The FTO-regulated circNFATC3/miR-23b-3p axis promotes RAI14-mediated gastric cancer progression via lipid metabolic reprogramming

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Aim To determine the mechanism by which fat mass and the obesity-associated protein (FTO)-regulated circNFATC3/miR-23b-3p axis influence RAI14-mediated gastric cancer (GC) progression. Methods Retinoic acid-induced protein 14 (RAI14), adenosine 5′-monophosphate-activated protein kinase (AMPK), mTOR (mTOR), sterol regulatory element-binding protein 1 (SREBP1), ATP citrate lyase (ACLY), fatty acid synthase (FASN), and miR-23b-3p expression was assessed via quantitative real-time polymerase chain reaction and/or western blotting. Cell viability, proliferative and migratory were determined via MTT, colony formation, and Transwell assays. Tumor growth was monitored in vivo via a xenograft model, and protein expression was evaluated viaimmunohistochemical staining. RNA immunoprecipitation (RIP) and methylated RNA immunoprecipitation (MeRIP) assays were performed to examine the direct interaction between FTO and circNFATC3 and to assess the m6A modification level of circNFATC3. N6-methyladenosine (m6A)-regulated genes targeted by circNFATC3 were predicted via the miRanda algorithm. Results RAI14 overexpression decreased miR-23b-3p and AMPK expression but increased mTOR, SREBP1, ACLY, and FASN expression in GC cells. AMPK, mTOR, and SREBP1 modulation affects GC cell growth and invasiveness. circNFATC3 overexpression facilitated tumor growth in vivo, accompanied by elevated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression and decreased AMPK expression. circNFATC3 depletion inhibited tumor growth. RIP assays confirmed the direct binding of FTO protein to circNFATC3 RNA. MeRIP assays demonstrated that FTO overexpression/knowdown decreased/increased m6A modification on circNFATC3. FTO overexpression/depletion increased/decreased circNFATC3 expression and decreased/increased miR-23b-3p expression. FTO enhances GC cell proliferation and invasion by influencing circNFATC3 expression. Analysis of human GC tissues revealed lower AMPK expression than that in adjacent normal tissues. Conclusion Lipid synthesis and metabolic reprogramming play critical roles in energy metabolism, growth, and proliferation in GC. FTO directly binds to circNFATC3 and regulates the circNFATC3/miR-23b-3p/RAI14 axis during GC progression through an m6A-dependent mechanism.
Full text 146,123 characters · extracted from preprint-html · click to expand
The FTO-regulated circNFATC3/miR-23b-3p axis promotes RAI14-mediated gastric cancer progression via lipid metabolic reprogramming | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The FTO-regulated circNFATC3/miR-23b-3p axis promotes RAI14-mediated gastric cancer progression via lipid metabolic reprogramming Xinxin Yan, Zhendan Yao, Yanmeng Liu, Yinshi Xu, Jingxuan Qiu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9252847/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aim To determine the mechanism by which fat mass and the obesity-associated protein (FTO)-regulated circNFATC3/miR-23b-3p axis influence RAI14-mediated gastric cancer (GC) progression. Methods Retinoic acid-induced protein 14 (RAI14), adenosine 5′-monophosphate-activated protein kinase (AMPK), mTOR (mTOR), sterol regulatory element-binding protein 1 (SREBP1), ATP citrate lyase (ACLY), fatty acid synthase (FASN), and miR-23b-3p expression was assessed via quantitative real-time polymerase chain reaction and/or western blotting. Cell viability, proliferative and migratory were determined via MTT, colony formation, and Transwell assays. Tumor growth was monitored in vivo via a xenograft model, and protein expression was evaluated viaimmunohistochemical staining. RNA immunoprecipitation (RIP) and methylated RNA immunoprecipitation (MeRIP) assays were performed to examine the direct interaction between FTO and circNFATC3 and to assess the m6A modification level of circNFATC3. N6-methyladenosine (m6A)-regulated genes targeted by circNFATC3 were predicted via the miRanda algorithm. Results RAI14 overexpression decreased miR-23b-3p and AMPK expression but increased mTOR, SREBP1, ACLY, and FASN expression in GC cells. AMPK, mTOR, and SREBP1 modulation affects GC cell growth and invasiveness. circNFATC3 overexpression facilitated tumor growth in vivo, accompanied by elevated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression and decreased AMPK expression. circNFATC3 depletion inhibited tumor growth. RIP assays confirmed the direct binding of FTO protein to circNFATC3 RNA. MeRIP assays demonstrated that FTO overexpression/knowdown decreased/increased m6A modification on circNFATC3. FTO overexpression/depletion increased/decreased circNFATC3 expression and decreased/increased miR-23b-3p expression. FTO enhances GC cell proliferation and invasion by influencing circNFATC3 expression. Analysis of human GC tissues revealed lower AMPK expression than that in adjacent normal tissues. Conclusion Lipid synthesis and metabolic reprogramming play critical roles in energy metabolism, growth, and proliferation in GC. FTO directly binds to circNFATC3 and regulates the circNFATC3/miR-23b-3p/RAI14 axis during GC progression through an m6A-dependent mechanism. FTO circNFATC3 lipid metabolism reprogramming gastric cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction Gastric cancer (GC) is the fifth most prevalent and third deadliest malignancy globally [ 1 ], with 1,089,103 cases diagnosed in 2020, 44% of which occurred in China. Early GC detection remains challenging, and its prognosis is grim, as the 5-year survival rate for advanced GC is lower than 10% [ 2 ]. Obesity is a significant risk factor for GC [ 3 ], as epidemiological findings have demonstrated distinct associations between higher body mass index or excessive waist circumference and elevated GC risk [ 4 , 5 ]. Although adipose infiltration is observed within GC tumors, fatty acid metabolism in GC remains poorly understood, and no investigations have explored the impact of lipid metabolism on the prognosis of GC [ 6 ]. Elucidating the molecular mechanisms by which fatty acid metabolism influences GC could provide pivotal insights into disease progression and prognosis while fuelling the development of novel therapeutic interventions targeting metabolic pathways. Sterol regulatory element-binding proteins (SREBPs) are transcription factors with pivotal roles in orchestrating lipid synthesis. They respond to a variety of signals to modulate the expression of enzymes involved in cholesterol and fatty acid synthesis and uptake [ 7 ]. Many investigations have implicated SREBP dysregulation in cancer progression [ 8 ]. Cancer is characterized by increased SREBP expression, which promotes tumor growth. Hence, lipid metabolism plays a critical role in cancer metabolism [ 9 ], highlighting the need to scrutinize its involvement in GC onset, progression, and prognosis. The adenosine 5′-monophosphate-activated protein kinase (AMPK)/mechanistic target of rapamycin (mTOR)/SREBP1 axis, a key enzymatic pathway in lipid synthesis metabolism, has been implicated in the regulation of various metabolic diseases, inflammatory conditions, and cancers. AMPK and mTOR are crucial cellular nutrition sensors and regulators of cellular proliferation[ 10 , 11 ]. mTOR, which serves as a nexus for growth factors and nutritional signals, modulates diverse cellular processes, including growth, proliferation, and survival [ 12 , 13 ]. mTORC1 promotes de novo lipid synthesis via SREBP transcription factors [ 14 ]. Studies have indicated that patients with mTOR-positive GC exhibit markedly shorter median survival than their mTOR-negative counterparts do, indicating a poorer prognosis for those with mTOR-positive GC [ 15 ]. Notably, one study linked the retinoic acid-induced protein 14 (RAI14) gene to cancer aggressiveness and drug resistance [ 16 ]. Data from The Cancer Genome Atlas and Gene Expression Omnibus databases revealed a significant increase in RAI14 expression in GC compared with that in normal gastric tissue. Elevated RAI14 expression in GC is correlated with significantly reduced overall and disease-free survival [ 17 – 19 ]. Research has suggested that RAI14 can influence GC progression via the mTOR pathway [ 20 ]. Given the interplay between RAI14 and mTOR and the correlations of RAI14 with the development, progression, and prognosis of GC, further investigation into RAI14’s ability to modulate lipid metabolism via the AMPK/mTOR/SREBP1 pathway is warranted. Circular RNAs (circRNAs) affect tumor growth and metastasis in a variety of cancers by regulating the expression of their target genes [ 21 , 22 ][ 23 ]. Because of their stability against degradation, circRNAs can serve as early cancer diagnostic biomarkers, prognostic indicators, and prospective therapeutic targets in cancer. Our preliminary investigations revealed a correlation between elevated RAI14 expression and poor prognosis in patients with GC. Our data revealed that upon upregulation via the circNFATC3/miR-23b-3p axis, RAI14 promotes GC cell proliferation and invasion, but the precise mechanisms remain obscure. N6-methyladenosine (m6A) is a common mRNA modification involved in the pathogenesis of various diseases, including cancer [ 24 , 25 ]. Researchers have revealed that circRNAs are m6A-modified in multiple cancers[ 26 , 27 ]. Therefore, the uncharted terrain of m6A-mediated circNFATC3/miR-23b-3p signaling targeting RAI14 warrants exploration. Our preliminary investigations revealed that the downregulation of circNFATC3 (also termed hsa_circ_0039930) can modulate the miR-23b-3p/RAI14 axis, suppressing cell proliferation and invasion in GC [ 28 ]. Given that m6A promotes cancer initiation via circRNAs, it is conceivable that m6A might potentiate cancer development through a binding interface with circNFATC3. Bioinformatics has been used to predict circNFATC3 target genes regulated by m6A (Supplementary Fig. S1), and fat mass and obesity-associated protein (FTO) were identified. Notably, FTO is closely related to lipid metabolism, and it is a m6A “eraser” [ 29 ]. FTO-mediated m6A RNA methylation has broad functional effects on internal homeostasis, with any perturbation in m6A levels precipitating functional impairments or diseases. Human GC tissues exhibit FTO overexpression, which is associated with breast, thyroid, and endometrial cancers. FTO expression is correlated with GC differentiation and lymph node metastasis, among other factors, suggesting a correlation with GC prognosis [ 30 – 32 ]. In our previous work, we analyzed the expression of FTO in gastric cancer via Bulk-RNAs and its relationship with clinical features, demonstrating the potential of FTO as a biomarker for gastric cancer (Supplementary Fig. S2). Therefore, we hypothesized that FTO mediates m6A modifications that regulate circNFATC3. Supplementary Fig. S1 circNFATC3 (hsa_circ_0039930) targets m6A-regulated genes as predicted by miRanda. Circles represent circRNAs, squares represent coding genes, and green lines indicate the predicted binding relationships between them. Supplementary Fig. S2 Expression of FTO in gastric cancer and its relationship with clinical features. Fig. S2A Expression levels of FTO in cancer tissues and adjacent non-cancerous tissues. FIG. S2B Expression of FTO in different tumor stages. FIG. S2C Expression of FTO in different genders. FIG.S2D Expression of FTO among different age groups. FIG. S2E Expression of FTO across different pathological stages. FIG. S2F Expression of FTO in relation to tumor size (T), lymph node metastasis (N), and whether the tumor has metastasized (M). FIG. S2G Overall survival (OS), disease-free survival (DFS), and disease-specific survival (DSS) in high and low expression groups of FTO. FIG.S2H Comparison of OS and DFS between the 80% and 20% groups of FTO gene expression. Materials and methods Tissue microarrays The continuous section of a human GC tumor tissue array was assembled by Outdo Biotech Co., Ltd. (Lot No. HStm-Ade060CS-01, Shanghai, China). This dataset consisted of 28 GC tissue samples juxtaposed with an equal number of adjacent nontumor tissue samples. The pertinent pathological parameters characterizing both GC and adjacent normal tissues are described in Table 1 . The study was approved by the Ethics Committee of Beijing Aerospace Center Hospital (No. 2021-AMHTG-002). Table 1 Clinicopathological parameters of patients with GC Sex GC tissue Adjacent non-tumor Male 20 20 Female 8 8 Age (years) 64.11 ± 10.51 64.11 ± 10.51 Stage I 4 4 II 9 9 III 11 11 IV 4 4 Degree of infiltration Mucous layer 1 1 Muscular layer 4 4 Placenta percreta 10 10 Full thickness 13 13 Cell culture and transfection GES-1 human gastric epithelial cells and GC cell lines (HGC-27, AGS, SGC-7901, BGC-823, MGC-803, and MKN-28) were obtained from FUTURE BIOTECH Co. Ltd. (Beijing, China) and cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% heat-inactivated fetal bovine serum and antibiotics (100 U/ml penicillin and 100 U/ml streptomycin). The cells were cultured in an incubator in a 5% CO 2 atmosphere with 95% humidity at 37°C. RAI14 plasmids, siRNAs targeting RAI14, lentivirus-mediated circNFATC3, si-circNFATC3, and miR-23b-3p mimics/inhibitors were purchased from GenePharma (Shanghai, China). Negative-control (NC) plasmids or lentiviruses and miR-NC were used as the control vectors. The oligonucleotides and plasmids used in this study are described in Table 2 . Table 2 Oligonucleotides and plasmids used in this study RAI14 siRNA Sense (5′→3′) Antisense (5′→3′) GCUGCUUCUUGCUGUACAATT UUGUACAGCAAGAAGCAGCTT AMPK siRNA GGGCCACAAUCAAAGAUAUTT AUAUCUUUGAUUGUGGCCCTT mTOR siRNA GGCCUAUGGUCGAGAUUUATT UAAAUCUCGACCAUAGGCCTT SREBP1 siRNA CUCUCAGGAUGCUGAUUUATT UAAAUCAGCAUCCUGAGAGTT FTO siRNA CAGGAACCUUGGAUUAUAUTT AUAUAAUCCAAGGUUCCUGTT miR-23b-3p mimic AUCACAUUGCCAGGGAUUACCAC GGUAAUCCCUGGCAAUGUGAUUU miR-23b-3p inhibitor GUGGUAAUCCCUGGCAAUGUGAU circNFATC3 inhibitor TTGTGAAGCACATCTTCAT Quantitative real-time polymerase chain reaction (qRT‒PCR) Total RNA was extracted from cells via TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized via M-MLV Reverse Transcriptase (#28025013; Thermo Fisher Scientific, USA) per the manufacturer’s protocol. For miRNA detection, total RNA was isolated from cells via a High Pure miRNA isolation kit (#05080576001, Roche, Basel, Switzerland), and a TaqMan MicroRNA Reverse Transcription Kit (#4366596, Life Technologies, Thermo Fisher Scientific) was used to synthesize first-strand cDNA. The expression of target genes was determined in triplicate via qRT‒PCR via iTaq™ Universal SYBR® Green Supermix (1725121, Bio-Rad Laboratories, Hercules, CA, USA). The expression of target genes was normalized to that of GAPDH and β-actin. The relative expression of the target genes was calculated via the 2 −ΔΔCt method. The sequences of primers used in this study are listed in Table 3 . RNA Immunoprecipitation (RIP) Assay RIP assays were performed to determine the interaction between FTO protein and circNFATC3 using the EZ-Magna RIP Kit (#17-10499, Millipore, Burlington, MA, USA) according to the manufacturer’s instructions. Briefly, AGS and HGC-27 cells with FTO overexpression (oeFTO) and the respective controls (oeNC and siNC) were harvested and lysed in complete RIP lysis buffer. Cell lysates (approximately 2 × 10 7 cells per sample) were incubated with magnetic beads conjugated to anti-FTO antibody (#ab126605, Abcam, Cambridge, UK) or normal rabbit IgG (negative control) overnight at 4°C with rotation. After extensive washing with RIP wash buffer, the immunoprecipitated RNA–protein complexes were treated with proteinase K to digest proteins. RNA was subsequently extracted and purified. The enrichment of circNFATC3 in the immunoprecipitates was quantified by qRT-PCR. Methylated RNA Immunoprecipitation (MeRIP) Assay The m6A modification level of circNFATC3 was assessed using the Magna MeRIP m6A Kit (#17-10499, Millipore) following the manufacturer’s protocol. Total RNA was extracted from AGS and HGC-27 cells transfected with FTO overexpression vector (oeFTO) or FTO-targeting siRNA (siFTO) and their respective controls (oeNC and siNC) using the ReliaPrep RNA Miniprep System (#Z6010, Promega, Madison, WI, USA). Poly(A)+ mRNA was enriched using the PolyATtract mRNA Isolation System (#Z5210, Promega). Approximately 100 µg of purified RNA was chemically fragmented and incubated with anti-m6A antibody-conjugated magnetic beads or IgG control (provided in the kit) overnight at 4°C with gentle rotation. After immunoprecipitation and washing, the m6A-modified RNA fragments were eluted and subjected to qRT-PCR analysis using circNFATC3-specific primers. Table 3 Primer sequences Gene Forward (5′→3′) Reverse (5′→3′) miR-23b-3p GCGGTCATCACATTGCCAG TATGGTTGTTCACGACTCCTTCAC AMPK TTGAAACCTGAAAATGTCCTGCT GGTGAGCCACAACTTGTTCTT mTOR ATGCTTGGAACCGGACCTG TCTTGACTCATCTCTCGGAGTT SREBP1 CTTGGAGCGAGCACTGAATTG GGGCATCTGAGAACTCCTTGTC ACLY TCGGCCAAGGCAATTTCAGAG CGAGCATACTTGAACCGATTCT FASN AAGGACCTGTCTAGGTTTGATGC TGGCTTCATAGGTGACTTCCA RAI14 AGCCCAAGATACTACCGGACA CGCTGCATAATGTAAAGCTGTTT circNFATC3 AAACTGAAGGTAGCCGAGGG CCAAAATGAGCTGGTAAAGGCC GAPDH TGCACCACCAACTGCTTAGC GGCATGTCAGATCCACAACGG β-actin CCTCTATGCCAACACAGTGCTG CACGATGCCAGTGAGGTCTTCC Western blotting Western blotting was conducted as previously described [ 33 ]. In brief, the cells were solubilized with radioimmunoprecipitation assay buffer, and the cleared whole-cell lysate was obtained via centrifugation. The protein concentration in the total cell lysate was evaluated via the Bradford method. The same amount of cell lysate from each indicated group was separated by SDS‒PAGE and transferred onto PVDF membranes. The membranes were blocked with 5% skim milk for 1 h at room temperature, followed by incubation with the following primary antibodies overnight at 4°C: anti-RAI14 (1:2000, ab137118, Abcam, Cambridge, UK), anti-AMPK (1:1000, ab32047, Abcam), anti-mTOR (1:1000, ab32028, Abcam), anti-SREBP1 (1:1000, ab28481, Abcam), anti-ATP citrate lyase (ACLY, 1:10,000, ab40793, Abcam), anti-fatty acid synthase (FASN, 1:10,000, ab128870, Abcam), and β-actin (1:1000, ab8226, Abcam). The next day, the membrane was washed with TBST (three times, 10 min each) and incubated with HRP-conjugated goat-anti-rabbit IgG (1:2000, ab9485, Abcam) for 1 h at room temperature. The membrane was subsequently developed with enhanced chemiluminescence substrate (Thermo Fisher Scientific) and imaged via a Tanon-5200 imaging system (Tanon, Shanghai, China). The images were analyzed via ImageJ software (NIH, Bethesda, MD, USA), and the intensity values of the protein bands were normalized to those of β-actin. Human GC xenografts in immunodeficient mice BALB/c nude mice (male, 4–5 weeks old) were purchased from Shanghai SIPPR-BK Laboratory Animal Co. Ltd. (Shanghai, China). The mice were randomly assigned to two groups (n = 8/group), and each mouse received a subcutaneous injection of 200 µL of sterile PBS containing 1 × 10 6 GC cells (AGS and HGC-27) into the flank area under the indicated conditions. All animals were euthanized after 4 weeks, the tumors were collected, and the final tumor weights were recorded. The tumor tissues were subsequently fixed in 4% paraformaldehyde for 24 h, embedded in paraffin or O.C.T. compound, and sectioned for immunohistochemistry (IHC) and oil red O (ORO) staining. All animal experiments were performed in accordance with the Animal Ethics Committee of Beijing Aerospace Center Hospital (No. 2021-AMHTG-002). IHC Antigen retrieval was conducted via a heat-induced epitope retrieval technique employing sodium citrate buffer at pH 6.0. Endogenous peroxidase activity was quenched by the addition of hydrogen peroxide, and the samples were blocked with TBST supplemented with 5% normal goat serum. The sections were subsequently incubated overnight at 4°C with the following primary antibodies: anti-RAI14 (1:500), anti-FTO (1:200, FNab09787, Fine Biotech, Wuhan China), anti-AMPK (1:1000), anti-mTOR (1:1000, ab32028), anti-SREBP1 (1:500), anti-ACLY (1:500, ab40793), anti-FASN (1:500), and anti-Ki67 (1:200, ab15580, Abcam). Following thorough washing with TBST, the sections were incubated with a goat anti-rabbit IgG secondary antibody (1:200) for 1 h at room temperature. The subsequent steps involved additional washing, incubation with peroxidase substrate, dehydration, and mounting. Image evaluation was performed via ImageJ software by an experienced researcher who was blinded to the study design, and the results are presented as the mean integrated optical density (IOD). The detailed IHC experimental procedures were described elsewhere [ 33 ]. ORO staining O.C.T. compound-embedded sections (10 µm) were fixed in 10% formalin solution, washed with distilled water, and rinsed with 60% isopropanol. The sections were subsequently stained with ORO (O1391, Sigma‒Aldrich, St. Louis, MO, USA) staining solution for 15 min according to the manufacturer’s protocol, followed by a brief rinse with 60% isopropanol. Thereafter, the nuclei were counterstained with hematoxylin. The sections were rinsed with distilled water before being mounted with glycerol gelatin. The sections were subsequently examined and imaged under a microscope. ORO staining was quantified via Image-Pro Plus 7.0 software. The results are presented as the percentage area of red lipid droplets relative to the entire image area. Cell proliferation analyses Cell viability was analyzed via the MTT assay. In brief, 5 × 10 3 cells were seeded into a 96-well plate in 100 µL of culture medium. The cells were allowed to adhere to the growing surface for 2 h. Subsequently, 10 µL of MTT solution (5 mg/mL) was added to the culture medium, followed by 4 h of incubation. The absorbance (OD) at 450 nm was subsequently determined via an Enzyme Immunoassay Analyzer (Bio-Rad) to assess cell viability. Cell proliferation was also determined by a colony formation assay. In brief, the cells were cultured in 6-cm plates at a density of 50, 100, or 200 per dish for 14–21 days. Colonies were then fixed for 20 min with 4% formaldehyde and stained with 0.1% crystal violet for 10–30 min. Colonies containing ≥ 10 cells were counted under a microscope. Transwell invasion assay Cell invasion was measured via the Transwell invasion assay. In general, Millicell inserts precoated with extracellular matrix (2 mg/mL) were placed into multiwell plates containing complete culture medium. In total, 1 × 10 5 cells suspended in starvation medium were loaded into the chamber of the cell insert and incubated for 24 h. Subsequently, the extracellular matrix and cells remaining in the upper chamber were removed. The cells that crossed the cell insert membrane were fixed (5% glutaraldehyde, 10 min), stained (1% crystal violet, 20 min), and imaged. The average counts were taken from five randomly selected fields. Statistical analysis The data are presented as the means ± SEMs. Graphs were generated via SPSS 20.0 (IBM, Armonk, NY, USA) and GraphPad Prism version 9.5 (GraphPad Software, Boston, MA, USA). Pairwise comparisons were conducted via Student’s t test, whereas multiple comparisons were performed via two-way analysis of variance with the Bonferroni post hoc correction. P < 0.05 was considered statistically significant. Results circNFATC3 expression in GC cell lines On the basis of our previous research, we identified 12 upregulated circRNAs and 13 downregulated circRNAs in GC tissues ( P 3) and found that circNFATC3 was markedly upregulated in GC ( P = 0.002, FC = 8.50)[ 28 ]. Our investigations indicated that circNFATC3 favors a poor prognosis in patients with GC [ 28 ]. To confirm our previous findings, qRT‒PCR was conducted to determine circNFATC3 expression in various lines of GC cells (HGC-27, AGS, SGC-7901, GBC-823, MGC-803, and MKN-28) and normal gastric epithelial cells (GES-1). These findings revealed increased circNFATC3 expression in BGC-823, SGC-7901, HGC-27, and MGC-803 cells and decreased expression in MKN-28 and AGS cells compared with GES-1 cells (Fig. 1 ) Upregulation of RAI14 in GC with low circNFATC3 expression was inversely related to miR-23b-3p and AMPK expression Our previous study demonstrated that RAI14 is regulated by the circNFATC3/miR-23b-3p axis and that it plays an important role in GC cell proliferation and invasion [ 28 ]. These findings confirmed the importance of RAI14 in GC tumorigenesis. Therefore, we modulated RAI14 expression in GC cells via lentivirus-mediated overexpression or siRNA-mediated gene silencing. RAI14 upregulation (LV5-RAI14) led to diminished miR-23b-3p and AMPK expression, accompanied by increased mTOR, SREBP1, ACLY, and FASN expression, at both the mRNA and protein levels compared with those in the blank control and vector control (LV5-GFP) groups (Fig. 2 ). These observations are consistent with our previous findings in a large cohort of GC tissues[ 28 ]. Conversely, RAI14 depletion (RAI14 siRNA) in GC cell lines with increased circNFATC3 expression (BGC-823, SGC-7901, HGC-27, and MGC-803) resulted in increased expression of miR-23b-3p and AMPK and decreased expression of mTOR, SREBP1, ACLY, and FASN at both the mRNA and protein levels compared with those in the blank control and nontargeting control (Control siRNA) groups (Fig. 3 ). These results indicate the involvement of RAI14 in the regulation of these genes. Specifically, we observed opposing trends in RAI14-mediated modulation of miR-23b-3p and AMPK expression compared with mTOR, SREBP1, ACLY, and FASN expression in GC cells. Therefore, it is reasonable to speculate that RAI14 affects the cellular functions of GCs by regulating the expression of these genes. Downregulation of AMPK, coupled with upregulation of mTOR/SREBP1, facilitates cell growth and invasion in GC To test this hypothesis, we depleted AMPK and overexpressed mTOR and SREBP1 in AGS and MKN-28 cells and assessed the expression of miR-23b-3p, RAI14, ACLY, and FASN via qRT‒PCR and/or western blotting. The results demonstrated that changes in AMPK, mTOR, and SREBP1 expression did not affect the expression of miR-23b-3p but resulted in RAI14, ACLY, and FASN upregulation (Fig. 4A1–B2). Moreover, downregulation of AMPK and overexpression of mTOR and SREBP1 significantly facilitated proliferation (Fig. 4C1), colony formation (Fig. 4 D), and migration (Fig. 4 E) in GC cells. Upregulation of AMPK and downregulation of mTOR/SREBP1 repressed cell proliferation, colony formation, and invasion in GC In GC cells with high circNFATC3 expression, we simultaneously overexpressed AMPK and silenced mTOR and SREBP1 (LV5-AMPK+mTOR siRNA+SERBP1 siRNA). We subsequently determined the expression of miR-23b-3p, RAI14, ACLY, and FASN. These findings revealed that altering AMPK, mTOR, and SREBP1 expression did not change the expression of miR-23b-3p. However, RAI14, ACLY, and FASN were repressed ( Fig. 5 A–B ). In addition, AMPK overexpression and mTOR and SREBP1 depletion inhibited the proliferation (Fig. 5C1), colony formation ( Fig. 5 D ), and migration ( Fig. 5 E ) of GC cells. circNFATC3 facilitates GC progression in vivo To investigate the in vivo effects of circNFATC3 on GC tumorigenesis, we established a xenograft tumor model using AGS cells with or without circNFATC3 overexpression (LV5-circNFATC3 and LV5-GFP). The results demonstrated that the volumes and weights of GC tumors were greater in the circNFATC3 group than in the control group, in which the tumor cells were transduced with vehicle alone (Fig. 6A1, A2). IHC revealed that RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression was significantly greater in the circNFATC3 group than in the LV5-GFP group (Fig. 6B1). Conversely, the expression of AMPK was lower in the former group. Furthermore, miR-23b-3p expression was decreased in the circNFATC3 group (Fig. 6C1). ORO staining revealed increased lipid droplet content in the circNFATC3 group (Fig. 6D1, D2), and triglyceride (TG) levels were also elevated (Fig. 6E1). Knockdown of circNFATC3 repressed GC tumorigenesis in vivo In parallel, we employed HGC-27 cells with or without circNFATC3 depletion (LV5-sg circNFATC3 and LV5-GFP) to generate a xenograft model and monitored tumor growth in vivo . Compared with those in the LV5-GFP group, the tumors in the circNFATC3-depleted (si-circNFATC3) group presented smaller volumes and lower weights (Fig. 7A1, A2). IHC demonstrated that RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression was significantly lower in the circNFATC3-depleted group than in the LV5-GFP group (Fig. 7B1), accompanied by increased AMPK expression. Additionally, miR-23b-3p expression was increased in the si-circNFATC3 group compared with the LV5-GFP group (Fig. 7C1). ORO staining confirmed a reduction in lipid droplet levels (Fig. 6D1, D2) and decreased TG levels in the si-circNFATC3 group (Fig. 7E1). FTO directly binds to circNFATC3 and regulates its expression through m6A demethylation To investigate whether FTO directly interacts with circNFATC3, RIP assays were performed in GC cells. In AGS cells and HGC-27 cells, FTO overexpression (oeFTO) significantly increased the enrichment of circNFATC3 in the anti-FTO immunoprecipitates compared with the negative control group (oeNC) (Fig. 8 A). These findings demonstrate that FTO protein directly binds to circNFATC3 RNA in GC cells. Given that FTO functions as an m6A demethylase, we further examined whether FTO regulates circNFATC3 through m6A modification using MeRIP assays. In AGS cells, FTO overexpression (oeFTO) significantly decreased the m6A modification level of circNFATC3 compared with the control group (oeNC), whereas FTO knockdown (siFTO) markedly increased the m6A enrichment of circNFATC3 compared with the siNC group (Fig. 8 B). Consistent results were obtained in HGC-27 cells, where oeFTO reduced and siFTO elevated the m6A modification of circNFATC3 (Fig. 8 C). These results indicate that FTO regulates circNFATC3 expression through m6A demethylation, providing direct evidence for the m6A-dependent regulatory mechanism of FTO on circNFATC3 in GC cells. FTO promotes the proliferation and invasion of GC cells by regulating circNFATC3 Using qRT‒PCR, AGS cells with decreased circNFATC3 expression were transfected with FTO or vehicle vector. Consequently, a significant increase in circNFATC3 expression was observed (Fig. 9 A), as was significant miR-23b-3p downregulation (Fig. 9 B). Moreover, the increase in FTO expression significantly potentiated cellular proliferation (Fig. 9 C), colony formation (Fig. 9D1), and invasion (Fig. 9E1) compared with those in the LV5-GFP group. Similarly, HGC-27 cells harboring elevated circNFATC3 expression were transfected with FTO-targeting siRNA or empty vector. This intervention resulted in a discernible decrease in circNFATC3 expression along with a notable increase in miR-23b-3p expression. Notably, the suppression of FTO impeded cellular proliferation (Fig. 10 C), colony formation (Fig. 10D1), and invasion (Fig. 10E1) compared with the findings in the LV5-CAG-GFP group. Expression of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN in normal gastric and GC tissues We further validated the findings via IHC via a tissue microarray. Significantly lower RAI14, FTO, SREBP1, mTOR, ACLY, and FASN expression was observed in normal gastric tissues than in their corresponding GC tissues, as reflected by the lower mean IOD (Fig. 11 A–F). Conversely, an inverse trend was observed for AMPK expression, which was decreased in GC tissues (Fig. 11 G). These results corroborate our in vitro studies, confirming the low expression of AMPK and high expression of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN in GC tissues (Fig. 11 ). The consistency across in vivo , in vitro , and human GC tissue analyses highlighted the involvement of these molecules in GC onset and established their interrelation. However, because of the limited availability of GC tissues, no further investigations have been conducted. Discussion Accumulating evidence has highlighted the role of lipid metabolism in cancer [ 9 , 34 – 36 ], particularly through pathways involving AMPK, mTOR, and SREBP1. In GC, circNFATC3 has been linked to the regulation of the miR-23b-3p/RAI14 axis, thereby influencing cell growth and invasion [ 28 ]. However, the mechanism by which RAI14 influences GC metastasis and its interaction with circNFATC3 remain unclear. We hypothesized that m6A modification regulates circNFATC3, affecting the miR-23b-3p/RAI14 pathway and potentially inducing GC via lipid metabolism reprogramming. AMPK serves as a crucial regulator of cellular trophism and growth, with its activity finely tuned by various upstream signals [ 37 ]. In this study, RAI14 upregulation led to a decrease in miR-23b-3p and AMPK expression, suggesting that AMPK, which is pivotal for maintaining energy homeostasis, can counteract the procancer effects of RAI14. The changes in AMPK expression mirrored those observed for miR-23b-3p. circRNAs constitute a class of noncoding RNAs that play critical roles in regulating gene expression in GC, either by promoting or inhibiting tumor progression [ 38 ][ 39 ]. Previous studies, including ours, confirmed the oncogenic effects of circNFATC3 in GC [ 28 ][ 40 ]. In the present study, we found that increasing RAI14 expression in GC cell lines with low circNFATC3 expression suppressed miR-23b-3p and AMPK expression while increasing the expression of mTOR, SREBP1, ACLY, and FASN, all of which are implicated in lipid metabolism, making them potential targets for cancer therapy [ 41 – 43 ]. These findings highlight the interplay between RAI14 and lipid metabolism in GC cells, with circNFATC3 acting as a crucial mediator. Our results revealed that modulating the expression of downstream effectors of RAI14, including AMPK, mTOR, and SREBP1, influences the expression and functions of lipid metabolism regulators, such as ACLY and FASN, in GC cells. Specifically, simultaneously upregulating AMPK and downregulating mTOR/SREBP1 increased the protein expression of ACLY and FASN, thereby promoting cellular proliferation and invasion. Conversely, depleting AMPK and overexpressing mTOR/SREBP1 suppressed the expression of ACLY and FASN, concomitantly inhibiting cell proliferation and invasion. These findings confirm, at least partially, that the stimulation of RAI14 in GC development is related to lipid metabolism. Accumulating evidence has established the importance of lipid metabolism in cancer progression [ 44 ]. Previous studies have also demonstrated the role of RAI14 in GC development [ 17 , 18 ]. For the first time, our study extends our knowledge by demonstrating that RAI14 promotes GC progression by regulating lipid metabolic pathways. Interestingly, we observed a potential regulatory loop among RAI14, AMPK, mTOR, and SREBP1. Whereas RAI14 overexpression decreased AMPK and increased mTOR/SREBP1 expression (Fig. 1 ), RAI14 silencing had the opposite effect (Fig. 2 ). Moreover, combined AMPK knockdown and mTOR/SREPB overexpression increased the expression of RAI14 (Fig. 3 ). These observations suggest a potential positive feedback mechanism. As AMPK, mTOR, and SREBP1 are closely involved in transcriptional regulation, it is possible that these molecules directly or indirectly influence RAI14 transcription. Further investigations are needed to explore the exact molecular activities supporting this regulatory network. Understanding the regulatory relationships among these molecules could provide novel insights into metabolic adaptations in GC and help uncover potential combinational therapy strategies targeting multiple molecules in GC. Moreover, animal studies confirmed the role of circNFATC3 in promoting GC growth, as evidenced by increases in tumor volume and weight; decreased AMPK and miR-23b-3p expression; and elevated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression. Conversely, circNFATC3 suppression decreased tumor size; upregulated AMPK and miR-23b-3p; and downregulated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 while reducing TG and lipid levels. These results underscore the regulatory role of circNFATC3 in lipid metabolism, through which it contributes to GC progression. In parallel, increased circNFATC3 expression in GC tissues was also confirmed by other groups. Elevated expression of circNFATC3 is positively correlated with tumor volume, highlighting its potential significance in GC progression [ 40 ]. Our study, on the basis of these findings, is the first to report the relationship between circNFATC3 and lipid metabolism in GC. These findings both expand our understanding of metabolic reprogramming in GC and reveal potential therapeutic targets. Both in vitro and in vivo experiments revealed consistent changes in GC tissues and normal tissues. AMPK expression was low in GC tissues, whereas RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN expression was elevated. These findings suggest crucial roles for these factors in GC initiation and progression. However, because of the limited sample size, further investigations are warranted to elucidate their relationships in human GC tissues. Metabolic reprogramming is a hallmark of malignant tumors. In eukaryotes, m6A methylation, involving “writers,” “erasers,” and “readers,” plays a crucial role in regulating mRNAs [ 45 ]. Recent studies have suggested a close relationship between mTOR signaling and m6A methylation in the regulation of tumor metabolism [ 46 ]. The results of our previous studies revealed that circNFATC3 plays a critical role in GC progression by regulating the miR-23b-3p/RAI14 axis to increase cancer cell proliferation and invasion[ 28 ]. Given the role of m6A in circRNA regulation, we hypothesized that FTO regulates circNFATC3 expression during GC progression in an m6A-dependent manner. This hypothesis was initially supported by our bioinformatics analysis predicting the interaction between FTO and circNFATC3 (Supplementary Fig. 1), and was subsequently validated by our RIP and MeRIP experiments. FTO, a m6A eraser, demethylates m6A to promote mRNA splicing and translation. Many studies have illustrated the associations of FTO with various malignancies, including endometrial cancer[ 47 , 48 ], breast cancer[ 49 ], pancreatic cancer[ 50 ], and melanoma[ 51 ]. FTO expression might also play an important role in promoting the occurrence of GC, and it could be a vital molecular marker for GC diagnosis and prognosis[ 30 – 32 ]. To elucidate the molecular mechanism by which FTO regulates circNFATC3, we performed RIP and MeRIP assays to investigate the direct interaction between FTO and circNFATC3 as well as the m6A modification status of circNFATC3. Our RIP results demonstrated that FTO protein directly binds to circNFATC3 RNA in both AGS and HGC-27 cells, with significantly increased enrichment of circNFATC3 in anti-FTO immunoprecipitates upon FTO overexpression. This finding provides the direct evidence that FTO physically interacts with circNFATC3, establishing the molecular basis for FTO-mediated regulation of circNFATC3. Furthermore, MeRIP assays revealed that FTO overexpression markedly decreased the m6A modification level of circNFATC3, whereas FTO knockdown significantly elevated m6A enrichment on circNFATC3. These results demonstrate that FTO functions as an m6A demethylase for circNFATC3, removing m6A modifications from circNFATC3 transcripts. Given that m6A modification typically promotes RNA degradation through recognition by m6A reader proteins such as YTHDF2, our findings suggest that FTO-mediated m6A demethylation protects circNFATC3 from m6A-dependent degradation, thereby stabilizing circNFATC3 and promoting its accumulation in GC cells. This mechanistic insight not only validates our initial hypothesis but also reveals a novel regulatory axis whereby FTO enhances GC progression through m6A-dependent stabilization of the oncogenic circNFATC3. These findings indicate that FTO regulates circNFATC3 to promote GC progression through the AMPK/mTOR/SREBP1 axis. Specifically, our data demonstrate that FTO directly binds to circNFATC3 and removes its m6A modifications, leading to increased circNFATC3 stability and expression. The elevated circNFATC3 subsequently sponges miR-23b-3p, resulting in RAI14 upregulation and downstream activation of the mTOR/SREBP1 lipid synthesis pathway. Conversely, FTO downregulation increased m6A modification on circNFATC3, promoting its degradation and consequently elevating miR-23b-3p expression, which suppressed RAI14 and inhibited GC cell proliferation, invasion, and migration. Together, these observations establish a complete regulatory cascade: FTO → m6A demethylation → circNFATC3 stabilization → miR-23b-3p sponging → RAI14 upregulation → AMPK/mTOR/SREBP1 pathway activation → lipid metabolic reprogramming → GC progression. This mechanistic framework provides novel insights into how epitranscriptomic regulation intersects with lipid metabolism to drive GC development. Conclusion Our study revealed a novel regulatory network involved in GC progression involving FTO, circNFATC3, miR-23b-3p, and RAI14. Mechanistically, we demonstrated that FTO directly binds to circNFATC3 and functions as an m6A demethylase to remove m6A modifications from circNFATC3, thereby enhancing its stability and expression. The upregulated circNFATC3 subsequently sponges miR-23b-3p, leading to increased RAI14 expression in GC cells. Together, tthis regulatory cascade modulates the AMPK/mTOR/SREBP1 signaling pathway to promote lipid metabolic reprogramming, ultimately enhancing GC cell proliferation and invasion. Our findings highlight the critical role of epitranscriptomic regulation in metabolic reprogramming during GC progression. These data establish the FTO/m6A/circNFATC3/miR-23b-3p/RAI14 axis as a promising therapeutic target for GC. Declarations Author Contribution YXX and YZD were granted full access to all the data in the study and bears the responsibility for upholding the data’s integrity and ensuring the accuracy of the data analysis. YZD, YXX designed this study. YXX, LYM, and YZD performed the experiments and contributed equally to this manuscript. YXX wrote the paper and YZD revised the manuscript. A YXX and YZD are two authors contributed. Conceptualization:GN, XYS; Data curation and Formal Analysis: RSW,QJX; Project Administration: YXX, XYS. Supervision: WYT,GYL. References Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394-424. Machlowska J, Baj J, Sitarz M, Maciejewski R, Sitarz R. Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies. Int J Mol Sci. 2020;21. Yusefi AR, Bagheri Lankarani K, Bastani P, Radinmanesh, Kavosi Z. Risk Factors for Gastric Cancer: A Systematic Review. Asian Pac J Cancer Prev. 2018;19:591-603. Neuman MG, French SW, Zakhari S, et al. Alcohol, microbiome, life style influence alcohol and non-alcoholic organ damage. Exp Mol Pathol. 2017;102:162-80. Steffen A, Huerta JM, Weiderpass E, et al. General and abdominal obesity and risk of esophageal and gastric adenocarcinoma in the European Prospective Investigation into Cancer and Nutrition. Int J Cancer. 2015;137:646-57. Dong SR, Ju XL, Yang WZ. STAT5A reprograms fatty acid metabolism and promotes tumorigenesis of gastric cancer cells. Eur Rev Med Pharmacol Sci. 2019;23:8360-70. Peck B, Schulze A. Lipid Metabolism at the Nexus of Diet and Tumor Microenvironment. Trends Cancer. 2019;5:693-703. Li Y, Wu S, Zhao X, et al. Key events in cancer: Dysregulation of SREBPs. Front Pharmacol. 2023;14:1130747. Beloribi-Djefaflia S, Vasseur S, Guillaumond F. Lipid metabolic reprogramming in cancer cells. Oncogenesis. 2016;5:e189. Hardie DG, Ross FA, Hawley SA. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol. 2012;13:251-62. Ling N, Kaczmarek A, Hoque A, et al. mTORC1 directly inhibits AMPK to promote cell proliferation under nutrient stress. Nat Metab. 2020;2:41-9. Saxton RA, Sabatini DM. mTOR Signaling in Growth, Metabolism, and Disease. Cell. 2017;168:960-76. Sengupta S, Peterson TR, Sabatini DM. Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress. Mol Cell. 2010;40:310-22. Peterson TR, Sengupta SS, Harris TE, et al. mTOR complex 1 regulates lipin 1 localization to control the SREBP pathway. Cell. 2011;146:408-20. Hashimoto I, Koizumi K, Tatematsu M, et al. Blocking on the CXCR4/mTOR signalling pathway induces the anti-metastatic properties and autophagic cell death in peritoneal disseminated gastric cancer cells. Eur J Cancer. 2008;44:1022-9. Hsu YC, Chen HY, Yuan S, et al. Genome-wide analysis of three-way interplay among gene expression, cancer cell invasion and anti-cancer compound sensitivity. BMC Med. 2013;11:106. Chen C, Maimaiti A, Zhang X, et al. Knockdown of RAI14 suppresses the progression of gastric cancer. Onco Targets Ther. 2018;11:6693-703. He XY, Zhao J, Chen ZQ, Jin R, Liu CY. High Expression of Retinoic Acid Induced 14 (RAI14) in Gastric Cancer and Its Prognostic Value. Med Sci Monit. 2018;24:2244-51. Xiao Y, Zhang H, Du G, et al. RAI14 Is a Prognostic Biomarker and Correlated With Immune Cell Infiltrates in Gastric Cancer. Technol Cancer Res Treat. 2020;19:1533033820970684. Shen X, Zhang J, Zhang X, Wang Y, Hu Y, Guo J. Retinoic Acid-Induced Protein 14 (RAI14) Promotes mTOR-Mediated Inflammation Under Inflammatory Stress and Chemical Hypoxia in a U87 Glioblastoma Cell Line. Cell Mol Neurobiol. 2019;39:241-54. Fang S, Pan J, Zhou C, et al. Circular RNAs Serve as Novel Biomarkers and Therapeutic Targets in Cancers. Curr Gene Ther. 2019;19:125-33. Geng Y, Jiang J, Wu C. Function and clinical significance of circRNAs in solid tumors. J Hematol Oncol. 2018;11:98. Ashwal-Fluss R, Meyer M, Pamudurti NR, et al. circRNA biogenesis competes with pre-mRNA splicing. Mol Cell. 2014;56:55-66. Di Timoteo G, Dattilo D, Centrón-Broco A, et al. Modulation of circRNA Metabolism by m6A Modification. Cell Rep. 2020;31:107641. Wei W, Ji X, Guo X, Ji S. Regulatory Role of N(6) -methyladenosine (m(6) A) Methylation in RNA Processing and Human Diseases. J Cell Biochem. 2017;118:2534-43. Zhang G, Li X, Huang X. m6A-related bioinformatics analysis and functional characterization reveals that METTL3-mediated NPC1L1 mRNA hypermethylation facilitates progression of atherosclerosis via inactivation of the MAPK pathway. Inflamm Res. 2023;72:429-42. Zhang L, Wang X, Zhao W, Liu J. Overview of m(6)A and circRNAs in human cancers. J Cancer Res Clin Oncol. 2023;149:6769-84. Yan X, Zhang M, Li B, Ji X, Wu H, Zhang Q. RAI14 Regulated by circNFATC3/miR-23b-3p axis Facilitates Cell Growth and Invasion in Gastric Cancer. Cell Transplant. 30,2021. 9636897211007055. Zhang X, Wei LH, Wang Y, et al. Structural insights into FTO's catalytic mechanism for the demethylation of multiple RNA substrates. Proc Natl Acad Sci U S A. 2019;116:2919-24. Li Y, Zheng D, Wang F, Xu Y, Yu H, Zhang H. Expression of Demethylase Genes, FTO and ALKBH1, Is Associated with Prognosis of Gastric Cancer. Dig Dis Sci. 2019;64:1503-13. Xu D, Shao W, Jiang Y, Wang X, Liu Y, Liu X. FTO expression is associated with the occurrence of gastric cancer and prognosis. Oncol Rep. 2017;38:2285-92. Yang Z, Jiang X, Zhang Z, et al. HDAC3-dependent transcriptional repression of FOXA2 regulates FTO/m6A/MYC signaling to contribute to the development of gastric cancer. Cancer Gene Ther. 2020. Zhang J, Hou L, Liang R, et al. CircDLST promotes the tumorigenesis and metastasis of gastric cancer by sponging miR-502-5p and activating the NRAS/MEK1/ERK1/2 signaling. Mol Cancer. 2019;18:80. Dumas JF, Brisson L, Chevalier S, et al. Metabolic reprogramming in cancer cells, consequences on pH and tumour progression: Integrated therapeutic perspectives with dietary lipids as adjuvant to anticancer treatment. Semin Cancer Biol. 2017;43:90-110. Ray U, Roy SS. Aberrant lipid metabolism in cancer cells - the role of oncolipid-activated signaling. FEBS J. 2018;285:432-43. Schiliro C, Firestein BL. Mechanisms of Metabolic Reprogramming in Cancer Cells Supporting Enhanced Growth and Proliferation. Cells. 2021;10:1056. Garcia D, Shaw RJ. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol Cell. 2017;66:789-800. Wang KW, Dong M. Role of circular RNAs in gastric cancer: Recent advances and prospects. World J Gastrointest Oncol. 2019;11:459-69. He Z, Zhu Q. Circular RNAs: Emerging roles and new insights in human cancers. Biomed Pharmacother. 2023;165:115217. Yang F, Ma Q, Huang B, et al. CircNFATC3 promotes the proliferation of gastric cancer through binding to IGF2BP3 and restricting its ubiquitination to enhance CCND1 mRNA stability. J Transl Med. 2023;21:402. Koundouros N, Poulogiannis G. Reprogramming of fatty acid metabolism in cancer. Br J Cancer. 2020;122:4-22. Röhrig F, Schulze A. The multifaceted roles of fatty acid synthesis in cancer. Nat Rev Cancer. 2016;16:732-49. Yan Z, Liu K, Xu P, et al. ACLY promotes gastric tumorigenesis and accelerates peritoneal metastasis of gastric cancer regulated by HIF-1A. Cell Cycle. 2023;22:2288-301. Bian X, Liu R, Meng Y, Xing D, Xu D, Lu Z. Lipid metabolism and cancer. J Exp Med. 2021;218:e20201606. An Y, Duan H. The role of m6A RNA methylation in cancer metabolism. Mol Cancer. 2022;21:14. Zhang C, Zhang M, Ge S, et al. Reduced m6A modification predicts malignant phenotypes and augmented Wnt/PI3K-Akt signaling in gastric cancer. Cancer Med. 2019;8:4766-81. Delahanty RJ, Beeghly-Fadiel A, Xiang YB, et al. Association of obesity-related genetic variants with endometrial cancer risk: a report from the Shanghai Endometrial Cancer Genetics Study. Am J Epidemiol. 2011;174:1115-26. Huang X, Zhao J, Yang M, Li M, Zheng J. Association between FTO gene polymorphism (rs9939609 T/A) and cancer risk: a meta-analysis. Eur J Cancer Care (Engl). 2017;26. Azzam SK, Alsafar H, Sajini AA. FTO m6A Demethylase in Obesity and Cancer: Implications and Underlying Molecular Mechanisms. Int J Mol Sci. 2022;23:3800. Lin Y, Ueda J, Yagyu K, et al. Association between variations in the fat mass and obesity-associated gene and pancreatic cancer risk: a case-control study in Japan. BMC Cancer. 2013;13:337. Kalo E, Güvenç C, Marasigan V, Lambrechts D, van den Oord J, Garmyn M. A variant in FTO gene shows association with histological ulceration in cutaneous melanoma. J Cutan Pathol. 2020;47:98-101. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigs.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9252847","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":614891682,"identity":"37fea47e-0e8b-4949-8f40-074906df915a","order_by":0,"name":"Xinxin Yan","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xinxin","middleName":"","lastName":"Yan","suffix":""},{"id":614891686,"identity":"8adf866f-3408-4810-8ddf-794a1b0ad57d","order_by":1,"name":"Zhendan Yao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYLACHgMbOcb2BoYDJGgpSDNm7jlAkpYPhxPbZyQQqdrg+OHDH94YHDbmnfn84eGCGgZ5fjEClhmcSUswnGOQLic5O8fg8IxjDIYzZxOwzuBAjkEyj4G1seHsHIbDPGwMCQa3CWk5D3QVjwFz4v6bxx8c5vlHjJYbOYbNPAbOiY0zGAwO87YRoUXyxrNkxjkGacaMPUC/8PZJEPYL3/lkYIj9AUXl8cefeb7ZyPNLE9CicACVL4FfOQjINxBWMwpGwSgYBSMdAAAmnkhQzIFDwAAAAABJRU5ErkJggg==","orcid":"","institution":"Peking University Cancer Hospital \u0026 Institute","correspondingAuthor":true,"prefix":"","firstName":"Zhendan","middleName":"","lastName":"Yao","suffix":""},{"id":614891689,"identity":"59d67d1d-d882-43ef-a991-62aa8e2b0954","order_by":2,"name":"Yanmeng Liu","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanmeng","middleName":"","lastName":"Liu","suffix":""},{"id":614891691,"identity":"44397f22-6609-4030-a578-5dd3d7869161","order_by":3,"name":"Yinshi Xu","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yinshi","middleName":"","lastName":"Xu","suffix":""},{"id":614891695,"identity":"538fd7b6-f8b0-49af-ae47-316f0ddd8864","order_by":4,"name":"Jingxuan Qiu","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jingxuan","middleName":"","lastName":"Qiu","suffix":""},{"id":614891698,"identity":"8bd1e849-58a5-489e-bdce-42f9db382681","order_by":5,"name":"Songwei Ru","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Songwei","middleName":"","lastName":"Ru","suffix":""},{"id":614891702,"identity":"0f434cd8-a8b7-4bbd-ae30-dff8edfb9e6c","order_by":6,"name":"Na Guo","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Guo","suffix":""},{"id":614891711,"identity":"ae447b9a-13b4-407b-ad9f-5f498cbabb8f","order_by":7,"name":"Yitong Wang","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yitong","middleName":"","lastName":"Wang","suffix":""},{"id":614891715,"identity":"2cdd2b0e-81d4-4df9-8f3c-f2e76599c5fc","order_by":8,"name":"Yunlei Gao","email":"","orcid":"","institution":"Peking University Aerospace School of Clinical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yunlei","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2026-03-28 12:53:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9252847/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9252847/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106038029,"identity":"ef15f56f-5376-4b43-8834-539947d279cf","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":66052,"visible":true,"origin":"","legend":"\u003cp\u003eResults of qRT-PCR revealing the relative expression of circNFATC3 in normal gastric epithelial cells and GC cells.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/7b33cbcc29af3064f911ef11.png"},{"id":106038030,"identity":"6a338c4b-4a09-4855-8fc2-603736f266e0","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":183619,"visible":true,"origin":"","legend":"\u003cp\u003eRAI14 overexpression modulates miR-23b-3p and lipid metabolism-related gene expression in GC cells with low circNFATC3 expression. (A1, B1) Results of qRT-PCR demonstrating the relative expression of miR-23b-3p, AMPK, mTOR, SREBP1, ACLY, and FASN in GC cells with or without RAI14 overexpression. (A2, B2) Representative images and analyzed data of western blotting demonstrating the relative expression of AMPK, mTOR, SREBP1, ACLY, and FASN in GC cells with or without RAI14 overexpression. *** P \u0026lt; 0.0001 vs. LV5-GFP.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/aae3538bb5a9c3be26c4fc03.png"},{"id":106093801,"identity":"07efc5db-316b-4d2a-8d31-e0e8fe11a550","added_by":"auto","created_at":"2026-04-03 11:39:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":276366,"visible":true,"origin":"","legend":"\u003cp\u003eRAI14 knockdown reverses the expression of miR-23b-3p and lipid metabolism-related genes in GC cells with high circNFATC3 expression. (A1, B1, C1, D1) Results of qRT-PCR demonstrating the relative expression of miR-23b-3p, AMPK, mTOR, SREBP1, ACLY, and FASN in GC cells with or without RAI14 silencing. (A2, B2, C2, D2) Representative images and analyzed data of western blotting demonstrating the relative expression of AMPK, mTOR, SREBP1, ACLY, and FASN in GC cells with or without RAI14 silencing. *** P \u0026lt; 0.0001 vs. LV5-GFP\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/5537861b6a43c7accd6485d4.png"},{"id":106038033,"identity":"4d0a16ac-0c95-4109-b59d-1b5f4cb6f115","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":303681,"visible":true,"origin":"","legend":"\u003cp\u003eAMPK knockdown combined with mTOR/SREBP1 overexpression promotes GC cell proliferation and invasion. (A1, B1) Results of qRT-PCR demonstrating the relative expression of miR-23b-3p, RAI14, ACLY, and FASN in GC cells with or without AMPK knockdown and SREBP1 overexpression. (A2, B2) Representative images and quantified data of western blotting demonstrating the relative expression of RAI14, ACLY, and FASN in GC cells with or without AMPK knockdown and SREBP1 overexpression. (C1). Quantified data of MTT assay reflecting the proliferative potency of GC cells with or without AMPK knockdown and SREBP1 overexpression. (D1, D2) Quantified data (D1) and representative images (D2) of the colony formation assay presenting the proliferative potency of GC cells with or without AMPK knockdown and SREBP1 overexpression. (E1, E2) Quantified data (E1) and representative images (E2) of the invasion assay demonstrating the invasiveness of GC cells with or without AMPK knockdown and SREBP1 overexpression. *** P \u0026lt; 0.0001 vs. Control siRNA+LV5-GFP.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/97337fd2c94e9fcdd24dbb11.png"},{"id":106038040,"identity":"6fcec71b-9bdc-46cb-86ea-98ade52f56e3","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":318823,"visible":true,"origin":"","legend":"\u003cp\u003eAMPK overexpression combined with mTOR/SREBP1 knockdown inhibits GC cell proliferation and invasion. (A1, B1) Results of qRT-PCR demonstrating the relative expression of miR-23b-3p, RAI14, ACLY, and FASN in GC cells with or without AMPK overexpression and mTOR/SREBP1 knockdown. (A2, B2) Representative images and quantified data of western blotting demonstrating the relative expression of RAI14, ACLY, and FASN in GC cells with or without AMPK overexpression and mTOR/SREBP1 knockdown. (C1). Quantified data of the MTT assay reflecting the proliferative potency of GC cells with or without AMPK knockdown and SREBP1 overexpression. (D1, D2) Quantified data (D1) and representative images (D2) of the colony formation assay presenting the proliferative potency of GC cells with or without AMPK overexpression and mTOR/SREBP1 knockdown. (E1, E2) Quantified data (E1) and representative images (E2) of the invasion assay demonstrating the invasiveness of GC cells with or without AMPK overexpression and mTOR/SREBP1 knockdown. *** P \u0026lt; 0.0001 vs. Control siRNA+LV5-GFP.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/0999396bd1c0b916bcf551ca.png"},{"id":106038039,"identity":"658e2b25-fcd1-456a-b18b-029042f1f3b6","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":335232,"visible":true,"origin":"","legend":"\u003cp\u003eCircNFATC3 overexpression promotes GC tumor growth and lipid accumulation in vivo. (A1). Image of xenograft tumors from mice injected with GC cells with or without circNFATC3 overexpression. (A2) Quantification of the tumor weights of xenograft tumors from mice injected with GC cells with or without circNFATC3 overexpression. (B1, B2) Quantified data (B1) and representative images of IHC (B2) demonstrating the expression levels of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, FASN, and Ki67 in xenograft tumors with or without circNFATC3 overexpression. (C1) Results of qRT-PCR presenting the relative expression of miR-23b-3p in xenograft tumors with or without circNFATC3 overexpression. (D1, D2) Quantified results (D1) and representative images (D2) of ORO staining demonstrating the lipid droplet content in xenograft tumors with or without circNFATC3 overexpression. (E1) Quantified data reflecting the relative TG content in xenograft tumors with or without circNFATC3 overexpression. *** P \u0026lt; 0.0001 vs. LV5-GFP.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/0e66f1b10b8b3d692d166651.png"},{"id":106038034,"identity":"957ac934-59cc-444f-a50d-9728dc90726f","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":339879,"visible":true,"origin":"","legend":"\u003cp\u003eCircNFATC3 knockdown suppresses GC tumor growth and lipid accumulation in vivo. (A1). Image of xenograft tumors from mice injected with GC cells with or without circNFATC3 knockdown. (A2) Quantification of the tumor weights of xenograft tumors from mice injected with GC cells with or without circNFATC3 knockdown. (B1, B2) Quantified data (B1) and representative images of IHC (B2) demonstrating the expression of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, FASN, and Ki67 in xenograft tumors with or without circNFATC3 knockdown. (C1) Results of qRT-PCR presenting the relative expression of miR-23b-3p in xenograft tumors with or without circNFATC3 overexpression. (D1, D2) Quantified results (D1) and representative images (D2) of ORO staining demonstrating the lipid droplet content in xenograft tumors with or without circNFATC3 knockdown. (E1) Quantified data reflecting the relative TG content in xenograft tumors with or without circNFATC3 knockdown. *** P \u0026lt; 0.0001 vs. LV5-GFP.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/6a2cfeb05ba5b7d08732c413.png"},{"id":106093983,"identity":"a7625a8c-52e5-4fb0-9e2d-febaa5a11fd0","added_by":"auto","created_at":"2026-04-03 11:40:28","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":119415,"visible":true,"origin":"","legend":"\u003cp\u003eFTO directly binds to circNFATC3 and regulates its m6A modification. (A) RIP-qPCR analysis demonstrating the enrichment of circNFATC3 in anti-FTO immunoprecipitates in AGS and HGC-27 cells with or without FTO overexpression (oeNC vs. oeFTO). (B, C) MeRIP-qPCR analysis showing the m6A modification level of circNFATC3 in AGS (B) and HGC-27 (C) cells with FTO overexpression (oeNC vs. oeFTO) or FTO knockdown (siNC vs. siFTO). ***P \u0026lt; 0.001 vs. oeNC/siNC.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/6043ec25618c31864cc55b88.png"},{"id":106093993,"identity":"7cf2cc13-6bc1-4dc6-a625-1d902fc94a07","added_by":"auto","created_at":"2026-04-03 11:40:31","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":227647,"visible":true,"origin":"","legend":"\u003cp\u003eFTO overexpression promotes GC cell proliferation and invasion by upregulating circNFATC3. (A, B) Results of qRT-PCR demonstrating the relative expression of circNFATC3 (A) and miR-23b-3p (B) in GC cells with or without FTO overexpression. (C) Quantified data of the MTT assay reflecting the proliferation of GC cells with or without FTO overexpression. (D1, D2) Quantified results (D1) and representative images (D2) of the colony formation assay presenting the proliferative potency of GC cells with or without FTO overexpression. (E1, E2) Quantified results (D1) and representative images (D2) of the Transwell invasion assay demonstrating the invasiveness of GC cells with or without FTO overexpression. *** P \u0026lt; 0.0001 vs. LV5-GFP.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/34553b7b331dd3be0fe3bd85.png"},{"id":106094982,"identity":"38e53d62-9f64-405e-9352-20f06bd8267e","added_by":"auto","created_at":"2026-04-03 11:43:52","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":247520,"visible":true,"origin":"","legend":"\u003cp\u003eFTO knockdown inhibits GC cell proliferation and invasion by downregulating circNFATC3. (A, B) Results of qRT-PCR demonstrating the relative expression of circNFATC3 (A) and miR-23b-3p (B) in GC cells with or without FTO knockdown. (C) Quantified data of the MTT assay reflecting the proliferative potency of GC cells with or without FTO knockdown. (D1, D2) Quantified results (D1) and representative images (D2) of the colony formation assay presenting the proliferation of GC cells with or without FTO knockdown. (E1, E2) Quantified results (D1) and representative images (D2) of the Transwell invasion assay demonstrating the invasiveness of GC cells with or without FTO knockdown. *** P \u0026lt; 0.0001 vs. LV5-GFP.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/5d2a00192b089af0e266622a.png"},{"id":106038037,"identity":"91f86155-2bb5-413e-b912-2dafab545b17","added_by":"auto","created_at":"2026-04-02 16:46:15","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":344446,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN in normal gastric and GC tissues. (A-G) Results of IHC using a tissue microarray (n = 28) demonstrating the expression of RAI14 (A), FTO (B), SREBP1 (C), mTOR (D), ACLY (E), FASN (F), and AMPK (G) in normal and cancerous gastric tissues. The quantified data are presented on the left, and representative IHC images are displayed on the right. *** P \u0026lt; 0.001 vs. Normal.\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/55944c2e414f36aa49271420.png"},{"id":106959627,"identity":"8c7bfdea-33ef-4c9e-8acc-15aba908570e","added_by":"auto","created_at":"2026-04-15 09:12:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3549003,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/7c4d02bd-6411-4bd6-abd2-dacc2162c2af.pdf"},{"id":106094399,"identity":"75560bb2-d60e-4fa2-abf4-7c5ac7f4cbcd","added_by":"auto","created_at":"2026-04-03 11:42:26","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":277504,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigs.docx","url":"https://assets-eu.researchsquare.com/files/rs-9252847/v1/c3457436009c514c36633468.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"The FTO-regulated circNFATC3/miR-23b-3p axis promotes RAI14-mediated gastric cancer progression via lipid metabolic reprogramming","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGastric cancer (GC) is the fifth most prevalent and third deadliest malignancy globally [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], with 1,089,103 cases diagnosed in 2020, 44% of which occurred in China. Early GC detection remains challenging, and its prognosis is grim, as the 5-year survival rate for advanced GC is lower than 10% [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eObesity is a significant risk factor for GC [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], as epidemiological findings have demonstrated distinct associations between higher body mass index or excessive waist circumference and elevated GC risk [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Although adipose infiltration is observed within GC tumors, fatty acid metabolism in GC remains poorly understood, and no investigations have explored the impact of lipid metabolism on the prognosis of GC [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Elucidating the molecular mechanisms by which fatty acid metabolism influences GC could provide pivotal insights into disease progression and prognosis while fuelling the development of novel therapeutic interventions targeting metabolic pathways.\u003c/p\u003e \u003cp\u003eSterol regulatory element-binding proteins (SREBPs) are transcription factors with pivotal roles in orchestrating lipid synthesis. They respond to a variety of signals to modulate the expression of enzymes involved in cholesterol and fatty acid synthesis and uptake [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Many investigations have implicated SREBP dysregulation in cancer progression [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Cancer is characterized by increased SREBP expression, which promotes tumor growth. Hence, lipid metabolism plays a critical role in cancer metabolism [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], highlighting the need to scrutinize its involvement in GC onset, progression, and prognosis. The adenosine 5\u0026prime;-monophosphate-activated protein kinase (AMPK)/mechanistic target of rapamycin (mTOR)/SREBP1 axis, a key enzymatic pathway in lipid synthesis metabolism, has been implicated in the regulation of various metabolic diseases, inflammatory conditions, and cancers. AMPK and mTOR are crucial cellular nutrition sensors and regulators of cellular proliferation[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. mTOR, which serves as a nexus for growth factors and nutritional signals, modulates diverse cellular processes, including growth, proliferation, and survival [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. mTORC1 promotes \u003cem\u003ede novo\u003c/em\u003e lipid synthesis \u003cem\u003evia\u003c/em\u003e SREBP transcription factors [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Studies have indicated that patients with mTOR-positive GC exhibit markedly shorter median survival than their mTOR-negative counterparts do, indicating a poorer prognosis for those with mTOR-positive GC [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNotably, one study linked the retinoic acid-induced protein 14 (RAI14) gene to cancer aggressiveness and drug resistance [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Data from The Cancer Genome Atlas and Gene Expression Omnibus databases revealed a significant increase in RAI14 expression in GC compared with that in normal gastric tissue. Elevated RAI14 expression in GC is correlated with significantly reduced overall and disease-free survival [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Research has suggested that RAI14 can influence GC progression \u003cem\u003evia\u003c/em\u003e the mTOR pathway [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Given the interplay between RAI14 and mTOR and the correlations of RAI14 with the development, progression, and prognosis of GC, further investigation into RAI14\u0026rsquo;s ability to modulate lipid metabolism \u003cem\u003evia\u003c/em\u003e the AMPK/mTOR/SREBP1 pathway is warranted.\u003c/p\u003e \u003cp\u003eCircular RNAs (circRNAs) affect tumor growth and metastasis in a variety of cancers by regulating the expression of their target genes [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e][\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Because of their stability against degradation, circRNAs can serve as early cancer diagnostic biomarkers, prognostic indicators, and prospective therapeutic targets in cancer. Our preliminary investigations revealed a correlation between elevated RAI14 expression and poor prognosis in patients with GC. Our data revealed that upon upregulation via the circNFATC3/miR-23b-3p axis, RAI14 promotes GC cell proliferation and invasion, but the precise mechanisms remain obscure.\u003c/p\u003e \u003cp\u003eN6-methyladenosine (m6A) is a common mRNA modification involved in the pathogenesis of various diseases, including cancer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Researchers have revealed that circRNAs are m6A-modified in multiple cancers[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Therefore, the uncharted terrain of m6A-mediated circNFATC3/miR-23b-3p signaling targeting RAI14 warrants exploration.\u003c/p\u003e \u003cp\u003eOur preliminary investigations revealed that the downregulation of circNFATC3 (also termed hsa_circ_0039930) can modulate the miR-23b-3p/RAI14 axis, suppressing cell proliferation and invasion in GC [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Given that m6A promotes cancer initiation \u003cem\u003evia\u003c/em\u003e circRNAs, it is conceivable that m6A might potentiate cancer development through a binding interface with circNFATC3. Bioinformatics has been used to predict circNFATC3 target genes regulated by m6A (Supplementary Fig. S1), and fat mass and obesity-associated protein (FTO) were identified. Notably, FTO is closely related to lipid metabolism, and it is a m6A \u0026ldquo;eraser\u0026rdquo; [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. FTO-mediated m6A RNA methylation has broad functional effects on internal homeostasis, with any perturbation in m6A levels precipitating functional impairments or diseases. Human GC tissues exhibit FTO overexpression, which is associated with breast, thyroid, and endometrial cancers. FTO expression is correlated with GC differentiation and lymph node metastasis, among other factors, suggesting a correlation with GC prognosis [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In our previous work, we analyzed the expression of FTO in gastric cancer via Bulk-RNAs and its relationship with clinical features, demonstrating the potential of FTO as a biomarker for gastric cancer (Supplementary Fig. S2). Therefore, we hypothesized that FTO mediates m6A modifications that regulate circNFATC3.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSupplementary Fig. S1 circNFATC3 (hsa_circ_0039930) targets m6A-regulated genes as predicted by miRanda. Circles represent circRNAs, squares represent coding genes, and green lines indicate the predicted binding relationships between them.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSupplementary Fig. S2 Expression of FTO in gastric cancer and its relationship with clinical features. Fig. S2A Expression levels of FTO in cancer tissues and adjacent non-cancerous tissues. FIG. S2B Expression of FTO in different tumor stages. FIG. S2C Expression of FTO in different genders. FIG.S2D Expression of FTO among different age groups. FIG. S2E Expression of FTO across different pathological stages. FIG. S2F Expression of FTO in relation to tumor size (T), lymph node metastasis (N), and whether the tumor has metastasized (M). FIG. S2G Overall survival (OS), disease-free survival (DFS), and disease-specific survival (DSS) in high and low expression groups of FTO. FIG.S2H Comparison of OS and DFS between the 80% and 20% groups of FTO gene expression.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eTissue microarrays\u003c/h2\u003e \u003cp\u003eThe continuous section of a human GC tumor tissue array was assembled by Outdo Biotech Co., Ltd. (Lot No. HStm-Ade060CS-01, Shanghai, China). This dataset consisted of 28 GC tissue samples juxtaposed with an equal number of adjacent nontumor tissue samples. The pertinent pathological parameters characterizing both GC and adjacent normal tissues are described in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The study was approved by the Ethics Committee of Beijing Aerospace Center Hospital (No. 2021-AMHTG-002).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinicopathological parameters of patients with GC\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGC tissue\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdjacent non-tumor\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge (years)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e64.11\u0026thinsp;\u0026plusmn;\u0026thinsp;10.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e64.11\u0026thinsp;\u0026plusmn;\u0026thinsp;10.51\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eStage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDegree of infiltration\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMucous layer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMuscular layer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlacenta percreta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFull thickness\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell culture and transfection\u003c/h3\u003e\n\u003cp\u003eGES-1 human gastric epithelial cells and GC cell lines (HGC-27, AGS, SGC-7901, BGC-823, MGC-803, and MKN-28) were obtained from FUTURE BIOTECH Co. Ltd. (Beijing, China) and cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium supplemented with 10% heat-inactivated fetal bovine serum and antibiotics (100 U/ml penicillin and 100 U/ml streptomycin). The cells were cultured in an incubator in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere with 95% humidity at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003eRAI14 plasmids, siRNAs targeting RAI14, lentivirus-mediated circNFATC3, si-circNFATC3, and miR-23b-3p mimics/inhibitors were purchased from GenePharma (Shanghai, China). Negative-control (NC) plasmids or lentiviruses and miR-NC were used as the control vectors. The oligonucleotides and plasmids used in this study are described in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOligonucleotides and plasmids used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eRAI14 siRNA\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAntisense (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCUGCUUCUUGCUGUACAATT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUUGUACAGCAAGAAGCAGCTT\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAMPK siRNA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCCACAAUCAAAGAUAUTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAUAUCUUUGAUUGUGGCCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emTOR siRNA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCCUAUGGUCGAGAUUUATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUAAAUCUCGACCAUAGGCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSREBP1 siRNA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCUCUCAGGAUGCUGAUUUATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUAAAUCAGCAUCCUGAGAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFTO siRNA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAACCUUGGAUUAUAUTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAUAUAAUCCAAGGUUCCUGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emiR-23b-3p mimic\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAUCACAUUGCCAGGGAUUACCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGUAAUCCCUGGCAAUGUGAUUU\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emiR-23b-3p inhibitor\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGUGGUAAUCCCUGGCAAUGUGAU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ecircNFATC3 inhibitor\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGTGAAGCACATCTTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eQuantitative real-time polymerase chain reaction (qRT‒PCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from cells via TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer\u0026rsquo;s instructions. Complementary DNA (cDNA) was synthesized via M-MLV Reverse Transcriptase (#28025013; Thermo Fisher Scientific, USA) per the manufacturer\u0026rsquo;s protocol. For miRNA detection, total RNA was isolated from cells via a High Pure miRNA isolation kit (#05080576001, Roche, Basel, Switzerland), and a TaqMan MicroRNA Reverse Transcription Kit (#4366596, Life Technologies, Thermo Fisher Scientific) was used to synthesize first-strand cDNA. The expression of target genes was determined in triplicate via qRT‒PCR via iTaq\u0026trade; Universal SYBR\u0026reg; Green Supermix (1725121, Bio-Rad Laboratories, Hercules, CA, USA). The expression of target genes was normalized to that of GAPDH and β-actin. The relative expression of the target genes was calculated via the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. The sequences of primers used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003ch3\u003eRNA Immunoprecipitation (RIP) Assay\u003c/h3\u003e\n\u003cp\u003eRIP assays were performed to determine the interaction between FTO protein and circNFATC3 using the EZ-Magna RIP Kit (#17-10499, Millipore, Burlington, MA, USA) according to the manufacturer\u0026rsquo;s instructions. Briefly, AGS and HGC-27 cells with FTO overexpression (oeFTO) and the respective controls (oeNC and siNC) were harvested and lysed in complete RIP lysis buffer. Cell lysates (approximately 2 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e cells per sample) were incubated with magnetic beads conjugated to anti-FTO antibody (#ab126605, Abcam, Cambridge, UK) or normal rabbit IgG (negative control) overnight at 4\u0026deg;C with rotation. After extensive washing with RIP wash buffer, the immunoprecipitated RNA\u0026ndash;protein complexes were treated with proteinase K to digest proteins. RNA was subsequently extracted and purified. The enrichment of circNFATC3 in the immunoprecipitates was quantified by qRT-PCR.\u003c/p\u003e\n\u003ch3\u003eMethylated RNA Immunoprecipitation (MeRIP) Assay\u003c/h3\u003e\n\u003cp\u003eThe m6A modification level of circNFATC3 was assessed using the Magna MeRIP m6A Kit (#17-10499, Millipore) following the manufacturer\u0026rsquo;s protocol. Total RNA was extracted from AGS and HGC-27 cells transfected with FTO overexpression vector (oeFTO) or FTO-targeting siRNA (siFTO) and their respective controls (oeNC and siNC) using the ReliaPrep RNA Miniprep System (#Z6010, Promega, Madison, WI, USA). Poly(A)+ mRNA was enriched using the PolyATtract mRNA Isolation System (#Z5210, Promega). Approximately 100 \u0026micro;g of purified RNA was chemically fragmented and incubated with anti-m6A antibody-conjugated magnetic beads or IgG control (provided in the kit) overnight at 4\u0026deg;C with gentle rotation. After immunoprecipitation and washing, the m6A-modified RNA fragments were eluted and subjected to qRT-PCR analysis using circNFATC3-specific primers.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emiR-23b-3p\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGTCATCACATTGCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATGGTTGTTCACGACTCCTTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAMPK\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGAAACCTGAAAATGTCCTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGAGCCACAACTTGTTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emTOR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCTTGGAACCGGACCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTGACTCATCTCTCGGAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSREBP1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGGAGCGAGCACTGAATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGCATCTGAGAACTCCTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eACLY\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGGCCAAGGCAATTTCAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAGCATACTTGAACCGATTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFASN\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGACCTGTCTAGGTTTGATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCTTCATAGGTGACTTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRAI14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCCAAGATACTACCGGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTGCATAATGTAAAGCTGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ecircNFATC3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACTGAAGGTAGCCGAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAAATGAGCTGGTAAAGGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCACCACCAACTGCTTAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCATGTCAGATCCACAACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eβ-actin\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTCTATGCCAACACAGTGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACGATGCCAGTGAGGTCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eWestern blotting was conducted as previously described [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In brief, the cells were solubilized with radioimmunoprecipitation assay buffer, and the cleared whole-cell lysate was obtained via centrifugation. The protein concentration in the total cell lysate was evaluated via the Bradford method. The same amount of cell lysate from each indicated group was separated by SDS‒PAGE and transferred onto PVDF membranes. The membranes were blocked with 5% skim milk for 1 h at room temperature, followed by incubation with the following primary antibodies overnight at 4\u0026deg;C: anti-RAI14 (1:2000, ab137118, Abcam, Cambridge, UK), anti-AMPK (1:1000, ab32047, Abcam), anti-mTOR (1:1000, ab32028, Abcam), anti-SREBP1 (1:1000, ab28481, Abcam), anti-ATP citrate lyase (ACLY, 1:10,000, ab40793, Abcam), anti-fatty acid synthase (FASN, 1:10,000, ab128870, Abcam), and β-actin (1:1000, ab8226, Abcam). The next day, the membrane was washed with TBST (three times, 10 min each) and incubated with HRP-conjugated goat-anti-rabbit IgG (1:2000, ab9485, Abcam) for 1 h at room temperature. The membrane was subsequently developed with enhanced chemiluminescence substrate (Thermo Fisher Scientific) and imaged via a Tanon-5200 imaging system (Tanon, Shanghai, China). The images were analyzed via ImageJ software (NIH, Bethesda, MD, USA), and the intensity values of the protein bands were normalized to those of β-actin.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHuman GC xenografts in immunodeficient mice\u003c/h3\u003e\n\u003cp\u003eBALB/c nude mice (male, 4\u0026ndash;5 weeks old) were purchased from Shanghai SIPPR-BK Laboratory Animal Co. Ltd. (Shanghai, China). The mice were randomly assigned to two groups (n\u0026thinsp;=\u0026thinsp;8/group), and each mouse received a subcutaneous injection of 200 \u0026micro;L of sterile PBS containing 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e GC cells (AGS and HGC-27) into the flank area under the indicated conditions. All animals were euthanized after 4 weeks, the tumors were collected, and the final tumor weights were recorded. The tumor tissues were subsequently fixed in 4% paraformaldehyde for 24 h, embedded in paraffin or O.C.T. compound, and sectioned for immunohistochemistry (IHC) and oil red O (ORO) staining. All animal experiments were performed in accordance with the Animal Ethics Committee of Beijing Aerospace Center Hospital (No. 2021-AMHTG-002).\u003c/p\u003e\n\u003ch3\u003eIHC\u003c/h3\u003e\n\u003cp\u003eAntigen retrieval was conducted via a heat-induced epitope retrieval technique employing sodium citrate buffer at pH 6.0. Endogenous peroxidase activity was quenched by the addition of hydrogen peroxide, and the samples were blocked with TBST supplemented with 5% normal goat serum. The sections were subsequently incubated overnight at 4\u0026deg;C with the following primary antibodies: anti-RAI14 (1:500), anti-FTO (1:200, FNab09787, Fine Biotech, Wuhan China), anti-AMPK (1:1000), anti-mTOR (1:1000, ab32028), anti-SREBP1 (1:500), anti-ACLY (1:500, ab40793), anti-FASN (1:500), and anti-Ki67 (1:200, ab15580, Abcam). Following thorough washing with TBST, the sections were incubated with a goat anti-rabbit IgG secondary antibody (1:200) for 1 h at room temperature. The subsequent steps involved additional washing, incubation with peroxidase substrate, dehydration, and mounting. Image evaluation was performed via ImageJ software by an experienced researcher who was blinded to the study design, and the results are presented as the mean integrated optical density (IOD). The detailed IHC experimental procedures were described elsewhere [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eORO staining\u003c/h2\u003e \u003cp\u003eO.C.T. compound-embedded sections (10 \u0026micro;m) were fixed in 10% formalin solution, washed with distilled water, and rinsed with 60% isopropanol. The sections were subsequently stained with ORO (O1391, Sigma‒Aldrich, St. Louis, MO, USA) staining solution for 15 min according to the manufacturer\u0026rsquo;s protocol, followed by a brief rinse with 60% isopropanol. Thereafter, the nuclei were counterstained with hematoxylin. The sections were rinsed with distilled water before being mounted with glycerol gelatin. The sections were subsequently examined and imaged under a microscope. ORO staining was quantified via Image-Pro Plus 7.0 software. The results are presented as the percentage area of red lipid droplets relative to the entire image area.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation analyses\u003c/h2\u003e \u003cp\u003eCell viability was analyzed via the MTT assay. In brief, 5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells were seeded into a 96-well plate in 100 \u0026micro;L of culture medium. The cells were allowed to adhere to the growing surface for 2 h. Subsequently, 10 \u0026micro;L of MTT solution (5 mg/mL) was added to the culture medium, followed by 4 h of incubation. The absorbance (OD) at 450 nm was subsequently determined via an Enzyme Immunoassay Analyzer (Bio-Rad) to assess cell viability.\u003c/p\u003e \u003cp\u003eCell proliferation was also determined by a colony formation assay. In brief, the cells were cultured in 6-cm plates at a density of 50, 100, or 200 per dish for 14\u0026ndash;21 days. Colonies were then fixed for 20 min with 4% formaldehyde and stained with 0.1% crystal violet for 10\u0026ndash;30 min. Colonies containing\u0026thinsp;\u0026ge;\u0026thinsp;10 cells were counted under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTranswell invasion assay\u003c/h2\u003e \u003cp\u003eCell invasion was measured via the Transwell invasion assay. In general, Millicell inserts precoated with extracellular matrix (2 mg/mL) were placed into multiwell plates containing complete culture medium. In total, 1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells suspended in starvation medium were loaded into the chamber of the cell insert and incubated for 24 h. Subsequently, the extracellular matrix and cells remaining in the upper chamber were removed. The cells that crossed the cell insert membrane were fixed (5% glutaraldehyde, 10 min), stained (1% crystal violet, 20 min), and imaged. The average counts were taken from five randomly selected fields.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEMs. Graphs were generated via SPSS 20.0 (IBM, Armonk, NY, USA) and GraphPad Prism version 9.5 (GraphPad Software, Boston, MA, USA). Pairwise comparisons were conducted via Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test, whereas multiple comparisons were performed via two-way analysis of variance with the Bonferroni post hoc correction. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ecircNFATC3 expression in GC cell lines\u003c/h2\u003e \u003cp\u003eOn the basis of our previous research, we identified 12 upregulated circRNAs and 13 downregulated circRNAs in GC tissues (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.03 and fold change [FC]\u0026thinsp;\u0026gt;\u0026thinsp;3) and found that circNFATC3 was markedly upregulated in GC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002, FC\u0026thinsp;=\u0026thinsp;8.50)[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Our investigations indicated that circNFATC3 favors a poor prognosis in patients with GC [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. To confirm our previous findings, qRT‒PCR was conducted to determine circNFATC3 expression in various lines of GC cells (HGC-27, AGS, SGC-7901, GBC-823, MGC-803, and MKN-28) and normal gastric epithelial cells (GES-1). These findings revealed increased circNFATC3 expression in BGC-823, SGC-7901, HGC-27, and MGC-803 cells and decreased expression in MKN-28 and AGS cells compared with GES-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eUpregulation of RAI14 in GC with low circNFATC3 expression was inversely related to miR-23b-3p and AMPK expression\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOur previous study demonstrated that RAI14 is regulated by the circNFATC3/miR-23b-3p axis and that it plays an important role in GC cell proliferation and invasion [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These findings confirmed the importance of RAI14 in GC tumorigenesis. Therefore, we modulated RAI14 expression in GC cells \u003cem\u003evia\u003c/em\u003e lentivirus-mediated overexpression or siRNA-mediated gene silencing. RAI14 upregulation (LV5-RAI14) led to diminished miR-23b-3p and AMPK expression, accompanied by increased mTOR, SREBP1, ACLY, and FASN expression, at both the mRNA and protein levels compared with those in the blank control and vector control (LV5-GFP) groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These observations are consistent with our previous findings in a large cohort of GC tissues[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eConversely, RAI14 depletion (RAI14 siRNA) in GC cell lines with increased circNFATC3 expression (BGC-823, SGC-7901, HGC-27, and MGC-803) resulted in increased expression of miR-23b-3p and AMPK and decreased expression of mTOR, SREBP1, ACLY, and FASN at both the mRNA and protein levels compared with those in the blank control and nontargeting control (Control siRNA) groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese results indicate the involvement of RAI14 in the regulation of these genes. Specifically, we observed opposing trends in RAI14-mediated modulation of miR-23b-3p and AMPK expression compared with mTOR, SREBP1, ACLY, and FASN expression in GC cells. Therefore, it is reasonable to speculate that RAI14 affects the cellular functions of GCs by regulating the expression of these genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eDownregulation of AMPK, coupled with upregulation of mTOR/SREBP1, facilitates cell growth and invasion in GC\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo test this hypothesis, we depleted AMPK and overexpressed mTOR and SREBP1 in AGS and MKN-28 cells and assessed the expression of miR-23b-3p, RAI14, ACLY, and FASN via qRT‒PCR and/or western blotting. The results demonstrated that changes in AMPK, mTOR, and SREBP1 expression did not affect the expression of miR-23b-3p but resulted in RAI14, ACLY, and FASN upregulation (Fig.\u0026nbsp;4A1\u0026ndash;B2). Moreover, downregulation of AMPK and overexpression of mTOR and SREBP1 significantly facilitated proliferation (Fig.\u0026nbsp;4C1), colony formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), and migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) in GC cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eUpregulation of AMPK and downregulation of mTOR/SREBP1 repressed cell proliferation, colony formation, and invasion in GC\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eIn GC cells with high circNFATC3 expression, we simultaneously overexpressed AMPK and silenced mTOR and SREBP1 (LV5-AMPK+mTOR siRNA+SERBP1 siRNA). We subsequently determined the expression of miR-23b-3p, RAI14, ACLY, and FASN. These findings revealed that altering AMPK, mTOR, and SREBP1 expression did not change the expression of miR-23b-3p. However, RAI14, ACLY, and FASN were repressed (\u003c/em\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u0026ndash;B\u003cem\u003e). In addition, AMPK overexpression and mTOR and SREBP1 depletion inhibited the proliferation (Fig.\u0026nbsp;5C1), colony formation (\u003c/em\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD\u003cem\u003e), and migration (\u003c/em\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE\u003cem\u003e) of GC cells.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003ecircNFATC3 facilitates GC progression in vivo\u003c/h2\u003e \u003cp\u003eTo investigate the \u003cem\u003ein vivo\u003c/em\u003e effects of circNFATC3 on GC tumorigenesis, we established a xenograft tumor model using AGS cells with or without circNFATC3 overexpression (LV5-circNFATC3 and LV5-GFP). The results demonstrated that the volumes and weights of GC tumors were greater in the circNFATC3 group than in the control group, in which the tumor cells were transduced with vehicle alone (Fig.\u0026nbsp;6A1, A2). IHC revealed that RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression was significantly greater in the circNFATC3 group than in the LV5-GFP group (Fig.\u0026nbsp;6B1). Conversely, the expression of AMPK was lower in the former group. Furthermore, miR-23b-3p expression was decreased in the circNFATC3 group (Fig.\u0026nbsp;6C1). ORO staining revealed increased lipid droplet content in the circNFATC3 group (Fig.\u0026nbsp;6D1, D2), and triglyceride (TG) levels were also elevated (Fig.\u0026nbsp;6E1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of circNFATC3 repressed GC tumorigenesis in vivo\u003c/h2\u003e \u003cp\u003eIn parallel, we employed HGC-27 cells with or without circNFATC3 depletion (LV5-sg circNFATC3 and LV5-GFP) to generate a xenograft model and monitored tumor growth \u003cem\u003ein vivo\u003c/em\u003e. Compared with those in the LV5-GFP group, the tumors in the circNFATC3-depleted (si-circNFATC3) group presented smaller volumes and lower weights (Fig.\u0026nbsp;7A1, A2). IHC demonstrated that RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression was significantly lower in the circNFATC3-depleted group than in the LV5-GFP group (Fig.\u0026nbsp;7B1), accompanied by increased AMPK expression. Additionally, miR-23b-3p expression was increased in the si-circNFATC3 group compared with the LV5-GFP group (Fig.\u0026nbsp;7C1). ORO staining confirmed a reduction in lipid droplet levels (Fig.\u0026nbsp;6D1, D2) and decreased TG levels in the si-circNFATC3 group (Fig.\u0026nbsp;7E1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eFTO directly binds to circNFATC3 and regulates its expression through m6A demethylation\u003c/h2\u003e \u003cp\u003eTo investigate whether FTO directly interacts with circNFATC3, RIP assays were performed in GC cells. In AGS cells and HGC-27 cells, FTO overexpression (oeFTO) significantly increased the enrichment of circNFATC3 in the anti-FTO immunoprecipitates compared with the negative control group (oeNC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). These findings demonstrate that FTO protein directly binds to circNFATC3 RNA in GC cells.\u003c/p\u003e \u003cp\u003eGiven that FTO functions as an m6A demethylase, we further examined whether FTO regulates circNFATC3 through m6A modification using MeRIP assays. In AGS cells, FTO overexpression (oeFTO) significantly decreased the m6A modification level of circNFATC3 compared with the control group (oeNC), whereas FTO knockdown (siFTO) markedly increased the m6A enrichment of circNFATC3 compared with the siNC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Consistent results were obtained in HGC-27 cells, where oeFTO reduced and siFTO elevated the m6A modification of circNFATC3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). These results indicate that FTO regulates circNFATC3 expression through m6A demethylation, providing direct evidence for the m6A-dependent regulatory mechanism of FTO on circNFATC3 in GC cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eFTO promotes the proliferation and invasion of GC cells by regulating circNFATC3\u003c/h2\u003e \u003cp\u003eUsing qRT‒PCR, AGS cells with decreased circNFATC3 expression were transfected with FTO or vehicle vector. Consequently, a significant increase in circNFATC3 expression was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA), as was significant miR-23b-3p downregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). Moreover, the increase in FTO expression significantly potentiated cellular proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC), colony formation (Fig.\u0026nbsp;9D1), and invasion (Fig.\u0026nbsp;9E1) compared with those in the LV5-GFP group.\u003c/p\u003e \u003cp\u003eSimilarly, HGC-27 cells harboring elevated circNFATC3 expression were transfected with FTO-targeting siRNA or empty vector. This intervention resulted in a discernible decrease in circNFATC3 expression along with a notable increase in miR-23b-3p expression. Notably, the suppression of FTO impeded cellular proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC), colony formation (Fig.\u0026nbsp;10D1), and invasion (Fig.\u0026nbsp;10E1) compared with the findings in the LV5-CAG-GFP group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN in normal gastric and GC tissues\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe further validated the findings \u003cem\u003evia\u003c/em\u003e IHC via a tissue microarray. Significantly lower RAI14, FTO, SREBP1, mTOR, ACLY, and FASN expression was observed in normal gastric tissues than in their corresponding GC tissues, as reflected by the lower mean IOD (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eA\u0026ndash;F). Conversely, an inverse trend was observed for AMPK expression, which was decreased in GC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003eThese results corroborate our \u003cem\u003ein vitro\u003c/em\u003e studies, confirming the low expression of AMPK and high expression of RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN in GC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e). The consistency across \u003cem\u003ein vivo\u003c/em\u003e, \u003cem\u003ein vitro\u003c/em\u003e, and human GC tissue analyses highlighted the involvement of these molecules in GC onset and established their interrelation. However, because of the limited availability of GC tissues, no further investigations have been conducted.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAccumulating evidence has highlighted the role of lipid metabolism in cancer [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], particularly through pathways involving AMPK, mTOR, and SREBP1. In GC, circNFATC3 has been linked to the regulation of the miR-23b-3p/RAI14 axis, thereby influencing cell growth and invasion [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, the mechanism by which RAI14 influences GC metastasis and its interaction with circNFATC3 remain unclear. We hypothesized that m6A modification regulates circNFATC3, affecting the miR-23b-3p/RAI14 pathway and potentially inducing GC \u003cem\u003evia\u003c/em\u003e lipid metabolism reprogramming.\u003c/p\u003e \u003cp\u003eAMPK serves as a crucial regulator of cellular trophism and growth, with its activity finely tuned by various upstream signals [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In this study, RAI14 upregulation led to a decrease in miR-23b-3p and AMPK expression, suggesting that AMPK, which is pivotal for maintaining energy homeostasis, can counteract the procancer effects of RAI14. The changes in AMPK expression mirrored those observed for miR-23b-3p.\u003c/p\u003e \u003cp\u003ecircRNAs constitute a class of noncoding RNAs that play critical roles in regulating gene expression in GC, either by promoting or inhibiting tumor progression [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e][\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Previous studies, including ours, confirmed the oncogenic effects of circNFATC3 in GC [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e][\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In the present study, we found that increasing RAI14 expression in GC cell lines with low circNFATC3 expression suppressed miR-23b-3p and AMPK expression while increasing the expression of mTOR, SREBP1, ACLY, and FASN, all of which are implicated in lipid metabolism, making them potential targets for cancer therapy [\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These findings highlight the interplay between RAI14 and lipid metabolism in GC cells, with circNFATC3 acting as a crucial mediator.\u003c/p\u003e \u003cp\u003eOur results revealed that modulating the expression of downstream effectors of RAI14, including AMPK, mTOR, and SREBP1, influences the expression and functions of lipid metabolism regulators, such as ACLY and FASN, in GC cells. Specifically, simultaneously upregulating AMPK and downregulating mTOR/SREBP1 increased the protein expression of ACLY and FASN, thereby promoting cellular proliferation and invasion. Conversely, depleting AMPK and overexpressing mTOR/SREBP1 suppressed the expression of ACLY and FASN, concomitantly inhibiting cell proliferation and invasion. These findings confirm, at least partially, that the stimulation of RAI14 in GC development is related to lipid metabolism. Accumulating evidence has established the importance of lipid metabolism in cancer progression [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Previous studies have also demonstrated the role of RAI14 in GC development [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. For the first time, our study extends our knowledge by demonstrating that RAI14 promotes GC progression by regulating lipid metabolic pathways. Interestingly, we observed a potential regulatory loop among RAI14, AMPK, mTOR, and SREBP1. Whereas RAI14 overexpression decreased AMPK and increased mTOR/SREBP1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), RAI14 silencing had the opposite effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Moreover, combined AMPK knockdown and mTOR/SREPB overexpression increased the expression of RAI14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These observations suggest a potential positive feedback mechanism. As AMPK, mTOR, and SREBP1 are closely involved in transcriptional regulation, it is possible that these molecules directly or indirectly influence RAI14 transcription. Further investigations are needed to explore the exact molecular activities supporting this regulatory network. Understanding the regulatory relationships among these molecules could provide novel insights into metabolic adaptations in GC and help uncover potential combinational therapy strategies targeting multiple molecules in GC.\u003c/p\u003e \u003cp\u003eMoreover, animal studies confirmed the role of circNFATC3 in promoting GC growth, as evidenced by increases in tumor volume and weight; decreased AMPK and miR-23b-3p expression; and elevated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression. Conversely, circNFATC3 suppression decreased tumor size; upregulated AMPK and miR-23b-3p; and downregulated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 while reducing TG and lipid levels. These results underscore the regulatory role of circNFATC3 in lipid metabolism, through which it contributes to GC progression. In parallel, increased circNFATC3 expression in GC tissues was also confirmed by other groups. Elevated expression of circNFATC3 is positively correlated with tumor volume, highlighting its potential significance in GC progression [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Our study, on the basis of these findings, is the first to report the relationship between circNFATC3 and lipid metabolism in GC. These findings both expand our understanding of metabolic reprogramming in GC and reveal potential therapeutic targets. Both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments revealed consistent changes in GC tissues and normal tissues. AMPK expression was low in GC tissues, whereas RAI14, FTO, AMPK, mTOR, SREBP1, ACLY, and FASN expression was elevated. These findings suggest crucial roles for these factors in GC initiation and progression. However, because of the limited sample size, further investigations are warranted to elucidate their relationships in human GC tissues.\u003c/p\u003e \u003cp\u003eMetabolic reprogramming is a hallmark of malignant tumors. In eukaryotes, m6A methylation, involving \u0026ldquo;writers,\u0026rdquo; \u0026ldquo;erasers,\u0026rdquo; and \u0026ldquo;readers,\u0026rdquo; plays a crucial role in regulating mRNAs [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Recent studies have suggested a close relationship between mTOR signaling and m6A methylation in the regulation of tumor metabolism [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The results of our previous studies revealed that circNFATC3 plays a critical role in GC progression by regulating the miR-23b-3p/RAI14 axis to increase cancer cell proliferation and invasion[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Given the role of m6A in circRNA regulation, we hypothesized that FTO regulates circNFATC3 expression during GC progression in an m6A-dependent manner. This hypothesis was initially supported by our bioinformatics analysis predicting the interaction between FTO and circNFATC3 (Supplementary Fig.\u0026nbsp;1), and was subsequently validated by our RIP and MeRIP experiments.\u003c/p\u003e \u003cp\u003eFTO, a m6A eraser, demethylates m6A to promote mRNA splicing and translation. Many studies have illustrated the associations of FTO with various malignancies, including endometrial cancer[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], breast cancer[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], pancreatic cancer[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], and melanoma[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. FTO expression might also play an important role in promoting the occurrence of GC, and it could be a vital molecular marker for GC diagnosis and prognosis[\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. To elucidate the molecular mechanism by which FTO regulates circNFATC3, we performed RIP and MeRIP assays to investigate the direct interaction between FTO and circNFATC3 as well as the m6A modification status of circNFATC3. Our RIP results demonstrated that FTO protein directly binds to circNFATC3 RNA in both AGS and HGC-27 cells, with significantly increased enrichment of circNFATC3 in anti-FTO immunoprecipitates upon FTO overexpression. This finding provides the direct evidence that FTO physically interacts with circNFATC3, establishing the molecular basis for FTO-mediated regulation of circNFATC3. Furthermore, MeRIP assays revealed that FTO overexpression markedly decreased the m6A modification level of circNFATC3, whereas FTO knockdown significantly elevated m6A enrichment on circNFATC3. These results demonstrate that FTO functions as an m6A demethylase for circNFATC3, removing m6A modifications from circNFATC3 transcripts. Given that m6A modification typically promotes RNA degradation through recognition by m6A reader proteins such as YTHDF2, our findings suggest that FTO-mediated m6A demethylation protects circNFATC3 from m6A-dependent degradation, thereby stabilizing circNFATC3 and promoting its accumulation in GC cells. This mechanistic insight not only validates our initial hypothesis but also reveals a novel regulatory axis whereby FTO enhances GC progression through m6A-dependent stabilization of the oncogenic circNFATC3.\u003c/p\u003e \u003cp\u003eThese findings indicate that FTO regulates circNFATC3 to promote GC progression through the AMPK/mTOR/SREBP1 axis. Specifically, our data demonstrate that FTO directly binds to circNFATC3 and removes its m6A modifications, leading to increased circNFATC3 stability and expression. The elevated circNFATC3 subsequently sponges miR-23b-3p, resulting in RAI14 upregulation and downstream activation of the mTOR/SREBP1 lipid synthesis pathway. Conversely, FTO downregulation increased m6A modification on circNFATC3, promoting its degradation and consequently elevating miR-23b-3p expression, which suppressed RAI14 and inhibited GC cell proliferation, invasion, and migration. Together, these observations establish a complete regulatory cascade: FTO \u0026rarr; m6A demethylation \u0026rarr; circNFATC3 stabilization \u0026rarr; miR-23b-3p sponging \u0026rarr; RAI14 upregulation \u0026rarr; AMPK/mTOR/SREBP1 pathway activation \u0026rarr; lipid metabolic reprogramming \u0026rarr; GC progression. This mechanistic framework provides novel insights into how epitranscriptomic regulation intersects with lipid metabolism to drive GC development.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study revealed a novel regulatory network involved in GC progression involving FTO, circNFATC3, miR-23b-3p, and RAI14. Mechanistically, we demonstrated that FTO directly binds to circNFATC3 and functions as an m6A demethylase to remove m6A modifications from circNFATC3, thereby enhancing its stability and expression. The upregulated circNFATC3 subsequently sponges miR-23b-3p, leading to increased RAI14 expression in GC cells. Together, tthis regulatory cascade modulates the AMPK/mTOR/SREBP1 signaling pathway to promote lipid metabolic reprogramming, ultimately enhancing GC cell proliferation and invasion. Our findings highlight the critical role of epitranscriptomic regulation in metabolic reprogramming during GC progression. These data establish the FTO/m6A/circNFATC3/miR-23b-3p/RAI14 axis as a promising therapeutic target for GC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYXX and YZD were granted full access to all the data in the study and bears the responsibility for upholding the data\u0026rsquo;s integrity and ensuring the accuracy of the data analysis. YZD, YXX designed this study. YXX, LYM, and YZD performed the experiments and contributed equally to this manuscript. YXX wrote the paper and YZD revised the manuscript. A YXX and YZD are two authors contributed. Conceptualization:GN, XYS; Data curation and Formal Analysis: RSW,QJX; Project Administration: YXX, XYS. Supervision: WYT,GYL.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394-424.\u003c/li\u003e\n \u003cli\u003eMachlowska J, Baj J, Sitarz M, Maciejewski R, Sitarz R. Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies. Int J Mol Sci. 2020;21.\u003c/li\u003e\n \u003cli\u003eYusefi AR, Bagheri Lankarani K, Bastani P, Radinmanesh, Kavosi Z. Risk Factors for Gastric Cancer: A Systematic Review. Asian Pac J Cancer Prev. 2018;19:591-603.\u003c/li\u003e\n \u003cli\u003eNeuman MG, French SW, Zakhari S, et al. Alcohol, microbiome, life style influence alcohol and non-alcoholic organ damage. Exp Mol Pathol. 2017;102:162-80.\u003c/li\u003e\n \u003cli\u003eSteffen A, Huerta JM, Weiderpass E, et al. General and abdominal obesity and risk of esophageal and gastric adenocarcinoma in the European Prospective Investigation into Cancer and Nutrition. Int J Cancer. 2015;137:646-57.\u003c/li\u003e\n \u003cli\u003eDong SR, Ju XL, Yang WZ. STAT5A reprograms fatty acid metabolism and promotes tumorigenesis of gastric cancer cells. Eur Rev Med Pharmacol Sci. 2019;23:8360-70.\u003c/li\u003e\n \u003cli\u003ePeck B, Schulze A. Lipid Metabolism at the Nexus of Diet and Tumor Microenvironment. Trends Cancer. 2019;5:693-703.\u003c/li\u003e\n \u003cli\u003eLi Y, Wu S, Zhao X, et al. Key events in cancer: Dysregulation of SREBPs. Front Pharmacol. 2023;14:1130747.\u003c/li\u003e\n \u003cli\u003eBeloribi-Djefaflia S, Vasseur S, Guillaumond F. Lipid metabolic reprogramming in cancer cells. Oncogenesis. 2016;5:e189.\u003c/li\u003e\n \u003cli\u003eHardie DG, Ross FA, Hawley SA. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol. 2012;13:251-62.\u003c/li\u003e\n \u003cli\u003eLing N, Kaczmarek A, Hoque A, et al. mTORC1 directly inhibits AMPK to promote cell proliferation under nutrient stress. Nat Metab. 2020;2:41-9.\u003c/li\u003e\n \u003cli\u003eSaxton RA, Sabatini DM. mTOR Signaling in Growth, Metabolism, and Disease. Cell. 2017;168:960-76.\u003c/li\u003e\n \u003cli\u003eSengupta S, Peterson TR, Sabatini DM. Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress. Mol Cell. 2010;40:310-22.\u003c/li\u003e\n \u003cli\u003ePeterson TR, Sengupta SS, Harris TE, et al. mTOR complex 1 regulates lipin 1 localization to control the SREBP pathway. Cell. 2011;146:408-20.\u003c/li\u003e\n \u003cli\u003eHashimoto I, Koizumi K, Tatematsu M, et al. Blocking on the CXCR4/mTOR signalling pathway induces the anti-metastatic properties and autophagic cell death in peritoneal disseminated gastric cancer cells. Eur J Cancer. 2008;44:1022-9.\u003c/li\u003e\n \u003cli\u003eHsu YC, Chen HY, Yuan S, et al. Genome-wide analysis of three-way interplay among gene expression, cancer cell invasion and anti-cancer compound sensitivity. BMC Med. 2013;11:106.\u003c/li\u003e\n \u003cli\u003eChen C, Maimaiti A, Zhang X, et al. Knockdown of RAI14 suppresses the progression of gastric cancer. Onco Targets Ther. 2018;11:6693-703.\u003c/li\u003e\n \u003cli\u003eHe XY, Zhao J, Chen ZQ, Jin R, Liu CY. High Expression of Retinoic Acid Induced 14 (RAI14) in Gastric Cancer and Its Prognostic Value. Med Sci Monit. 2018;24:2244-51.\u003c/li\u003e\n \u003cli\u003eXiao Y, Zhang H, Du G, et al. RAI14 Is a Prognostic Biomarker and Correlated With Immune Cell Infiltrates in Gastric Cancer. Technol Cancer Res Treat. 2020;19:1533033820970684.\u003c/li\u003e\n \u003cli\u003eShen X, Zhang J, Zhang X, Wang Y, Hu Y, Guo J. Retinoic Acid-Induced Protein 14 (RAI14) Promotes mTOR-Mediated Inflammation Under Inflammatory Stress and Chemical Hypoxia in a U87 Glioblastoma Cell Line. Cell Mol Neurobiol. 2019;39:241-54.\u003c/li\u003e\n \u003cli\u003eFang S, Pan J, Zhou C, et al. Circular RNAs Serve as Novel Biomarkers and Therapeutic Targets in Cancers. Curr Gene Ther. 2019;19:125-33.\u003c/li\u003e\n \u003cli\u003eGeng Y, Jiang J, Wu C. Function and clinical significance of circRNAs in solid tumors. J Hematol Oncol. 2018;11:98.\u003c/li\u003e\n \u003cli\u003eAshwal-Fluss R, Meyer M, Pamudurti NR, et al. circRNA biogenesis competes with pre-mRNA splicing. Mol Cell. 2014;56:55-66.\u003c/li\u003e\n \u003cli\u003eDi Timoteo G, Dattilo D, Centr\u0026oacute;n-Broco A, et al. Modulation of circRNA Metabolism by m6A Modification. Cell Rep. 2020;31:107641.\u003c/li\u003e\n \u003cli\u003eWei W, Ji X, Guo X, Ji S. Regulatory Role of N(6) -methyladenosine (m(6) A) Methylation in RNA Processing and Human Diseases. J Cell Biochem. 2017;118:2534-43.\u003c/li\u003e\n \u003cli\u003eZhang G, Li X, Huang X. m6A-related bioinformatics analysis and functional characterization reveals that METTL3-mediated NPC1L1 mRNA hypermethylation facilitates progression of atherosclerosis via inactivation of the MAPK pathway. Inflamm Res. 2023;72:429-42.\u003c/li\u003e\n \u003cli\u003eZhang L, Wang X, Zhao W, Liu J. Overview of m(6)A and circRNAs in human cancers. J Cancer Res Clin Oncol. 2023;149:6769-84.\u003c/li\u003e\n \u003cli\u003eYan X, Zhang M, Li B, Ji X, Wu H, Zhang Q. RAI14 Regulated by circNFATC3/miR-23b-3p axis Facilitates Cell Growth and Invasion in Gastric Cancer. Cell Transplant. 30,2021. 9636897211007055.\u003c/li\u003e\n \u003cli\u003eZhang X, Wei LH, Wang Y, et al. Structural insights into FTO\u0026apos;s catalytic mechanism for the demethylation of multiple RNA substrates. Proc Natl Acad Sci U S A. 2019;116:2919-24.\u003c/li\u003e\n \u003cli\u003eLi Y, Zheng D, Wang F, Xu Y, Yu H, Zhang H. Expression of Demethylase Genes, FTO and ALKBH1, Is Associated with Prognosis of Gastric Cancer. Dig Dis Sci. 2019;64:1503-13.\u003c/li\u003e\n \u003cli\u003eXu D, Shao W, Jiang Y, Wang X, Liu Y, Liu X. FTO expression is associated with the occurrence of gastric cancer and prognosis. Oncol Rep. 2017;38:2285-92.\u003c/li\u003e\n \u003cli\u003eYang Z, Jiang X, Zhang Z, et al. HDAC3-dependent transcriptional repression of FOXA2 regulates FTO/m6A/MYC signaling to contribute to the development of gastric cancer. Cancer Gene Ther. 2020.\u003c/li\u003e\n \u003cli\u003eZhang J, Hou L, Liang R, et al. CircDLST promotes the tumorigenesis and metastasis of gastric cancer by sponging miR-502-5p and activating the NRAS/MEK1/ERK1/2 signaling. Mol Cancer. 2019;18:80.\u003c/li\u003e\n \u003cli\u003eDumas JF, Brisson L, Chevalier S, et al. Metabolic reprogramming in cancer cells, consequences on pH and tumour progression: Integrated therapeutic perspectives with dietary lipids as adjuvant to anticancer treatment. Semin Cancer Biol. 2017;43:90-110.\u003c/li\u003e\n \u003cli\u003eRay U, Roy SS. Aberrant lipid metabolism in cancer cells - the role of oncolipid-activated signaling. FEBS J. 2018;285:432-43.\u003c/li\u003e\n \u003cli\u003eSchiliro C, Firestein BL. Mechanisms of Metabolic Reprogramming in Cancer Cells Supporting Enhanced Growth and Proliferation. Cells. 2021;10:1056.\u003c/li\u003e\n \u003cli\u003eGarcia D, Shaw RJ. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol Cell. 2017;66:789-800.\u003c/li\u003e\n \u003cli\u003eWang KW, Dong M. Role of circular RNAs in gastric cancer: Recent advances and prospects. World J Gastrointest Oncol. 2019;11:459-69.\u003c/li\u003e\n \u003cli\u003eHe Z, Zhu Q. Circular RNAs: Emerging roles and new insights in human cancers. Biomed Pharmacother. 2023;165:115217.\u003c/li\u003e\n \u003cli\u003eYang F, Ma Q, Huang B, et al. CircNFATC3 promotes the proliferation of gastric cancer through binding to IGF2BP3 and restricting its ubiquitination to enhance CCND1 mRNA stability. J Transl Med. 2023;21:402.\u003c/li\u003e\n \u003cli\u003eKoundouros N, Poulogiannis G. Reprogramming of fatty acid metabolism in cancer. Br J Cancer. 2020;122:4-22.\u003c/li\u003e\n \u003cli\u003eR\u0026ouml;hrig F, Schulze A. The multifaceted roles of fatty acid synthesis in cancer. Nat Rev Cancer. 2016;16:732-49.\u003c/li\u003e\n \u003cli\u003eYan Z, Liu K, Xu P, et al. ACLY promotes gastric tumorigenesis and accelerates peritoneal metastasis of gastric cancer regulated by HIF-1A. Cell Cycle. 2023;22:2288-301.\u003c/li\u003e\n \u003cli\u003eBian X, Liu R, Meng Y, Xing D, Xu D, Lu Z. Lipid metabolism and cancer. J Exp Med. 2021;218:e20201606.\u003c/li\u003e\n \u003cli\u003eAn Y, Duan H. The role of m6A RNA methylation in cancer metabolism. Mol Cancer. 2022;21:14.\u003c/li\u003e\n \u003cli\u003eZhang C, Zhang M, Ge S, et al. Reduced m6A modification predicts malignant phenotypes and augmented Wnt/PI3K-Akt signaling in gastric cancer. Cancer Med. 2019;8:4766-81.\u003c/li\u003e\n \u003cli\u003eDelahanty RJ, Beeghly-Fadiel A, Xiang YB, et al. Association of obesity-related genetic variants with endometrial cancer risk: a report from the Shanghai Endometrial Cancer Genetics Study. Am J Epidemiol. 2011;174:1115-26.\u003c/li\u003e\n \u003cli\u003eHuang X, Zhao J, Yang M, Li M, Zheng J. Association between FTO gene polymorphism (rs9939609 T/A) and cancer risk: a meta-analysis. Eur J Cancer Care (Engl). 2017;26.\u003c/li\u003e\n \u003cli\u003eAzzam SK, Alsafar H, Sajini AA. FTO m6A Demethylase in Obesity and Cancer: Implications and Underlying Molecular Mechanisms. Int J Mol Sci. 2022;23:3800.\u003c/li\u003e\n \u003cli\u003eLin Y, Ueda J, Yagyu K, et al. Association between variations in the fat mass and obesity-associated gene and pancreatic cancer risk: a case-control study in Japan. BMC Cancer. 2013;13:337.\u003c/li\u003e\n \u003cli\u003eKalo E, G\u0026uuml;ven\u0026ccedil; C, Marasigan V, Lambrechts D, van den Oord J, Garmyn M. A variant in FTO gene shows association with histological ulceration in cutaneous melanoma. J Cutan Pathol. 2020;47:98-101.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"FTO, circNFATC3, lipid metabolism reprogramming, gastric cancer","lastPublishedDoi":"10.21203/rs.3.rs-9252847/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9252847/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eAim\u003c/strong\u003e To determine the mechanism by which fat mass and the obesity-associated protein (FTO)-regulated circNFATC3/miR-23b-3p axis influence RAI14-mediated gastric cancer (GC) progression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e Retinoic acid-induced protein 14 (RAI14), adenosine 5′-monophosphate-activated protein kinase (AMPK), mTOR (mTOR), sterol regulatory element-binding protein 1 (SREBP1), ATP citrate lyase (ACLY), fatty acid synthase (FASN), and miR-23b-3p expression was assessed via quantitative real-time polymerase chain reaction and/or western blotting. Cell viability, proliferative and migratory were determined via MTT, colony formation, and Transwell assays. Tumor growth was monitored\u003cem\u003ein vivo\u003c/em\u003e via a xenograft model, and protein expression was evaluated viaimmunohistochemical staining. RNA immunoprecipitation (RIP) and methylated RNA immunoprecipitation (MeRIP) assays were performed to examine the direct interaction between FTO and circNFATC3 and to assess the m6A modification level of circNFATC3. N6-methyladenosine (m6A)-regulated genes targeted by circNFATC3 were predicted via the miRanda algorithm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eRAI14 overexpression decreased miR-23b-3p and AMPK expression but increased mTOR, SREBP1, ACLY, and FASN expression in GC cells. AMPK, mTOR, and SREBP1 modulation affects GC cell growth and invasiveness. circNFATC3 overexpression facilitated tumor growth \u003cem\u003ein vivo,\u003c/em\u003e accompanied by elevated RAI14, FTO, mTOR, SREBP1, ACLY, FASN, and Ki67 expression and decreased AMPK expression. circNFATC3 depletion inhibited tumor growth. RIP assays confirmed the direct binding of FTO protein to circNFATC3 RNA. MeRIP assays demonstrated that FTO overexpression/knowdown decreased/increased m6A modification on circNFATC3. FTO overexpression/depletion increased/decreased circNFATC3 expression and decreased/increased miR-23b-3p expression. FTO enhances GC cell proliferation and invasion by influencing circNFATC3 expression. Analysis of human GC tissues revealed lower AMPK expression than that in adjacent normal tissues.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e Lipid synthesis and metabolic reprogramming play critical roles in energy metabolism, growth, and proliferation in GC. FTO directly binds to circNFATC3 and regulates the circNFATC3/miR-23b-3p/RAI14 axis during GC progression through an m6A-dependent mechanism.\u003c/p\u003e","manuscriptTitle":"The FTO-regulated circNFATC3/miR-23b-3p axis promotes RAI14-mediated gastric cancer progression via lipid metabolic reprogramming","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-02 16:46:10","doi":"10.21203/rs.3.rs-9252847/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"18198edc-e85b-479b-ac6c-6989a74dbfec","owner":[],"postedDate":"April 2nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-03T09:41:17+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-02 16:46:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9252847","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9252847","identity":"rs-9252847","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00