Acroporids in northwestern Philippines with varied thermotolerance host similar photosymbionts | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Acroporids in northwestern Philippines with varied thermotolerance host similar photosymbionts John Bennedick Quijano, Jake Ivan P. Baquiran, Madeleine J. H. van Oppen, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8838536/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Coral reefs worldwide are threatened by rapid warming of the oceans, yet many corals persist despite thermal stress. Reefs in northwestern Philippines, which are frequently exposed to elevated temperatures (29–30°C, mean monthly maximum), present an opportunity to examine inter-colony variation in thermotolerance and its correlation with Symbiodiniaceae, the coral’s microalgal symbiotic partner. In this study, we assessed the thermotolerance of individual colonies of three Acropora species, A. digitifera , A. millepora , and A. cf. tenuis , from a reef in Anda, Pangasinan, Philippines. Thermotolerance varied within and among species. ITS2 metabarcoding revealed that the corals host four closely related strains of Cladocopium patulum (formerly referred to as “type C3u”). However, inter- and intra-specific differences in thermotolerance did not show strong correlation with symbiont composition. These findings suggest that while Symbiodiniaceae communities may contribute to heat resilience in corals, they do not solely explain the marked difference in thermotolerance among individuals. Acropora digitifera Acropora millepora Acropora cf. tenuis heat tolerance ITS2 metabarcoding Bolinao-Anda Reef Complex (BARC) Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Coral reefs are among the most productive ecosystems on earth and are hotspots of biodiversity supporting an estimated one million multicellular species that inhabit coral reefs (Fisher et al. 2015 ). Healthy reefs are vital providers of ecosystem goods and services to human populations in tropical and subtropical regions (Cinner et al. 2012 ; Hoegh-Guldberg et al. 2018 ). Despite their great importance, coral reefs are rapidly declining due to extreme and abrupt changes in the environment, including, but not limited to, global warming, ocean acidification, destructive fishing, pollution, and the introduction of exotic species (Hughes et al. 2017 ; Hughes et al. 2018 ; Eddy et al. 2021 ). Among these, the rapid rise of seawater temperature due to global warming is the biggest threat to these valuable ecosystems (Oliver et al. 2019 ; Eddy et al. 2021 ). Like other multicellular organisms, corals are holobionts, ecological units that integrate the host and its associated microorganisms (Baedke et al. 2020 ). The coral host forms close associations with microorganisms such as microeukaryotes (e.g., fungi, dinoflagellates, apicomplexans), archaea, bacteria, and viruses that work together or against each other depending on the environment (van Oppen and Nitschke 2022 ). Among these microorganisms, dinoflagellate microalgae in the family Symbiodiniaceae (colloquially known as zooxanthellae) provide the majority of nutritional and energetic requirements of the host in return for a habitat with stable light conditions and vital (micro)nutrients (Falkowski et al. 1984 ; Trench 1993 ; Voolstra et al. 2021 ; Wiedenmann et al. 2023 ). Different coral-Symbiodiniaceae pairings are linked to distinct holobiont phenotypes. Thermotolerant species are often dominated by Durusdinium , whereas thermosensitive taxa, such as Indo-West Pacific acroporids, are typically dominated by Cladocopium . Despite their general sensitivity, acroporids can alter their photosymbionts in response to stressors. For example, on the Great Barrier Reef, Acropora millepora symbionts were shown to shift from Cladocopium to Durusdinium following temperature-induced bleaching (Berkelmans and van Oppen 2006 ). Similarly, Pocillopora symbionts were reported to change from C. latusorum to D. glynii after a mass bleaching event (Palacio-Castro et al. 2023 ). However, while Durusdinium is often linked to enhanced thermal tolerance, corals that associate with it often exhibit reduced growth rates due to lower nutritional provision by the symbiont under normal temperature levels (Abrego et al. 2008 ; Cantin et al. 2009 ; Wall et al. 2020 ), although there are exceptions (Kemp et al. 2023 ; Turnham et al. 2023 ). Aside from Durusdinium , some members of Cladocopium have been correlated with increased coral thermotolerance. For example, corals in the Red Sea, where temperatures can reach 36°C, are usually associated with Cladocopium thermophilum (D’Angelo et al. 2015 ). Thermotolerant Acropora in the South China Sea were also found to associate with Cladocopium spp. (Gong et al. 2019 ; Ip et al. 2022 ). Nonetheless, symbiont associations alone may not fully account for variation in coral thermal tolerance, which can also be shaped by acclimatization history, interactions with other holobiont partners, and host traits. Host traits and photosymbiont type may explain why differences in thermal tolerance are often observed even within the same coral population, and sometimes among individuals found in the same reef area. For example, in an American Samoan reef (< 100 km 2 ) exposed to slightly higher temperatures, some individuals of Acropora hyacinthus , A. gemmifera , Pocillopora damicornis , and Porites cylindrica exhibited better thermal tolerance compared to others (Morikawa and Palumbi 2019 ). Similar patterns were observed in A. hyacinthus (Naugle et al. 2024 )d spathulata (Denis et al. 2024 ) from the Great Barrier Reef where thermotolerance varied among conspecific colonies within and among reefs. Variation was also recorded in Montipora capitata individuals from a small reef patch in Hawaii (Stat et al. 2011 ; Drury et al. 2022 ), as well as in A. digitifera and A. hyacinthus from small reef patches in Palau where differences in survival under controlled heat stress experiments were observed (Cornwell et al. 2021 ; Humanes et al. 2022 ). Such within-population differences in thermotolerance may arise from host genetic factors that shape colony phenotypes (e.g., colony size, tissue thickness, skeletal density) (Brown 1997 ; Enríquez et al. 2005 ; Voolstra et al. 2021 ; Shah et al. 2022 ) or from symbiont community composition (Kavousi et al. 2020 ; Drury et al. 2022 ). Understanding coral and photosymbiont thermotolerance is especially important because reefs in the Coral Triangle are rapidly declining due to rising sea surface temperatures and recurring summer heatwaves that cause bleaching (Peñaflor et al. 2009 ; McLeod et al. 2010 ; Mellin et al. 2024 ; Handiani et al. 2025 ). The Bolinao-Anda Reef Complex (BARC) in the northern West Philippine Sea region of the South China Sea has experienced several widespread bleaching events over the past decades (Yap et al. 1992 ; Arceo et al. 2001 ; Kleypas et al. 2015 ; Quimpo et al. 2020 ), yet some colonies continue to persist (Harrison et al. 2021 ), suggesting variation in thermal resilience among individuals and species. Whether this variation in thermal tolerance among individuals and closely related species is primarily associated with photosymbiont composition, host factors, or an interplay of the two remains an open question. To examine coral thermotolerance and its link to Symbiodiniaceae community composition, we conducted short-term heat stress assays on three species of acroporids, Acropora digitifera , A. millepora and A. cf. tenuis , and profiled their associated Symbiodiniaceae using ITS2 metabarcoding. By focusing on a reef repeatedly affected by thermal stress, this study contributes to ongoing efforts to understand coral-symbiont relationships and their role in thermotolerance across multiple species and regions within the Coral Triangle. Materials & Methods Coral collection Thirty healthy colonies each of Acropora cf. tenuis and A. millepora , and 40 colonies of A. digitifera from a depth of 4–5 meters in Anda, Pangasinan, northwestern Philippines (16.31487° N, 120.03128° E) were haphazardly selected and marked using small stainless steel tags. To increase the likelihood of obtaining different genotypes, colonies at least 5 meters apart were chosen (Howlett et al. 2024 ). Colonies were considered healthy if they showed no visible signs of bleaching or tissue sloughing (i.e., detachment of coral tissue from skeleton, observed as exposed white skeleton without overlying tissue). Collections were conducted with permission from the Philippines Department of Agriculture Bureau of Fisheries and Aquatic Resources (DA-BFAR Gratuitous Permit No. 0169 − 19 and 0324 − 24). A small piece containing at least 20 branches was collected from each colony using a hammer and chisel. Coral pieces were transported to the outdoor hatchery of the Bolinao Marine Laboratory on October 6, 2021 ( A. millepora ), October 28, 2021 ( A. digitifera ), and November 13, 2021 ( A. cf. tenuis ) where they were held in flow-through seawater tanks maintained at ~ 29°C (Fig. S1 and Table S1 ) for a day until fragment preparation. The same tank was used for each species and was cleaned between each run. Sixteen fragments (~ 3 cm in length) were cut from the apical branch tips of each colony and attached to cement nubbin holders using cyanoacrylate glue (Dizon et al. 2008 ). Nubbins (1,600 in total) were labeled with small plastic tags to enable tracking of parent colonies. Heat stress assays Coral fragments attached to fragment holders (n = 16 per colony) were randomly placed into eight (8) 40-L plastic tanks (4 control and 4 heat-stress tank replicates) supported with artificial lighting (100 µE/m2⋅s) on a diel cycle (12:12 light-dark cycle), continuous seawater flow, and thermostat-regulated seawater temperature. All the coral fragments were initially acclimated at 29°C (mean monthly maximum sea surface temperature, MMM, at the Bolinao-Anda Reef Complex) (Quimpo et al. 2020 ) for 3 days. The tanks were then heated slowly (ramping) by 1°C a day, until 33°C was reached. This temperature, which is 3–4°C above the MMM, was used to induce bleaching. Fragments were maintained at this temperature until the end of the experiment. Experiment duration varied across species and was terminated when 15–30% of fragments displayed mortality (4 days for A. millepora and A. cf. tenuis; 7 days for A. digitifera ). In this study, mortality was defined as loss of all coral tissue with no intact tissue remaining on the coral skeleton (Humanes et al. 2024 ). During the exposure period, the coral fragments were observed at least thrice daily (morning ~ 09:00, midday ~ 12:00, and late afternoon ~ 16:00) to monitor health status and mortality. Colonies that showed signs of bleaching or mortality in the control tanks were excluded from the final analysis to avoid confounding factors unrelated to heat stress. To verify that the laboratory conditions were stable throughout the course of the experiment, temperature and pH were checked using a handheld meter (LAQUAact-PC110, Horiba, UK) (Fig. S2 and Table S2 ) thrice daily in addition to the data collected by submersible HOBO loggers (Onset, USA) placed in each tank. Coral fragment color was documented at the start (pre-exposure) and end (post-exposure) of the experiment using a Tough TG-5 Waterproof Digital Camera (Olympus, USA) with black, white, and coral color reference cards (Siebeck et al. 2006 ) to capture subtle, quantitative changes in tissue coloration. Survival analysis Kaplan-Meier (KM) survival analysis (Kaplan and Meier 1958 ) was used to compare survivorship among Acropora species subjected to heat stress, as it allows analysis of time-to-event data and accommodates censored observations (i.e., fragments still alive at the end of the experiment). KM survival curves were made using the ggally package (Schloerke et al. 2018 ) to visualize the data and log-rank tests were done to compare survivorship among species. This non-parametric approach incorporates exact survival times (i.e., time until a fragment is recorded as dead) and has been used in studies that evaluated survival of coral fragments or individuals over time (Dizon and Yap 2006 ; Hazraty-Kari et al. 2022 ). Thermotolerance classification of colonies Classification of thermotolerance of conspecific Acropora colonies was based on (1) incidence of mortality (IOM), (2) fragment color change (%ΔC), and (3) colony stress index (CSI) which is the combination of both (1 & 2). IOM is based on direct counts of dead fragments observed at the end of the experiment, %ΔC is a quantitative measure of bleaching based on photographs taken of each fragment before and after heat exposure, while CSI is the total value of normalized IOM and normalized average fragment color change (%ΔC ave ). Incidence of mortality Incidence of mortality (IOM) was computed by dividing the number of dead fragments (n) by the total number of fragments (N) subjected to high temperature per colony, multiplied by 100%. Dead fragments were defined as those that had completely sloughed off tissue from the skeleton. IOM = \(\:\frac{\text{n}}{\text{N}}\times\:100\%\) Colonies with IOM greater than or equal to 50% were tagged as thermosensitive (S), while those with less than 50% were tagged as thermotolerant (T). Because of the gradual temperature ramping and short duration of exposure, colony mortality was generally low and many colonies had the same ranking. Fragment color change Color change in heat-stressed fragments was estimated using mean gray values (Mclachlan and Grottoli 2021 ). Images of the coral fragments were converted to gray scale and the mean gray value (MGV) of each heat-stressed fragment (M F ) was measured using ImageJ. To account for differences in image brightness, the MGV of a 1 cm 2 white standard (M s ) was measured for each photo. Normalized MGV (nMGV) was computed by dividing fragment MGV (M F ) by the standard MGV (M S ) multiplied by 100%. nMGV = \(\:\frac{{\text{M}}_{\text{F}}}{{\text{M}}_{\text{S}}}\times\:\:100\%\) To get percent color change (%ΔC), initial nMGV (nMGV i ; from pre-exposure fragment images) was subtracted from final nMGV (nMGV f ; from post-exposure fragment images) then divided by nMGV i . %ΔC = \(\:\frac{{\text{n}\text{M}\text{G}\text{V}}_{\text{f}}-\:{\text{n}\text{M}\text{G}\text{V}}_{\text{i}}}{{\text{n}\text{M}\text{G}\text{V}}_{\text{i}}}\:\times\:100\%\) Percent color change per fragment (n = 8) was averaged per colony (%ΔC ave ). Higher values reflect increased bleaching severity, indicated by fragments becoming visibly whiter. Colonies were ranked based on their %ΔC ave with the top 20% of the sampled population classified as thermosensitive and the bottom 20% as thermotolerant, ensuring that the worst and best performing colonies were identified for subsequent analyses. Colony stress index To obtain a representative measure of the coral heat stress response, IOM and %ΔC ave were combined per colony per species. Spearman correlation was first used to assess association between IOM and %ΔC ave across species, as bleaching (color loss) does not always equate to mortality. IOM and %ΔC ave were then merged into a single metric by getting the sum of each measure normalized to their respective minimum and maximum values per species. Normalized IOM or %ΔC ave = \(\:\frac{\text{x}\:-\:{\text{x}}_{\text{m}\text{i}\text{n}}}{{\text{x}}_{\text{m}\text{a}\text{x}}\:-\:{\text{x}}_{\text{m}\text{i}\text{n}}\:}\) The sum of normalized IOM and %ΔC ave , colony stress index (CSI), was then used to classify colony thermotolerance based on their ranks per species. The bottom 20% of colonies with least change relative to original phenotypes, were classified as thermotolerant and the top 20%, with the most change, as thermosensitive. CSI = normalized IOM + normalized %ΔC ave To compare thermotolerance characteristics of all acroporid colonies regardless of species, incidence of mortality of all colonies (IOM all ) was derived by min-max normalization of IOM values of all colonies at day 10 of the experiment (four days at 33°C). Similarly, the percent color change of all colonies (%ΔC all ) was obtained by min-max normalization of %ΔC ave values. The colony stress index of all colonies (CSI all ) was computed as the sum of IOM all and %ΔC all . DNA extraction and PCR Prior to thermal stress experiments, two fragments (~ 3 cm) were sampled from each colony and fixed in 5 mL of 100% ethanol. Tissue was collected from these fragments using an airbrush with 0.2 µm-filtered artificial seawater. Tissue slurries were stored on ice until DNA extraction. The coral slurry was centrifuged for 5 minutes at 10,000 g at 4°C. The seawater was removed and the pellet was resuspended in 400 µL of complete 2% CTAB buffer (Murray and Thompson 1980 ). Cells were lysed by incubation for an hour at 60°C then 400 µL of chloroform:isoamyl alcohol (24:1) solution was added. The solution was vigorously mixed by hand for 2 minutes then centrifuged at 10,000 g at 4°C for phase separation. The aqueous phase was transferred into a fresh tube and 600 µL of isopropanol was added. DNA was precipitated for 2–3 hours on ice then pelleted by centrifugation at 12,000 g at 4°C for 30 minutes. The pellet was washed twice with 1 mL cold 70% ethanol and centrifuged at 10,000 g at 4°C for 10 minutes. The pellet was resuspended in 25–50 µL ultrapure, nuclease-free water. DNA quality was checked by agarose gel electrophoresis and quantity was measured using a Qubit 3.0 fluorometer (ThermoFisher Scientific, USA). Genomic DNA samples were stored at -20°C. Identification of symbiont communities Genomic DNA was submitted to Macrogen, South Korea, for ITS2 library construction using the Herculase II Fusion DNA Polymerase Nextera XT Index Kit V2 (Agilent Technologies, Santa Clara, CA, USA) and the primer pair ITSintfor2 (GAATTGCAGAACTCCGTG) (Coleman et al. 1994 ) and ITS-reverse (GGGATCCATATGCTTAAGTTCAGCGGGT) (LaJeunesse 2002 ). Libraries were subjected to paired-end, multiplexed sequencing on the MiSeq platform to generate 300 base pair reads (Illumina, USA). Raw sequence data were deposited in the NCBI Sequence Read Archive and can be accessed under BioProject accession number PRJNA1295142. The SymPortal pipeline (Hume et al. 2019 ) was used to analyze the resulting ITS2 sequences and to identify the Symbiodiniaceae community present in the acroporid samples. SymPortal is a bioinformatic pipeline that identifies the putative taxa within a Symbiodiniaceae community from ITS2 amplicon data. By considering the intragenomic diversity in every Symbiodiniaceae genome, SymPortal names ITS2 type profiles (strains) based on combinations of defining intragenomic variants (DIVs) (Hume et al. 2019 ). The pipeline includes quality-checking steps to increase the reliability of ITS2 sequence annotation and profile prediction (Schloss et al. 2009 ; Eren et al. 2015 ; Sayers et al. 2022 ). Statistical analyses Heatmaps and bar plots were generated to visualize the distribution of Symbiodiniaceae-related ITS2 sequences and predicted ITS2 type profiles among the samples. Principal coordinates analysis (PCoA) plots (Gower 2015 ), Weighted UniFrac (Lozupone et al. 2007 ) and Bray-Curtis dissimilarity (Bray and Curtis 1957 ) computed from square root-transformed abundance of ITS2 sequences, were used to visualize compositional similarities or groupings of samples. Weighted UniFrac incorporates both phylogenetic relationships and relative abundances, whereas Bray-Curtis dissimilarity quantifies differences in taxon abundance between samples. Distance-based redundancy analysis (dbRDA) (Legendre and Anderson 1999 ) was done using the capscale function to explore how ITS2 sequence composition varied with explanatory variables (i.e., IOM all , %ΔC all , and CSI all ). Clustering of coral colonies based on Symbiodiniaceae-related ITS2 sequence composition was checked by permutational multivariate analysis of variance (PERMANOVA) (Anderson 2017 ) using the adonis2 and the pairwiseAdonis functions (Martinez Arbizu 2020 ). Dispersion among groups was compared by permutational analysis of dispersion (PERMDISP) (Anderson 2006 ) using the betadisper function. Bootstrapping was applied to both PERMANOVA and PERMDISP analyses to account for unequal sampling sizes and assess the robustness of group differences and dispersion estimates. To test for differences in thermotolerance metrics among groups, we used the Kruskal-Wallis test (Kruskal and Wallis 1952 ), followed by Dunn’s post-hoc pairwise comparisons (Dunn 1964 ). Rarefaction curves were generated using the rarecurve function to evaluate whether sampling depth was sufficient to capture the diversity of ITS2 sequences across samples. The functions capsale, adonis2, betadisper, diversity, specnumber, and rarecurve are part of the vegan package (Oksanen et al. 2022 ). All statistical analyses were conducted in R (R Core Team 2023 ) using RStudio (Posit team 2025 ). Data handling and plotting were done using the tidyverse suite of packages (Wickham et al. 2019 ). Results Thermotolerance of Acropora species All colonies of A. digitifera (n = 40), A. millepora (n = 30) and A. cf. tenuis (n = 30) survived the pre-exposure stage prior to heat stress application. All fragments in the control tanks remained healthy, except for five fragments from five different colonies of A. cf. tenuis that showed bleaching during the experiment (Fig. S3 and Table S3). The colonies from which these fragments originated were excluded from thermotolerance and symbiont community analyses (Table S4). Thermotolerance among Acropora species differed based on incidence of mortality (IOM) (log-rank test P- value < 0.001; Fig. 1 A). Acropora digitifera showed the highest survival under elevated temperature, followed by A. millepora , and A. cf. tenuis (Fig. 1 A, Table 1 ). Comparison of IOM at day 10 revealed lower IOM all in A. digitifera (median = 0, IQR = 0–0) compared to A. millepora (median = 0.063, IQR = 0-0.34) and A. cf. tenuis (median = 0.13, IQR = 0-0.38) (Fig. 1 B, Table S3). Percent color change (%ΔC all ) also differed among species, with A. digitifera (median = 0.09, IQR = 0.05–0.18) showing lower %ΔC compared to A. millepora (median = 0.31, IQR = 0.25–0.48) and A. cf. tenuis (median = 0.28, IQR = 0.21–0.28) (Fig. 1 B, Table S5). Colony stress index (CSI all ) was lower in A. digitifera (median = 0, IQR = 0–0) compared to A. millepora (median = 0.38, IQR = 0.28–0.78) and A. cf. tenuis (median = 0.36, IQR = 0.21–0.72) (Fig. 1 B, Table S5). Considering the outcomes of time-to-event analysis (log-rank test) and common timepoint metrics (IOM all , %ΔC all , and CSI all ) together, we ranked thermotolerance of the three coral species as follows: A. digitifera > A. millepora ≥ A. cf. tenuis . Table 1 Pairwise log-rank test among Acropora species with BH-corrected P- values ( Q- values). Group 1 Group 2 Q -value A. millepora A. digitifera < 0.001 A. cf. tenuis A. digitifera < 0.001 A. cf. tenuis A. millepora < 0.001 Thermotolerance classification of colonies Although IOM and %ΔC showed high correlation (Fig. S4), use of these metrics individually resulted in identification of differing numbers of heat tolerant and heat sensitive colonies. While IOM values showed limited variation due to the short duration of the experiment (Fig. S5 and Table S6), %ΔC reflected finer differences among colonies but tended to underestimate bleaching intensity (Fig. S6 and Table S7). Thus, we combined these metrics to address imbalanced grouping and the similarity of IOM rankings among colonies for each species. This merging resulted in a colony stress index (CSI), which was used to make an operational thermotolerance classification scheme. Using this classification scheme, the bottom 20% were categorized as thermosensitive and the top 20% as thermotolerant. This metric yielded the same number of thermotolerant and thermosensitive colonies per species (Fig. 1 C and Table S8). Symbiodiniaceae communities of Acropora species and individuals Out of 8,620,518 raw paired ITS2 sequences, 7,889,145 sequences (mean count of 83,044 ± 12,643) passed quality checking and were classified as Symbiodiniaceae (Fig. S7A). Rarefaction curves plateaued for all samples, confirming that sequencing effort was adequate to capture ITS2 sequence diversity and that comparisons among samples and groups were not biased by differences in sequencing depth (Fig. S7B). Eight defining intragenomic variants (DIVs) were observed, all affiliated with the genus Cladocopium . From these DIVs, four ITS2 type profiles dominated by ITS2 type C3u ( Cladocopium patulum ) were named: C3u-C3xu-C3-C115, C3u-C3xu-C3-C115-C3xv, C3u-C3-C115-C3xt, and C3/C3u-C115-C21ab-C3ge. Durusdinium sequences were also detected but at counts too low to be considered as DIVs (< 200 sequences) (Fig. S8, Table S9). Overall Symbiodiniaceae composition showed a weak correlation with Acropora thermotolerance. Distance-based redundancy analysis (dbRDA) showed a significant but weak relationship between photosymbiont community structure and thermotolerance parameters (F = 2.834, P = 0.0324), explaining only 5.80% of the variation (Fig. 2 A). Among the parameters, only IOM all correlated, albeit weakly, with photosymbiont composition (Table S10). CSI all was collinear with the other parameters and was removed from the analysis. Thermotolerance metrics showed no consistent differences when compared across ITS2 profiles in the combined dataset of all three acroporids, although IOM all , %ΔC all , and CSI all distributions were marginally skewed to the right for C3u-C3xu-C3-C115 and C3u-C3xu-C3-C115-C3xv compared to C3u-C3-C115-C3xt and C3/C3u-C115-C21ab-C3ge (Fig. 2 B, Table S11). This suggests that within the Bolinao-Anda Reef Complex, the ability to evaluate direct links between symbiont identity and thermotolerance is constrained by the predominance of highly similar Cladocopium patulum lineages. The composition and diversity of photosymbionts based on ITS2 type profiles did not differ across colonies of the three species. Each coral colony harbored only one dominant Cladocopium ITS2 sequence. Four ITS2 type profiles in total were observed across A. digitifera and A. millepora colonies, while only two were observed in A. cf. tenuis colonies (Fig. 3 A-C). C3u-C3xu-C3-C115 and C3u-C3xu-C3-C115-C3xv are closely related ITS2 type profiles found in all acroporid species examined. C3u-C3xu-C3-C115 was the most common, present in 16 A. digitifera , 21 A. millepora , and 18 A. cf. tenuis individuals, while C3u-C3xu-C3-C115-C3xv was found in eight A. digitifera , seven A. millepora , and seven A. cf. tenuis . ITS2 type profiles C3u-C3-C115-C3xt and C115-C21ab-C3ge were detected only in A. digitifera and A. millepora colonies but were more prevalent in the former species. C3u-C3-C115-C3xt was present in ten A . digitifera and one A . millepora individual, while C115-C21ab-C3ge was in six A . digitifera and one A . millepora individual. The composition of Symbiodiniaceae communities based on all ITS2 sequences differed among the three Acropora species (Tables 2 & S12, Figs. 3 A-C & S9A). Acropora digitifera exhibited more within-species variation and distinct ITS2 sequence distribution among colonies (Table 2 and Fig. 3 D). This pattern remained robust after controlling for unequal sample sizes (100 bootstrapped PERMANOVA and PERMDISP replicates; Tables S13-14 and Fig S10). Pairwise comparisons using a single representative iteration, defined as the resample with a pseudo-F statistic closest to the median, confirmed overall interspecific differences (Table S15; Fig. S10). There was no significant difference between A. digitifera and A. millepora , whereas both species differed significantly from A. cf. tenuis , which exhibited the most homogeneous symbiont communities. Table 2 PERMANOVA and PERMDISP results of weighted Unifrac of ITS2 sequences between high and low heat tolerance colonies and among Acropora species (9,999 permutations). PERMANOVA PERMDISP R 2 F P -value/ Q -value F P -value/ Q -value High vs low heat tolerance A. digitifera 0.0374 0.545 0.581 0.179 0.664 A. millepora 0.0398 0.414 0.871 0.562 0.613 A. cf. tenuis 0.551 9.83 0.0152 2.06 0.175 Interspecific All 0.222 13.1 < 0.001 14.1 < 0.001 A. digitifera - A. millepora 0.0999 7.55 0.004 3.30 0.001 A. digitifera - A. cf. tenuis 0.260 22.1 < 0.001 5.36 < 0.001 A. millepora - A. cf. tenuis 0.142 8.74 < 0.001 1.50 0.143 No clear patterns in Symbiodiniaceae community composition could be discerned between thermotolerant and thermosensitive individuals of each species. Based on ITS2 type profiles and ITS2 sequences, only A. cf. tenuis showed segregation of symbionts with thermotolerance, with strain C3u-C3xu-C3-C115 present in all thermotolerant colonies (5 out of 5) and C3u-C3xu-C3-C115-C3xv present in 80% of thermosensitive individuals (4 out of 5) (Fig. 4 A). This pattern was corroborated by significant compositional differences in ITS2 sequences between thermotolerant and thermosensitive A. cf. tenuis colonies (Fig. 4 B, S9B-D, and Table 2 ). However, these two closely related strains were also distributed across colonies of A. digitifera and A. millepora with varying thermotolerance characteristics. Moreover, Durusdinium sequences did not correlate with a thermotolerant phenotype in the acroporids, as these were detected mostly in colonies with intermediate tolerance (Fig. S11). Discussion Thermotolerance varies among and within species Short-term thermal stress assays revealed differences in thermotolerance among Acropora species and among individuals within each species. Our results were consistent with previous observations on corals from the same site (Da-Anoy et al. 2019 ), with A. digitifera as most thermotolerant, followed by A. millepora , and A. cf. tenuis as most thermosensitive. Our findings differ from surveys on the Great Barrier Reef from 2015–2016, which showed A. tenuis (currently recognized as A. kenti ) (Bridge et al. 2024 ) as most thermotolerant, followed by A. millepora , and A. digitifera as thermosensitive (Hoogenboom et al. 2017 ). Thermotolerance also varied among individual colonies within each species, mirroring observations in A. digitifera from Palau (Humanes et al. 2022 ; Lachs et al. 2023 ; Humanes et al. 2024 )d cf. tenuis from the Philippines (Baquiran et al. 2025 ). Reports of high inter-colony phenotypic variation among A. millepora from the Great Barrier Reef and A. cervicornis from Florida Keys also support this observation (Granados-Cifuentes et al. 2013 ; Million et al. 2022 ). However, given recent taxonomic revisions within genus Acropora (Bridge et al. 2024 ), these comparisons must be interpreted with caution, as some populations may indeed represent different species. In our study, species identification was based on in situ observations of colony morphology, and genetic confirmation was not conducted. Differences in thermotolerance among and within Acropora species on a single reef highlight the presence of substantial trait diversity among these corals. Such trait diversity likely reflects multiple underlying mechanisms that vary across taxa or individuals, including antioxidants and stress enzymes (Fitt et al. 2009 ; Diaz et al. 2016 ; Seveso et al. 2020 ), host morphology (Loya et al. 2001 ; Jimenez et al. 2011 ; Smith et al. 2017 ), and heterotrophy (Grottoli et al. 2018 ; Conti-Jerpe et al. 2020 ). For example, relatively thermotolerant species such as Favites colemani and Montipora digitata possess expanded antioxidant protein families and chaperones compared to more sensitive taxa (Da-Anoy et al. 2019 ; Da-Anoy et al. 2024 ). Similarly, interspecific differences in the expression of heat-shock proteins were observed in Goniopora lobata , P. lobata , Seriatopora hystrix and Stylophora pistillata (Seveso et al. 2020 ). Morphology and trophic traits also play a role, with finely branched corals tending to bleach more readily than encrusting corals (Loya et al. 2001 ), and species with greater heterotrophic flexibility generally exhibiting greater resilience (Conti-Jerpe et al. 2020 ). Taken together, our findings emphasize that interspecific variation in thermotolerance mirrors distinct ecological and physiological strategies among Acropora species. High inter-colony variation within species provides a reservoir of resilient individuals that offer multiple avenues for adaptation. This diversity drives tolerance to heat stress and suggests that conservation and restoration strategies could benefit from harnessing both species- and colony-level variation to buffer reefs against the looming changes in climate (van Oppen et al. 2015 ). Photosymbiont community in acroporids Symbiodiniaceae communities in acroporids from the BARC were dominated by genus Cladocopium , with four putative strains of C. patulum (formerly referred to as ITS2 type C3u) (Butler et al. 2023 ), C3/C3u-C115-C21ab-C3g3, C3u-C3-C115-C3xt, C3u-C3xu-C3-C115, and C3u-C3xu-C3-C115-C3xv. Cladocopium patulum has been reported in corals of the Western Indian Ocean (LaJeunesse et al. 2010 ; Chauka 2012 ; Chauka et al. 2016 ), Palau (Butler et al. 2023 ; Lewis et al. 2024 ), and in the South China Sea (SCS) (Ravelo and Conaco 2018 ; Da-Anoy et al. 2019 ; Chen et al. 2020 ; Torres et al. 2021 ). C. patulum is present in corals from the warmer southern SCS, including the Gulf of Thailand (Chankong et al. 2020 ), Singapore (Smith et al. 2020 ), Vietnam (Amid et al. 2018 ; Sikorskaya et al. 2022 ), and Malaysia (Lee et al. 2022 ; Rabbani et al. 2025 ), but is rarely found in corals of the cooler northern SCS (Chen et al. 2019 ; Qin et al. 2019 ). The prevalence of Cladocopium patulum in warmer waters of the SCS indicates a potential role in coral thermotolerance. C. patulum was detected in A. hyacinthus colonies from a reef in Hainan Island with relatively high seawater temperatures and nitrate concentrations (Li et al. 2024 ). This symbiont was also dominant in corals in the Huangyan Reef (Bajo de Masinloc), an atoll in the central SCS characterized by elevated sea surface temperatures (Chen et al. 2024 ). The high prevalence of C. patulum in SCS reefs may partly explain the observed thermotolerance of Acropora in the region. This species expresses a lipidome profile similar to Durusdinium trenchii (Sikorskaya et al. 2022 ), suggesting that it may exhibit comparable thermotolerance traits. In contrast, at Passu Keah, an atoll in the central SCS, A. formosa from the warmer inner lagoon harbored fewer C. patulum compared to those from the cooler outer reef (Qin et al. 2021 ). This suggests that presence or an increase in abundance of C. patulum may also be influenced by other environmental factors. Cladocopium patulum is a host generalist (LaJeunesse et al. 2010 ; Butler et al. 2023 ) abundant in environmental samples from the South China Sea (Lin et al. 2024 ). C. patulum likely accumulates in corals that acquire their symbionts from the environment. This symbiont has been detected in Acropora , but not in Pocillopora , Seriatopora , Stylophora , and Porites corals, which are known to vertically transmit photosymbionts (Ravelo and Conaco 2018 ; Da-Anoy et al. 2019 ; Torres et al. 2021 ). This pattern parallels the dominance of C. madreporum , another host generalist, in Palauan corals that also acquire photosymbionts through horizontal transmission (Butler et al. 2023 ; Lewis et al. 2024 ). In the BARC, Acropora are dominated by C. patulum , suggesting that horizontal acquisition may facilitate establishment of this symbiont. The BARC has experienced several mass bleaching events. While acroporids suffered high mortality during the 1983 and 1998 events (Yap et al. 1992 ; Arceo et al. 2001 ), they showed comparatively lower bleaching prevalence than other coral taxa in 2016 (Quimpo et al. 2020 ). Although historical symbiont data are unavailable, the current dominance of C. patulum raises the possibility that its presence contributed to coral resilience in recent thermal stress events. This underscores the potential role of host-generalist Cladocopium species in enhancing heat tolerance across reefs. Comparison of ITS2 profiles of corals from other regions near the Coral Triangle, such as Palau ( C. madreporum ) and the Great Barrier Reef ( C. proliferum ), indicate that host-generalist Cladocopium species are widespread and may play similar functional roles across geographically distinct reefs (Butler et al. 2023 ; Lewis et al. 2024 ). Although largely observational, these patterns suggest that regional variation in Symbiodiniaceae composition could influence bleaching susceptibility and resilience. Further comparative studies will be necessary to test whether differences in ITS2 type profiles correspond with differences in bleaching outcomes across the Coral Triangle. Thermotolerance among Acropora shows weak correlation with photosymbiont composition Corals in the genus Acropora are particularly reliant on their photosymbionts to meet their energy demands and thus depend more heavily on autotrophy compared to other coral species (Conti-Jerpe et al. 2020 ). Prolonged exposure to stressors, such as abnormal temperature conditions, triggers expulsion of its photosymbionts, making Acropora especially vulnerable to warming ocean conditions. Although we observed clear inter-specific differences in thermotolerance, this was only weakly correlated with photosymbiont type. For instance, ITS2 type profiles C3/C3u-C115-C21ab-C3g3 and C3u-C3-C115-C3xt were more frequently detected in A. digitifera , which has relatively higher thermotolerance, though these same profiles also occurred in A. millepora . This suggests that symbiont identity alone cannot account for the observed inter-specific variation in heat resilience and that host biology likely plays a stronger role. Evidence from hybridization and selective breeding studies support this view. Hybrids of A. tenuis (thermosensitive) and A. loripes (thermotolerant) showed enhanced resilience compared to their sensitive parent (Chan et al. 2018 ), and offspring from thermotolerant A. digitifera parents exhibited greater thermotolerance than those from thermosensitive broodstock (Humanes et al. 2022 ; Humanes et al. 2024 ). These imply that thermotolerance traits have some level of heritability. Future studies integrating detailed holobiont phenotyping (e.g., photosynthetic efficiency, calcification, and nutrition) with genomic approaches will be crucial to disentangle the relative contributions of hosts and their symbionts to coral thermotolerance (Conti-Jerpe et al. 2020 ; Ros et al. 2020 ; Voolstra et al. 2020 ; Marzonie et al. 2024 ). While host traits are important, symbiont diversity and physiology may nevertheless play a role in thermotolerance. In our dataset, the two ITS2 type profiles noted in A. digitifera and A. millepora were absent in A. cf. tenuis , which could have influenced the response of the latter species to elevated temperatures. Thermally stressed Symbiodiniaceae produce excessive reactive oxygen species (ROS), one of the major drivers of coral bleaching (Warner et al. 1999 ; Tchernov et al. 2004 ; Wooldridge 2009 ; Wiedenmann et al. 2013 ; Rädecker et al. 2021 ; Wiedenmann et al. 2023 ; Marangon et al. 2025 ). Yet certain genotypes can effectively mitigate oxidative stress to maintain symbiosis under heat stress. For example, two genotypes from Cladocopium proliferum displayed divergent responses to elevated temperatures (Levin et al. 2016 ). The thermosensitive genotype suffered reduced photosynthetic efficiency and increased ROS, while the thermotolerant genotype upregulated ROS-scavenging and heat-shock protein genes. Subsequent studies have confirmed similar physiological divergence among these C. proliferum genotypes from the Great Barrier Reef (Howells et al. 2012 ; Beltrán et al. 2021 ; Butler et al. 2023 ), and among C15 genotypes of Porites spp. in Palau (Hoadley et al. 2021 ), indicating that even within a single Symbiodiniaceae species, functional responses to heat stress can vary. Thus, the absence of certain ITS2 type profiles in A. cf. tenuis could indicate the loss of potentially thermotolerant symbiont types, which may have contributed to its poorer thermal performance, underscoring the interplay between host traits and symbiont physiology. Thermotolerance of conspecifics does not correlate with photosymbionts The variation of thermotolerance among colonies of the same species did not show correlation with Symbiodiniaceae composition. Lack of clear correlation between inter-individual thermotolerance and algal symbiont communities has also been reported in A. digitifera from Palau (Humanes et al. 2022 ; Lachs et al. 2023 ; Humanes et al. 2024 ). These results imply that intra-specific thermotolerance variation in Acropora is not solely influenced by its photosymbionts. The disconnect between intra-specific thermotolerance and photosymbiont composition may be attributed to other colony-specific traits and environmental factors. Other sources of intra-specific variation in thermotolerance include morphology (Brown 1997 ; Enríquez et al. 2005 ; McWilliam et al. 2022 ), gene expression and epigenetics (Granados-Cifuentes et al. 2013 ; Devlin-Durante et al. 2016 ; Drury et al. 2022 ), age (Devlin-Durante et al. 2016 ), microhabitat (Nakamura and van Woesik 2001 ; Morikawa and Palumbi 2019 ), and microbiome (Glasl et al. 2016 ; Ziegler et al. 2017 ; Baquiran et al. 2025 ). Nevertheless, though photosymbiont profile was not the primary determinant of individual holobiont thermotolerance in our study, a specific photosymbiont strain may complement host traits, contributing to overall fitness under thermal stress. This pattern was observed in Okinawa, where unique combinations of Montipora capitata genotypes and Cladocopium strains explained intra-specific variation in thermotolerance (Kavousi et al. 2020 ). Overall, the observed ITS2 type profiles indicate that adaptive potential may not only arise from differences among host species or broad symbiont groups, but could also extend to genotypic variation within the same symbiont lineage. In the Bolinao-Anda Reef Complex, Acropora harbored four distinct C. patulum ITS2 type profiles, pointing to substantial intra-specific diversity within the local photosymbiont pool. Such diversity expands the possible host-symbiont pairings, each resulting in potentially distinct physiologies. Recognizing and harnessing both host and symbiont variation will be important for strategies aimed at enhancing coral persistence under climate change. There remain many gaps in our understanding of how host and symbiont traits interact to influence holobiont thermotolerance. To address these, we recommend standardizing taxonomic markers and integrating multi-omics approaches to improve species identification, functional characterization, and culturing methods. Culturing Symbiodiniaceae will also allow co-culture experiments with corals to verify the effects of Symbiodiniaceae on coral holobiont thermotolerance and help explain the processes underlying this intimate partnership. We recommend long-term co-culture experiments that assess the physiology of the holobiont, including both the host coral and its symbionts, the genetic makeup of its members and their responses to the environmental conditions. These studies will provide a deeper understanding of coral holobiont thermotolerance and inform strategies for reef conservation. Conclusions Here, we show that acroporid corals from the same reef area in northwestern Philippines are dominated by Cladocopium symbionts. Several putative strains of C. patulum were detected among the corals, with individual colonies each harboring a single ITS2 type profile. Interspecific and intraspecific differences in thermotolerance did not clearly correlate with symbiont composition. Collectively, our findings suggest that, while the diversity of symbionts associated with these acroporids represent functional diversity that may contribute to adaptation to warmer temperatures, variation in thermotolerance cannot be attributed solely to association with specific types of Symbiodiniaceae. Thus, further studies on taxonomic and functional diversity of Symbiodiniaceae and coral hosts, extending to other members of the holobiont (i.e., bacteria, archaea, fungi, other microeukaryotes, viruses) will greatly enhance our understanding of coral holobiont thermotolerance and could be harnessed to improve the tolerance of corals in the face of progressively warming oceans. Declarations Acknowledgements The authors thank Ben Jack Gabuay, Fernando Castrence Jr., and staff of the Bolinao Marine Laboratory for their invaluable assistance with the experiments. We thank the Marine Environment and Resources Foundation Inc. (MERF, Inc.) for project management support. Author contributions John Bennedick Quijano: Data curation; formal analysis; methodology; software; visualization; writing – original draft preparation; writing – review & editing. Jake Ivan P. Baquiran: Conceptualization; data curation; investigation; methodology; writing – review & editing. Madeleine J.H. van Oppen: Conceptualization; writing – original draft preparation; writing – review & editing. Patrick C. Cabaitan: Funding acquisition; writing – original draft preparation; writing – review & editing . Peter L. Harrison: Funding acquisition; writing – original draft preparation; writing – review & editing. Cecilia Conaco: Conceptualization; methodology; supervision; writing – original draft preparation; writing – review & editing. Funding This study was funded by a grant from the Department of Science and Technology – Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (QMSR-MRRD- MEC-295-1449) awarded to PCC and CC, and by the Australian Centre for International Agricultural Research (FIS/2019/123) awarded to PLH, MJHvO, PCC, and CC. Data availability The data files that support the findings of this study are available on Figshare: https://doi.org/10.6084/m9.figshare.28380719.v3. The R codes and documentation that support the analyses and findings of this study are available at GitHub: https://github.com/jbquijano/000_aten and Zenodo: https://doi.org/10.5281/zenodo.16410969. Conflict of Interest Disclosure The authors declare that they have no competing interests. References Abrego D, Ulstrup KE, Willis BL, van Oppen MJH (2008) Species–specific interactions between algal endosymbionts and coral hosts define their bleaching response to heat and light stress. Proc Biol Sci 275(1648):2273–2282. https://doi.org/10.1098/rspb.2008.0180 Amid C, Olstedt M, Gunnarsson JS, Le Lan H, Tran Thi Minh H, Van den Brink P, Hellström M, Tedengren M (2018) Additive effects of the herbicide glyphosate and elevated temperature on the branched coral Acropora formosa in Nha Trang, Vietnam. Environmental Science and Pollution Research 25:13360–13372 Anderson MJ (2017) Permutational Multivariate Analysis of Variance (PERMANOVA). In: Wiley StatsRef: Statistics Reference Online. John Wiley & Sons, Ltd, pp 1–15 Anderson MJ (2006) Distance-based tests for homogeneity of multivariate dispersions. Biometrics 62(1):245–253 Arceo HO, Quibilan MC, Aliño PM, Lim G, Licuanan WY (2001) Coral bleaching in Philippine reefs: coincident evidences with mesoscale thermal anomalies. Bulletin of Marine Science 69(2):579–593 Baedke J, Fábregas-Tejeda A, Nieves Delgado A (2020) The holobiont concept before Margulis. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 334(3):149–155. https://doi.org/10.1002/jez.b.22931 Baquiran JIP, Quijano JB, van Oppen MJH, Cabaitan PC, Harrison PL, Conaco C (2025) Microbiome Stability Is Linked to Acropora Coral Thermotolerance in Northwestern Philippines. Environmental Microbiology 27(2):e70041. https://doi.org/10.1111/1462-2920.70041 Beltrán VH, Puill-Stephan E, Howells E, Flores-Moya A, Doblin M, Núñez-Lara E, Escamilla V, López T, van Oppen MJH (2021) Physiological diversity among sympatric, conspecific endosymbionts of coral (Cladocopium C1acro) from the Great Barrier Reef. Coral Reefs 40(4):985–997. https://doi.org/10.1007/s00338-021-02092-z Berkelmans R, van Oppen MJH (2006) The role of zooxanthellae in the thermal tolerance of corals: a ‘nugget of hope’ for coral reefs in an era of climate change. Proc R Soc B 273(1599):2305–2312. https://doi.org/10.1098/rspb.2006.3567 Bray JR, Curtis JT (1957) An Ordination of the Upland Forest Communities of Southern Wisconsin. Ecological Monographs 27(4):325–349. https://doi.org/10.2307/1942268 Bridge TCL, Cowman PF, Quattrini AM, Bonito VE, Sinniger F, Harii S, Head CEI, Hung JY, Halafihi T, Rongo T, Baird AH (2024) A tenuis relationship: traditional taxonomy obscures systematics and biogeography of the ‘Acropora tenuis’ (Scleractinia: Acroporidae) species complex. Zoological Journal of the Linnean Society 202(1):zlad062. https://doi.org/10.1093/zoolinnean/zlad062 Brown BE (1997) Coral bleaching: causes and consequences. Coral Reefs 16(1):S129–S138. https://doi.org/10.1007/s003380050249 Butler CC, Turnham KE, Lewis AM, Nitschke MR, Warner ME, Kemp DW, Hoegh-Guldberg O, Fitt WK, van Oppen MJH, LaJeunesse TC (2023) Formal recognition of host-generalist species of dinoflagellate (Cladocopium, Symbiodiniaceae) mutualistic with Indo-Pacific reef corals. Journal of Phycology 59(4):698–711. https://doi.org/10.1111/jpy.13340 Cantin NE, van Oppen MJH, Willis BL, Mieog JC, Negri AP (2009) Juvenile corals can acquire more carbon from high-performance algal symbionts. Coral Reefs 28(2):405–414. https://doi.org/10.1007/s00338-009-0478-8 Chan WY, Peplow LM, Menéndez P, Hoffmann AA, van Oppen MJH (2018) Interspecific Hybridization May Provide Novel Opportunities for Coral Reef Restoration. Frontiers in Marine Science Volume 5-2018 Chankong A, Kongjandtre N, Senanan W, Manthachitra V (2020) Community composition of Symbiodiniaceae among four scleractinian corals in the eastern Gulf of Thailand. Regional Studies in Marine Science 33:100918. https://doi.org/10.1016/j.rsma.2019.100918 Chauka LJ (2012) Diversity of the symbiotic alga Symbiodinium in Tanzanian scleractinian corals. Western Indian Ocean Journal of Marine Science 11:67–76 Chauka LJ, Steinert G, Mtolera M (2016) Influence of local environmental conditions and bleaching histories on the diversity and distribution of Symbiodinium in reef-building corals in Tanzania. African Journal of Marine Science 38(1):57–64 Chen B, Wei Y, Yu K, Liang Y, Yu X, Liao Z, Qin Z, Xu L, Bao Z (2024) The microbiome dynamics and interaction of endosymbiotic Symbiodiniaceae and fungi are associated with thermal bleaching susceptibility of coral holobionts. Applied and Environmental Microbiology 90(4):e01939-23 Chen B, Yu K, Liang J, Huang W, Wang G, Su H, Qin Z, Huang X, Pan Z, Luo W, Luo Y, Wang Y (2019) Latitudinal Variation in the Molecular Diversity and Community Composition of Symbiodiniaceae in Coral From the South China Sea. Frontiers in Microbiology 10 Chen B, Yu K, Qin Z, Liang J, Wang G, Huang X, Wu Q, Jiang L (2020) Dispersal, genetic variation, and symbiont interaction network of heat-tolerant endosymbiont Durusdinium trenchii: Insights into the adaptive potential of coral to climate change. Science of the Total Environment 723:138026 Cinner JE, McClanahan TR, Graham NAJ, Daw TM, Maina J, Stead SM, Wamukota A, Brown K, Bodin Ö (2012) Vulnerability of coastal communities to key impacts of climate change on coral reef fisheries. Global Environmental Change 22(1):12–20. https://doi.org/10.1016/j.gloenvcha.2011.09.018 Coleman AW, Suarez A, Goff LJ (1994) MOLECULAR DELINEATION OF SPECIES AND SYNGENS IN VOLVOCACEAN GREEN ALGAE (CHLOROPHYTA). Journal of Phycology 30(1):80–90. https://doi.org/10.1111/j.0022-3646.1994.00080.x Conti-Jerpe IE, Thompson PD, Wong CWM, Oliveira NL, Duprey NN, Moynihan MA, Baker DM (2020) Trophic strategy and bleaching resistance in reef-building corals. Science Advances 6(15):eaaz5443 Cornwell B, Armstrong K, Walker NS, Lippert M, Nestor V, Golbuu Y, Palumbi SR (2021) Widespread variation in heat tolerance and symbiont load are associated with growth tradeoffs in the coral Acropora hyacinthus in Palau. Elife 10:e64790 Da-Anoy J, Posadas N, Conaco C (2024) Interspecies differences in the transcriptome response of corals to acute heat stress. PeerJ 12:e18627. https://doi.org/10.7717/peerj.18627 Da-Anoy JP, Cabaitan PC, Conaco C (2019) Species variability in the response to elevated temperature of select corals in north-western Philippines. Journal of the Marine Biological Association of the United Kingdom 99(6):1273–1279 D’Angelo C, Hume BCC, Burt J, Smith EG, Achterberg EP, Wiedenmann J (2015) Local adaptation constrains the distribution potential of heat-tolerant Symbiodinium from the Persian/Arabian Gulf. ISME J 9(12):2551–2560. https://doi.org/10.1038/ismej.2015.80 Denis H, Bay LK, Mocellin VJ, Naugle MS, Lecellier G, Purcell SW, Berteaux-Lecellier V, Howells EJ (2024) Thermal tolerance traits of individual corals are widely distributed across the Great Barrier Reef. Proceedings of the Royal Society B 291(2030):20240587 Devlin-Durante MK, Miller MW, Caribbean Acropora Research Group, Precht WF, Baums IB (2016) How old are you? Genet age estimates in a clonal animal. Molecular Ecology 25(22):5628–5646. https://doi.org/10.1111/mec.13865 Diaz JM, Hansel CM, Apprill A, Brighi C, Zhang T, Weber L, McNally S, Xun L (2016) Species-specific control of external superoxide levels by the coral holobiont during a natural bleaching event. Nature Communications 7(1):13801 Dizon RM, Edwards AJ, Gomez ED (2008) Comparison of three types of adhesives in attaching coral transplants to clam shell substrates. Aquatic Conservation: Marine and Freshwater Ecosystems 18(7):1140–1148. https://doi.org/10.1002/aqc.944 Dizon RM, Yap HT (2006) Effects of multiple perturbations on the survivorship of fragments of three coral species. Marine Pollution Bulletin 52(8):928–934. https://doi.org/10.1016/j.marpolbul.2005.12.009 Drury C, Bean NK, Harris CI, Hancock JR, Huckeba J, Roach TN, Quinn RA, Gates RD (2022) Intrapopulation adaptive variance supports thermal tolerance in a reef-building coral. Communications biology 5(1):486 Dunn OJ (1964) Multiple comparisons using rank sums. Technometrics 6(3):241–252 Eddy TD, Lam VWY, Reygondeau G, Cisneros-Montemayor AM, Greer K, Palomares MLD, Bruno JF, Ota Y, Cheung WWL (2021) Global decline in capacity of coral reefs to provide ecosystem services. One Earth 4(9):1278–1285. https://doi.org/10.1016/j.oneear.2021.08.016 Enríquez S, Méndez ER, ‐Prieto RI (2005) Multiple scattering on coral skeletons enhances light absorption by symbiotic algae. Limnology and Oceanography 50(4):1025–1032 Eren AM, Morrison HG, Lescault PJ, Reveillaud J, Vineis JH, Sogin ML (2015) Minimum entropy decomposition: Unsupervised oligotyping for sensitive partitioning of high-throughput marker gene sequences. ISME J 9(4):968–979. https://doi.org/10.1038/ismej.2014.195 Falkowski PG, Dubinsky Z, Muscatine L, Porter JW (1984) Light and the Bioenergetics of a Symbiotic Coral. BioScience 34(11):705–709. https://doi.org/10.2307/1309663 Fisher R, O’Leary RA, Low-Choy S, Mengersen K, Knowlton N, Brainard RE, Caley MJ (2015) Species Richness on Coral Reefs and the Pursuit of Convergent Global Estimates. Current Biology 25(4):500–505. https://doi.org/10.1016/j.cub.2014.12.022 Fitt W, Gates R, Hoegh-Guldberg O, Bythell J, Jatkar A, Grottoli A, Gomez M, Fisher P, Lajuenesse T, Pantos O, others (2009) Response of two species of Indo-Pacific corals, Porites cylindrica and Stylophora pistillata, to short-term thermal stress: The host does matter in determining the tolerance of corals to bleaching. Journal of experimental marine biology and ecology 373(2):102–110 Glasl B, Herndl GJ, Frade PR (2016) The microbiome of coral surface mucus has a key role in mediating holobiont health and survival upon disturbance. The ISME journal 10(9):2280–2292 Gong S, Xu L, Yu K, Zhang F, Li Z (2019) Differences in Symbiodiniaceae communities and photosynthesis following thermal bleaching of massive corals in the northern part of the South China Sea. Marine Pollution Bulletin 144:196–204. https://doi.org/10.1016/j.marpolbul.2019.04.069 Gower JC (2015) Principal Coordinates Analysis. In: Wiley StatsRef: Statistics Reference Online. pp 1–7 Granados-Cifuentes C, Bellantuono AJ, Ridgway T, Hoegh-Guldberg O, Rodriguez-Lanetty M (2013) High natural gene expression variation in the reef-building coral Acropora millepora: potential for acclimative and adaptive plasticity. BMC genomics 14:1–12 Grottoli AG, Martins PD, Wilkins MJ, Johnston MD, Warner ME, Cai W-J, Melman TF, Hoadley KD, Pettay DT, Levas S, Schoepf V (2018) Coral physiology and microbiome dynamics under combined warming and ocean acidification. PLOS ONE 13(1):e0191156. https://doi.org/10.1371/journal.pone.0191156 Handiani DN, Ningsih NS, Beliyana E (2025) Coral bleaching occurrence and its relation to marine heatwave events in the Southwestern waters of South Sulawesi, Indonesia, as part of the Coral Triangle region. Journal of Marine Systems 252:104136. https://doi.org/10.1016/j.jmarsys.2025.104136 Harrison PL, dela Cruz DW, Cameron KA, Cabaitan PC (2021) Increased Coral Larval Supply Enhances Recruitment for Coral and Fish Habitat Restoration. Frontiers in Marine Science Volume 8-2021 Hazraty-Kari S, Tavakoli-Kolour P, Kitanobo S, Nakamura T, Morita M (2022) Adaptations by the coral Acropora tenuis confer resilience to future thermal stress. Communications Biology 5(1):1371. https://doi.org/10.1038/s42003-022-04309-5 Hoadley KD, Pettay DT, Lewis A, Wham D, Grasso C, Smith R, Kemp DW, LaJeunesse T, Warner ME (2021) Different functional traits among closely related algal symbionts dictate stress endurance for vital Indo-Pacific reef-building corals. Global Change Biology 27(20):5295–5309 Hoegh-Guldberg O, Kennedy EV, Beyer HL, McClennen C, Possingham HP (2018) Securing a Long-term Future for Coral Reefs. Trends in Ecology & Evolution 33(12):936–944. https://doi.org/10.1016/j.tree.2018.09.006 Hoogenboom MO, Frank GE, Chase TJ, Jurriaans S, Álvarez-Noriega M, Peterson K, Critchell K, Berry KL, Nicolet KJ, Ramsby B, others (2017) Environmental drivers of variation in bleaching severity of Acropora species during an extreme thermal anomaly. Frontiers in Marine Science 4:376 Howells EJ, Beltran VH, Larsen NW, Bay LK, Willis BL, van Oppen MJH (2012) Coral thermal tolerance shaped by local adaptation of photosymbionts. Nature Clim Change 2(2):116–120. https://doi.org/10.1038/nclimate1330 Howlett L, Camp EF, Locatelli NS, Baums IB, Strudwick P, Rassmussen S, Suggett DJ (2024) Population and clonal structure of Acropora cf. hyacinthus to inform coral restoration practices on the Great Barrier Reef. Coral Reefs 43(4):1023–1035. https://doi.org/10.1007/s00338-024-02520-w Hughes TP, Anderson KD, Connolly SR, Heron SF, Kerry JT, Lough JM, Baird AH, Baum JK, Berumen ML, Bridge TC, Claar DC, Eakin CM, Gilmour JP, Graham NAJ, Harrison H, Hobbs J-PA, Hoey AS, Hoogenboom M, Lowe RJ, McCulloch MT, Pandolfi JM, Pratchett M, Schoepf V, Torda G, Wilson SK (2018) Spatial and temporal patterns of mass bleaching of corals in the Anthropocene. Science 359(6371):80–83. https://doi.org/10.1126/science.aan8048 Hughes TP, Barnes ML, Bellwood DR, Cinner JE, Cumming GS, Jackson JBC, Kleypas J, van de Leemput IA, Lough JM, Morrison TH, Palumbi SR, van Nes EH, Scheffer M (2017) Coral reefs in the Anthropocene. Nature 546(7656):82–90. https://doi.org/10.1038/nature22901 Humanes A, Lachs L, Beauchamp E, Bukurou L, Buzzoni D, Bythell J, Craggs JR, de la Torre Cerro R, Edwards AJ, Golbuu Y, others (2024) Selective breeding enhances coral heat tolerance to marine heatwaves. Nature Communications 15(1):8703 Humanes A, Lachs L, Beauchamp EA, Bythell JC, Edwards AJ, Golbuu Y, Martinez HM, Palmowski P, Treumann A, van der Steeg E, van Hooidonk R, Guest JR (2022) Within-population variability in coral heat tolerance indicates climate adaptation potential. Proceedings of the Royal Society B: Biological Sciences 289(1981):20220872. https://doi.org/10.1098/rspb.2022.0872 Hume BC, Smith EG, Ziegler M, Warrington HJ, Burt JA, LaJeunesse TC, Wiedenmann J, Voolstra CR (2019) SymPortal: A novel analytical framework and platform for coral algal symbiont next‐generation sequencing ITS2 profiling. Molecular ecology resources 19(4):1063–1080 Ip JC-H, Zhang Y, Xie JY, Yeung YH, Qiu J-W (2022) Stable Symbiodiniaceae composition in three coral species during the 2017 natural bleaching event in subtropical Hong Kong. Marine Pollution Bulletin 184:114224. https://doi.org/10.1016/j.marpolbul.2022.114224 Jimenez IM, Kühl M, Larkum AW, Ralph PJ (2011) Effects of flow and colony morphology on the thermal boundary layer of corals. Journal of The Royal Society Interface 8(65):1785–1795 Kaplan EL, Meier P (1958) Nonparametric Estimation from Incomplete Observations. Journal of the American Statistical Association 53(282):457–481. https://doi.org/10.2307/2281868 Kavousi J, Denis V, Sharp V, Reimer JD, Nakamura T, Parkinson JE (2020) Unique combinations of coral host and algal symbiont genotypes reflect intraspecific variation in heat stress responses among colonies of the reef-building coral, Montipora digitata. Marine Biology 167(2):23. https://doi.org/10.1007/s00227-019-3632-z Kemp DW, Hoadley KD, Lewis AM, Wham DC, Smith RT, Warner ME, LaJeunesse TC (2023) Thermotolerant coral–algal mutualisms maintain high rates of nutrient transfer while exposed to heat stress. Proceedings of the Royal Society B 290(2007):20231403 Kleypas JA, Castruccio FS, Curchitser EN, Mcleod E (2015) The impact of ENSO on coral heat stress in the western equatorial Pacific. Global Change Biology 21(7):2525–2539 Kruskal WH, Wallis WA (1952) Use of ranks in one-criterion variance analysis. Journal of the American statistical Association 47(260):583–621 Lachs L, Humanes A, Pygas DR, Bythell JC, Mumby PJ, Ferrari R, Figueira WF, Beauchamp E, East HK, Edwards AJ, Golbuu Y, Martinez HM, Sommer B, van der Steeg E, Guest JR (2023) No apparent trade-offs associated with heat tolerance in a reef-building coral. Communications Biology 6(1):400. https://doi.org/10.1038/s42003-023-04758-6 LaJeunesse TC (2002) Diversity and community structure of symbiotic dinoflagellates from Caribbean coral reefs. Marine biology 141:387–400 LaJeunesse TC, Pettay DT, Sampayo EM, Phongsuwan N, Brown B, Obura DO, Hoegh‐Guldberg O, Fitt WK (2010) Long‐standing environmental conditions, geographic isolation and host–symbiont specificity influence the relative ecological dominance and genetic diversification of coral endosymbionts in the genus Symbiodinium. Journal of Biogeography 37(5):785–800 Lee LK, Leaw CP, Lee LC, Lim ZF, Hii KS, Chan AA, Gu H, Lim PT (2022) Molecular diversity and assemblages of coral symbionts (Symbiodiniaceae) in diverse scleractinian coral species. Marine Environmental Research 179:105706. https://doi.org/10.1016/j.marenvres.2022.105706 Legendre P, Anderson MJ (1999) DISTANCE-BASED REDUNDANCY ANALYSIS: TESTING MULTISPECIES RESPONSES IN MULTIFACTORIAL ECOLOGICAL EXPERIMENTS. Ecological Monographs 69(1):1–24. https://doi.org/10.1890/0012-9615(1999)069%255B0001:DBRATM%255D2.0.CO;2 Levin RA, Beltran VH, Hill R, Kjelleberg S, McDougald D, Steinberg PD, van Oppen MJH (2016) Sex, Scavengers, and Chaperones: Transcriptome Secrets of Divergent Symbiodinium Thermal Tolerances. Molecular Biology and Evolution 33(9):2201–2215. https://doi.org/10.1093/molbev/msw119 Lewis AM, Butler CC, Turnham KE, Wham DF, Hoadley KD, Smith RT, Kemp DW, Warner ME, LaJeunesse TC (2024) The diversity, distribution, and temporal stability of coral ‘zooxanthellae’on a pacific reef: from the scale of individual colonies to across the host community. Coral Reefs 43(4):841–856 Li Y, Chen R-W, Liu X, Li Z, Zhu W, Wang A, Li X (2024) The adaptation of three scleractinian corals from the perspectives of Symbiodiniaceae and photosynthesis capacity at Luhuitou fringing reef. Marine Biology 171(8):151. https://doi.org/10.1007/s00227-024-04472-9 Lin S, Li L, Zhou Z, Yuan H, Saad OS, Tang J, Cai W, Yu K, Lin S (2024) Higher genotypic diversity and distinct assembly mechanism of free-living Symbiodiniaceae assemblages than sympatric coral-endosymbiotic assemblages in a tropical coral reef. Microbiology Spectrum 12(8):e00514-24. https://doi.org/10.1128/spectrum.00514-24 Loya Y, Sakai K, Yamazato K, Nakano Y, Sambali H, van Woesik R (2001) Coral bleaching: the winners and the losers. Ecology Letters 4(2):122–131. https://doi.org/10.1046/j.1461-0248.2001.00203.x Lozupone CA, Hamady M, Kelley ST, Knight R (2007) Quantitative and qualitative β diversity measures lead to different insights into factors that structure microbial communities. Applied and environmental microbiology 73(5):1576–1585 Marangon E, Rädecker N, Li JYQ, Terzin M, Buerger P, Webster NS, Bourne DG, Laffy PW (2025) Destabilization of mutualistic interactions shapes the early heat stress response of the coral holobiont. Microbiome 13(1):31. https://doi.org/10.1186/s40168-024-02006-5 Martinez Arbizu P (2020) pairwiseAdonis: Pairwise multilevel comparison using adonis. R package version 04 1 Marzonie MR, Nitschke MR, Bay LK, Bourne DG, Harrison HB (2024) Symbiodiniaceae diversity varies by host and environment across thermally distinct reefs. Molecular Ecology 33(9):e17342. https://doi.org/10.1111/mec.17342 Mclachlan R, Grottoli AG (2021) Image Analysis to Quantify Coral Bleaching Using Greyscale Model. protocols.io. https://doi.org/dx.doi.org/10.17504/protocols.io.bx8wprxe McLeod E, Moffitt R, Timmermann A, Salm R, Menviel L, Palmer MJ, Selig ER, Casey KS, Bruno JF (2010) Warming seas in the coral triangle: coral reef vulnerability and management implications. Coastal Management 38(5):518–539 McWilliam M, Madin JS, Chase TJ, Hoogenboom MO, Bridge TCL (2022) Intraspecific variation reshapes coral assemblages under elevated temperature and acidity. Ecology Letters 25(11):2513–2524. https://doi.org/10.1111/ele.14114 Mellin C, Brown S, Cantin N, Klein-Salas E, Mouillot D, Heron SF, Fordham DA (2024) Cumulative risk of future bleaching for the world’s coral reefs. Science Advances 10(26):eadn9660. https://doi.org/10.1126/sciadv.adn9660 Million WC, Ruggeri M, O’Donnell S, Bartels E, Conn T, Krediet CJ, Kenkel CD (2022) Evidence for adaptive morphological plasticity in the Caribbean coral, Acropora cervicornis. Proceedings of the National Academy of Sciences 119(49):e2203925119. https://doi.org/10.1073/pnas.2203925119 Morikawa MK, Palumbi SR (2019) Using naturally occurring climate resilient corals to construct bleaching-resistant nurseries. Proceedings of the National Academy of Sciences 116(21):10586–10591 Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8(19):4321–4325. https://doi.org/10.1093/nar/8.19.4321 Nakamura T, van Woesik R (2001) Water-flow rates and passive diffusion partially explain differential survival of corals during the 1998 bleaching event. Mar Ecol Prog Ser 212:301–304 Naugle MS, Denis H, Mocellin VJ, Laffy PW, Popovic I, Bay LK, Howells EJ (2024) Heat tolerance varies considerably within a reef-building coral species on the Great Barrier Reef. Communications earth & environment 5(1):525 Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin P, O’Hara R, Simpson G, Solymos P (2022) vegan: Community Ecology Package. R package version 2.5–7. 2020 Oliver ECJ, Burrows MT, Donat MG, Sen Gupta A, Alexander LV, Perkins-Kirkpatrick SE, Benthuysen JA, Hobday AJ, Holbrook NJ, Moore PJ, Thomsen MS, Wernberg T, Smale DA (2019) Projected Marine Heatwaves in the 21st Century and the Potential for Ecological Impact. Frontiers in Marine Science Volume 6-2019. https://doi.org/10.3389/fmars.2019.00734 Palacio-Castro AM, Smith TB, Brandtneris V, Snyder GA, van Hooidonk R, Maté JL, Manzello D, Glynn PW, Fong P, Baker AC (2023) Increased dominance of heat-tolerant symbionts creates resilient coral reefs in near-term ocean warming. Proceedings of the National Academy of Sciences 120(8):e2202388120. https://doi.org/10.1073/pnas.2202388120 Peñaflor EL, Skirving WJ, Strong AE, Heron SF, David LT (2009) Sea-surface temperature and thermal stress in the Coral Triangle over the past two decades. Coral Reefs 28(4):841. https://doi.org/10.1007/s00338-009-0522-8 Posit team (2025) RStudio: Integrated Development Environment for R. Posit Software, PBC, Boston, MA Qin Z, Yu K, Chen B, Wang Y, Liang J, Luo W, Xu L, Huang X (2019) Diversity of Symbiodiniaceae in 15 Coral Species From the Southern South China Sea: Potential Relationship With Coral Thermal Adaptability. Frontiers in Microbiology Volume 10-2019 Qin Z, Yu K, Chen S, Chen B, Liang J, Yao Q, Yu X, Liao Z, Deng C, Liang Y (2021) Microbiome of juvenile corals in the outer reef slope and lagoon of the South China Sea: insight into coral acclimatization to extreme thermal environments. Environmental Microbiology 23(8):4389–4404. https://doi.org/10.1111/1462-2920.15624 Quimpo TJR, Requilme JNC, Gomez EJ, Sayco SLG, Tolentino MPS, Cabaitan PC (2020) Low coral bleaching prevalence at the Bolinao-Anda Reef Complex, northwestern Philippines during the 2016 thermal stress event. Marine Pollution Bulletin 160:111567. https://doi.org/10.1016/j.marpolbul.2020.111567 R Core Team (2023) R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria Rabbani G, Afiq-Rosli L, Lee JN, Waheed Z, Wainwright BJ (2025) Effects of life history strategy on the diversity and composition of the coral holobiont communities of Sabah, Malaysia. Scientific Reports 15(1):4459 Rädecker N, Pogoreutz C, Gegner HM, Cárdenas A, Roth F, Bougoure J, Guagliardo P, Wild C, Pernice M, Raina J-B, Meibom A, Voolstra CR (2021) Heat stress destabilizes symbiotic nutrient cycling in corals. Proceedings of the National Academy of Sciences 118(5):e2022653118. https://doi.org/10.1073/pnas.2022653118 Ravelo SF, Conaco C (2018) Comparison of the response of in hospite and ex hospite Symbiodinium to elevated temperature. Marine and Freshwater Behaviour and Physiology 51(2):93–108 Ros M, Camp EF, Hughes DJ, Crosswell JR, Warner ME, Leggat WP, Suggett DJ (2020) Unlocking the black-box of inorganic carbon-uptake and utilization strategies among coral endosymbionts (Symbiodiniaceae). Limnology and Oceanography 65(8):1747–1763 Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, Connor R, Funk K, Kelly C, Kim S, Madej T, Marchler-Bauer A, Lanczycki C, Lathrop S, Lu Z, Thibaud-Nissen F, Murphy T, Phan L, Skripchenko Y, Tse T, Wang J, Williams R, Trawick BW, Pruitt KD, Sherry ST (2022) Database resources of the national center for biotechnology information. Nucleic Acids Research 50(D1):D20–D26. https://doi.org/10.1093/nar/gkab1112 Schloerke B, Crowley J, Cook D (2018) Package ‘ggally.’ Extension to ‘ggplot2 713 Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF (2009) Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities. Applied and Environmental Microbiology 75(23):7537–7541. https://doi.org/10.1128/AEM.01541-09 Seveso D, Arrigoni R, Montano S, Maggioni D, Orlandi I, Berumen ML, Galli P, Vai M (2020) Investigating the heat shock protein response involved in coral bleaching across scleractinian species in the central Red Sea. Coral Reefs 39:85–98 Shah S, Dougan KE, Bhattacharya D, Chan CX (2022) Coral Conservation from the Genomic Perspective on Symbiodiniaceae Diversity and Function in the Holobiont. In: van Oppen MJH, Aranda Lastra M (eds) Coral Reef Conservation and Restoration in the Omics Age. Springer International Publishing, Cham, pp 85–96 Siebeck UE, Marshall NJ, Klüter A, Hoegh-Guldberg O (2006) Monitoring coral bleaching using a colour reference card. Coral Reefs 25(3):453–460. https://doi.org/10.1007/s00338-006-0123-8 Sikorskaya TV, Ermolenko EV, Efimova KV, Dang LTP (2022) Coral Holobionts Possess Distinct Lipid Profiles That May Be Shaped by Symbiodiniaceae Taxonomy. Marine Drugs 20(8):485. https://doi.org/10.3390/md20080485 Smith EG, Gurskaya A, Hume BC, Voolstra CR, Todd PA, Bauman AG, Burt JA (2020) Low Symbiodiniaceae diversity in a turbid marginal reef environment. Coral Reefs 39(3):545–553 Smith H, Epstein H, Torda G (2017) The molecular basis of differential morphology and bleaching thresholds in two morphs of the coral Pocillopora acuta. Scientific Reports 7(1):10066 Stat M, Bird CE, Pochon X, Chasqui L, Chauka LJ, Concepcion GT, Logan D, Takabayashi M, Toonen RJ, Gates RD (2011) Variation in Symbiodinium ITS2 Sequence Assemblages among Coral Colonies. PLOS ONE 6(1):e15854. https://doi.org/10.1371/journal.pone.0015854 Tchernov D, Gorbunov MY, de Vargas C, Narayan Yadav S, Milligan AJ, Häggblom M, Falkowski PG (2004) Membrane lipids of symbiotic algae are diagnostic of sensitivity to thermal bleaching in corals. Proceedings of the National Academy of Sciences 101(37):13531–13535. https://doi.org/10.1073/pnas.0402907101 Torres AF, Valino DAM, Ravago-Gotanco R (2021) Zooxanthellae Diversity and Coral-Symbiont Associations in the Philippine Archipelago: Specificity and Adaptability Across Thermal Gradients. Frontiers in Marine Science 8 Trench R (1993) Microalgal-invertebrate Ssmbioses-a review. Endocyt Cell Res 9:135–175 Turnham KE, Aschaffenburg MD, Pettay DT, Paz-García DA, Reyes-Bonilla H, Pinzón J, Timmins E, Smith RT, McGinley MP, Warner ME, LaJeunesse TC (2023) High physiological function for corals with thermally tolerant, host-adapted symbionts. Proceedings of the Royal Society B: Biological Sciences 290(2003):20231021. https://doi.org/10.1098/rspb.2023.1021 van Oppen MJH, Nitschke MR (2022) Increasing Coral Thermal Bleaching Tolerance via the Manipulation of Associated Microbes. In: van Oppen MJH, Aranda Lastra M (eds) Coral Reef Conservation and Restoration in the Omics Age. Springer International Publishing, Cham, pp 117–133 van Oppen MJH, Oliver JK, Putnam HM, Gates RD (2015) Building coral reef resilience through assisted evolution. Proceedings of the National Academy of Sciences 112(8):2307–2313. https://doi.org/10.1073/pnas.1422301112 Voolstra CR, Buitrago-López C, Perna G, Cárdenas A, Hume BC, Rädecker N, Barshis DJ (2020) Standardized short-term acute heat stress assays resolve historical differences in coral thermotolerance across microhabitat reef sites. Global Change Biology 26(8):4328–4343 Voolstra CR, Suggett DJ, Peixoto RS, Parkinson JE, Quigley KM, Silveira CB, Sweet M, Muller EM, Barshis DJ, Bourne DG, Aranda M (2021) Extending the natural adaptive capacity of coral holobionts. Nat Rev Earth Environ 2(11):747–762. https://doi.org/10.1038/s43017-021-00214-3 Wall CB, Kaluhiokalani M, Popp BN, Donahue MJ, Gates RD (2020) Divergent symbiont communities determine the physiology and nutrition of a reef coral across a light-availability gradient. ISME J 14(4):945–958. https://doi.org/10.1038/s41396-019-0570-1 Warner ME, Fitt WK, Schmidt GW (1999) Damage to photosystem II in symbiotic dinoflagellates: A determinant of coral bleaching. Proceedings of the National Academy of Sciences 96(14):8007–8012. https://doi.org/10.1073/pnas.96.14.8007 Wickham H, Averick M, Bryan J, Chang W, McGowan LD, François R, Grolemund G, Hayes A, Henry L, Hester J, Kuhn M, Pedersen TL, Miller E, Bache SM, Müller K, Ooms J, Robinson D, Seidel DP, Spinu V, Takahashi K, Vaughan D, Wilke C, Woo K, Yutani H (2019) Welcome to the tidyverse. Journal of Open Source Software 4(43):1686. https://doi.org/10.21105/joss.01686 Wiedenmann J, D’Angelo C, Mardones ML, Moore S, Benkwitt CE, Graham NAJ, Hambach B, Wilson PA, Vanstone J, Eyal G, Ben-Zvi O, Loya Y, Genin A (2023) Reef-building corals farm and feed on their photosynthetic symbionts. Nature 620(7976):1018–1024. https://doi.org/10.1038/s41586-023-06442-5 Wiedenmann J, D’Angelo C, Smith EG, Hunt AN, Legiret F-E, Postle AD, Achterberg EP (2013) Nutrient enrichment can increase the susceptibility of reef corals to bleaching. Nature Climate Change 3(2):160–164 Wooldridge SA (2009) A new conceptual model for the warm-water breakdown of the coral–algae endosymbiosis. Marine & Freshwater Research 60(6):483–496. https://doi.org/10.1071/MF08251 Yap HT, Alino PM, Gomez ED (1992) Trends in growth and mortality of three coral species(Anthozoa: Scleractinia), including effects of transplantation. Marine ecology progress series Oldendorf 83(1):91–101 Ziegler M, Seneca FO, Yum LK, Palumbi SR, Voolstra CR (2017) Bacterial community dynamics are linked to patterns of coral heat tolerance. Nature Communications 8(1):14213. https://doi.org/10.1038/ncomms14213 Additional Declarations No competing interests reported. Supplementary Files 000acroSupplementaryfigures20260126.docx 000acroSupplementarytables20260126.xlsx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 06 Apr, 2026 Reviews received at journal 01 Apr, 2026 Reviews received at journal 01 Apr, 2026 Reviewers agreed at journal 03 Mar, 2026 Reviewers agreed at journal 02 Mar, 2026 Reviewers invited by journal 01 Mar, 2026 Editor assigned by journal 13 Feb, 2026 Submission checks completed at journal 12 Feb, 2026 First submitted to journal 10 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8838536","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":600298034,"identity":"3b635752-58bd-4614-89aa-acb217b46634","order_by":0,"name":"John Bennedick Quijano","email":"","orcid":"","institution":"University of the Philippines Diliman","correspondingAuthor":false,"prefix":"","firstName":"John","middleName":"Bennedick","lastName":"Quijano","suffix":""},{"id":600298035,"identity":"934b895a-41e0-46a2-804d-39cf01047380","order_by":1,"name":"Jake Ivan P. Baquiran","email":"","orcid":"","institution":"University of the Philippines Diliman","correspondingAuthor":false,"prefix":"","firstName":"Jake","middleName":"Ivan P.","lastName":"Baquiran","suffix":""},{"id":600298036,"identity":"c42153d8-c39b-4af0-809e-0a15e63a52e3","order_by":2,"name":"Madeleine J. H. van Oppen","email":"","orcid":"","institution":"Australian Institute of Marine Science","correspondingAuthor":false,"prefix":"","firstName":"Madeleine","middleName":"J. H. van","lastName":"Oppen","suffix":""},{"id":600298037,"identity":"ee9fb959-4acf-47ee-ba7f-bf17b12ca6f4","order_by":3,"name":"Patrick C. Cabaitan","email":"","orcid":"","institution":"University of the Philippines Diliman","correspondingAuthor":false,"prefix":"","firstName":"Patrick","middleName":"C.","lastName":"Cabaitan","suffix":""},{"id":600298038,"identity":"a16722bf-01d9-4a16-a2e2-a2c0d2a54236","order_by":4,"name":"Peter L. Harrison","email":"","orcid":"","institution":"Southern Cross University","correspondingAuthor":false,"prefix":"","firstName":"Peter","middleName":"L.","lastName":"Harrison","suffix":""},{"id":600298039,"identity":"412b32b9-09c3-4031-82a7-656c7aab2717","order_by":5,"name":"Cecilia Conaco","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBADOQYGxgYgzQzECVA2AWBMupZEqBoitPC3Hz724EeNTfra/sMNzLw7rBn42XMMmAt34NYicSYt3bDnWFruthuJQC1n0hkke94YMM88g1uLgQSPmQRvw2GgFkaglrbDDAY3gLbwtuHXIvm34XC62fmDEC32xGiRBtqSYHYgEWqLBAEtQL+kScscSzME+eXg3DPpPBJnnhUcnolHCyjEJN/U2MibnT/+8MHbHdZy/O3JGx8X4tGCAg4Ao4MHxDhMpAYGRAwyE69lFIyCUTAKRgAAAO6uTnWqiwdsAAAAAElFTkSuQmCC","orcid":"","institution":"University of the Philippines Diliman","correspondingAuthor":true,"prefix":"","firstName":"Cecilia","middleName":"","lastName":"Conaco","suffix":""}],"badges":[],"createdAt":"2026-02-10 08:41:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8838536/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8838536/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104042943,"identity":"fb3971b7-eb70-48f0-bf78-2ea5037838f9","added_by":"auto","created_at":"2026-03-06 05:25:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":220357,"visible":true,"origin":"","legend":"\u003cp\u003eInterspecific and intraspecific variation of thermotolerance in \u003cem\u003eAcropora\u003c/em\u003e. (\u003cstrong\u003ea\u003c/strong\u003e) Survival probabilities of corals subjected to 33°C over time. Line colors represent the different species (\u003cem\u003eA. digitifera\u003c/em\u003e, black; \u003cem\u003eA. millepora\u003c/em\u003e, red; \u003cem\u003eA. cf. tenuis\u003c/em\u003e, yellow). The background color gradient indicates the temperature at each stage of the experiment.\u0026nbsp; The experiment was terminated at day 10 for \u003cem\u003eA. millepora\u003c/em\u003e and \u003cem\u003eA. \u003c/em\u003ecf. \u003cem\u003etenuis\u003c/em\u003e, and at day 13 for \u003cem\u003eA. digitifera\u003c/em\u003e. Statistical differences in survival among species were assessed using the log-rank test. The inset shows representative images of coral fragments from each species (scale bar, 1 cm). (\u003cstrong\u003eb\u003c/strong\u003e) Min-max normalized incidence of mortality (IOM\u003csub\u003eall\u003c/sub\u003e), min-max normalized percent color change (%ΔC\u003csub\u003eall\u003c/sub\u003e), and colony stress index (CSI\u003csub\u003eall\u003c/sub\u003e) at day 10 for all species. Big circles represent median values. Statistical differences in thermotolerance metrics among species were determined using Kruskal-Wallis test. Letters to the right of median values indicate significant differences among groups (\u003cem\u003eP\u003c/em\u003e-value\u003cem\u003e \u003c/em\u003e≤ 0.05) based on Dunn’s test with Benjamini-Hochberg correction. (\u003cstrong\u003ec\u003c/strong\u003e) Ranking of colonies based on CSI\u003csub\u003eall\u003c/sub\u003e (big circles). Colors represent thermotolerance classifications (red, thermotolerant; grey, intermediate; blue, thermosensitive). Bars represent IOM\u003csub\u003eall\u003c/sub\u003e and small circles represent %ΔC\u003csub\u003eall\u003c/sub\u003e.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/5c35013a6d39dcfdb99579f0.png"},{"id":104042941,"identity":"73aa1656-8569-4d0a-8552-2f6a1211bb75","added_by":"auto","created_at":"2026-03-06 05:25:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":122376,"visible":true,"origin":"","legend":"\u003cp\u003eSymbiodiniaceae composition and \u003cem\u003eAcropora\u003c/em\u003ethermotolerance. (\u003cstrong\u003ea\u003c/strong\u003e) Distance-based redundancy analysis (dbRDA) shows correlation between ITS2 sequence composition (colored by ITS2 profile) and thermotolerance parameters. Black arrow indicates significant correlation with ITS2 sequence composition. (\u003cstrong\u003eb\u003c/strong\u003e) Distribution of thermotolerance parameter values across ITS2 profiles. Big circles indicate median values. Statistical differences in thermotolerance metrics among ITS2 type profiles were determined using Kruskal-Wallis test.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/6415eedfb471331dd0b98761.png"},{"id":104042925,"identity":"ef084142-75bb-467e-a97e-c0ff72d2021a","added_by":"auto","created_at":"2026-03-06 05:25:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":235662,"visible":true,"origin":"","legend":"\u003cp\u003eSymbiodiniaceae composition of (\u003cstrong\u003ea\u003c/strong\u003e) \u003cem\u003eAcropora digitifera\u003c/em\u003e, (\u003cstrong\u003eb\u003c/strong\u003e) \u003cem\u003eA. millepora\u003c/em\u003e and (\u003cstrong\u003ec\u003c/strong\u003e) \u003cem\u003eA.\u003c/em\u003e cf.\u003cem\u003e tenuis\u003c/em\u003e colonies. Heatmap colors represent square root-transformed counts of ITS2 sequences in coral colonies. Histograms to the right of each heatmap represent total ITS2 sequence counts. The color bar on top of each heatmap denotes relative abundance of ITS2 type profiles. The dendrogram beside the ITS2 profile legend depicts similarity among ITS2 profiles based on weighted Unifrac. Colony IDs in bold indicate presence of \u003cem\u003eDurusdinium\u003c/em\u003e-related ITS2 sequences. (\u003cstrong\u003ed\u003c/strong\u003e) PCoA plot based on weighted Unifrac of \u003cem\u003eCladocopium\u003c/em\u003e ITS2 sequences among \u003cem\u003eAcropora\u003c/em\u003especies. Colors denote \u003cem\u003eAcropora \u003c/em\u003especies. Lines depict the distance of each sample (small circles) to the group centroid (large circles).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/84f47d1b28ec73208fa777b3.png"},{"id":104042922,"identity":"025920e0-01fc-4e02-8422-ef399773b8c7","added_by":"auto","created_at":"2026-03-06 05:25:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":216541,"visible":true,"origin":"","legend":"\u003cp\u003eSymbiodiniaceae composition between thermotolerant and thermosensitive colonies of \u003cem\u003eAcropora digitifera\u003c/em\u003e, \u003cem\u003eA. millepora\u003c/em\u003e, and \u003cem\u003eA. \u003c/em\u003ecf.\u003cem\u003e tenuis\u003c/em\u003e. (\u003cstrong\u003ea\u003c/strong\u003e) Heatmaps represent square root-transformed counts of ITS2 sequences in thermotolerant and thermosensitive colonies. The topmost color bar denotes thermotolerance group (red, thermotolerant; blue, thermosensitive). The second color bar depicts ITS2 profile. (\u003cstrong\u003eb\u003c/strong\u003e) PCoA plots based on weighted Unifrac of \u003cem\u003eCladocopium\u003c/em\u003e ITS2 sequences in thermotolerant and thermosensitive colonies. Colors denote thermotolerance group with lines illustrating the distance of each sample (small circle) to the group centroid (big circle). The dendrogram beside the ITS2 profile legend depicts similarity among ITS2 profiles based on weighted Unifrac.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/998d6d77ec076f058dd569cc.png"},{"id":104402432,"identity":"a1358ec0-a1d8-4f02-a08c-051bcaef1b9e","added_by":"auto","created_at":"2026-03-11 12:15:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1831129,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/cc0a9f85-800e-4738-9096-82a25b9091bb.pdf"},{"id":104042956,"identity":"42d8b4c6-7bf5-47c6-9b1d-d2971c6b1eeb","added_by":"auto","created_at":"2026-03-06 05:25:20","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1463532,"visible":true,"origin":"","legend":"","description":"","filename":"000acroSupplementaryfigures20260126.docx","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/5f8ba49e140cb428476571bf.docx"},{"id":104042947,"identity":"6aa3a53c-a2f8-4da2-91d0-b331f334a0a0","added_by":"auto","created_at":"2026-03-06 05:25:14","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":230755,"visible":true,"origin":"","legend":"","description":"","filename":"000acroSupplementarytables20260126.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8838536/v1/af89211d295ff255f8ead137.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Acroporids in northwestern Philippines with varied thermotolerance host similar photosymbionts","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCoral reefs are among the most productive ecosystems on earth and are hotspots of biodiversity supporting an estimated one million multicellular species that inhabit coral reefs (Fisher et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Healthy reefs are vital providers of ecosystem goods and services to human populations in tropical and subtropical regions (Cinner et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hoegh-Guldberg et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Despite their great importance, coral reefs are rapidly declining due to extreme and abrupt changes in the environment, including, but not limited to, global warming, ocean acidification, destructive fishing, pollution, and the introduction of exotic species (Hughes et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Hughes et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Eddy et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Among these, the rapid rise of seawater temperature due to global warming is the biggest threat to these valuable ecosystems (Oliver et al. \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Eddy et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLike other multicellular organisms, corals are holobionts, ecological units that integrate the host and its associated microorganisms (Baedke et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The coral host forms close associations with microorganisms such as microeukaryotes (e.g., fungi, dinoflagellates, apicomplexans), archaea, bacteria, and viruses that work together or against each other depending on the environment (van Oppen and Nitschke \u003cspan citationid=\"CR117\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Among these microorganisms, dinoflagellate microalgae in the family Symbiodiniaceae (colloquially known as zooxanthellae) provide the majority of nutritional and energetic requirements of the host in return for a habitat with stable light conditions and vital (micro)nutrients (Falkowski et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Trench \u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Voolstra et al. \u003cspan citationid=\"CR120\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wiedenmann et al. \u003cspan citationid=\"CR124\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDifferent coral-Symbiodiniaceae pairings are linked to distinct holobiont phenotypes. Thermotolerant species are often dominated by \u003cem\u003eDurusdinium\u003c/em\u003e, whereas thermosensitive taxa, such as Indo-West Pacific acroporids, are typically dominated by \u003cem\u003eCladocopium\u003c/em\u003e. Despite their general sensitivity, acroporids can alter their photosymbionts in response to stressors. For example, on the Great Barrier Reef, \u003cem\u003eAcropora millepora\u003c/em\u003e symbionts were shown to shift from \u003cem\u003eCladocopium\u003c/em\u003e to \u003cem\u003eDurusdinium\u003c/em\u003e following temperature-induced bleaching (Berkelmans and van Oppen \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Similarly, \u003cem\u003ePocillopora\u003c/em\u003e symbionts were reported to change from \u003cem\u003eC. latusorum\u003c/em\u003e to \u003cem\u003eD. glynii\u003c/em\u003e after a mass bleaching event (Palacio-Castro et al. \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). However, while \u003cem\u003eDurusdinium\u003c/em\u003e is often linked to enhanced thermal tolerance, corals that associate with it often exhibit reduced growth rates due to lower nutritional provision by the symbiont under normal temperature levels (Abrego et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Cantin et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Wall et al. \u003cspan citationid=\"CR121\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), although there are exceptions (Kemp et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Turnham et al. \u003cspan citationid=\"CR116\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Aside from \u003cem\u003eDurusdinium\u003c/em\u003e, some members of \u003cem\u003eCladocopium\u003c/em\u003e have been correlated with increased coral thermotolerance. For example, corals in the Red Sea, where temperatures can reach 36\u0026deg;C, are usually associated with \u003cem\u003eCladocopium thermophilum\u003c/em\u003e (D\u0026rsquo;Angelo et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Thermotolerant \u003cem\u003eAcropora\u003c/em\u003e in the South China Sea were also found to associate with \u003cem\u003eCladocopium\u003c/em\u003e spp. (Gong et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ip et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Nonetheless, symbiont associations alone may not fully account for variation in coral thermal tolerance, which can also be shaped by acclimatization history, interactions with other holobiont partners, and host traits.\u003c/p\u003e \u003cp\u003eHost traits and photosymbiont type may explain why differences in thermal tolerance are often observed even within the same coral population, and sometimes among individuals found in the same reef area. For example, in an American Samoan reef (\u0026lt;\u0026thinsp;100 km\u003csup\u003e2\u003c/sup\u003e) exposed to slightly higher temperatures, some individuals of \u003cem\u003eAcropora hyacinthus\u003c/em\u003e, \u003cem\u003eA. gemmifera\u003c/em\u003e, \u003cem\u003ePocillopora damicornis\u003c/em\u003e, and \u003cem\u003ePorites cylindrica\u003c/em\u003e exhibited better thermal tolerance compared to others (Morikawa and Palumbi \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Similar patterns were observed in \u003cem\u003eA. hyacinthus\u003c/em\u003e (Naugle et al. \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2024\u003c/span\u003e)d \u003cem\u003espathulata\u003c/em\u003e (Denis et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) from the Great Barrier Reef where thermotolerance varied among conspecific colonies within and among reefs. Variation was also recorded in \u003cem\u003eMontipora capitata\u003c/em\u003e individuals from a small reef patch in Hawaii (Stat et al. \u003cspan citationid=\"CR112\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Drury et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), as well as in \u003cem\u003eA. digitifera\u003c/em\u003e and \u003cem\u003eA. hyacinthus\u003c/em\u003e from small reef patches in Palau where differences in survival under controlled heat stress experiments were observed (Cornwell et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Humanes et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Such within-population differences in thermotolerance may arise from host genetic factors that shape colony phenotypes (e.g., colony size, tissue thickness, skeletal density) (Brown \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Enr\u0026iacute;quez et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Voolstra et al. \u003cspan citationid=\"CR120\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Shah et al. \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) or from symbiont community composition (Kavousi et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Drury et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eUnderstanding coral and photosymbiont thermotolerance is especially important because reefs in the Coral Triangle are rapidly declining due to rising sea surface temperatures and recurring summer heatwaves that cause bleaching (Pe\u0026ntilde;aflor et al. \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; McLeod et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Mellin et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Handiani et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The Bolinao-Anda Reef Complex (BARC) in the northern West Philippine Sea region of the South China Sea has experienced several widespread bleaching events over the past decades (Yap et al. \u003cspan citationid=\"CR127\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Arceo et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Kleypas et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Quimpo et al. \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), yet some colonies continue to persist (Harrison et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), suggesting variation in thermal resilience among individuals and species. Whether this variation in thermal tolerance among individuals and closely related species is primarily associated with photosymbiont composition, host factors, or an interplay of the two remains an open question.\u003c/p\u003e \u003cp\u003eTo examine coral thermotolerance and its link to Symbiodiniaceae community composition, we conducted short-term heat stress assays on three species of acroporids, \u003cem\u003eAcropora digitifera\u003c/em\u003e, \u003cem\u003eA. millepora\u003c/em\u003e and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e, and profiled their associated Symbiodiniaceae using ITS2 metabarcoding. By focusing on a reef repeatedly affected by thermal stress, this study contributes to ongoing efforts to understand coral-symbiont relationships and their role in thermotolerance across multiple species and regions within the Coral Triangle.\u003c/p\u003e"},{"header":"Materials \u0026 Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eCoral collection\u003c/h2\u003e\n \u003cp\u003eThirty healthy colonies each of \u003cem\u003eAcropora\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e and \u003cem\u003eA. millepora\u003c/em\u003e, and 40 colonies of \u003cem\u003eA. digitifera\u003c/em\u003e from a depth of 4\u0026ndash;5 meters in Anda, Pangasinan, northwestern Philippines (16.31487\u0026deg; N, 120.03128\u0026deg; E) were haphazardly selected and marked using small stainless steel tags. To increase the likelihood of obtaining different genotypes, colonies at least 5 meters apart were chosen (Howlett et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e). Colonies were considered healthy if they showed no visible signs of bleaching or tissue sloughing (i.e., detachment of coral tissue from skeleton, observed as exposed white skeleton without overlying tissue). Collections were conducted with permission from the Philippines Department of Agriculture Bureau of Fisheries and Aquatic Resources (DA-BFAR Gratuitous Permit No. 0169\u0026thinsp;\u0026minus;\u0026thinsp;19 and 0324\u0026thinsp;\u0026minus;\u0026thinsp;24). A small piece containing at least 20 branches was collected from each colony using a hammer and chisel. Coral pieces were transported to the outdoor hatchery of the Bolinao Marine Laboratory on October 6, 2021 (\u003cem\u003eA. millepora\u003c/em\u003e), October 28, 2021 (\u003cem\u003eA. digitifera\u003c/em\u003e), and November 13, 2021 (\u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e) where they were held in flow-through seawater tanks maintained at ~\u0026thinsp;29\u0026deg;C (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e and Table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e) for a day until fragment preparation. The same tank was used for each species and was cleaned between each run. Sixteen fragments (~\u0026thinsp;3 cm in length) were cut from the apical branch tips of each colony and attached to cement nubbin holders using cyanoacrylate glue (Dizon et al. \u003cspan class=\"CitationRef\"\u003e2008\u003c/span\u003e). Nubbins (1,600 in total) were labeled with small plastic tags to enable tracking of parent colonies.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eHeat stress assays\u003c/h3\u003e\n\u003cp\u003eCoral fragments attached to fragment holders (n\u0026thinsp;=\u0026thinsp;16 per colony) were randomly placed into eight (8) 40-L plastic tanks (4 control and 4 heat-stress tank replicates) supported with artificial lighting (100 \u0026micro;E/m2\u0026sdot;s) on a diel cycle (12:12 light-dark cycle), continuous seawater flow, and thermostat-regulated seawater temperature. All the coral fragments were initially acclimated at 29\u0026deg;C (mean monthly maximum sea surface temperature, MMM, at the Bolinao-Anda Reef Complex) (Quimpo et al. \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e) for 3 days. The tanks were then heated slowly (ramping) by 1\u0026deg;C a day, until 33\u0026deg;C was reached. This temperature, which is 3\u0026ndash;4\u0026deg;C above the MMM, was used to induce bleaching. Fragments were maintained at this temperature until the end of the experiment. Experiment duration varied across species and was terminated when 15\u0026ndash;30% of fragments displayed mortality (4 days for \u003cem\u003eA. millepora\u003c/em\u003e and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis;\u003c/em\u003e 7 days for \u003cem\u003eA. digitifera\u003c/em\u003e). In this study, mortality was defined as loss of all coral tissue with no intact tissue remaining on the coral skeleton (Humanes et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e). During the exposure period, the coral fragments were observed at least thrice daily (morning\u0026thinsp;~\u0026thinsp;09:00, midday\u0026thinsp;~\u0026thinsp;12:00, and late afternoon\u0026thinsp;~\u0026thinsp;16:00) to monitor health status and mortality. Colonies that showed signs of bleaching or mortality in the control tanks were excluded from the final analysis to avoid confounding factors unrelated to heat stress. To verify that the laboratory conditions were stable throughout the course of the experiment, temperature and pH were checked using a handheld meter (LAQUAact-PC110, Horiba, UK) (Fig. \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003e and Table \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003e) thrice daily in addition to the data collected by submersible HOBO loggers (Onset, USA) placed in each tank. Coral fragment color was documented at the start (pre-exposure) and end (post-exposure) of the experiment using a Tough TG-5 Waterproof Digital Camera (Olympus, USA) with black, white, and coral color reference cards (Siebeck et al. \u003cspan class=\"CitationRef\"\u003e2006\u003c/span\u003e) to capture subtle, quantitative changes in tissue coloration.\u003c/p\u003e\n\u003ch3\u003eSurvival analysis\u003c/h3\u003e\n\u003cp\u003eKaplan-Meier (KM) survival analysis (Kaplan and Meier \u003cspan class=\"CitationRef\"\u003e1958\u003c/span\u003e) was used to compare survivorship among \u003cem\u003eAcropora\u003c/em\u003e species subjected to heat stress, as it allows analysis of time-to-event data and accommodates censored observations (i.e., fragments still alive at the end of the experiment). KM survival curves were made using the ggally package (Schloerke et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e) to visualize the data and log-rank tests were done to compare survivorship among species. This non-parametric approach incorporates exact survival times (i.e., time until a fragment is recorded as dead) and has been used in studies that evaluated survival of coral fragments or individuals over time (Dizon and Yap \u003cspan class=\"CitationRef\"\u003e2006\u003c/span\u003e; Hazraty-Kari et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eThermotolerance classification of colonies\u003c/h3\u003e\n\u003cp\u003eClassification of thermotolerance of conspecific \u003cem\u003eAcropora\u003c/em\u003e colonies was based on (1) incidence of mortality (IOM), (2) fragment color change (%\u0026Delta;C), and (3) colony stress index (CSI) which is the combination of both (1 \u0026amp; 2). IOM is based on direct counts of dead fragments observed at the end of the experiment, %\u0026Delta;C is a quantitative measure of bleaching based on photographs taken of each fragment before and after heat exposure, while CSI is the total value of normalized IOM and normalized average fragment color change (%\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e).\u003c/p\u003e\n\u003ch3\u003eIncidence of mortality\u003c/h3\u003e\n\u003cp\u003eIncidence of mortality (IOM) was computed by dividing the number of dead fragments (n) by the total number of fragments (N) subjected to high temperature per colony, multiplied by 100%. Dead fragments were defined as those that had completely sloughed off tissue from the skeleton.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eIOM = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{\\text{n}}{\\text{N}}\\times\\:100\\%\\)\u003c/span\u003e\u003c/span\u003e\u003c/h2\u003e\n \u003cp\u003eColonies with IOM greater than or equal to 50% were tagged as thermosensitive (S), while those with less than 50% were tagged as thermotolerant (T). Because of the gradual temperature ramping and short duration of exposure, colony mortality was generally low and many colonies had the same ranking.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eFragment color change\u003c/h3\u003e\n\u003cp\u003eColor change in heat-stressed fragments was estimated using mean gray values (Mclachlan and Grottoli \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Images of the coral fragments were converted to gray scale and the mean gray value (MGV) of each heat-stressed fragment (M\u003csub\u003eF\u003c/sub\u003e) was measured using ImageJ. To account for differences in image brightness, the MGV of a 1 cm\u003csup\u003e2\u003c/sup\u003e white standard (M\u003csub\u003es\u003c/sub\u003e) was measured for each photo. Normalized MGV (nMGV) was computed by dividing fragment MGV (M\u003csub\u003eF\u003c/sub\u003e) by the standard MGV (M\u003csub\u003eS\u003c/sub\u003e) multiplied by 100%.\u003c/p\u003e\n\u003cp\u003enMGV = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{{\\text{M}}_{\\text{F}}}{{\\text{M}}_{\\text{S}}}\\times\\:\\:100\\%\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eTo get percent color change (%\u0026Delta;C), initial nMGV (nMGV\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e; from pre-exposure fragment images) was subtracted from final nMGV (nMGV\u003csub\u003e\u003cem\u003ef\u003c/em\u003e\u003c/sub\u003e; from post-exposure fragment images) then divided by nMGV\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e.\u003c/p\u003e\n\u003cdiv class=\"Heading\"\u003e%\u0026Delta;C = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{{\\text{n}\\text{M}\\text{G}\\text{V}}_{\\text{f}}-\\:{\\text{n}\\text{M}\\text{G}\\text{V}}_{\\text{i}}}{{\\text{n}\\text{M}\\text{G}\\text{V}}_{\\text{i}}}\\:\\times\\:100\\%\\)\u003c/span\u003e\u003c/span\u003e\u003c/div\u003e\n\u003cp\u003ePercent color change per fragment (n\u0026thinsp;=\u0026thinsp;8) was averaged per colony (%\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e). Higher values reflect increased bleaching severity, indicated by fragments becoming visibly whiter. Colonies were ranked based on their %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e with the top 20% of the sampled population classified as thermosensitive and the bottom 20% as thermotolerant, ensuring that the worst and best performing colonies were identified for subsequent analyses.\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eColony stress index\u003c/h2\u003e\n \u003cp\u003eTo obtain a representative measure of the coral heat stress response, IOM and %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e were combined per colony per species. Spearman correlation was first used to assess association between IOM and %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e across species, as bleaching (color loss) does not always equate to mortality. IOM and %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e were then merged into a single metric by getting the sum of each measure normalized to their respective minimum and maximum values per species.\u003c/p\u003e\n \u003cp\u003eNormalized IOM or %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{\\text{x}\\:-\\:{\\text{x}}_{\\text{m}\\text{i}\\text{n}}}{{\\text{x}}_{\\text{m}\\text{a}\\text{x}}\\:-\\:{\\text{x}}_{\\text{m}\\text{i}\\text{n}}\\:}\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eThe sum of normalized IOM and %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e, colony stress index (CSI), was then used to classify colony thermotolerance based on their ranks per species. The bottom 20% of colonies with least change relative to original phenotypes, were classified as thermotolerant and the top 20%, with the most change, as thermosensitive.\u003c/p\u003e\n \u003cp\u003eCSI\u0026thinsp;=\u0026thinsp;normalized IOM\u0026thinsp;+\u0026thinsp;normalized %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e\u003c/p\u003e\n \u003cp\u003eTo compare thermotolerance characteristics of all acroporid colonies regardless of species, incidence of mortality of all colonies (IOM\u003csub\u003eall\u003c/sub\u003e) was derived by min-max normalization of IOM values of all colonies at day 10 of the experiment (four days at 33\u0026deg;C). Similarly, the percent color change of all colonies (%\u0026Delta;C\u003csub\u003eall\u003c/sub\u003e) was obtained by min-max normalization of %\u0026Delta;C\u003csub\u003eave\u003c/sub\u003e values. The colony stress index of all colonies (CSI\u003csub\u003eall\u003c/sub\u003e) was computed as the sum of IOM\u003csub\u003eall\u003c/sub\u003e and %\u0026Delta;C\u003csub\u003eall\u003c/sub\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eDNA extraction and PCR\u003c/h2\u003e\n \u003cp\u003ePrior to thermal stress experiments, two fragments (~\u0026thinsp;3 cm) were sampled from each colony and fixed in 5 mL of 100% ethanol. Tissue was collected from these fragments using an airbrush with 0.2 \u0026micro;m-filtered artificial seawater. Tissue slurries were stored on ice until DNA extraction. The coral slurry was centrifuged for 5 minutes at 10,000 g at 4\u0026deg;C. The seawater was removed and the pellet was resuspended in 400 \u0026micro;L of complete 2% CTAB buffer (Murray and Thompson \u003cspan class=\"CitationRef\"\u003e1980\u003c/span\u003e). Cells were lysed by incubation for an hour at 60\u0026deg;C then 400 \u0026micro;L of chloroform:isoamyl alcohol (24:1) solution was added. The solution was vigorously mixed by hand for 2 minutes then centrifuged at 10,000 g at 4\u0026deg;C for phase separation. The aqueous phase was transferred into a fresh tube and 600 \u0026micro;L of isopropanol was added. DNA was precipitated for 2\u0026ndash;3 hours on ice then pelleted by centrifugation at 12,000 g at 4\u0026deg;C for 30 minutes. The pellet was washed twice with 1 mL cold 70% ethanol and centrifuged at 10,000 g at 4\u0026deg;C for 10 minutes. The pellet was resuspended in 25\u0026ndash;50 \u0026micro;L ultrapure, nuclease-free water. DNA quality was checked by agarose gel electrophoresis and quantity was measured using a Qubit 3.0 fluorometer (ThermoFisher Scientific, USA). Genomic DNA samples were stored at -20\u0026deg;C.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eIdentification of symbiont communities\u003c/h2\u003e\n \u003cp\u003eGenomic DNA was submitted to Macrogen, South Korea, for ITS2 library construction using the Herculase II Fusion DNA Polymerase Nextera XT Index Kit V2 (Agilent Technologies, Santa Clara, CA, USA) and the primer pair ITSintfor2 (GAATTGCAGAACTCCGTG) (Coleman et al. \u003cspan class=\"CitationRef\"\u003e1994\u003c/span\u003e) and ITS-reverse (GGGATCCATATGCTTAAGTTCAGCGGGT) (LaJeunesse \u003cspan class=\"CitationRef\"\u003e2002\u003c/span\u003e). Libraries were subjected to paired-end, multiplexed sequencing on the MiSeq platform to generate 300 base pair reads (Illumina, USA). Raw sequence data were deposited in the NCBI Sequence Read Archive and can be accessed under BioProject accession number PRJNA1295142. The SymPortal pipeline (Hume et al. \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e) was used to analyze the resulting ITS2 sequences and to identify the Symbiodiniaceae community present in the acroporid samples. SymPortal is a bioinformatic pipeline that identifies the putative taxa within a Symbiodiniaceae community from ITS2 amplicon data. By considering the intragenomic diversity in every Symbiodiniaceae genome, SymPortal names ITS2 type profiles (strains) based on combinations of defining intragenomic variants (DIVs) (Hume et al. \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e). The pipeline includes quality-checking steps to increase the reliability of ITS2 sequence annotation and profile prediction (Schloss et al. \u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e; Eren et al. \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e; Sayers et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analyses\u003c/h2\u003e\n \u003cp\u003eHeatmaps and bar plots were generated to visualize the distribution of Symbiodiniaceae-related ITS2 sequences and predicted ITS2 type profiles among the samples. Principal coordinates analysis (PCoA) plots (Gower \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e), Weighted UniFrac (Lozupone et al. \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e) and Bray-Curtis dissimilarity (Bray and Curtis \u003cspan class=\"CitationRef\"\u003e1957\u003c/span\u003e) computed from square root-transformed abundance of ITS2 sequences, were used to visualize compositional similarities or groupings of samples. Weighted UniFrac incorporates both phylogenetic relationships and relative abundances, whereas Bray-Curtis dissimilarity quantifies differences in taxon abundance between samples. Distance-based redundancy analysis (dbRDA) (Legendre and Anderson \u003cspan class=\"CitationRef\"\u003e1999\u003c/span\u003e) was done using the capscale function to explore how ITS2 sequence composition varied with explanatory variables (i.e., IOM\u003csub\u003eall\u003c/sub\u003e, %\u0026Delta;C\u003csub\u003eall\u003c/sub\u003e, and CSI\u003csub\u003eall\u003c/sub\u003e). Clustering of coral colonies based on Symbiodiniaceae-related ITS2 sequence composition was checked by permutational multivariate analysis of variance (PERMANOVA) (Anderson \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e) using the adonis2 and the pairwiseAdonis functions (Martinez Arbizu \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e). Dispersion among groups was compared by permutational analysis of dispersion (PERMDISP) (Anderson \u003cspan class=\"CitationRef\"\u003e2006\u003c/span\u003e) using the betadisper function. Bootstrapping was applied to both PERMANOVA and PERMDISP analyses to account for unequal sampling sizes and assess the robustness of group differences and dispersion estimates. To test for differences in thermotolerance metrics among groups, we used the Kruskal-Wallis test (Kruskal and Wallis \u003cspan class=\"CitationRef\"\u003e1952\u003c/span\u003e), followed by Dunn\u0026rsquo;s post-hoc pairwise comparisons (Dunn \u003cspan class=\"CitationRef\"\u003e1964\u003c/span\u003e). Rarefaction curves were generated using the rarecurve function to evaluate whether sampling depth was sufficient to capture the diversity of ITS2 sequences across samples. The functions capsale, adonis2, betadisper, diversity, specnumber, and rarecurve are part of the vegan package (Oksanen et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). All statistical analyses were conducted in R (R Core Team \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e) using RStudio (Posit team \u003cspan class=\"CitationRef\"\u003e2025\u003c/span\u003e). Data handling and plotting were done using the tidyverse suite of packages (Wickham et al. \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThermotolerance of\u003c/b\u003e \u003cb\u003eAcropora\u003c/b\u003e \u003cb\u003especies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAll colonies of \u003cem\u003eA. digitifera\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;40), \u003cem\u003eA. millepora\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;30) and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;30) survived the pre-exposure stage prior to heat stress application. All fragments in the control tanks remained healthy, except for five fragments from five different colonies of \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e that showed bleaching during the experiment (Fig. S3 and Table S3). The colonies from which these fragments originated were excluded from thermotolerance and symbiont community analyses (Table S4).\u003c/p\u003e \u003cp\u003eThermotolerance among \u003cem\u003eAcropora\u003c/em\u003e species differed based on incidence of mortality (IOM) (log-rank test \u003cem\u003eP-\u003c/em\u003evalue\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). \u003cem\u003eAcropora digitifera\u003c/em\u003e showed the highest survival under elevated temperature, followed by \u003cem\u003eA. millepora\u003c/em\u003e, and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Comparison of IOM at day 10 revealed lower IOM\u003csub\u003eall\u003c/sub\u003e in \u003cem\u003eA. digitifera\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0, IQR\u0026thinsp;=\u0026thinsp;0\u0026ndash;0) compared to \u003cem\u003eA. millepora\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.063, IQR\u0026thinsp;=\u0026thinsp;0-0.34) and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.13, IQR\u0026thinsp;=\u0026thinsp;0-0.38) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Table S3). Percent color change (%ΔC\u003csub\u003eall\u003c/sub\u003e) also differed among species, with \u003cem\u003eA. digitifera\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.09, IQR\u0026thinsp;=\u0026thinsp;0.05\u0026ndash;0.18) showing lower %ΔC compared to \u003cem\u003eA. millepora\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.31, IQR\u0026thinsp;=\u0026thinsp;0.25\u0026ndash;0.48) and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.28, IQR\u0026thinsp;=\u0026thinsp;0.21\u0026ndash;0.28) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Table S5). Colony stress index (CSI\u003csub\u003eall\u003c/sub\u003e) was lower in \u003cem\u003eA. digitifera\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0, IQR\u0026thinsp;=\u0026thinsp;0\u0026ndash;0) compared to \u003cem\u003eA. millepora\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.38, IQR\u0026thinsp;=\u0026thinsp;0.28\u0026ndash;0.78) and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e (median\u0026thinsp;=\u0026thinsp;0.36, IQR\u0026thinsp;=\u0026thinsp;0.21\u0026ndash;0.72) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Table S5). Considering the outcomes of time-to-event analysis (log-rank test) and common timepoint metrics (IOM\u003csub\u003eall\u003c/sub\u003e, %ΔC\u003csub\u003eall\u003c/sub\u003e, and CSI\u003csub\u003eall\u003c/sub\u003e) together, we ranked thermotolerance of the three coral species as follows: \u003cem\u003eA. digitifera\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cem\u003eA. millepora\u003c/em\u003e\u0026thinsp;\u0026ge;\u0026thinsp;\u003cem\u003eA. cf. tenuis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePairwise log-rank test among \u003cem\u003eAcropora\u003c/em\u003e species with BH-corrected \u003cem\u003eP-\u003c/em\u003evalues (\u003cem\u003eQ-\u003c/em\u003evalues).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup 1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGroup 2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eQ\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. millepora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA. digitifera\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA. digitifera\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eA. millepora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eThermotolerance classification of colonies\u003c/h2\u003e \u003cp\u003eAlthough IOM and %ΔC showed high correlation (Fig. S4), use of these metrics individually resulted in identification of differing numbers of heat tolerant and heat sensitive colonies. While IOM values showed limited variation due to the short duration of the experiment (Fig. S5 and Table S6), %ΔC reflected finer differences among colonies but tended to underestimate bleaching intensity (Fig. S6 and Table S7). Thus, we combined these metrics to address imbalanced grouping and the similarity of IOM rankings among colonies for each species. This merging resulted in a colony stress index (CSI), which was used to make an operational thermotolerance classification scheme. Using this classification scheme, the bottom 20% were categorized as thermosensitive and the top 20% as thermotolerant. This metric yielded the same number of thermotolerant and thermosensitive colonies per species (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and Table S8).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSymbiodiniaceae communities of\u003c/b\u003e \u003cb\u003eAcropora\u003c/b\u003e \u003cb\u003especies and individuals\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOut of 8,620,518 raw paired ITS2 sequences, 7,889,145 sequences (mean count of 83,044\u0026thinsp;\u0026plusmn;\u0026thinsp;12,643) passed quality checking and were classified as Symbiodiniaceae (Fig. S7A). Rarefaction curves plateaued for all samples, confirming that sequencing effort was adequate to capture ITS2 sequence diversity and that comparisons among samples and groups were not biased by differences in sequencing depth (Fig. S7B). Eight defining intragenomic variants (DIVs) were observed, all affiliated with the genus \u003cem\u003eCladocopium\u003c/em\u003e. From these DIVs, four ITS2 type profiles dominated by ITS2 type C3u (\u003cem\u003eCladocopium patulum\u003c/em\u003e) were named: C3u-C3xu-C3-C115, C3u-C3xu-C3-C115-C3xv, C3u-C3-C115-C3xt, and C3/C3u-C115-C21ab-C3ge. \u003cem\u003eDurusdinium\u003c/em\u003e sequences were also detected but at counts too low to be considered as DIVs (\u0026lt;\u0026thinsp;200 sequences) (Fig. S8, Table S9).\u003c/p\u003e \u003cp\u003eOverall Symbiodiniaceae composition showed a weak correlation with \u003cem\u003eAcropora\u003c/em\u003e thermotolerance. Distance-based redundancy analysis (dbRDA) showed a significant but weak relationship between photosymbiont community structure and thermotolerance parameters (F\u0026thinsp;=\u0026thinsp;2.834, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0324), explaining only 5.80% of the variation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Among the parameters, only IOM\u003csub\u003eall\u003c/sub\u003e correlated, albeit weakly, with photosymbiont composition (Table S10). CSI\u003csub\u003eall\u003c/sub\u003e was collinear with the other parameters and was removed from the analysis. Thermotolerance metrics showed no consistent differences when compared across ITS2 profiles in the combined dataset of all three acroporids, although IOM\u003csub\u003eall\u003c/sub\u003e, %ΔC\u003csub\u003eall\u003c/sub\u003e, and CSI\u003csub\u003eall\u003c/sub\u003e distributions were marginally skewed to the right for C3u-C3xu-C3-C115 and C3u-C3xu-C3-C115-C3xv compared to C3u-C3-C115-C3xt and C3/C3u-C115-C21ab-C3ge (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, Table S11). This suggests that within the Bolinao-Anda Reef Complex, the ability to evaluate direct links between symbiont identity and thermotolerance is constrained by the predominance of highly similar \u003cem\u003eCladocopium patulum\u003c/em\u003e lineages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe composition and diversity of photosymbionts based on ITS2 type profiles did not differ across colonies of the three species. Each coral colony harbored only one dominant \u003cem\u003eCladocopium\u003c/em\u003e ITS2 sequence. Four ITS2 type profiles in total were observed across \u003cem\u003eA. digitifera\u003c/em\u003e and \u003cem\u003eA. millepora\u003c/em\u003e colonies, while only two were observed in \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). C3u-C3xu-C3-C115 and C3u-C3xu-C3-C115-C3xv are closely related ITS2 type profiles found in all acroporid species examined. C3u-C3xu-C3-C115 was the most common, present in 16 \u003cem\u003eA. digitifera\u003c/em\u003e, 21 \u003cem\u003eA. millepora\u003c/em\u003e, and 18 \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e individuals, while C3u-C3xu-C3-C115-C3xv was found in eight \u003cem\u003eA. digitifera\u003c/em\u003e, seven \u003cem\u003eA. millepora\u003c/em\u003e, and seven \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e. ITS2 type profiles C3u-C3-C115-C3xt and C115-C21ab-C3ge were detected only in \u003cem\u003eA. digitifera\u003c/em\u003e and \u003cem\u003eA. millepora\u003c/em\u003e colonies but were more prevalent in the former species. C3u-C3-C115-C3xt was present in ten \u003cem\u003eA\u003c/em\u003e. \u003cem\u003edigitifera\u003c/em\u003e and one \u003cem\u003eA\u003c/em\u003e. \u003cem\u003emillepora\u003c/em\u003e individual, while C115-C21ab-C3ge was in six \u003cem\u003eA\u003c/em\u003e. \u003cem\u003edigitifera\u003c/em\u003e and one \u003cem\u003eA\u003c/em\u003e. \u003cem\u003emillepora\u003c/em\u003e individual.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe composition of Symbiodiniaceae communities based on all ITS2 sequences differed among the three \u003cem\u003eAcropora\u003c/em\u003e species (Tables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026amp; S12, Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C \u0026amp; S9A). \u003cem\u003eAcropora digitifera\u003c/em\u003e exhibited more within-species variation and distinct ITS2 sequence distribution among colonies (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). This pattern remained robust after controlling for unequal sample sizes (100 bootstrapped PERMANOVA and PERMDISP replicates; Tables S13-14 and Fig S10). Pairwise comparisons using a single representative iteration, defined as the resample with a pseudo-F statistic closest to the median, confirmed overall interspecific differences (Table S15; Fig. S10). There was no significant difference between \u003cem\u003eA. digitifera\u003c/em\u003e and \u003cem\u003eA. millepora\u003c/em\u003e, whereas both species differed significantly from \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e, which exhibited the most homogeneous symbiont communities.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePERMANOVA and PERMDISP results of weighted Unifrac of ITS2 sequences between high and low heat tolerance colonies and among \u003cem\u003eAcropora\u003c/em\u003e species (9,999 permutations).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003ePERMANOVA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003ePERMDISP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value/\u003cem\u003eQ\u003c/em\u003e-value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value/\u003cem\u003eQ\u003c/em\u003e-value\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh vs low heat tolerance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. digitifera\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0374\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.581\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.179\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.664\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. millepora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0398\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.414\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.871\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.562\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.613\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.551\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.0152\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.175\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInterspecific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAll\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.222\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. digitifera - A. millepora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0999\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.004\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. digitifera - A.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.260\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA. millepora - A.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.142\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.143\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eNo clear patterns in Symbiodiniaceae community composition could be discerned between thermotolerant and thermosensitive individuals of each species. Based on ITS2 type profiles and ITS2 sequences, only \u003cem\u003eA. cf. tenuis\u003c/em\u003e showed segregation of symbionts with thermotolerance, with strain C3u-C3xu-C3-C115 present in all thermotolerant colonies (5 out of 5) and C3u-C3xu-C3-C115-C3xv present in 80% of thermosensitive individuals (4 out of 5) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). This pattern was corroborated by significant compositional differences in ITS2 sequences between thermotolerant and thermosensitive \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, S9B-D, and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). However, these two closely related strains were also distributed across colonies of \u003cem\u003eA. digitifera\u003c/em\u003e and \u003cem\u003eA. millepora\u003c/em\u003e with varying thermotolerance characteristics. Moreover, \u003cem\u003eDurusdinium\u003c/em\u003e sequences did not correlate with a thermotolerant phenotype in the acroporids, as these were detected mostly in colonies with intermediate tolerance (Fig. S11).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eThermotolerance varies among and within species\u003c/h2\u003e \u003cp\u003eShort-term thermal stress assays revealed differences in thermotolerance among \u003cem\u003eAcropora\u003c/em\u003e species and among individuals within each species. Our results were consistent with previous observations on corals from the same site (Da-Anoy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), with \u003cem\u003eA. digitifera\u003c/em\u003e as most thermotolerant, followed by \u003cem\u003eA. millepora\u003c/em\u003e, and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e as most thermosensitive. Our findings differ from surveys on the Great Barrier Reef from 2015\u0026ndash;2016, which showed \u003cem\u003eA. tenuis\u003c/em\u003e (currently recognized as \u003cem\u003eA. kenti\u003c/em\u003e) (Bridge et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) as most thermotolerant, followed by \u003cem\u003eA. millepora\u003c/em\u003e, and \u003cem\u003eA. digitifera\u003c/em\u003e as thermosensitive (Hoogenboom et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Thermotolerance also varied among individual colonies within each species, mirroring observations in \u003cem\u003eA. digitifera\u003c/em\u003e from Palau (Humanes et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Lachs et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Humanes et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2024\u003c/span\u003e)d cf. \u003cem\u003etenuis\u003c/em\u003e from the Philippines (Baquiran et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Reports of high inter-colony phenotypic variation among \u003cem\u003eA. millepora\u003c/em\u003e from the Great Barrier Reef and \u003cem\u003eA. cervicornis\u003c/em\u003e from Florida Keys also support this observation (Granados-Cifuentes et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Million et al. \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, given recent taxonomic revisions within genus \u003cem\u003eAcropora\u003c/em\u003e (Bridge et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), these comparisons must be interpreted with caution, as some populations may indeed represent different species. In our study, species identification was based on \u003cem\u003ein situ\u003c/em\u003e observations of colony morphology, and genetic confirmation was not conducted.\u003c/p\u003e \u003cp\u003eDifferences in thermotolerance among and within \u003cem\u003eAcropora\u003c/em\u003e species on a single reef highlight the presence of substantial trait diversity among these corals. Such trait diversity likely reflects multiple underlying mechanisms that vary across taxa or individuals, including antioxidants and stress enzymes (Fitt et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Diaz et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Seveso et al. \u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), host morphology (Loya et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Jimenez et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Smith et al. \u003cspan citationid=\"CR111\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and heterotrophy (Grottoli et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Conti-Jerpe et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). For example, relatively thermotolerant species such as \u003cem\u003eFavites colemani\u003c/em\u003e and \u003cem\u003eMontipora digitata\u003c/em\u003e possess expanded antioxidant protein families and chaperones compared to more sensitive taxa (Da-Anoy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Da-Anoy et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Similarly, interspecific differences in the expression of heat-shock proteins were observed in \u003cem\u003eGoniopora lobata\u003c/em\u003e, \u003cem\u003eP. lobata\u003c/em\u003e, \u003cem\u003eSeriatopora hystrix\u003c/em\u003e and \u003cem\u003eStylophora pistillata\u003c/em\u003e (Seveso et al. \u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Morphology and trophic traits also play a role, with finely branched corals tending to bleach more readily than encrusting corals (Loya et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), and species with greater heterotrophic flexibility generally exhibiting greater resilience (Conti-Jerpe et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTaken together, our findings emphasize that interspecific variation in thermotolerance mirrors distinct ecological and physiological strategies among \u003cem\u003eAcropora\u003c/em\u003e species. High inter-colony variation within species provides a reservoir of resilient individuals that offer multiple avenues for adaptation. This diversity drives tolerance to heat stress and suggests that conservation and restoration strategies could benefit from harnessing both species- and colony-level variation to buffer reefs against the looming changes in climate (van Oppen et al. \u003cspan citationid=\"CR118\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003ePhotosymbiont community in acroporids\u003c/h2\u003e \u003cp\u003eSymbiodiniaceae communities in acroporids from the BARC were dominated by genus \u003cem\u003eCladocopium\u003c/em\u003e, with four putative strains of \u003cem\u003eC. patulum\u003c/em\u003e (formerly referred to as ITS2 type C3u) (Butler et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), C3/C3u-C115-C21ab-C3g3, C3u-C3-C115-C3xt, C3u-C3xu-C3-C115, and C3u-C3xu-C3-C115-C3xv. \u003cem\u003eCladocopium patulum\u003c/em\u003e has been reported in corals of the Western Indian Ocean (LaJeunesse et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Chauka \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Chauka et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), Palau (Butler et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Lewis et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), and in the South China Sea (SCS) (Ravelo and Conaco \u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Da-Anoy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Torres et al. \u003cspan citationid=\"CR114\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \u003cem\u003eC. patulum\u003c/em\u003e is present in corals from the warmer southern SCS, including the Gulf of Thailand (Chankong et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), Singapore (Smith et al. \u003cspan citationid=\"CR110\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), Vietnam (Amid et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Sikorskaya et al. \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and Malaysia (Lee et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Rabbani et al. \u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), but is rarely found in corals of the cooler northern SCS (Chen et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Qin et al. \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe prevalence of \u003cem\u003eCladocopium patulum\u003c/em\u003e in warmer waters of the SCS indicates a potential role in coral thermotolerance. \u003cem\u003eC. patulum\u003c/em\u003e was detected in \u003cem\u003eA. hyacinthus\u003c/em\u003e colonies from a reef in Hainan Island with relatively high seawater temperatures and nitrate concentrations (Li et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This symbiont was also dominant in corals in the Huangyan Reef (Bajo de Masinloc), an atoll in the central SCS characterized by elevated sea surface temperatures (Chen et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The high prevalence of \u003cem\u003eC. patulum\u003c/em\u003e in SCS reefs may partly explain the observed thermotolerance of \u003cem\u003eAcropora\u003c/em\u003e in the region. This species expresses a lipidome profile similar to \u003cem\u003eDurusdinium trenchii\u003c/em\u003e (Sikorskaya et al. \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), suggesting that it may exhibit comparable thermotolerance traits. In contrast, at Passu Keah, an atoll in the central SCS, \u003cem\u003eA. formosa\u003c/em\u003e from the warmer inner lagoon harbored fewer \u003cem\u003eC. patulum\u003c/em\u003e compared to those from the cooler outer reef (Qin et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This suggests that presence or an increase in abundance of \u003cem\u003eC. patulum\u003c/em\u003e may also be influenced by other environmental factors.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCladocopium patulum\u003c/em\u003e is a host generalist (LaJeunesse et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Butler et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) abundant in environmental samples from the South China Sea (Lin et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). \u003cem\u003eC. patulum\u003c/em\u003e likely accumulates in corals that acquire their symbionts from the environment. This symbiont has been detected in \u003cem\u003eAcropora\u003c/em\u003e, but not in \u003cem\u003ePocillopora\u003c/em\u003e, \u003cem\u003eSeriatopora\u003c/em\u003e, \u003cem\u003eStylophora\u003c/em\u003e, and \u003cem\u003ePorites\u003c/em\u003e corals, which are known to vertically transmit photosymbionts (Ravelo and Conaco \u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Da-Anoy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Torres et al. \u003cspan citationid=\"CR114\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This pattern parallels the dominance of \u003cem\u003eC. madreporum\u003c/em\u003e, another host generalist, in Palauan corals that also acquire photosymbionts through horizontal transmission (Butler et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Lewis et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the BARC, \u003cem\u003eAcropora\u003c/em\u003e are dominated by \u003cem\u003eC. patulum\u003c/em\u003e, suggesting that horizontal acquisition may facilitate establishment of this symbiont. The BARC has experienced several mass bleaching events. While acroporids suffered high mortality during the 1983 and 1998 events (Yap et al. \u003cspan citationid=\"CR127\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Arceo et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), they showed comparatively lower bleaching prevalence than other coral taxa in 2016 (Quimpo et al. \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Although historical symbiont data are unavailable, the current dominance of \u003cem\u003eC. patulum\u003c/em\u003e raises the possibility that its presence contributed to coral resilience in recent thermal stress events. This underscores the potential role of host-generalist \u003cem\u003eCladocopium\u003c/em\u003e species in enhancing heat tolerance across reefs.\u003c/p\u003e \u003cp\u003eComparison of ITS2 profiles of corals from other regions near the Coral Triangle, such as Palau (\u003cem\u003eC. madreporum\u003c/em\u003e) and the Great Barrier Reef (\u003cem\u003eC. proliferum\u003c/em\u003e), indicate that host-generalist \u003cem\u003eCladocopium\u003c/em\u003e species are widespread and may play similar functional roles across geographically distinct reefs (Butler et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Lewis et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Although largely observational, these patterns suggest that regional variation in Symbiodiniaceae composition could influence bleaching susceptibility and resilience. Further comparative studies will be necessary to test whether differences in ITS2 type profiles correspond with differences in bleaching outcomes across the Coral Triangle.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThermotolerance among\u003c/b\u003e \u003cb\u003eAcropora\u003c/b\u003e \u003cb\u003eshows weak correlation with photosymbiont composition\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCorals in the genus \u003cem\u003eAcropora\u003c/em\u003e are particularly reliant on their photosymbionts to meet their energy demands and thus depend more heavily on autotrophy compared to other coral species (Conti-Jerpe et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Prolonged exposure to stressors, such as abnormal temperature conditions, triggers expulsion of its photosymbionts, making \u003cem\u003eAcropora\u003c/em\u003e especially vulnerable to warming ocean conditions. Although we observed clear inter-specific differences in thermotolerance, this was only weakly correlated with photosymbiont type. For instance, ITS2 type profiles C3/C3u-C115-C21ab-C3g3 and C3u-C3-C115-C3xt were more frequently detected in \u003cem\u003eA. digitifera\u003c/em\u003e, which has relatively higher thermotolerance, though these same profiles also occurred in \u003cem\u003eA. millepora\u003c/em\u003e. This suggests that symbiont identity alone cannot account for the observed inter-specific variation in heat resilience and that host biology likely plays a stronger role. Evidence from hybridization and selective breeding studies support this view. Hybrids of \u003cem\u003eA. tenuis\u003c/em\u003e (thermosensitive) and \u003cem\u003eA. loripes\u003c/em\u003e (thermotolerant) showed enhanced resilience compared to their sensitive parent (Chan et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and offspring from thermotolerant \u003cem\u003eA. digitifera\u003c/em\u003e parents exhibited greater thermotolerance than those from thermosensitive broodstock (Humanes et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Humanes et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These imply that thermotolerance traits have some level of heritability. Future studies integrating detailed holobiont phenotyping (e.g., photosynthetic efficiency, calcification, and nutrition) with genomic approaches will be crucial to disentangle the relative contributions of hosts and their symbionts to coral thermotolerance (Conti-Jerpe et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Ros et al. \u003cspan citationid=\"CR102\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Voolstra et al. \u003cspan citationid=\"CR119\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Marzonie et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWhile host traits are important, symbiont diversity and physiology may nevertheless play a role in thermotolerance. In our dataset, the two ITS2 type profiles noted in \u003cem\u003eA. digitifera\u003c/em\u003e and \u003cem\u003eA. millepora\u003c/em\u003e were absent in \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e, which could have influenced the response of the latter species to elevated temperatures. Thermally stressed Symbiodiniaceae produce excessive reactive oxygen species (ROS), one of the major drivers of coral bleaching (Warner et al. \u003cspan citationid=\"CR122\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Tchernov et al. \u003cspan citationid=\"CR113\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Wooldridge \u003cspan citationid=\"CR126\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Wiedenmann et al. \u003cspan citationid=\"CR125\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; R\u0026auml;decker et al. \u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wiedenmann et al. \u003cspan citationid=\"CR124\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Marangon et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Yet certain genotypes can effectively mitigate oxidative stress to maintain symbiosis under heat stress. For example, two genotypes from \u003cem\u003eCladocopium proliferum\u003c/em\u003e displayed divergent responses to elevated temperatures (Levin et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The thermosensitive genotype suffered reduced photosynthetic efficiency and increased ROS, while the thermotolerant genotype upregulated ROS-scavenging and heat-shock protein genes. Subsequent studies have confirmed similar physiological divergence among these \u003cem\u003eC. proliferum\u003c/em\u003e genotypes from the Great Barrier Reef (Howells et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Beltr\u0026aacute;n et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Butler et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and among C15 genotypes of \u003cem\u003ePorites\u003c/em\u003e spp. in Palau (Hoadley et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), indicating that even within a single Symbiodiniaceae species, functional responses to heat stress can vary. Thus, the absence of certain ITS2 type profiles in \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e could indicate the loss of potentially thermotolerant symbiont types, which may have contributed to its poorer thermal performance, underscoring the interplay between host traits and symbiont physiology.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eThermotolerance of conspecifics does not correlate with photosymbionts\u003c/h2\u003e \u003cp\u003eThe variation of thermotolerance among colonies of the same species did not show correlation with Symbiodiniaceae composition. Lack of clear correlation between inter-individual thermotolerance and algal symbiont communities has also been reported in \u003cem\u003eA. digitifera\u003c/em\u003e from Palau (Humanes et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Lachs et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Humanes et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These results imply that intra-specific thermotolerance variation in \u003cem\u003eAcropora\u003c/em\u003e is not solely influenced by its photosymbionts.\u003c/p\u003e \u003cp\u003eThe disconnect between intra-specific thermotolerance and photosymbiont composition may be attributed to other colony-specific traits and environmental factors. Other sources of intra-specific variation in thermotolerance include morphology (Brown \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Enr\u0026iacute;quez et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; McWilliam et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), gene expression and epigenetics (Granados-Cifuentes et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Devlin-Durante et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Drury et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), age (Devlin-Durante et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), microhabitat (Nakamura and van Woesik \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Morikawa and Palumbi \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and microbiome (Glasl et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ziegler et al. \u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Baquiran et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Nevertheless, though photosymbiont profile was not the primary determinant of individual holobiont thermotolerance in our study, a specific photosymbiont strain may complement host traits, contributing to overall fitness under thermal stress. This pattern was observed in Okinawa, where unique combinations of \u003cem\u003eMontipora capitata\u003c/em\u003e genotypes and \u003cem\u003eCladocopium\u003c/em\u003e strains explained intra-specific variation in thermotolerance (Kavousi et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOverall, the observed ITS2 type profiles indicate that adaptive potential may not only arise from differences among host species or broad symbiont groups, but could also extend to genotypic variation within the same symbiont lineage. In the Bolinao-Anda Reef Complex, \u003cem\u003eAcropora\u003c/em\u003e harbored four distinct \u003cem\u003eC. patulum\u003c/em\u003e ITS2 type profiles, pointing to substantial intra-specific diversity within the local photosymbiont pool. Such diversity expands the possible host-symbiont pairings, each resulting in potentially distinct physiologies. Recognizing and harnessing both host and symbiont variation will be important for strategies aimed at enhancing coral persistence under climate change.\u003c/p\u003e \u003cp\u003eThere remain many gaps in our understanding of how host and symbiont traits interact to influence holobiont thermotolerance. To address these, we recommend standardizing taxonomic markers and integrating multi-omics approaches to improve species identification, functional characterization, and culturing methods. Culturing Symbiodiniaceae will also allow co-culture experiments with corals to verify the effects of Symbiodiniaceae on coral holobiont thermotolerance and help explain the processes underlying this intimate partnership. We recommend long-term co-culture experiments that assess the physiology of the holobiont, including both the host coral and its symbionts, the genetic makeup of its members and their responses to the environmental conditions. These studies will provide a deeper understanding of coral holobiont thermotolerance and inform strategies for reef conservation.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eHere, we show that acroporid corals from the same reef area in northwestern Philippines are dominated by \u003cem\u003eCladocopium\u003c/em\u003e symbionts. Several putative strains of \u003cem\u003eC. patulum\u003c/em\u003e were detected among the corals, with individual colonies each harboring a single ITS2 type profile. Interspecific and intraspecific differences in thermotolerance did not clearly correlate with symbiont composition. Collectively, our findings suggest that, while the diversity of symbionts associated with these acroporids represent functional diversity that may contribute to adaptation to warmer temperatures, variation in thermotolerance cannot be attributed solely to association with specific types of Symbiodiniaceae. Thus, further studies on taxonomic and functional diversity of Symbiodiniaceae and coral hosts, extending to other members of the holobiont (i.e., bacteria, archaea, fungi, other microeukaryotes, viruses) will greatly enhance our understanding of coral holobiont thermotolerance and could be harnessed to improve the tolerance of corals in the face of progressively warming oceans.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank Ben Jack Gabuay, Fernando Castrence Jr., and staff of the Bolinao Marine Laboratory for their invaluable assistance with the experiments. We thank the Marine Environment and Resources Foundation Inc. (MERF, Inc.) for project management support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eJohn Bennedick Quijano:\u003c/strong\u003e Data curation; formal analysis; methodology; software; visualization; writing \u0026ndash; original draft preparation; writing \u0026ndash; review \u0026amp; editing. \u003cstrong\u003eJake Ivan P. Baquiran:\u0026nbsp;\u003c/strong\u003eConceptualization; data curation; investigation; methodology; writing \u0026ndash; review \u0026amp; editing. \u003cstrong\u003eMadeleine J.H. van Oppen:\u0026nbsp;\u003c/strong\u003eConceptualization; writing \u0026ndash; original draft preparation; writing \u0026ndash; review \u0026amp; editing. \u003cstrong\u003ePatrick C. Cabaitan:\u0026nbsp;\u003c/strong\u003eFunding acquisition; writing \u0026ndash; original draft preparation; writing \u0026ndash; review \u0026amp; editing\u003cstrong\u003e. Peter L. Harrison:\u003c/strong\u003e Funding acquisition; writing \u0026ndash; original draft preparation; writing \u0026ndash; review \u0026amp; editing. \u003cstrong\u003eCecilia Conaco:\u003c/strong\u003e Conceptualization; methodology; supervision; writing \u0026ndash; original draft preparation; writing \u0026ndash; review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by a grant from the Department of Science and Technology \u0026ndash; Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (QMSR-MRRD- MEC-295-1449) awarded to PCC and CC, and by the Australian Centre for International Agricultural Research (FIS/2019/123) awarded to PLH, MJHvO, PCC, and CC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data files that support the findings of this study are available on Figshare:\u003c/p\u003e\n\u003cp\u003ehttps://doi.org/10.6084/m9.figshare.28380719.v3.\u0026nbsp;The R codes and documentation that support the analyses and findings of this study are\u003c/p\u003e\n\u003cp\u003eavailable at GitHub:\u0026nbsp;https://github.com/jbquijano/000_aten\u0026nbsp;and Zenodo:\u003c/p\u003e\n\u003cp\u003ehttps://doi.org/10.5281/zenodo.16410969.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Disclosure\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbrego D, Ulstrup KE, Willis BL, van Oppen MJH (2008) Species\u0026ndash;specific interactions between algal endosymbionts and coral hosts define their bleaching response to heat and light stress. Proc Biol Sci 275(1648):2273\u0026ndash;2282. https://doi.org/10.1098/rspb.2008.0180\u003c/li\u003e\n \u003cli\u003eAmid C, Olstedt M, Gunnarsson JS, Le Lan H, Tran Thi Minh H, Van den Brink P, Hellstr\u0026ouml;m M, Tedengren M (2018) Additive effects of the herbicide glyphosate and elevated temperature on the branched coral Acropora formosa in Nha Trang, Vietnam. Environmental Science and Pollution Research 25:13360\u0026ndash;13372\u003c/li\u003e\n \u003cli\u003eAnderson MJ (2017) Permutational Multivariate Analysis of Variance (PERMANOVA). In: Wiley StatsRef: Statistics Reference Online. John Wiley \u0026amp; Sons, Ltd, pp 1\u0026ndash;15\u003c/li\u003e\n \u003cli\u003eAnderson MJ (2006) Distance-based tests for homogeneity of multivariate dispersions. Biometrics 62(1):245\u0026ndash;253\u003c/li\u003e\n \u003cli\u003eArceo HO, Quibilan MC, Ali\u0026ntilde;o PM, Lim G, Licuanan WY (2001) Coral bleaching in Philippine reefs: coincident evidences with mesoscale thermal anomalies. Bulletin of Marine Science 69(2):579\u0026ndash;593\u003c/li\u003e\n \u003cli\u003eBaedke J, F\u0026aacute;bregas-Tejeda A, Nieves Delgado A (2020) The holobiont concept before Margulis. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 334(3):149\u0026ndash;155. https://doi.org/10.1002/jez.b.22931\u003c/li\u003e\n \u003cli\u003eBaquiran JIP, Quijano JB, van Oppen MJH, Cabaitan PC, Harrison PL, Conaco C (2025) Microbiome Stability Is Linked to Acropora Coral Thermotolerance in Northwestern Philippines. Environmental Microbiology 27(2):e70041. https://doi.org/10.1111/1462-2920.70041\u003c/li\u003e\n \u003cli\u003eBeltr\u0026aacute;n VH, Puill-Stephan E, Howells E, Flores-Moya A, Doblin M, N\u0026uacute;\u0026ntilde;ez-Lara E, Escamilla V, L\u0026oacute;pez T, van Oppen MJH (2021) Physiological diversity among sympatric, conspecific endosymbionts of coral (Cladocopium C1acro) from the Great Barrier Reef. Coral Reefs 40(4):985\u0026ndash;997. https://doi.org/10.1007/s00338-021-02092-z\u003c/li\u003e\n \u003cli\u003eBerkelmans R, van Oppen MJH (2006) The role of zooxanthellae in the thermal tolerance of corals: a \u0026lsquo;nugget of hope\u0026rsquo; for coral reefs in an era of climate change. Proc R Soc B 273(1599):2305\u0026ndash;2312. https://doi.org/10.1098/rspb.2006.3567\u003c/li\u003e\n \u003cli\u003eBray JR, Curtis JT (1957) An Ordination of the Upland Forest Communities of Southern Wisconsin. Ecological Monographs 27(4):325\u0026ndash;349. https://doi.org/10.2307/1942268\u003c/li\u003e\n \u003cli\u003eBridge TCL, Cowman PF, Quattrini AM, Bonito VE, Sinniger F, Harii S, Head CEI, Hung JY, Halafihi T, Rongo T, Baird AH (2024) A tenuis relationship: traditional taxonomy obscures systematics and biogeography of the \u0026lsquo;Acropora tenuis\u0026rsquo; (Scleractinia: Acroporidae) species complex. Zoological Journal of the Linnean Society 202(1):zlad062. https://doi.org/10.1093/zoolinnean/zlad062\u003c/li\u003e\n \u003cli\u003eBrown BE (1997) Coral bleaching: causes and consequences. Coral Reefs 16(1):S129\u0026ndash;S138. https://doi.org/10.1007/s003380050249\u003c/li\u003e\n \u003cli\u003eButler CC, Turnham KE, Lewis AM, Nitschke MR, Warner ME, Kemp DW, Hoegh-Guldberg O, Fitt WK, van Oppen MJH, LaJeunesse TC (2023) Formal recognition of host-generalist species of dinoflagellate (Cladocopium, Symbiodiniaceae) mutualistic with Indo-Pacific reef corals. Journal of Phycology 59(4):698\u0026ndash;711. https://doi.org/10.1111/jpy.13340\u003c/li\u003e\n \u003cli\u003eCantin NE, van Oppen MJH, Willis BL, Mieog JC, Negri AP (2009) Juvenile corals can acquire more carbon from high-performance algal symbionts. Coral Reefs 28(2):405\u0026ndash;414. https://doi.org/10.1007/s00338-009-0478-8\u003c/li\u003e\n \u003cli\u003eChan WY, Peplow LM, Men\u0026eacute;ndez P, Hoffmann AA, van Oppen MJH (2018) Interspecific Hybridization May Provide Novel Opportunities for Coral Reef Restoration. Frontiers in Marine Science Volume 5-2018\u003c/li\u003e\n \u003cli\u003eChankong A, Kongjandtre N, Senanan W, Manthachitra V (2020) Community composition of Symbiodiniaceae among four scleractinian corals in the eastern Gulf of Thailand. Regional Studies in Marine Science 33:100918. https://doi.org/10.1016/j.rsma.2019.100918\u003c/li\u003e\n \u003cli\u003eChauka LJ (2012) Diversity of the symbiotic alga Symbiodinium in Tanzanian scleractinian corals. Western Indian Ocean Journal of Marine Science 11:67\u0026ndash;76\u003c/li\u003e\n \u003cli\u003eChauka LJ, Steinert G, Mtolera M (2016) Influence of local environmental conditions and bleaching histories on the diversity and distribution of Symbiodinium in reef-building corals in Tanzania. African Journal of Marine Science 38(1):57\u0026ndash;64\u003c/li\u003e\n \u003cli\u003eChen B, Wei Y, Yu K, Liang Y, Yu X, Liao Z, Qin Z, Xu L, Bao Z (2024) The microbiome dynamics and interaction of endosymbiotic Symbiodiniaceae and fungi are associated with thermal bleaching susceptibility of coral holobionts. Applied and Environmental Microbiology 90(4):e01939-23\u003c/li\u003e\n \u003cli\u003eChen B, Yu K, Liang J, Huang W, Wang G, Su H, Qin Z, Huang X, Pan Z, Luo W, Luo Y, Wang Y (2019) Latitudinal Variation in the Molecular Diversity and Community Composition of Symbiodiniaceae in Coral From the South China Sea. Frontiers in Microbiology 10\u003c/li\u003e\n \u003cli\u003eChen B, Yu K, Qin Z, Liang J, Wang G, Huang X, Wu Q, Jiang L (2020) Dispersal, genetic variation, and symbiont interaction network of heat-tolerant endosymbiont Durusdinium trenchii: Insights into the adaptive potential of coral to climate change. Science of the Total Environment 723:138026\u003c/li\u003e\n \u003cli\u003eCinner JE, McClanahan TR, Graham NAJ, Daw TM, Maina J, Stead SM, Wamukota A, Brown K, Bodin \u0026Ouml; (2012) Vulnerability of coastal communities to key impacts of climate change on coral reef fisheries. Global Environmental Change 22(1):12\u0026ndash;20. https://doi.org/10.1016/j.gloenvcha.2011.09.018\u003c/li\u003e\n \u003cli\u003eColeman AW, Suarez A, Goff LJ (1994) MOLECULAR DELINEATION OF SPECIES AND SYNGENS IN VOLVOCACEAN GREEN ALGAE (CHLOROPHYTA). Journal of Phycology 30(1):80\u0026ndash;90. https://doi.org/10.1111/j.0022-3646.1994.00080.x\u003c/li\u003e\n \u003cli\u003eConti-Jerpe IE, Thompson PD, Wong CWM, Oliveira NL, Duprey NN, Moynihan MA, Baker DM (2020) Trophic strategy and bleaching resistance in reef-building corals. Science Advances 6(15):eaaz5443\u003c/li\u003e\n \u003cli\u003eCornwell B, Armstrong K, Walker NS, Lippert M, Nestor V, Golbuu Y, Palumbi SR (2021) Widespread variation in heat tolerance and symbiont load are associated with growth tradeoffs in the coral Acropora hyacinthus in Palau. Elife 10:e64790\u003c/li\u003e\n \u003cli\u003eDa-Anoy J, Posadas N, Conaco C (2024) Interspecies differences in the transcriptome response of corals to acute heat stress. PeerJ 12:e18627. https://doi.org/10.7717/peerj.18627\u003c/li\u003e\n \u003cli\u003eDa-Anoy JP, Cabaitan PC, Conaco C (2019) Species variability in the response to elevated temperature of select corals in north-western Philippines. Journal of the Marine Biological Association of the United Kingdom 99(6):1273\u0026ndash;1279\u003c/li\u003e\n \u003cli\u003eD\u0026rsquo;Angelo C, Hume BCC, Burt J, Smith EG, Achterberg EP, Wiedenmann J (2015) Local adaptation constrains the distribution potential of heat-tolerant Symbiodinium from the Persian/Arabian Gulf. ISME J 9(12):2551\u0026ndash;2560. https://doi.org/10.1038/ismej.2015.80\u003c/li\u003e\n \u003cli\u003eDenis H, Bay LK, Mocellin VJ, Naugle MS, Lecellier G, Purcell SW, Berteaux-Lecellier V, Howells EJ (2024) Thermal tolerance traits of individual corals are widely distributed across the Great Barrier Reef. Proceedings of the Royal Society B 291(2030):20240587\u003c/li\u003e\n \u003cli\u003eDevlin-Durante MK, Miller MW, Caribbean Acropora Research Group, Precht WF, Baums IB (2016) How old are you? Genet age estimates in a clonal animal. Molecular Ecology 25(22):5628\u0026ndash;5646. https://doi.org/10.1111/mec.13865\u003c/li\u003e\n \u003cli\u003eDiaz JM, Hansel CM, Apprill A, Brighi C, Zhang T, Weber L, McNally S, Xun L (2016) Species-specific control of external superoxide levels by the coral holobiont during a natural bleaching event. Nature Communications 7(1):13801\u003c/li\u003e\n \u003cli\u003eDizon RM, Edwards AJ, Gomez ED (2008) Comparison of three types of adhesives in attaching coral transplants to clam shell substrates. Aquatic Conservation: Marine and Freshwater Ecosystems 18(7):1140\u0026ndash;1148. https://doi.org/10.1002/aqc.944\u003c/li\u003e\n \u003cli\u003eDizon RM, Yap HT (2006) Effects of multiple perturbations on the survivorship of fragments of three coral species. Marine Pollution Bulletin 52(8):928\u0026ndash;934. https://doi.org/10.1016/j.marpolbul.2005.12.009\u003c/li\u003e\n \u003cli\u003eDrury C, Bean NK, Harris CI, Hancock JR, Huckeba J, Roach TN, Quinn RA, Gates RD (2022) Intrapopulation adaptive variance supports thermal tolerance in a reef-building coral. Communications biology 5(1):486\u003c/li\u003e\n \u003cli\u003eDunn OJ (1964) Multiple comparisons using rank sums. Technometrics 6(3):241\u0026ndash;252\u003c/li\u003e\n \u003cli\u003eEddy TD, Lam VWY, Reygondeau G, Cisneros-Montemayor AM, Greer K, Palomares MLD, Bruno JF, Ota Y, Cheung WWL (2021) Global decline in capacity of coral reefs to provide ecosystem services. One Earth 4(9):1278\u0026ndash;1285. https://doi.org/10.1016/j.oneear.2021.08.016\u003c/li\u003e\n \u003cli\u003eEnr\u0026iacute;quez S, M\u0026eacute;ndez ER,\u0026nbsp;‐Prieto RI (2005) Multiple scattering on coral skeletons enhances light absorption by symbiotic algae. Limnology and Oceanography 50(4):1025\u0026ndash;1032\u003c/li\u003e\n \u003cli\u003eEren AM, Morrison HG, Lescault PJ, Reveillaud J, Vineis JH, Sogin ML (2015) Minimum entropy decomposition: Unsupervised oligotyping for sensitive partitioning of high-throughput marker gene sequences. ISME J 9(4):968\u0026ndash;979. https://doi.org/10.1038/ismej.2014.195\u003c/li\u003e\n \u003cli\u003eFalkowski PG, Dubinsky Z, Muscatine L, Porter JW (1984) Light and the Bioenergetics of a Symbiotic Coral. BioScience 34(11):705\u0026ndash;709. https://doi.org/10.2307/1309663\u003c/li\u003e\n \u003cli\u003eFisher R, O\u0026rsquo;Leary RA, Low-Choy S, Mengersen K, Knowlton N, Brainard RE, Caley MJ (2015) Species Richness on Coral Reefs and the Pursuit of Convergent Global Estimates. Current Biology 25(4):500\u0026ndash;505. https://doi.org/10.1016/j.cub.2014.12.022\u003c/li\u003e\n \u003cli\u003eFitt W, Gates R, Hoegh-Guldberg O, Bythell J, Jatkar A, Grottoli A, Gomez M, Fisher P, Lajuenesse T, Pantos O, others (2009) Response of two species of Indo-Pacific corals, Porites cylindrica and Stylophora pistillata, to short-term thermal stress: The host does matter in determining the tolerance of corals to bleaching. Journal of experimental marine biology and ecology 373(2):102\u0026ndash;110\u003c/li\u003e\n \u003cli\u003eGlasl B, Herndl GJ, Frade PR (2016) The microbiome of coral surface mucus has a key role in mediating holobiont health and survival upon disturbance. The ISME journal 10(9):2280\u0026ndash;2292\u003c/li\u003e\n \u003cli\u003eGong S, Xu L, Yu K, Zhang F, Li Z (2019) Differences in Symbiodiniaceae communities and photosynthesis following thermal bleaching of massive corals in the northern part of the South China Sea. Marine Pollution Bulletin 144:196\u0026ndash;204. https://doi.org/10.1016/j.marpolbul.2019.04.069\u003c/li\u003e\n \u003cli\u003eGower JC (2015) Principal Coordinates Analysis. In: Wiley StatsRef: Statistics Reference Online. pp 1\u0026ndash;7\u003c/li\u003e\n \u003cli\u003eGranados-Cifuentes C, Bellantuono AJ, Ridgway T, Hoegh-Guldberg O, Rodriguez-Lanetty M (2013) High natural gene expression variation in the reef-building coral Acropora millepora: potential for acclimative and adaptive plasticity. BMC genomics 14:1\u0026ndash;12\u003c/li\u003e\n \u003cli\u003eGrottoli AG, Martins PD, Wilkins MJ, Johnston MD, Warner ME, Cai W-J, Melman TF, Hoadley KD, Pettay DT, Levas S, Schoepf V (2018) Coral physiology and microbiome dynamics under combined warming and ocean acidification. PLOS ONE 13(1):e0191156. https://doi.org/10.1371/journal.pone.0191156\u003c/li\u003e\n \u003cli\u003eHandiani DN, Ningsih NS, Beliyana E (2025) Coral bleaching occurrence and its relation to marine heatwave events in the Southwestern waters of South Sulawesi, Indonesia, as part of the Coral Triangle region. Journal of Marine Systems 252:104136. https://doi.org/10.1016/j.jmarsys.2025.104136\u003c/li\u003e\n \u003cli\u003eHarrison PL, dela Cruz DW, Cameron KA, Cabaitan PC (2021) Increased Coral Larval Supply Enhances Recruitment for Coral and Fish Habitat Restoration. Frontiers in Marine Science Volume 8-2021\u003c/li\u003e\n \u003cli\u003eHazraty-Kari S, Tavakoli-Kolour P, Kitanobo S, Nakamura T, Morita M (2022) Adaptations by the coral Acropora tenuis confer resilience to future thermal stress. Communications Biology 5(1):1371. https://doi.org/10.1038/s42003-022-04309-5\u003c/li\u003e\n \u003cli\u003eHoadley KD, Pettay DT, Lewis A, Wham D, Grasso C, Smith R, Kemp DW, LaJeunesse T, Warner ME (2021) Different functional traits among closely related algal symbionts dictate stress endurance for vital Indo-Pacific reef-building corals. Global Change Biology 27(20):5295\u0026ndash;5309\u003c/li\u003e\n \u003cli\u003eHoegh-Guldberg O, Kennedy EV, Beyer HL, McClennen C, Possingham HP (2018) Securing a Long-term Future for Coral Reefs. Trends in Ecology \u0026amp; Evolution 33(12):936\u0026ndash;944. https://doi.org/10.1016/j.tree.2018.09.006\u003c/li\u003e\n \u003cli\u003eHoogenboom MO, Frank GE, Chase TJ, Jurriaans S, \u0026Aacute;lvarez-Noriega M, Peterson K, Critchell K, Berry KL, Nicolet KJ, Ramsby B, others (2017) Environmental drivers of variation in bleaching severity of Acropora species during an extreme thermal anomaly. Frontiers in Marine Science 4:376\u003c/li\u003e\n \u003cli\u003eHowells EJ, Beltran VH, Larsen NW, Bay LK, Willis BL, van Oppen MJH (2012) Coral thermal tolerance shaped by local adaptation of photosymbionts. Nature Clim Change 2(2):116\u0026ndash;120. https://doi.org/10.1038/nclimate1330\u003c/li\u003e\n \u003cli\u003eHowlett L, Camp EF, Locatelli NS, Baums IB, Strudwick P, Rassmussen S, Suggett DJ (2024) Population and clonal structure of Acropora cf. hyacinthus to inform coral restoration practices on the Great Barrier Reef. Coral Reefs 43(4):1023\u0026ndash;1035. https://doi.org/10.1007/s00338-024-02520-w\u003c/li\u003e\n \u003cli\u003eHughes TP, Anderson KD, Connolly SR, Heron SF, Kerry JT, Lough JM, Baird AH, Baum JK, Berumen ML, Bridge TC, Claar DC, Eakin CM, Gilmour JP, Graham NAJ, Harrison H, Hobbs J-PA, Hoey AS, Hoogenboom M, Lowe RJ, McCulloch MT, Pandolfi JM, Pratchett M, Schoepf V, Torda G, Wilson SK (2018) Spatial and temporal patterns of mass bleaching of corals in the Anthropocene. Science 359(6371):80\u0026ndash;83. https://doi.org/10.1126/science.aan8048\u003c/li\u003e\n \u003cli\u003eHughes TP, Barnes ML, Bellwood DR, Cinner JE, Cumming GS, Jackson JBC, Kleypas J, van de Leemput IA, Lough JM, Morrison TH, Palumbi SR, van Nes EH, Scheffer M (2017) Coral reefs in the Anthropocene. Nature 546(7656):82\u0026ndash;90. https://doi.org/10.1038/nature22901\u003c/li\u003e\n \u003cli\u003eHumanes A, Lachs L, Beauchamp E, Bukurou L, Buzzoni D, Bythell J, Craggs JR, de la Torre Cerro R, Edwards AJ, Golbuu Y, others (2024) Selective breeding enhances coral heat tolerance to marine heatwaves. Nature Communications 15(1):8703\u003c/li\u003e\n \u003cli\u003eHumanes A, Lachs L, Beauchamp EA, Bythell JC, Edwards AJ, Golbuu Y, Martinez HM, Palmowski P, Treumann A, van der Steeg E, van Hooidonk R, Guest JR (2022) Within-population variability in coral heat tolerance indicates climate adaptation potential. Proceedings of the Royal Society B: Biological Sciences 289(1981):20220872. https://doi.org/10.1098/rspb.2022.0872\u003c/li\u003e\n \u003cli\u003eHume BC, Smith EG, Ziegler M, Warrington HJ, Burt JA, LaJeunesse TC, Wiedenmann J, Voolstra CR (2019) SymPortal: A novel analytical framework and platform for coral algal symbiont next‐generation sequencing ITS2 profiling. Molecular ecology resources 19(4):1063\u0026ndash;1080\u003c/li\u003e\n \u003cli\u003eIp JC-H, Zhang Y, Xie JY, Yeung YH, Qiu J-W (2022) Stable Symbiodiniaceae composition in three coral species during the 2017 natural bleaching event in subtropical Hong Kong. Marine Pollution Bulletin 184:114224. https://doi.org/10.1016/j.marpolbul.2022.114224\u003c/li\u003e\n \u003cli\u003eJimenez IM, K\u0026uuml;hl M, Larkum AW, Ralph PJ (2011) Effects of flow and colony morphology on the thermal boundary layer of corals. Journal of The Royal Society Interface 8(65):1785\u0026ndash;1795\u003c/li\u003e\n \u003cli\u003eKaplan EL, Meier P (1958) Nonparametric Estimation from Incomplete Observations. Journal of the American Statistical Association 53(282):457\u0026ndash;481. https://doi.org/10.2307/2281868\u003c/li\u003e\n \u003cli\u003eKavousi J, Denis V, Sharp V, Reimer JD, Nakamura T, Parkinson JE (2020) Unique combinations of coral host and algal symbiont genotypes reflect intraspecific variation in heat stress responses among colonies of the reef-building coral, Montipora digitata. Marine Biology 167(2):23. https://doi.org/10.1007/s00227-019-3632-z\u003c/li\u003e\n \u003cli\u003eKemp DW, Hoadley KD, Lewis AM, Wham DC, Smith RT, Warner ME, LaJeunesse TC (2023) Thermotolerant coral\u0026ndash;algal mutualisms maintain high rates of nutrient transfer while exposed to heat stress. Proceedings of the Royal Society B 290(2007):20231403\u003c/li\u003e\n \u003cli\u003eKleypas JA, Castruccio FS, Curchitser EN, Mcleod E (2015) The impact of ENSO on coral heat stress in the western equatorial Pacific. Global Change Biology 21(7):2525\u0026ndash;2539\u003c/li\u003e\n \u003cli\u003eKruskal WH, Wallis WA (1952) Use of ranks in one-criterion variance analysis. Journal of the American statistical Association 47(260):583\u0026ndash;621\u003c/li\u003e\n \u003cli\u003eLachs L, Humanes A, Pygas DR, Bythell JC, Mumby PJ, Ferrari R, Figueira WF, Beauchamp E, East HK, Edwards AJ, Golbuu Y, Martinez HM, Sommer B, van der Steeg E, Guest JR (2023) No apparent trade-offs associated with heat tolerance in a reef-building coral. Communications Biology 6(1):400. https://doi.org/10.1038/s42003-023-04758-6\u003c/li\u003e\n \u003cli\u003eLaJeunesse TC (2002) Diversity and community structure of symbiotic dinoflagellates from Caribbean coral reefs. Marine biology 141:387\u0026ndash;400\u003c/li\u003e\n \u003cli\u003eLaJeunesse TC, Pettay DT, Sampayo EM, Phongsuwan N, Brown B, Obura DO, Hoegh‐Guldberg O, Fitt WK (2010) Long‐standing environmental conditions, geographic isolation and host\u0026ndash;symbiont specificity influence the relative ecological dominance and genetic diversification of coral endosymbionts in the genus Symbiodinium. Journal of Biogeography 37(5):785\u0026ndash;800\u003c/li\u003e\n \u003cli\u003eLee LK, Leaw CP, Lee LC, Lim ZF, Hii KS, Chan AA, Gu H, Lim PT (2022) Molecular diversity and assemblages of coral symbionts (Symbiodiniaceae) in diverse scleractinian coral species. Marine Environmental Research 179:105706. https://doi.org/10.1016/j.marenvres.2022.105706\u003c/li\u003e\n \u003cli\u003eLegendre P, Anderson MJ (1999) DISTANCE-BASED REDUNDANCY ANALYSIS: TESTING MULTISPECIES RESPONSES IN MULTIFACTORIAL ECOLOGICAL EXPERIMENTS. Ecological Monographs 69(1):1\u0026ndash;24. https://doi.org/10.1890/0012-9615(1999)069%255B0001:DBRATM%255D2.0.CO;2\u003c/li\u003e\n \u003cli\u003eLevin RA, Beltran VH, Hill R, Kjelleberg S, McDougald D, Steinberg PD, van Oppen MJH (2016) Sex, Scavengers, and Chaperones: Transcriptome Secrets of Divergent Symbiodinium Thermal Tolerances. Molecular Biology and Evolution 33(9):2201\u0026ndash;2215. https://doi.org/10.1093/molbev/msw119\u003c/li\u003e\n \u003cli\u003eLewis AM, Butler CC, Turnham KE, Wham DF, Hoadley KD, Smith RT, Kemp DW, Warner ME, LaJeunesse TC (2024) The diversity, distribution, and temporal stability of coral \u0026lsquo;zooxanthellae\u0026rsquo;on a pacific reef: from the scale of individual colonies to across the host community. Coral Reefs 43(4):841\u0026ndash;856\u003c/li\u003e\n \u003cli\u003eLi Y, Chen R-W, Liu X, Li Z, Zhu W, Wang A, Li X (2024) The adaptation of three scleractinian corals from the perspectives of Symbiodiniaceae and photosynthesis capacity at Luhuitou fringing reef. Marine Biology 171(8):151. https://doi.org/10.1007/s00227-024-04472-9\u003c/li\u003e\n \u003cli\u003eLin S, Li L, Zhou Z, Yuan H, Saad OS, Tang J, Cai W, Yu K, Lin S (2024) Higher genotypic diversity and distinct assembly mechanism of free-living Symbiodiniaceae assemblages than sympatric coral-endosymbiotic assemblages in a tropical coral reef. Microbiology Spectrum 12(8):e00514-24. https://doi.org/10.1128/spectrum.00514-24\u003c/li\u003e\n \u003cli\u003eLoya Y, Sakai K, Yamazato K, Nakano Y, Sambali H, van Woesik R (2001) Coral bleaching: the winners and the losers. Ecology Letters 4(2):122\u0026ndash;131. https://doi.org/10.1046/j.1461-0248.2001.00203.x\u003c/li\u003e\n \u003cli\u003eLozupone CA, Hamady M, Kelley ST, Knight R (2007) Quantitative and qualitative \u0026beta; diversity measures lead to different insights into factors that structure microbial communities. Applied and environmental microbiology 73(5):1576\u0026ndash;1585\u003c/li\u003e\n \u003cli\u003eMarangon E, R\u0026auml;decker N, Li JYQ, Terzin M, Buerger P, Webster NS, Bourne DG, Laffy PW (2025) Destabilization of mutualistic interactions shapes the early heat stress response of the coral holobiont. Microbiome 13(1):31. https://doi.org/10.1186/s40168-024-02006-5\u003c/li\u003e\n \u003cli\u003eMartinez Arbizu P (2020) pairwiseAdonis: Pairwise multilevel comparison using adonis. R package version 04 1\u003c/li\u003e\n \u003cli\u003eMarzonie MR, Nitschke MR, Bay LK, Bourne DG, Harrison HB (2024) Symbiodiniaceae diversity varies by host and environment across thermally distinct reefs. Molecular Ecology 33(9):e17342. https://doi.org/10.1111/mec.17342\u003c/li\u003e\n \u003cli\u003eMclachlan R, Grottoli AG (2021) Image Analysis to Quantify Coral Bleaching Using Greyscale Model. protocols.io. https://doi.org/dx.doi.org/10.17504/protocols.io.bx8wprxe\u003c/li\u003e\n \u003cli\u003eMcLeod E, Moffitt R, Timmermann A, Salm R, Menviel L, Palmer MJ, Selig ER, Casey KS, Bruno JF (2010) Warming seas in the coral triangle: coral reef vulnerability and management implications. Coastal Management 38(5):518\u0026ndash;539\u003c/li\u003e\n \u003cli\u003eMcWilliam M, Madin JS, Chase TJ, Hoogenboom MO, Bridge TCL (2022) Intraspecific variation reshapes coral assemblages under elevated temperature and acidity. Ecology Letters 25(11):2513\u0026ndash;2524. https://doi.org/10.1111/ele.14114\u003c/li\u003e\n \u003cli\u003eMellin C, Brown S, Cantin N, Klein-Salas E, Mouillot D, Heron SF, Fordham DA (2024) Cumulative risk of future bleaching for the world\u0026rsquo;s coral reefs. Science Advances 10(26):eadn9660. https://doi.org/10.1126/sciadv.adn9660\u003c/li\u003e\n \u003cli\u003eMillion WC, Ruggeri M, O\u0026rsquo;Donnell S, Bartels E, Conn T, Krediet CJ, Kenkel CD (2022) Evidence for adaptive morphological plasticity in the Caribbean coral, Acropora cervicornis. Proceedings of the National Academy of Sciences 119(49):e2203925119. https://doi.org/10.1073/pnas.2203925119\u003c/li\u003e\n \u003cli\u003eMorikawa MK, Palumbi SR (2019) Using naturally occurring climate resilient corals to construct bleaching-resistant nurseries. Proceedings of the National Academy of Sciences 116(21):10586\u0026ndash;10591\u003c/li\u003e\n \u003cli\u003eMurray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8(19):4321\u0026ndash;4325. https://doi.org/10.1093/nar/8.19.4321\u003c/li\u003e\n \u003cli\u003eNakamura T, van Woesik R (2001) Water-flow rates and passive diffusion partially explain differential survival of corals during the 1998 bleaching event. Mar Ecol Prog Ser 212:301\u0026ndash;304\u003c/li\u003e\n \u003cli\u003eNaugle MS, Denis H, Mocellin VJ, Laffy PW, Popovic I, Bay LK, Howells EJ (2024) Heat tolerance varies considerably within a reef-building coral species on the Great Barrier Reef. Communications earth \u0026amp; environment 5(1):525\u003c/li\u003e\n \u003cli\u003eOksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin P, O\u0026rsquo;Hara R, Simpson G, Solymos P (2022) vegan: Community Ecology Package. R package version 2.5\u0026ndash;7. 2020\u003c/li\u003e\n \u003cli\u003eOliver ECJ, Burrows MT, Donat MG, Sen Gupta A, Alexander LV, Perkins-Kirkpatrick SE, Benthuysen JA, Hobday AJ, Holbrook NJ, Moore PJ, Thomsen MS, Wernberg T, Smale DA (2019) Projected Marine Heatwaves in the 21st Century and the Potential for Ecological Impact. Frontiers in Marine Science Volume 6-2019. https://doi.org/10.3389/fmars.2019.00734\u003c/li\u003e\n \u003cli\u003ePalacio-Castro AM, Smith TB, Brandtneris V, Snyder GA, van Hooidonk R, Mat\u0026eacute; JL, Manzello D, Glynn PW, Fong P, Baker AC (2023) Increased dominance of heat-tolerant symbionts creates resilient coral reefs in near-term ocean warming. Proceedings of the National Academy of Sciences 120(8):e2202388120. https://doi.org/10.1073/pnas.2202388120\u003c/li\u003e\n \u003cli\u003ePe\u0026ntilde;aflor EL, Skirving WJ, Strong AE, Heron SF, David LT (2009) Sea-surface temperature and thermal stress in the Coral Triangle over the past two decades. Coral Reefs 28(4):841. https://doi.org/10.1007/s00338-009-0522-8\u003c/li\u003e\n \u003cli\u003ePosit team (2025) RStudio: Integrated Development Environment for R. Posit Software, PBC, Boston, MA\u003c/li\u003e\n \u003cli\u003eQin Z, Yu K, Chen B, Wang Y, Liang J, Luo W, Xu L, Huang X (2019) Diversity of Symbiodiniaceae in 15 Coral Species From the Southern South China Sea: Potential Relationship With Coral Thermal Adaptability. Frontiers in Microbiology Volume 10-2019\u003c/li\u003e\n \u003cli\u003eQin Z, Yu K, Chen S, Chen B, Liang J, Yao Q, Yu X, Liao Z, Deng C, Liang Y (2021) Microbiome of juvenile corals in the outer reef slope and lagoon of the South China Sea: insight into coral acclimatization to extreme thermal environments. Environmental Microbiology 23(8):4389\u0026ndash;4404. https://doi.org/10.1111/1462-2920.15624\u003c/li\u003e\n \u003cli\u003eQuimpo TJR, Requilme JNC, Gomez EJ, Sayco SLG, Tolentino MPS, Cabaitan PC (2020) Low coral bleaching prevalence at the Bolinao-Anda Reef Complex, northwestern Philippines during the 2016 thermal stress event. Marine Pollution Bulletin 160:111567. https://doi.org/10.1016/j.marpolbul.2020.111567\u003c/li\u003e\n \u003cli\u003eR Core Team (2023) R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria\u003c/li\u003e\n \u003cli\u003eRabbani G, Afiq-Rosli L, Lee JN, Waheed Z, Wainwright BJ (2025) Effects of life history strategy on the diversity and composition of the coral holobiont communities of Sabah, Malaysia. Scientific Reports 15(1):4459\u003c/li\u003e\n \u003cli\u003eR\u0026auml;decker N, Pogoreutz C, Gegner HM, C\u0026aacute;rdenas A, Roth F, Bougoure J, Guagliardo P, Wild C, Pernice M, Raina J-B, Meibom A, Voolstra CR (2021) Heat stress destabilizes symbiotic nutrient cycling in corals. Proceedings of the National Academy of Sciences 118(5):e2022653118. https://doi.org/10.1073/pnas.2022653118\u003c/li\u003e\n \u003cli\u003eRavelo SF, Conaco C (2018) Comparison of the response of in hospite and ex hospite Symbiodinium to elevated temperature. Marine and Freshwater Behaviour and Physiology 51(2):93\u0026ndash;108\u003c/li\u003e\n \u003cli\u003eRos M, Camp EF, Hughes DJ, Crosswell JR, Warner ME, Leggat WP, Suggett DJ (2020) Unlocking the black-box of inorganic carbon-uptake and utilization strategies among coral endosymbionts (Symbiodiniaceae). Limnology and Oceanography 65(8):1747\u0026ndash;1763\u003c/li\u003e\n \u003cli\u003eSayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, Connor R, Funk K, Kelly C, Kim S, Madej T, Marchler-Bauer A, Lanczycki C, Lathrop S, Lu Z, Thibaud-Nissen F, Murphy T, Phan L, Skripchenko Y, Tse T, Wang J, Williams R, Trawick BW, Pruitt KD, Sherry ST (2022) Database resources of the national center for biotechnology information. Nucleic Acids Research 50(D1):D20\u0026ndash;D26. https://doi.org/10.1093/nar/gkab1112\u003c/li\u003e\n \u003cli\u003eSchloerke B, Crowley J, Cook D (2018) Package \u0026lsquo;ggally.\u0026rsquo; Extension to \u0026lsquo;ggplot2 713\u003c/li\u003e\n \u003cli\u003eSchloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF (2009) Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities. Applied and Environmental Microbiology 75(23):7537\u0026ndash;7541. https://doi.org/10.1128/AEM.01541-09\u003c/li\u003e\n \u003cli\u003eSeveso D, Arrigoni R, Montano S, Maggioni D, Orlandi I, Berumen ML, Galli P, Vai M (2020) Investigating the heat shock protein response involved in coral bleaching across scleractinian species in the central Red Sea. Coral Reefs 39:85\u0026ndash;98\u003c/li\u003e\n \u003cli\u003eShah S, Dougan KE, Bhattacharya D, Chan CX (2022) Coral Conservation from the Genomic Perspective on Symbiodiniaceae Diversity and Function in the Holobiont. In: van Oppen MJH, Aranda Lastra M (eds) Coral Reef Conservation and Restoration in the Omics Age. Springer International Publishing, Cham, pp 85\u0026ndash;96\u003c/li\u003e\n \u003cli\u003eSiebeck UE, Marshall NJ, Kl\u0026uuml;ter A, Hoegh-Guldberg O (2006) Monitoring coral bleaching using a colour reference card. Coral Reefs 25(3):453\u0026ndash;460. https://doi.org/10.1007/s00338-006-0123-8\u003c/li\u003e\n \u003cli\u003eSikorskaya TV, Ermolenko EV, Efimova KV, Dang LTP (2022) Coral Holobionts Possess Distinct Lipid Profiles That May Be Shaped by Symbiodiniaceae Taxonomy. Marine Drugs 20(8):485. https://doi.org/10.3390/md20080485\u003c/li\u003e\n \u003cli\u003eSmith EG, Gurskaya A, Hume BC, Voolstra CR, Todd PA, Bauman AG, Burt JA (2020) Low Symbiodiniaceae diversity in a turbid marginal reef environment. Coral Reefs 39(3):545\u0026ndash;553\u003c/li\u003e\n \u003cli\u003eSmith H, Epstein H, Torda G (2017) The molecular basis of differential morphology and bleaching thresholds in two morphs of the coral Pocillopora acuta. Scientific Reports 7(1):10066\u003c/li\u003e\n \u003cli\u003eStat M, Bird CE, Pochon X, Chasqui L, Chauka LJ, Concepcion GT, Logan D, Takabayashi M, Toonen RJ, Gates RD (2011) Variation in Symbiodinium ITS2 Sequence Assemblages among Coral Colonies. PLOS ONE 6(1):e15854. https://doi.org/10.1371/journal.pone.0015854\u003c/li\u003e\n \u003cli\u003eTchernov D, Gorbunov MY, de Vargas C, Narayan Yadav S, Milligan AJ, H\u0026auml;ggblom M, Falkowski PG (2004) Membrane lipids of symbiotic algae are diagnostic of sensitivity to thermal bleaching in corals. Proceedings of the National Academy of Sciences 101(37):13531\u0026ndash;13535. https://doi.org/10.1073/pnas.0402907101\u003c/li\u003e\n \u003cli\u003eTorres AF, Valino DAM, Ravago-Gotanco R (2021) Zooxanthellae Diversity and Coral-Symbiont Associations in the Philippine Archipelago: Specificity and Adaptability Across Thermal Gradients. Frontiers in Marine Science 8\u003c/li\u003e\n \u003cli\u003eTrench R (1993) Microalgal-invertebrate Ssmbioses-a review. Endocyt Cell Res 9:135\u0026ndash;175\u003c/li\u003e\n \u003cli\u003eTurnham KE, Aschaffenburg MD, Pettay DT, Paz-Garc\u0026iacute;a DA, Reyes-Bonilla H, Pinz\u0026oacute;n J, Timmins E, Smith RT, McGinley MP, Warner ME, LaJeunesse TC (2023) High physiological function for corals with thermally tolerant, host-adapted symbionts. Proceedings of the Royal Society B: Biological Sciences 290(2003):20231021. https://doi.org/10.1098/rspb.2023.1021\u003c/li\u003e\n \u003cli\u003evan Oppen MJH, Nitschke MR (2022) Increasing Coral Thermal Bleaching Tolerance via the Manipulation of Associated Microbes. In: van Oppen MJH, Aranda Lastra M (eds) Coral Reef Conservation and Restoration in the Omics Age. Springer International Publishing, Cham, pp 117\u0026ndash;133\u003c/li\u003e\n \u003cli\u003evan Oppen MJH, Oliver JK, Putnam HM, Gates RD (2015) Building coral reef resilience through assisted evolution. Proceedings of the National Academy of Sciences 112(8):2307\u0026ndash;2313. https://doi.org/10.1073/pnas.1422301112\u003c/li\u003e\n \u003cli\u003eVoolstra CR, Buitrago-L\u0026oacute;pez C, Perna G, C\u0026aacute;rdenas A, Hume BC, R\u0026auml;decker N, Barshis DJ (2020) Standardized short-term acute heat stress assays resolve historical differences in coral thermotolerance across microhabitat reef sites. Global Change Biology 26(8):4328\u0026ndash;4343\u003c/li\u003e\n \u003cli\u003eVoolstra CR, Suggett DJ, Peixoto RS, Parkinson JE, Quigley KM, Silveira CB, Sweet M, Muller EM, Barshis DJ, Bourne DG, Aranda M (2021) Extending the natural adaptive capacity of coral holobionts. Nat Rev Earth Environ 2(11):747\u0026ndash;762. https://doi.org/10.1038/s43017-021-00214-3\u003c/li\u003e\n \u003cli\u003eWall CB, Kaluhiokalani M, Popp BN, Donahue MJ, Gates RD (2020) Divergent symbiont communities determine the physiology and nutrition of a reef coral across a light-availability gradient. ISME J 14(4):945\u0026ndash;958. https://doi.org/10.1038/s41396-019-0570-1\u003c/li\u003e\n \u003cli\u003eWarner ME, Fitt WK, Schmidt GW (1999) Damage to photosystem II in symbiotic dinoflagellates: A determinant of coral bleaching. Proceedings of the National Academy of Sciences 96(14):8007\u0026ndash;8012. https://doi.org/10.1073/pnas.96.14.8007\u003c/li\u003e\n \u003cli\u003eWickham H, Averick M, Bryan J, Chang W, McGowan LD, Fran\u0026ccedil;ois R, Grolemund G, Hayes A, Henry L, Hester J, Kuhn M, Pedersen TL, Miller E, Bache SM, M\u0026uuml;ller K, Ooms J, Robinson D, Seidel DP, Spinu V, Takahashi K, Vaughan D, Wilke C, Woo K, Yutani H (2019) Welcome to the tidyverse. Journal of Open Source Software 4(43):1686. https://doi.org/10.21105/joss.01686\u003c/li\u003e\n \u003cli\u003eWiedenmann J, D\u0026rsquo;Angelo C, Mardones ML, Moore S, Benkwitt CE, Graham NAJ, Hambach B, Wilson PA, Vanstone J, Eyal G, Ben-Zvi O, Loya Y, Genin A (2023) Reef-building corals farm and feed on their photosynthetic symbionts. Nature 620(7976):1018\u0026ndash;1024. https://doi.org/10.1038/s41586-023-06442-5\u003c/li\u003e\n \u003cli\u003eWiedenmann J, D\u0026rsquo;Angelo C, Smith EG, Hunt AN, Legiret F-E, Postle AD, Achterberg EP (2013) Nutrient enrichment can increase the susceptibility of reef corals to bleaching. Nature Climate Change 3(2):160\u0026ndash;164\u003c/li\u003e\n \u003cli\u003eWooldridge SA (2009) A new conceptual model for the warm-water breakdown of the coral\u0026ndash;algae endosymbiosis. Marine \u0026amp; Freshwater Research 60(6):483\u0026ndash;496. https://doi.org/10.1071/MF08251\u003c/li\u003e\n \u003cli\u003eYap HT, Alino PM, Gomez ED (1992) Trends in growth and mortality of three coral species(Anthozoa: Scleractinia), including effects of transplantation. Marine ecology progress series Oldendorf 83(1):91\u0026ndash;101\u003c/li\u003e\n \u003cli\u003eZiegler M, Seneca FO, Yum LK, Palumbi SR, Voolstra CR (2017) Bacterial community dynamics are linked to patterns of coral heat tolerance. Nature Communications 8(1):14213. https://doi.org/10.1038/ncomms14213\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"coral-reefs","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"core","sideBox":"Learn more about [Coral Reefs](http://link.springer.com/journal/338)","snPcode":"338","submissionUrl":"https://submission.nature.com/new-submission/338/3","title":"Coral Reefs","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Acropora digitifera, Acropora millepora, Acropora cf. tenuis, heat tolerance, ITS2 metabarcoding, Bolinao-Anda Reef Complex (BARC)","lastPublishedDoi":"10.21203/rs.3.rs-8838536/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8838536/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCoral reefs worldwide are threatened by rapid warming of the oceans, yet many corals persist despite thermal stress. Reefs in northwestern Philippines, which are frequently exposed to elevated temperatures (29\u0026ndash;30\u0026deg;C, mean monthly maximum), present an opportunity to examine inter-colony variation in thermotolerance and its correlation with Symbiodiniaceae, the coral\u0026rsquo;s microalgal symbiotic partner. In this study, we assessed the thermotolerance of individual colonies of three \u003cem\u003eAcropora\u003c/em\u003e species, \u003cem\u003eA. digitifera\u003c/em\u003e, \u003cem\u003eA. millepora\u003c/em\u003e, and \u003cem\u003eA.\u003c/em\u003e cf. \u003cem\u003etenuis\u003c/em\u003e, from a reef in Anda, Pangasinan, Philippines. Thermotolerance varied within and among species. ITS2 metabarcoding revealed that the corals host four closely related strains of \u003cem\u003eCladocopium patulum\u003c/em\u003e (formerly referred to as \u0026ldquo;type C3u\u0026rdquo;). However, inter- and intra-specific differences in thermotolerance did not show strong correlation with symbiont composition. These findings suggest that while Symbiodiniaceae communities may contribute to heat resilience in corals, they do not solely explain the marked difference in thermotolerance among individuals.\u003c/p\u003e","manuscriptTitle":"Acroporids in northwestern Philippines with varied thermotolerance host similar photosymbionts","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-06 05:23:27","doi":"10.21203/rs.3.rs-8838536/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-06T04:34:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-01T12:27:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-01T10:39:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"154133320215946286368038994644540914294","date":"2026-03-04T02:36:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33212306594745015516368206585166883640","date":"2026-03-02T06:17:49+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-02T02:21:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-13T13:14:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-12T07:42:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Coral Reefs","date":"2026-02-10T07:59:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"coral-reefs","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"core","sideBox":"Learn more about [Coral Reefs](http://link.springer.com/journal/338)","snPcode":"338","submissionUrl":"https://submission.nature.com/new-submission/338/3","title":"Coral Reefs","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8e99dddf-dfea-43d3-bd0b-20bd33f5e8e1","owner":[],"postedDate":"March 6th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-29T10:08:48+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-06 05:23:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8838536","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8838536","identity":"rs-8838536","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.