4.xlsx Table S4. BlastN-identified sites on chromosome 3B containing sequence homologous with pSc119.2-1 and Oligo-pTa535-1. 20250827.Yuki.Yr.TableS5.xlsx Table S5. Nucleotide variation in cv. Jimai 262 with respect to the five Yr30 candidate genes (based on Table S5 of Wang et al. 2024). 20250827.Yuki.Yr.TableS6.xlsx Table S6. Allelic constitution at the marker loci AX-110053948 and YM3B-3 in CS, cv. Jimai 262, 262S, homozygous Pst resistant and susceptible cv. Jimai 262 x 262S F 2:3 plants. 20250827.Yuki.Yr.TableS7.xlsx Table S7. The reaction of the DH population to stripe rust at adult plant stage. 20250827.Yuki.Yr.TableS8.xlsx Table S8. Correlation between the four replications for reaction to stripe rust at adult plant stage. 20250827.Yuki.Yr.Fig.S.pdf Fig s1-s5 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revisions 05 Jan, 2026 Reviewers agreed at journal 12 Nov, 2025 Reviewers invited by journal 12 Nov, 2025 Editor assigned by journal 08 Sep, 2025 First submitted to journal 05 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7543105","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":544156131,"identity":"49330465-0e8a-498a-8e49-622e9515fddc","order_by":0,"name":"Xiaoxue Zeng","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences Institute of Crop Science","correspondingAuthor":false,"prefix":"","firstName":"Xiaoxue","middleName":"","lastName":"Zeng","suffix":""},{"id":544156132,"identity":"5cbebab8-8ff1-4587-90c2-6908ea0404ca","order_by":1,"name":"Jianbo Li","email":"","orcid":"","institution":"The University of Sydney Plant Breeding Institute","correspondingAuthor":false,"prefix":"","firstName":"Jianbo","middleName":"","lastName":"Li","suffix":""},{"id":544156133,"identity":"55cfe8a5-b125-4505-8f36-706ba6469190","order_by":2,"name":"Guangrong Li","email":"","orcid":"","institution":"University of Electronic Science and Technology of China School of Life Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Guangrong","middleName":"","lastName":"Li","suffix":""},{"id":544156134,"identity":"ac6c3cfa-6b6c-43d0-a978-3d1cb1ea8ad2","order_by":3,"name":"Wenping Gong","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences Crop Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Wenping","middleName":"","lastName":"Gong","suffix":""},{"id":544156135,"identity":"2461716d-c370-49df-bcd5-ed69d03b3dd5","order_by":4,"name":"Chunhao Fang","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences Crop Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Chunhao","middleName":"","lastName":"Fang","suffix":""},{"id":544156136,"identity":"acfdc586-84aa-4f69-81fd-3e8e43b5f74e","order_by":5,"name":"Xudong Liu","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences Crop Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Xudong","middleName":"","lastName":"Liu","suffix":""},{"id":544156137,"identity":"f3d1ff97-0ead-491a-a528-9bc5941cf8c7","order_by":6,"name":"Haosheng Li","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Haosheng","middleName":"","lastName":"Li","suffix":""},{"id":544156138,"identity":"ece8349b-2c85-47b5-8040-8c168b7fc13c","order_by":7,"name":"Takao Komatsuda","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYFACNhCRAOfIsbG3H8CrgQehhRmsxZiP50wCPh2YWhLnSTgY4NViz34s8cMHhjQ53fbzhz/zlNmlt0kADfhRsQ23LTxphyVnMOQYm51JZpPmOZec2ybdeICx58xtPA5Lb5DmYahI3HYgmY2Zt405t03mQAIzYxseLfzPm3+DtZx/zPyZt60+nU0iwQC/Fom0Y0BbchK33UhmkOZtO5xAWMuNZ2mWMxjSjM1uPDaTnHPuuGEbMJAP4vMLe3+a8Y0PDMlyZucTH394U1YtL9/efvDBjwrcWsCA8R+awAH86kfBKBgFo2AUEAIAWJlR2yabfGsAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-8195-249X","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"Takao","middleName":"","lastName":"Komatsuda","suffix":""},{"id":544156139,"identity":"01298b07-8893-4f7a-b478-cc88a8934e89","order_by":8,"name":"Cheng Liu","email":"","orcid":"","institution":"Shandong Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Cheng","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-09-05 09:59:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7543105/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7543105/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96657423,"identity":"9cc6d3ce-210b-49e6-b9f8-8579a022313e","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14971,"visible":true,"origin":"","legend":"","description":"","filename":"taagTAAGD2500810.xml","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/61d29db023443de90d54e2cc.xml"},{"id":96657421,"identity":"a1e24fb1-c8a3-4470-b6ee-ab0f802d8781","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1874,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD250081019233.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/71e25538ecf48ad53921e916.xml"},{"id":96710640,"identity":"c847c08a-452f-4198-a3e4-0318d9db5415","added_by":"auto","created_at":"2025-11-25 10:11:01","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":841,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD2500810Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/b2cc375f5ba3b9840ae42c56.xml"},{"id":96657431,"identity":"3cfbfc33-9cac-4722-97d4-87dca118ec1b","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122526,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD25008100enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/7700f49a9026776222b2c068.xml"},{"id":96657440,"identity":"5506d9bc-326e-4f50-abf2-12e08a031cd0","added_by":"auto","created_at":"2025-11-24 17:19:31","extension":"pdf","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5983858,"visible":true,"origin":"","legend":"","description":"","filename":"20250827.Yuki.Yr.Fig.1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/b73b35335708086535f0a885.pdf"},{"id":96657439,"identity":"75cd3c27-423f-4f8a-a554-cba5c8654950","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"pdf","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4966314,"visible":true,"origin":"","legend":"","description":"","filename":"20250827.Yuki.Yr.Fig.2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/affc871ac435292802afe97f.pdf"},{"id":96657437,"identity":"cbadeb66-41f4-4cd3-8761-8e6e9ad4c232","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"pdf","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":273181,"visible":true,"origin":"","legend":"","description":"","filename":"20250827.Yuki.Yr.Fig.4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/ef73da471145234bd8946388.pdf"},{"id":96710250,"identity":"be6197d8-ae53-4a7e-beda-df462d07c359","added_by":"auto","created_at":"2025-11-25 10:10:20","extension":"pdf","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82629,"visible":true,"origin":"","legend":"","description":"","filename":"20250827.Yuki.Yr.Fig.5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/c3fb44219a6dbde6065d86f9.pdf"},{"id":96709190,"identity":"6319a3cb-d96b-42f3-8fb9-44a96fe44f01","added_by":"auto","created_at":"2025-11-25 10:08:10","extension":"pdf","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30286,"visible":true,"origin":"","legend":"","description":"","filename":"20250827.Yuki.Yr.Fig.6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/8d65642fe2c49ecc392d709d.pdf"},{"id":96710764,"identity":"95e79a01-64b5-4f20-9acb-c052fdb4766c","added_by":"auto","created_at":"2025-11-25 10:11:10","extension":"pdf","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156328,"visible":true,"origin":"","legend":"","description":"","filename":"2025905.Yuki.Yr.Fig.3.ver2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/8a5b9a0e46ebfcbf0cfffce3.pdf"},{"id":96657433,"identity":"5a41afbd-202f-4155-8a76-363f99b2f7c5","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"jpeg","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13654,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/f507277559ac2c8af2cbd871.jpeg"},{"id":96709849,"identity":"d77c7d23-6469-4c25-b849-68dd3c36a56f","added_by":"auto","created_at":"2025-11-25 10:09:44","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6876,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/ab18e8f8cb30e935c3c6fcf9.png"},{"id":96709484,"identity":"ebde5644-7b1e-4967-b073-338c915bb302","added_by":"auto","created_at":"2025-11-25 10:09:05","extension":"xml","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120048,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD25008100structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/c3b30448732cf900685a1cde.xml"},{"id":96657441,"identity":"f3b86409-483f-4266-b440-97cf88622cbc","added_by":"auto","created_at":"2025-11-24 17:19:31","extension":"html","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134489,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/9e162da376415444ac99cbc7.html"},{"id":96709508,"identity":"5fea5635-00b9-4f9f-9518-cf578cbd7e9a","added_by":"auto","created_at":"2025-11-25 10:09:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3236739,"visible":true,"origin":"","legend":"\u003cp\u003eHost response to \u003cem\u003ePst\u003c/em\u003e exposure of cv. Jimai 262 (left) and 262S (right). (a) Whole plants at the heading stage, (b) flag leaves.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.11.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/04b9020297e1d428171a3b48.png"},{"id":96657410,"identity":"56ead8f7-82fa-49dc-91bc-38167a81b26d","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":34824,"visible":true,"origin":"","legend":"\u003cp\u003eThe identification, based on the ED\u003csup\u003e4\u003c/sup\u003e parameter,\u003cstrong\u003e \u003c/strong\u003eof chromosome arm 3BS as the most likely region for the location of \u003cem\u003eYrJ262\u003c/em\u003e. (a) Unfitted ED\u003csup\u003e4 \u003c/sup\u003evalues. (b) ED\u003csup\u003e4\u003c/sup\u003e values with a loess fit, the horizontal dotted line indicates the cut-off value of 0.047.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.12.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/499f520e37aeafdb3a86c623.png"},{"id":96657411,"identity":"520dd667-4a82-42f9-bc5f-97b661fff06f","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":41031,"visible":true,"origin":"","legend":"\u003cp\u003eCounts of the reads mapping to genes present on chromosome 3B, of the wheat genome reference sequence (CS RefSeq v2.1). The comparisons illustrated are between (a) cv. Jimai 262 and 262S, (b) F2-R (bulked DNA of \u003cem\u003ePst \u003c/em\u003eresistant F\u003csub\u003e2 \u003c/sub\u003eplants) and F2-S (bulked DNA of \u003cem\u003ePst \u003c/em\u003esusceptible F\u003csub\u003e2\u003c/sub\u003e plants). Note that since a \u0026gt;4-fold larger number of reads was acquired from 262S than from the other three templates (Table S1), the 262S count was divided by 5 for the purpose of this visualization.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.13.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/e1b55eec2bff4d55569baca3.png"},{"id":96709803,"identity":"8a0ff6d9-11ce-4122-995d-3c341fdae4b6","added_by":"auto","created_at":"2025-11-25 10:09:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":897450,"visible":true,"origin":"","legend":"\u003cp\u003eFISH analysis confirms the presence of a terminal deletion of chromosome 3BS of the mutant line 262S. Sites fluorescing green on root tip mitotic metaphase chromosomes contain pSc119.2-1 repeats, while those fluorescing red contain pTa535-1 repeats. (a) A homozygous \u003cem\u003ePst\u003c/em\u003e resistant F\u003csub\u003e2:3\u003c/sub\u003e plant from line #16, (b) a homozygous \u003cem\u003ePst\u003c/em\u003e susceptible F\u003csub\u003e2:3\u003c/sub\u003e plant from line #79. Copies of chromosome 3B are indicated and shown at higher magnification in the insets, where green arrowheads indicate the strong fluorescence of pSc119.2-1 repeats, white arrowheads indicate the weaker ones of pSc119.2-1 repeats and the red arrowheads indicate the fluorescence of pTa535-1 repeats. Bars: 10 μm.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.14.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/927a9289ecc02853a420b3fb.png"},{"id":96657415,"identity":"70eff2c7-9e75-4a1d-bf05-147be397f3a1","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":125158,"visible":true,"origin":"","legend":"\u003cp\u003eThe stable QTL for the adult plant resistance to stripe rust of Jimai 262 x Yannong 24 DH population. The LOD score and its corresponding genetic map were shown. The horizontal dashed line represents the threshold of the LOD score as 3.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.15.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/e2a5530f315a5699307cf7c9.png"},{"id":96709853,"identity":"0c8cf817-8008-4eb5-8498-be3254d59d7f","added_by":"auto","created_at":"2025-11-25 10:09:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":36297,"visible":true,"origin":"","legend":"\u003cp\u003eA hypothetical inheritance route of the APR displayed by cv. Jimai 262.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.16.png","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/62135cdd0e6ccf337c7c0df2.png"},{"id":96712877,"identity":"c74f86b6-bdc1-4a06-b0fe-af811e8e993b","added_by":"auto","created_at":"2025-11-25 10:17:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5753003,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/f00fe110-405e-415e-8cb0-37166d01e6ef.pdf"},{"id":96709323,"identity":"b35b0b48-fc02-4310-84f0-cb6e1aa168dd","added_by":"auto","created_at":"2025-11-25 10:08:43","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10580,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable 1. \u003c/strong\u003eThe segregation in cv. Jimai 262 x 262S F\u003csub\u003e2 \u003c/sub\u003eand F\u003csub\u003e2:3\u003c/sub\u003e plants of host reaction to exposure to \u003cem\u003ePst\u003c/em\u003e at the adult plant stage.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/a2386f7cf14ca3c1e191de08.xlsx"},{"id":96657416,"identity":"b11c07cd-af5f-494d-afd8-fff6582f7119","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":12128,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable 2. \u003c/strong\u003eThe quantitative trait loci underlying the score of adult plant resistance to stripe rust detected in the Jimai 262 x Yannong 24 DH population.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Table2.tk.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/f9780ced0400ae45fedad0ef.xlsx"},{"id":96657412,"identity":"8cb8505c-21f8-4c55-86e3-12f8b76250da","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":33031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S1.\u003c/strong\u003e The reaction (IT score) of the F\u003csub\u003e2:3 \u003c/sub\u003epopulation to stripe rust at adult plant stage.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/6b2e759aca807d5edf6a313e.xlsx"},{"id":96710707,"identity":"67ab01d4-fb88-48c9-ac28-c1fd2582981c","added_by":"auto","created_at":"2025-11-25 10:11:06","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":10744,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S2.\u003c/strong\u003e Statistics and sequence alignments derived from the exome-sequencing data acquired from the DNA of cv. Jimai 262, the 262S mutant, bulked \u003cem\u003ePst \u003c/em\u003eresistant F\u003csub\u003e2:3\u003c/sub\u003e individuals (F2-R) and bulked \u003cem\u003ePst \u003c/em\u003esusceptible F\u003csub\u003e2:3 \u003c/sub\u003eindividuals (F2-S).\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/880eaa4beffaae0dc73c18a5.xlsx"},{"id":96710094,"identity":"c1f62406-053d-469d-8c90-0c5da50a4ccb","added_by":"auto","created_at":"2025-11-25 10:10:04","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":320909,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S3. \u003c/strong\u003eCounts of reads mapping to genes annotated as lying on chromosome 3B of CS.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/edb97779b8bb5e764d7b2b76.xlsx"},{"id":96709567,"identity":"9c507def-15df-40ce-b62e-b8419eb7b067","added_by":"auto","created_at":"2025-11-25 10:09:16","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":12548,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S4.\u003c/strong\u003e BlastN-identified sites on chromosome 3B containing sequence homologous with pSc119.2-1 and Oligo-pTa535-1.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/aa015488941fb5376fd5c956.xlsx"},{"id":96657420,"identity":"302cf77b-158e-47e3-a0f5-8188e6a644e8","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":15979,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S5. \u003c/strong\u003eNucleotide variation in cv. Jimai 262 with respect to the five \u003cem\u003eYr30\u003c/em\u003e candidate genes (based on Table S5 of Wang et al. 2024).\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/d2a7f528180d093c449c7a24.xlsx"},{"id":96657427,"identity":"1cc143b5-137b-48af-a057-4b94ea1aafc8","added_by":"auto","created_at":"2025-11-24 17:19:30","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":11459,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S6.\u003c/strong\u003e Allelic constitution at the marker loci\u003cem\u003e AX-110053948\u003c/em\u003e and \u003cem\u003eYM3B-3\u003c/em\u003e in CS, cv. Jimai 262, 262S, homozygous \u003cem\u003ePst \u003c/em\u003eresistant and susceptible cv. Jimai 262 x 262S F\u003csub\u003e2:3\u003c/sub\u003e plants.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS6.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/ee77be32c9baa9e0ac3d484d.xlsx"},{"id":96709318,"identity":"9de1a9f1-9bed-4cb7-bdf5-30a36852f6dc","added_by":"auto","created_at":"2025-11-25 10:08:43","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":41049,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S7.\u003c/strong\u003e The reaction of the DH population to stripe rust at adult plant stage.\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS7.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/b87742e29d7806035b90c772.xlsx"},{"id":96709212,"identity":"43628e77-ecf0-48c4-8a7b-991cc3c607d8","added_by":"auto","created_at":"2025-11-25 10:08:16","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":9576,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable S8. \u003c/strong\u003eCorrelation between the four replications for reaction to stripe rust at adult plant stage\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.TableS8.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/aa85fff86c083ddaf15efbe6.xlsx"},{"id":96709894,"identity":"75b80230-e205-419b-a128-f39e47394d2c","added_by":"auto","created_at":"2025-11-25 10:09:46","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":6468096,"visible":true,"origin":"","legend":"\u003cp\u003eFig s1-s5\u003c/p\u003e","description":"","filename":"20250827.Yuki.Yr.Fig.S.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7543105/v1/c852bddcc13236de581f0069.pdf"}],"financialInterests":"","formattedTitle":"A wheat stripe rust adult plant resistant gene YrJ262 mapping within a spontaneous terminal deletion in the short arm of chromosome 3B","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBread wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e), one of the world\u0026rsquo;s most important crops, is a major supplier of both calories and protein in the human diet (Shiferaw et al. 2013). Both its yield and end-use quality are compromised by a range of pathogens, among which the fungus \u003cem\u003ePuccinia striiformis\u003c/em\u003e f. sp. \u003cem\u003etritici\u003c/em\u003e (\u003cem\u003ePst\u003c/em\u003e), the causative agent of stripe (or yellow) rust, can be especially damaging (Beddow et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Chen \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). While the crop can be protected by the use of fungicidal spays, the incorporation of resistance genes offers a more practical and environmentally sustainable control method.\u003c/p\u003e\u003cp\u003eTwo types of resistance genes against fungi, including \u003cem\u003ePst\u003c/em\u003e, have been recognized: the first (referred to as \u0026lsquo;adult plant resistance\u0026rsquo; [APR]) protects against infection at the adult plant stage, but not at its seedling stage, while the other protects the plant throughout its life cycle, but only against a specific physiological race(s) of the pathogen. \u003cem\u003ePst\u003c/em\u003e populations typically co-evolve with plants, thereby imposing a significant risk of sudden failure when race-specific resistance genes are deployed (Schwessinger \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In contrast, since APR is generally non-race specific, the resistance tends to be more durable; as a result, this class of genes has been increasingly exploited by crop breeders (Bhavani et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAs many as 86 \u003cem\u003ePst\u003c/em\u003e resistance genes have been recognized in wheat (Zhu et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), of which at least 30 confer APR (Fu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Krattinger et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Moore et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Nsabiyera et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2000a\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2000b\u003c/span\u003e; Zhu et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). As yet, just three \u003cem\u003ePst\u003c/em\u003e APR genes have been isolated (Fu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Krattinger et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Moore et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e): \u003cem\u003eYr18\u003c/em\u003e has been shown to encode an ABC transporter (Krattinger et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), \u003cem\u003eYr36\u003c/em\u003e a wheat kinase start 1 (WKS1) protein (Fu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) and \u003cem\u003eYr46\u003c/em\u003e a hexose transporter (Moore et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The APR gene \u003cem\u003eYr30\u003c/em\u003e, mapping to a location on chromosome arm 3BS, was originally identified in cv. Opata 85 (Singh et al. 2000). Subsequently, its presence has been associated with durable resistance against \u003cem\u003ePst\u003c/em\u003e, although its effectiveness is genetic background dependent (Wang et al. 2024). The level of host resistance conferred by \u003cem\u003eYr30\u003c/em\u003e can be enhanced by its combination with either of the two major genes \u003cem\u003eYr29\u003c/em\u003e (mapping to chromosome arm 1BL) and \u003cem\u003eYr31\u003c/em\u003e (chromosome arm 2BS) (Suenaga et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), or with the QTL \u003cem\u003eQYrFDC12\u003c/em\u003e (chromosome arm 4BL) (Liu et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Although Wang et al. (2024) fine-mapped \u003cem\u003eYr30\u003c/em\u003e to within a 617 kbp region, no candidate gene has yet been identified.\u003c/p\u003e\u003cp\u003eDurable resistance against \u003cem\u003ePst\u003c/em\u003e has become a priority breeding goal of wheat improvement programs worldwide in recent years. The variety Chinese cultivar (cv.) Jimai 262, a selection from the cross cv. Linmai 2 \u0026times; cv. Yannong 19, features a pronounced level of drought tolerance, as well as expressing APR against \u003cem\u003ePst\u003c/em\u003e (Li et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The isolation of a spontaneous mutant (262S), lacking the \u003cem\u003ePst\u003c/em\u003e APR, among field grown plants of cv, Jimai 262 has allowed the present study to show not only that a major gene mapping to the distal end of chromosome arm 3BS is responsible for the \u003cem\u003ePst\u003c/em\u003e resistance phenotype of cv. Jimai 262, but also that its APR is enhanced by the presence of two QTL, one mapping to chromosome 1B and the other to chromosome 4B.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePlant materials\u003c/h2\u003e\u003cp\u003eSeeds of cv. Jimai 262 was obtained from Wheat Breeding Group, Crop Research Institute, Shandong Academy of Agricultural Sciences. The \u003cem\u003ePst\u003c/em\u003e susceptible spontaneous mutant discovered and named 262S was crossed as male with cv. Jimai 262, and the resulting F\u003csub\u003e1\u003c/sub\u003e hybrid was self-pollinated to produce an F\u003csub\u003e2\u003c/sub\u003e population and a series of F\u003csub\u003e2:3\u003c/sub\u003e lines. Doubled haploid (DH) lines were created from the cross between Jimai 262 (as female) and Yannong 24 (as male).\u003c/p\u003e\u003cp\u003e\u003cb\u003eAssessment of\u003c/b\u003e \u003cb\u003ePst\u003c/b\u003e \u003cb\u003eresistance\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe assessment of host reaction to \u003cem\u003ePst\u003c/em\u003e infection was carried out at the Sichuan Academy of Sciences Xindu Experiment Station in Chengdu. A set of 20 progeny from each F\u003csub\u003e2:3\u003c/sub\u003e line was sown in duplicate, across two different fields in the year of 2021. Following Wu et al. (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), the inoculum comprised a mixture of three \u003cem\u003ePst\u003c/em\u003e races (CYR32, CYR33 and CYR34). The host response was assessed at both the seedling and the heading stages, coinciding with sporulation occurring on susceptible controls. Infection types (ITs) were assigned a score based on a 0\u0026ndash;9 scale.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eBulked segregant exome capture sequencing (BSE-Seq)\u003c/h3\u003e\n\u003cp\u003eTwo DNA bulks were created from phenotyped cv. Jimai 262 x 262S F\u003csub\u003e2\u003c/sub\u003e individuals: the resistant (wild type) bulk was formed from 30 plants scoring IT\u0026thinsp;=\u0026thinsp;2, while the susceptible (mutant type) one combined 26 plants with an IT of 6 or 7. Genomic DNA was extracted from young leaves of each bulk and each of the two parental lines, using a CTAB-based method (Porebski et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1997\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe process of exome capture sequencing was performed according to Dong et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Read quality was filtered using Fastp v0.12.4 software (Chen et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) to remove low quality reads and adapter sequences. The short-read alignment software package BWA (Li and Durbin \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) was used to align the filtered reads to the IWGSC RefSeq v2.1 Chinese Spring genome assembly (Zhu et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) applying default parameters. SAMtools software (Li et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) was used to convert, remove PCR duplicated reads, sort and index the resulting bam files. Single nucleotide polymorphisms (SNPs) were called using Bcftools software (Narasimhan et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), with the minimum-mapping-quality parameter set at 30 and the minimum-depth parameter at 5. According to the bam files acquired from the two bulks, a Euclidean distance metric (ED) was calculated to identify the candidate regions of the genome associated with the presence of a \u003cem\u003ePst\u003c/em\u003e-resistant gene(s) (Hill et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e): the relevant formula was:\u003c/p\u003e\u003cp\u003e\u003cimg src=\"https://myfiles.space/user_files/127393_c7e80a1c9bb65875/127393_custom_files/img1764003651.png\" style=\"width: 498px;\"\u003e\u003c/p\u003e\u003cp\u003ewhere A, C, G, T refer to the frequency of each base in either the mutant type (mut) or wild type (wt) bulk. As suggested by Hill et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), ED raised to the fourth power (ED\u003csup\u003e4\u003c/sup\u003e) was used to eliminate background noise. A count of those reads able to be mapped onto the reference genome was achieved using the HTSeq 2.0 tool (Putri et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFluorescence\u003c/b\u003e \u003cb\u003ein situ\u003c/b\u003e \u003cb\u003ehybridization analysis (FISH)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe processing of seedling root tips and the preparation of mitotic cells were achieved following methods given by Han et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), and the FISH procedure followed that given by Tang et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The Oligo-pSc119.2-1 probe (5'-CCGTTTTGTGGACTATTACTCACCGCTTTGGGGTCCCATAGCTAT) was 5\u0026prime;-labeled with 6-carboxyfluorescein while Oligo-pTa535-1 (5\u0026prime;- AAAAACTTGACGCACGTCACGTACAAATTGGACAAACTCTTTCGGAGTATCAGGGTTTC) was labeled with 6-carboxytetramethylrhodamine. ZEN 2.3 software was used to analyze images generated by an Axio Observer microscope equipped with an AxioCam camera (Carl Zeiss AG, Oberkochen, Germany). Root tips of the two genotypes, homozygous resistant and homozygous susceptible, from three or four different lines for each genotype (one seed per line) were observed. The physical location of sites hybridizing to each probe was performed using a local B2DSC web server (Lang et al., 2018), based on the criteria \u0026ldquo;% identical matches\u0026thinsp;\u0026gt;\u0026thinsp;85%\u0026rdquo; and \u0026ldquo;query coverage per subject\u0026thinsp;\u0026gt;\u0026thinsp;80%\u0026rdquo;, the counts of the repeats per Mbp were counted.\u003c/p\u003e\n\u003ch3\u003eKompetitive allele-specific PCR (KASP) assays\u003c/h3\u003e\n\u003cp\u003eTwo SNP markers (\u003cem\u003eAX-110053948\u003c/em\u003e and \u003cem\u003eYM3B-3\u003c/em\u003e), known to co-segregate with \u003cem\u003eYr30\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e), were used for a KASP assay. Each 5 \u0026micro;L reaction contained 2.5 \u0026micro;L HiGeno 2 \u0026times; Probe Mix B (JasonGen, Beijing, China), 0.0448 \u0026micro;L primer (100 \u0026micro;M), 200 ng genomic DNA and 1.4552 \u0026micro;L ddH\u003csub\u003e2\u003c/sub\u003eO. The reactions were run using a CFX96 Real-Time PCR detection device (Bio-Rad, Hercules, CA, USA): the reaction protocol was 94\u0026deg;C/15 min, followed by ten touchdown cycles of 94\u0026deg;C/20 s, annealing temperature/60 s (starting at 65\u0026deg;C, reducing by 0.8\u0026deg;C per cycle), followed by 30 cycles of 94\u0026deg;C/20 s, 57\u0026deg;C/60 s. Fluorescence was detected using a PHERAstar microplate reader supported by KlusterCaller genotyping software (BMG Labtech, Ortenberg, Germany).\u003c/p\u003e\n\u003ch3\u003eQTL mapping\u003c/h3\u003e\n\u003cp\u003eThe DH population was grown in four replicates as the year of 2022 (two different fields) and the year of 2023 (two different fields) and ten plants per DH line were assessed for their reaction to Pst infection in the spring of the following years. The 55k single nucleotide polymorphism (SNP) assay was used for genotyping the DH population and parents by Compass Biotechnology (Beijing, China). Linkage map construction and QTL analysis were conducted by IciMapping 4.1 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.isbreeding.net/software\u003c/span\u003e\u003cspan address=\"https://www.isbreeding.net/software\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The SNP markers distinguished between parents were selected (the genotypes of Jimai 262 were \u0026ldquo;2\u0026rdquo; while that of Yannong 24 were \u0026ldquo;0\u0026rdquo;) and filtered using the function of \u0026ldquo;BIN\u0026rdquo;. The Kosambi mapping function was used to estimate the genetic distances. The QTL detection was implemented by the biparental population (BIP) module using the method of Inclusive Composite Interval Mapping with the additive tool (ICIM-ADD). A minimum logarithm of odds (LOD) threshold value was set as 3. The proportion of phenotypic variance explained and the additive effect by the QTL was calculated.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eGenetic basis of the\u003c/b\u003e \u003cb\u003ePst\u003c/b\u003e \u003cb\u003esusceptibility shown by the 262S mutant\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOver the seasons from 2019 to 2022 growing seasons, seedlings of both cv. Jimai 262 and 262S were scored as \u003cem\u003ePst\u003c/em\u003e susceptible (IT\u0026thinsp;=\u0026thinsp;6\u0026ndash;7), but while cv. Jimai 262 plants at the heading stage were resistant (IT\u0026thinsp;=\u0026thinsp;2), those of 262S were susceptible (IT\u0026thinsp;=\u0026thinsp;6\u0026ndash;7) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) as supported by their scores (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). At the heading stage, the 145 F\u003csub\u003e2\u003c/sub\u003e progeny bred from the cross cv. Jimai 262 \u003cb\u003e\u0026times;\u003c/b\u003e 262S segregated as 119 resistant (IT\u0026thinsp;=\u0026thinsp;1\u0026ndash;3) and 26 susceptible (IT\u0026thinsp;=\u0026thinsp;6\u0026ndash;7) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), a ratio consistent with the presence of a single recessive locus for \u003cem\u003ePst\u003c/em\u003e susceptibility (χ\u003csup\u003e2\u003c/sup\u003e p-value 0.049, see Table\u0026nbsp;1). The ITs of 145 F\u003csub\u003e2:3\u003c/sub\u003e lines scored at the adult plant stage (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) showed that the F\u003csub\u003e2\u003c/sub\u003e progeny homozygous resistant, heterozygous and homozygous susceptible segregated to fit a 1:2:1 ratio (Table\u0026nbsp;1). The implication is that the \u003cem\u003ePst\u003c/em\u003e susceptibility of 262S results from the loss of the single dominant gene responsible for the \u003cem\u003ePst\u003c/em\u003e APR expressed by cv. Jimai 262 - this gene is here tentatively designated \u003cem\u003eYrJ262\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe\u003c/b\u003e \u003cb\u003eYrJ262\u003c/b\u003e \u003cb\u003elocus lies within a 73 Mbp segment of chromosome arm 3BS\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBSE-Seq approach was adopted in order to identify the genomic region(s) harboring \u003cem\u003eYrJ262\u003c/em\u003e. Two bulk DNAs were prepared: one (F2-R) comprised DNA extracted from 30 \u003cem\u003ePst\u003c/em\u003e resistant F\u003csub\u003e2\u003c/sub\u003e individuals, and the other (F2-S) from the DNA of 26 \u003cem\u003ePst\u003c/em\u003e susceptible ones. These bulk DNAs were processed for sequencing, along with DNA prepared from cv. Jimai 262 and 262S. Between 130 and 321\u0026nbsp;million clean paired-end reads were generated (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). An ED analysis carried out on the two bulks detected three discriminating regions, one mapping to chromosome 3A, one to 3B and one to 4B (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e); based on its loess fitted ED\u003csup\u003e4\u003c/sup\u003e value of 0.62, the strongest candidate region for \u003cem\u003eYrJ262\u003c/em\u003e was the 73 Mbp segment lying close to the terminus of chromosome arm 3BS (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eb). The DNAs of 262S and F2-S featured sites along this section of chromosome arm 3BS in which the read count was nearly zero (this region corresponds exactly to the one detected by the ED analysis), while the equivalent region in both cv. Jimai 262 and F2-R harbored a substantial number of occurrences (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). This result provides strong support to the notion that \u003cem\u003eYrJ262\u003c/em\u003e lies within the 73 Mbp distal region of chromosome arm 3BS. While sequences lying within the 73 Mbp segment present in the Chinese Spring (CS) whole genome sequence were represented in the DNA of both cv. Jimai 262 and F2-R, they were rare in the DNA of either 262S or F2-S (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e); in the latter DNAs, they may be present on a different homeologous group 3 chromosome or, less likely, on a non-homeologous chromosome.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eFISH analysis confirms the absence in 262S of the key 3BS terminal segment\u003c/b\u003e FISH analysis was conducted to characterize the status of chromosome 3B in 262S. The resulting karyotyping showed that the distal end of chromosome arm 3BS in homozygous \u003cem\u003ePst\u003c/em\u003e resistant F\u003csub\u003e2:3\u003c/sub\u003e individuals (line #16) harbored two sites hybridizing with the Oligo-pSc119.2-1 sequence, with the stronger site being the more distal one (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). While the distal site contained\u0026thinsp;\u0026gt;\u0026thinsp;2,300 copies of pSc119.2-1 spanning some 0\u0026ndash;18 Mbp region, the more proximal site contained only about 230 copies distributed across the 74\u0026ndash;75 Mbp region of chromosome 3BS (Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). The former site was absent in F\u003csub\u003e2:3\u003c/sub\u003e plants (line #79) classified as homozygous \u003cem\u003ePst\u003c/em\u003e susceptible, while the latter one was retained (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), indicating that the key deletion in the 262S mutant lay distal to the segment weakly hybridizing to pSc119.2-1. Fluorescence of Oligo-pTa535-1 was detected at the distal end of chromosome arm 3BL. The presence of fluorescing pTa535-1 together with that of fluorescing pSc119.2-1 indicated the identity of the chromosome arms of 3B following the result formerly presented (Gong et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe allelic relationship between\u003c/b\u003e \u003cb\u003eYrJ262\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eYr30\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe physical location of \u003cem\u003eYr30\u003c/em\u003e has been delimited to an interval harboring five candidate genes, namely \u003cem\u003eTraesCS3B03G0022700, 3B03G0022800, 3B03G0027400, 3B03G0027700\u003c/em\u003e and \u003cem\u003e3B03G0028100\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024a\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003eb\u003c/span\u003e). Between six and 323 occurrences of these sequences were recovered from the genomic DNA of both cv. Jimai 262 and F2-R, but only 0\u0026ndash;2 from that 262S and F2-S (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e), providing a clear indication of the location of the five candidate genes within the 73 Mbp segment deleted in 262S. A haplotype comparison, based on these five genes, resulted in identity between cv. Jimai 262 and four \u003cem\u003eYr30\u003c/em\u003e carriers and non-identity between cv. Jimai 262 and four non-carriers (Table \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e), thereby establishing a high likelihood of similarity between cv. Jimai 262 and carriers of \u003cem\u003eYr30\u003c/em\u003e. The genetic relationship between \u003cem\u003eYrJ262\u003c/em\u003e and \u003cem\u003eYr30\u003c/em\u003e was examined by a genotypic comparison based on the two KASP markers (\u003cem\u003eAX-110053948\u003c/em\u003e and \u003cem\u003eYM3B-3\u003c/em\u003e) (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e) reportedly linked to \u003cem\u003eYr30\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e). The same \u003cem\u003eAX-110053948\u003c/em\u003e-\u003cem\u003eB\u003c/em\u003e allele (FAM) was present in cv. Jimai 262, homozygous \u003cem\u003ePst\u003c/em\u003e resistant F\u003csub\u003e2:3\u003c/sub\u003e plants and the \u003cem\u003eYr30\u003c/em\u003e carrier YM91R, while null allele was present in 262S and homozygous \u003cem\u003ePst\u003c/em\u003e susceptible F\u003csub\u003e2:3\u003c/sub\u003e plants, and a third allele \u003cem\u003eAX-110053948\u003c/em\u003e-\u003cem\u003eA\u003c/em\u003e (HEX) was present in YM91S (\u003cem\u003eYr30\u003c/em\u003e non-carrier) and CS (Table \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003e). The result showed the presence of \u003cem\u003eAX-110053948\u003c/em\u003e-\u003cem\u003eB\u003c/em\u003e allele was consistent with the \u003cem\u003ePst\u003c/em\u003e resistance. \u003cem\u003eYM3B-3\u003c/em\u003e-\u003cem\u003eA\u003c/em\u003e (HEX) was monomorphic between cv. Jimai 262, 262S, homozygous \u003cem\u003ePst\u003c/em\u003e resistant F\u003csub\u003e2:3\u003c/sub\u003e plants, homozygous \u003cem\u003ePst\u003c/em\u003e susceptible F\u003csub\u003e2:3\u003c/sub\u003e plants and YM91R, but a different allele \u003cem\u003eYM3B-3\u003c/em\u003e-\u003cem\u003eB\u003c/em\u003e (FAM) was present in YM91S and CS. This monomorphism (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e) was probably due to the presence of a homologous sequence on chromosome 3D, an assumption supported by the identification of three related sequences (YM3B-262_3A, _3B and _3D) in cv. Jimai 262, but only two (YM3B-262_3A and _3D) in 262S (Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). The lack of polymorphism between cv. Jimai 262 and 262S resulted from the presence of identical SNP variants in YM3B-262_3B and _3D. As a result, it is not possible to exclude the possibility that cv. Jimai 262 carries a \u003cem\u003eYr\u003c/em\u003e gene allelic to \u003cem\u003eYr30\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eYrJ262\u003c/b\u003e \u003cb\u003ecomplemented with two QTL in the DH population\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAcross both the 2022 and 2023 growing seasons, cv. Jimai 262 expressed a high level of \u003cem\u003ePst\u003c/em\u003e APR: its IT score ranged from 3 to 5. In contrast, cv. Yannong 24 plants were susceptible (IT score of 6\u0026ndash;7) (Table \u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003e). The IT score distribution across the DH population was continuous in 2023 whereas rather bimodal in 2024 (Fig. \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e), although the responses of the separate replicates were significantly correlated with one another (Table \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003e). A total of 18 QTL, mapping to 11 different chromosomes, was detected. Two major QTL were repeatedly detected in all replicates and seasons (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e5\u003c/span\u003e). One of these (LOD score 6.1\u0026ndash;9.7) mapped to a 5.3 Mbp chromosome 1B interval flanked by markers \u003cem\u003eAX-110019040\u003c/em\u003e (670487316, 277.8 cM) and \u003cem\u003eAX-110017315\u003c/em\u003e (675816489, 288.2 cM) (Table\u0026nbsp;2). This locus explained 4.1\u0026ndash;13.2% of the phenotypic variance. The second QTL (LOD score 9.8\u0026ndash;44.2, 12.7\u0026ndash;64.6% of the phenotypic variance) mapped within an 82.4 Mbp segment of chromosome 4B, flanked by markers \u003cem\u003eAX-110544397\u003c/em\u003e (520577684, 176.7 cM) and \u003cem\u003eAX-110013985\u003c/em\u003e (602964022, 191.6 cM) (Table\u0026nbsp;2). At both these QTL, the resistant allele was harbored by cv. Jimai 262. The remaining QTL were detected in just one replicate: these comprised four sites on chromosome 2B, three on chromosome 3A, two on chromosome 3B, two on chromosome 4D and one on each of chromosomes 1A, 5D, 6D, 7B and 7D; individually, these loci explained 1.9\u0026ndash;25.5% of the phenotypic variance (Table\u0026nbsp;2). The QTL located on chromosome 3BS mapped to a region flanked by markers \u003cem\u003eAX-111121461\u003c/em\u003e (24477966, 29.7 cM) and \u003cem\u003eAX-109998593\u003c/em\u003e (27633515, 38.9 cM), explaining 2.0% of the phenotypic variance. The failure to detect a chromosome arm 3BS QTL in the DH population bred from the cross cv. Yannong 24 \u003cb\u003e\u0026times;\u003c/b\u003e cv. Jimai 262 implies either that both parents carry the same \u003cem\u003eYrJ262\u003c/em\u003e allele, or that another \u003cem\u003eYr\u003c/em\u003e gene lies too closely linked to \u003cem\u003eYrJ262\u003c/em\u003e to allow for the recovery of any recombinants in the mapping population. Since the haplotype of cv. Yannong 24 is the same as that of other cultivars known to carry \u003cem\u003eYr30\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e), it is likely that the \u003cem\u003eYr\u003c/em\u003e gene (i.e., \u003cem\u003eYrJ262\u003c/em\u003e) harbored by cv. Yannong 24 is identical to \u003cem\u003eYr30\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cb\u003eThe loss of a terminal segment of chromosome arm 3BS is responsible for the\u003c/b\u003e \u003cb\u003ePst\u003c/b\u003e \u003cb\u003esusceptibility of mutant 262S\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe hexaploidy of bread wheat allows it to tolerate a wide range of chromosome abnormalities (including segmental deletions and even nullisomy), but in some cases aneuploidy does have a significant phenotypic effect, because the missing genes cannot be adequately compensated by the presence of homeoloci on the unaltered chromosomes (Sears \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1954\u003c/span\u003e). In some recent examples, it has been shown that a\u0026thinsp;~\u0026thinsp;110 Mbp deletion on chromosome arm 2DS induces a malformed spike (Du et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), while a 36 Mbp deletion in the distal region of chromosome arm 2AL results in a semi-dwarf phenotype (Wu et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Here it has been shown that the 262S mutant, identified by its loss of \u003cem\u003ePst\u003c/em\u003e resistance, lacks a\u0026thinsp;~\u0026thinsp;73 Mbp segment mapping to the distal end of chromosome arm 3BS, and that the absence of \u003cem\u003eYrJ262\u003c/em\u003e was not complemented by any genes harbored by either of chromosome 3B\u0026rsquo;s homeologs. No QTL conferring APR for \u003cem\u003ePst\u003c/em\u003e was detectable within the candidate region of \u003cem\u003eYr30\u003c/em\u003e on chromosome 3BS in the DH population bred from the cross cv. Jimai 262 \u003cb\u003e\u0026times;\u003c/b\u003e cv. Yannong 24, presumably because the two parents are monomorphic at \u003cem\u003eYrJ262\u003c/em\u003e carrying most similar genes. A genotypic analysis indicated that the two cultivars shared the same haplotype as \u003cem\u003eYr30\u003c/em\u003e carriers (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e), lending support to the notion that \u003cem\u003eYrJ262\u003c/em\u003e is present in both cvs Jimai 262 and Yannong 24.\u003c/p\u003e\u003cp\u003e\u003cb\u003eYrJ262\u003c/b\u003e \u003cb\u003emay be allelic to or identical with\u003c/b\u003e \u003cb\u003eYr30\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFour \u003cem\u003ePst\u003c/em\u003e resistance genes are known to map to chromosome arm 3BS, namely \u003cem\u003eYr4\u003c/em\u003e, \u003cem\u003eYr30\u003c/em\u003e, \u003cem\u003eYr57\u003c/em\u003e and \u003cem\u003eYr58\u003c/em\u003e (Bansal et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Chhetri et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Randhawa et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2000a\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2000b\u003c/span\u003e) and the present study has demonstrated that all four of these genes lie within the key 73 Mbp terminal segment of chromosome arm 3BS. \u003cem\u003eYrJ262\u003c/em\u003e is unlikely to be an allele of either \u003cem\u003eYr4\u003c/em\u003e, \u003cem\u003eYr57\u003c/em\u003e or \u003cem\u003eYr58\u003c/em\u003e, since these genes each protect seedling, rather than encoding APR (Bansal et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Chhetri et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Randhawa et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In contrast, \u003cem\u003eYr30\u003c/em\u003e is recognized as an APR gene; it is known to lies within a 617 kbp segment bounded by markers \u003cem\u003eAX-110053948\u003c/em\u003e and \u003cem\u003eYM3B-3\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e). For both these markers, the allele carried by cv. Jimai 262 did not differ genotypically from that carried by \u003cem\u003eYr30\u003c/em\u003e carriers. Moreover, at nucleotide sites within each of the five \u003cem\u003eYr30\u003c/em\u003e candidate genes, the cv. Jimai 262 sequence is identical to that of \u003cem\u003eYr30\u003c/em\u003e carriers. A formal allelism test between the two dominant genes \u003cem\u003eYrJ262\u003c/em\u003e and \u003cem\u003eYr30\u003c/em\u003e has not been attempted as yet, as this would require a substantial commitment of both time and resource. Thus it has not been possible to reject the hypothesis that cv. Jimai 262 carries a \u003cem\u003eYr\u003c/em\u003e gene allelic with \u003cem\u003eYr30\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003eOther APR genes are present in cv. Jimai 262\u003c/h3\u003e\n\u003cp\u003eTwo stable QTL associated with \u003cem\u003ePst\u003c/em\u003e resistance were mapped \u0026ndash; one to chromosome arm 1BL and the other to chromosome arm 4BL; in each case, the allele contributed by cv. Jimai 262 contributed positively to resistance. The former locus lies adjacent to the site of the \u003cem\u003ePst\u003c/em\u003e APR gene \u003cem\u003eYr29\u003c/em\u003e (\u003cem\u003eQyr.nwafu-1BL.5\u003c/em\u003e) (Xiang et al. 2024), while the latter site has been associated with several \u003cem\u003ePst\u003c/em\u003e QTL, including \u003cem\u003eYr68\u003c/em\u003e (Xiang et al. 2024), \u003cem\u003eQYr.humai15-4BL\u003c/em\u003e (Yuan et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and \u003cem\u003eQYr.nwafu-4BL.3\u003c/em\u003e (Xiang et al. 2024). That the cv. Jimai 262 alleles at these two QTL were, on their own, unable to confer the level of resistance shown by cv. Jimai 262, can be inferred from the full \u003cem\u003ePst\u003c/em\u003e susceptibility of the 262S mutant. However, it is plausible to suggest that they act to enhance the strength and/or durability of the resistance conferred by \u003cem\u003eYrJ262\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003eDurable resistance conferred by complementary multiple genes in cv. Jimai 262\u003c/h3\u003e\n\u003cp\u003ePedigree analysis has shown that the parents of cv. Jimai 262 were cv. Linmai 2 and cv. Yannong 19 (Li et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), even though both these cultivars are \u003cem\u003ePst\u003c/em\u003e susceptible (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e). This raises the question of the origin of cv. Jimai 262\u0026rsquo;s \u003cem\u003ePst\u003c/em\u003e resistance. The \u003cem\u003eYM3B-3\u003c/em\u003e genotype of both parental cultivars implies that both are \u003cem\u003eYr30\u003c/em\u003e carriers, and their SNP haplotype within the key genomic interval is the same as that of cultivars known to harbor \u003cem\u003eYr30\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e). A possible hypothesis is that, in addition to \u003cem\u003eYrJ262\u003c/em\u003e, the presence of two complementary genes at QTL mapped to chromosomes 1B and 4B is required for the expression of \u003cem\u003ePst\u003c/em\u003e APR (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Such a scenario is consistent with the observation that APR genes typically confer at best a partial level of resistance, implying that the overall level of a host\u0026rsquo;s resistance may be enhanced by the addition of one or more of complementary genes (Huang et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2000a\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Here, the gene(s) present within the two QTL mapped to chromosomes 1B and 4B could be candidates for such complementary genes. The suggestion is that cv. Yannong 24 is \u003cem\u003ePst\u003c/em\u003e susceptible because it carries ineffective alleles at the chromosome 1B and chromosome 4B QTL, in contrast to cv. Jimai 262, which carries effective alleles at both loci.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary Information\u003c/strong\u003e The online version contains supplementary material available at https:\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e The authors thank Ennian Yang (Sichuan Academy of Agricultural Sciences), Zhijian Chang and Xin Li (Shanxi Agricultural University) for helping with the assessment of stripe rust.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution statement\u0026nbsp;\u003c/strong\u003eXZ, TK and CL conceptualized the research, XZ and TK designed experiments, XZ, JL, GL, CF and XL performed resistance experiments, XZ performed molecular mapping of genes, WG performed cytological experiments, HL produced mapping populations, XZ and TK analyzed the data and wrote the manuscript. All authors approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e This study was funded by the National Key R\u0026amp;D Plan (2023YFD1201005) to CL, Agricultural scientific and technological innovation project of Shandong Academy of Agricultural Sciences (CXGC2023G01) to TK, China Postdoctoral Science Foundation (2022M711971) to XZ, Shandong Province Key R\u0026amp;D Plan (2022LZG002-4) to CL, Shandong Province Wheat Industry Technology System (SDAIT-01-01) to CL, and Shandong Province Key R\u0026amp;D Program for Shandong (China)-Israel Cooperation Program (2023KJHZ003) to TK.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData, Materials, and Software Availability\u003c/strong\u003e The data are available in the manuscript, the supplementary files, or at publicly accessible repositories. The raw exome sequencing data are deposited in NCBI under the accession number of PRJNA1159985.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors declare that no commercial or financial relationships could be construed as representing any potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e All of the named authors have agreed to the carrying out of this research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e All of the named authors have agreed to the publication of this research in TAG.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBansal UK, Hayden MJ, Gill MB, Bariana HS (2009) Chromosomal location of an uncharacterised stripe rust resistance gene in wheat. Euphytica 171:121\u0026ndash;127\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeddow JM, Pardey PG, Chai Y, Hurley TM, Kriticos DJ, Braun H-J, Park RF, Cuddy WS, Yonow T (2015) Research investment implications of shifts in the global geography of wheat stripe rust. Nat Plants 1:15132\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhavani S, Singh RP, Hodson DP, Huerta-Espino J, Randhawa MS (2022) Wheat Rusts: Current Status, Prospects of Genetic Control and Integrated Approaches to Enhance Resistance Durability. In: Reynolds MP, Braun H-J (eds) Wheat Improvement: Food Security in a Changing Climate. Springer International Publishing, Cham, pp 125\u0026ndash;141\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen S, Zhou Y, Chen Y, Gu J (2018) fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884\u0026ndash;i890\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen X (2020) Pathogens which threaten food security: Puccinia striiformis, the wheat stripe rust pathogen. Food Secur 12:239\u0026ndash;251\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChhetri M, Bariana H, Kandiah P, Bansal U (2016) Yr58: A New Stripe Rust Resistance Gene and Its Interaction with Yr46 for Enhanced Resistance. Phytopathology 106:1530\u0026ndash;1534\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong C, Zhang L, Chen Z, Xia C, Gu Y, Wang J, Li D, Xie Z, Zhang Q, Zhang X, Gui L, Liu X, Kong X (2020) Combining a New Exome Capture Panel With an Effective varBScore Algorithm Accelerates BSA-Based Gene Cloning in Wheat. Front Plant Sci 11:1249\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDu D, Zhang D, Yuan J, Feng M, Li Z, Wang Z, Zhang Z, Li X, Ke W, Li R, Chen Z, Chai L, Hu Z, Guo W, Xing J, Su Z, Peng H, Xin M, Yao Y, Sun Q, Liu J, Ni Z (2021) FRIZZY PANICLE defines a regulatory hub for simultaneously controlling spikelet formation and awn elongation in bread wheat. New Phytol 231:814\u0026ndash;833\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu D, Uauy C, Distelfeld A, Blechl A, Epstein L, Chen X, Sela H, Fahima T, Dubcovsky J (2009) A Kinase-START Gene Confers Temperature-Dependent Resistance to Wheat Stripe Rust. Science 323:1357\u0026ndash;1360\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGong W, Li G, Han R, Song J, Li H, Liu A, Cao X, Yang Z, Liu C, Zhao Z, Liu J (2016) Fluorescence \u003cem\u003ein situ\u003c/em\u003e hybridization analysis of jimai serial wheat. Shandong Agricultural Sci 48(1):16\u0026ndash;20\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHan F, Lamb JC, Birchler JA (2006) High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proceedings of the National Academy of Sciences 103:3238\u0026ndash;3243\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHill JT, Demarest BL, Bisgrove BW, Gorsi B, Su YC, Yost HJ (2013) MMAPPR: mutation mapping analysis pipeline for pooled RNA-seq. Genome Res 23:687\u0026ndash;697\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang S, Zhang Y, Ren H, Li X, Zhang X, Zhang Z, Zhang C, Liu S, Wang X, Zeng Q, Wang Q, Singh RP, Bhavani S, Wu J, Han D, Kang Z (2022) Epistatic interaction effect between chromosome 1BL (Yr29) and a novel locus on 2AL facilitating resistance to stripe rust in Chinese wheat Changwu 357-9. Theor Appl Genet 135:2501\u0026ndash;2513\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrattinger SG, Lagudah ES, Spielmeyer W, Singh RP, Huerta-Espino J, McFadden H, Bossolini E, Selter LL, Keller B (2009) A Putative ABC Transporter Confers Durable Resistance to Multiple Fungal Pathogens in Wheat. Science 323:1360\u0026ndash;1363\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi H, Cheng D, Liu C, Han R, Song J, Liu A, Cao X, Guo J, Wang C, Liu J, Zhao Z, Zhai S, Zi Y (2021) Drought-resistant and water-saving wheat variety \u0026lsquo;Jimai 262\u0026rsquo;: breeding experience. J Agric 11(12):24\u0026ndash;27\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754\u0026ndash;1760\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Genome Project Data Processing S (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078\u0026ndash;2079\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLine RF, Qayoum A (1992) Virulence, aggressiveness, evolution, and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-87. Technical bulletin-United States Department of Agriculture\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu S, Wang X, Zhang Y, Jin Y, Xia Z, Xiang M, Huang S, Qiao L, Zheng W, Zeng Q, Wang Q, Yu R, Singh RP, Bhavani S, Kang Z, Han D, Wang C, Wu J (2022) Enhanced stripe rust resistance obtained by combining \u003cem\u003eYr30\u003c/em\u003e with a widely dispersed, consistent QTL on chromosome arm 4BL. Theor Appl Genet 135:351\u0026ndash;365\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMoore JW, Herrera-Foessel S, Lan C, Schnippenkoetter W, Ayliffe M, Huerta-Espino J, Lillemo M, Viccars L, Milne R, Periyannan S, Kong X, Spielmeyer W, Talbot M, Bariana H, Patrick JW, Dodds P, Singh R, Lagudah E (2015) A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet 47:1494\u0026ndash;1498\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNarasimhan V, Danecek P, Scally A, Xue Y, Tyler-Smith C, Durbin R (2016) BCFtools/RoH: a hidden Markov model approach for detecting autozygosity from next-generation sequencing data. Bioinformatics 32:1749\u0026ndash;1751\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNsabiyera V, Bariana HS, Qureshi N, Wong D, Hayden MJ, Bansal UK (2018) Characterisation and mapping of adult plant stripe rust resistance in wheat accession Aus27284. Theor Appl Genet 131:1459\u0026ndash;1467\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePorebski S, Bailey LG, Baum BR (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biology Report 15:8\u0026ndash;15\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePutri GH, Anders S, Pyl PT, Pimanda JE, Zanini F (2022) Analysing high-throughput sequencing data in Python with HTSeq 2.0. Bioinformatics 38:2943\u0026ndash;2945\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRandhawa MS, Bariana HS, Mago R, Bansal UK (2015) Mapping of a new stripe rust resistance locus Yr57 on chromosome 3BS of wheat. Molecular Breeding 35\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchwessinger B (2017) Fundamental wheat stripe rust research in the 21(st) century. New Phytol 213:1625\u0026ndash;1631\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSears ER (1954) The aneuploids of common wheat. University of Missouri, College of Agriculture, Agricultural Experiment Station\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh R, Huerta-Espino J, Rajaram S (2000a) Achieving near-immunity to leaf and stripe rusts in wheat by combining slow rusting resistance genes\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh RP, Nelson JC, Sorrells ME (2000b) Mapping Yr28 and Other Genes for Resistance to Stripe Rust in Wheat. Crop Sci 40:1148\u0026ndash;1155\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSuenaga K, Singh RP, Huerta-Espino J, William HM (2003) Microsatellite markers for genes Lr34/Yr18 and other quantitative trait loci for leaf rust and stripe rust resistance in bread wheat. Phytopathology 93:881\u0026ndash;890\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang Z, Yang Z, Fu S (2014) Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J Appl Genet 55:313\u0026ndash;318\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang F, Zhang M, Hu Y, Gan M, Jiang B, Hao M, Ning S, Yuan Z, Chen X, Chen X, Zhang L, Wu B, Liu D, Huang L (2023) Pyramiding of Adult-Plant Resistance Genes Enhances All-Stage Resistance to Wheat Stripe Rust. Plant Dis 107:879\u0026ndash;885\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang W, Li H, Qiu L, Wang H, Pan W, Yang Z, Wei W, Liu N, Sun J, Hu Z, Ma J, Ni Z, Li Y, Sun Q, Xie C (2024a) Fine-mapping of \u003cem\u003eLrN3B\u003c/em\u003e on wheat chromosome arm 3BS, one of the two complementary genes for adult-plant leaf rust resistance. Theor Appl Genet 137:203\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Xiang M, Li H, Li X, Mu K, Huang S, Zhang Y, Cheng X, Yang S, Yuan X, Singh RP, Bhavani S, Zeng Q, Wu J, Kang Z, Liu S, Han D (2024b) High-density mapping of durable and broad-spectrum stripe rust resistance gene Yr30 in wheat. Theor Appl Genet 137:152\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu L, Xia X, Rosewarne GM, Zhu H, Li S, Zhang Z, He Z, Miedaner T (2015) Stripe rust resistance gene Yr18 and its suppressor gene in Chinese wheat landraces. Plant Breeding 134:634\u0026ndash;640\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu Q, Chen Y, Xie J, Dong L, Wang Z, Lu P, Wang R, Yuan C, Zhang Y, Liu Z (2021) A 36 Mb terminal deletion of chromosome 2BL is responsible for a wheat semi-dwarf mutation. Crop J 9:873\u0026ndash;881\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang EN, Rosewarne GM, Herrera-Foessel SA, Huerta-Espino J, Tang ZX, Sun CF, Ren ZL, Singh RP (2013) QTL analysis of the spring wheat \u0026lsquo;\u0026lsquo;Chapio\u0026rsquo;\u0026rsquo; identifies stable stripe rust resistance despite inter-continental genotype 3 environment interactions. Theor Appl Genet 126:1721\u0026ndash;1732\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan F, Zeng Q, Wu J, Wang Q, Yang Z, Liang B, Kang Z, Chen X, Han D (2018) QTL Mapping and validation of adult plant resist- ance to stripe rust in Chinese wheat landrace Humai 15. Front Plant Sci 9:968\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu T, Wang L, Rimbert H, Rodriguez JC, Deal KR, De Oliveira R, Choulet F, Keeble-Gagnere G, Tibbits J, Rogers J, Eversole K, Appels R, Gu YQ, Mascher M, Dvorak J, Luo MC (2021) Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J 107:303\u0026ndash;314\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu Z, Cao Q, Han D, Wu J, Wu L, Tong J, Xu X, Yan J, Zhang Y, Xu K, Wang F, Dong Y, Gao C, He Z, Xia X, Hao Y (2023) Molecular characterization and validation of adult-plant stripe rust resistance gene Yr86 in Chinese wheat cultivar Zhongmai 895. Theor Appl Genet 136:142\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 and 2 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7543105/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7543105/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWheat stripe (or yellow) rust, caused by \u003cem\u003ePuccinia striiformis\u003c/em\u003e f. sp. \u003cem\u003etritici\u003c/em\u003e, imposes one of the gravest constraints to wheat production. While race-specific seedling resistance genes can be effective in controlling this disease, those which confer resistance at the adult stage typically protect the host from infection by a broad spectrum of the pathogen, and tend to be more durable. But the durable resistance such as that expressed by the recently developed Chinese cultivar (cv.) Jimai 262 is poorly understood. Based on the identification of a spontaneous loss-of-function mutant, a genetic analysis indicated that cv. Jimai 262\u0026rsquo;s adult plant resistance to stripe rust is conferred by the presence of a single dominant gene, tentatively designated \u003cem\u003eYrJ262\u003c/em\u003e. Bulk segregant exome sequencing implied that the distal end of chromosome arm 3BS of the mutant lacked a\u0026thinsp;~\u0026thinsp;73 Mbp segment which was present in cv. Jimai 262, thereby placing \u003cem\u003eYrJ262\u003c/em\u003e within this segment. The presence of this deletion was confirmed by a fluorescence \u003cem\u003ein situ\u003c/em\u003e hybridization-based analysis. The flanking sequences of the \u003cem\u003eYr30\u003c/em\u003e candidate region were identical between plants carrying \u003cem\u003eYr30\u003c/em\u003e and cv. Jimai 262, consistent with the hypothesis that \u003cem\u003eYr30\u003c/em\u003e and \u003cem\u003eYrJ262\u003c/em\u003e co-locate within the same locus. The \u003cem\u003eYrJ262\u003c/em\u003e was complemented by resistant alleles at the QTL on chromosomes 1B and 4B for sufficient adult plant resistance in Jimai 262.\u003c/p\u003e","manuscriptTitle":"A wheat stripe rust adult plant resistant gene YrJ262 mapping within a spontaneous terminal deletion in the short arm of chromosome 3B","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-24 17:19:25","doi":"10.21203/rs.3.rs-7543105/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2026-01-05T18:00:15+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-11-12T21:46:37+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-12T21:10:45+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-08T16:41:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Theoretical and Applied Genetics","date":"2025-09-05T05:58:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0e939034-3969-4315-851a-61f5173d10b7","owner":[],"postedDate":"November 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-05T08:28:49+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-24 17:19:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7543105","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7543105","identity":"rs-7543105","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.