Agronomic Performance and Flowering Behavior in Response to Photoperiod and Vernalization in Barley (Hordeum vulgare L.) Genotypes with Contrasting Drought Tolerance Behavior | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Agronomic Performance and Flowering Behavior in Response to Photoperiod and Vernalization in Barley ( Hordeum vulgare L.) Genotypes with Contrasting Drought Tolerance Behavior Jamal Abu-Elenein, Rabea Al-Sayaydeh, Zahera Akkeh, Zakaria Al-Ajlouni, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-289948/v2 This work is licensed under a CC BY 4.0 License Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Abstract In dry environments, the appropriate matching of reproductive development with water availability is considered very crucial for crop success. In this study, the role of variations in flowering time and drought tolerance in selected barley genotypes with contrasting drought tolerance behavior was studied under field and controlled conditions. For this purpose, field trials were conducted for two consecutive seasons at three diverse locations where the studied genotypes were subjected to either rainfed conditions or rainfed plus supplementary irrigation under two different sowing dates. Furthermore, reproductive meristem development was assessed in two selected barley genotypes, Rum (drought tolerant) and Steptoe (drought-sensitive), in response to both vernalization and water stress under two different photoperiod conditions. Variation in the number of days to heading was more pronounced under rainfed conditions than under well-water conditions. For agronomic performance, Rum was superior under all tested environments, which assures its general adaptability to dry environments. Under controlled conditions, the transition to reproductive meristem was faster under vernalized long-day conditions compared to vernalized short-day conditions. The progress of shoot apical meristem development and heading under long-day conditions was significantly faster in Rum compared to Steptoe. A pronounced effect of drought stress was observed on shoot apical meristem development in Steptoe. Under short-day conditions, vernalized Rum plants subjected to drought showed an advanced meristem development stage and a significantly earlier heading compared to non-stressed plants. This early heading in stressed Rum plants under short-day conditions was accompanied by higher gene expression of the Vrn-H1 and Vrn-H3 genes. In conclusion, the integration of vernalization and photoperiod signals in drought-tolerant barley genotypes was associated with early flowering time and higher productivity in dry environments. Plant Physiology and Morphology Plant Molecular Biology and Genetics Barley Drought Flowering time Gene Expression Photoperiod Vernalization Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Barley is considered one of the most important cereal crops in the world in terms of harvested area, trade value and human nutrition (Newman and Newman, 2008). It is commonly used for human consumption, animal feed and malting and it is considered the crop of choice in marginal and dry areas (Horsley et al., 2009). In eastern parts of the Mediterranean basin, barley is generally grown in arid and semi-arid areas that are characterized by low amounts of precipitation and prolonged drought conditions (Visioni et al., 2019). As a rainfed crop, barley is frequently suffering from drought conditions that occur when the soil water content is not available in sufficient amounts to support normal growth and development (Jedmowski et al., 2015). To maintain a sustainable increase in barley yield, the development of location-specific and high-yielding varieties with improved tolerance to abiotic stresses is needed (Visioni et al., 2019). Drought stress has always played an important selective role in the evolution of plant growth, development and physiology (Araus et al., 2008). Plant adaptation to dry conditions is considered a key factor that will determine crop productivity in response to climate change and associated conditions (Anderson et al., 2020). In this perspective, shifting planting dates or switching to short growing-season varieties are considered a useful strategy to reduce the negative impact of climatic change and associated stresses such as drought and heat stress (Lu et al., 2017). The ability to regulate flowering time in cereal plants will enable them to complete their life cycle successfully under a wide range of environments (Distelfeld et al., 2009). Therefore, flowering time is considered an important trait for crop improvement in dry environments (Jung et al., 2017). Flowering is a crucial event in the life cycle of seed propagated plants and is usually affected by different environmental stimuli (Jung et al., 2017). Flowering time, also known as heading date in cereals, is a major trait that is linked to the adaptation to particular environments and it determines the crop performance under field conditions (Campoli and von Korff, 2014; Gol et al., 2017). In temperate cereals, photoperiod sensitivity and vernalization requirements are major cues that determine flowering time (Distelfeld et al., 2009). Vernalization accelerates flowering by promoting inflorescence initiation, the first step in the transition of the shoot apex to the reproductive phase (Sasani et al., 2009). Vernalization is an adaptation process that prevents the exposure of sensitive floral meristems to freezing winter temperatures (Distelfeld et al., 2009). Winter barley requires vernalization and therefore, it is planted in the fall and requires long exposures to cold temperatures during winter to initiate flowering (Saisho et al., 2011). On the other hand, spring barley is planted in spring and does not require vernalization to flower, while in facultative type, vernalization accelerate flowering time, but still, plant can flower without it (Campoli and von Korff, 2014). On the other hand, photoperiod is a major factor determining cereal plant flowering and crop performance in response to day length (Jung et al., 2017). In barley, floret primordia are initiated under long and short days, whereas successful inflorescence development occurred only under long days (LD) in photoperiod responsive genotypes when the day becomes longer than a critical day length (Trevaskis et al., 2007; Digel et al., 2015). The manipulation of flowering time in barley may strongly affect its adaptation to marginal areas and dry conditions (Maurer et al., 2015; Wiegmann et al., 2019). Early genetic analysis indicates the presence of a correlation between growth habit and stress tolerance where spring barley genotypes were less freezing tolerant when compared to winter types (Galiba et al., 2009). Allelic differences and their combinations in vernalization- ( VRN ) and photoperiod-related ( PPD ) genes seem to have large effects on stress tolerance in temperate cereals (Von Korff et al., 2008; Casao et al., 2011a). For instance, the PHOTOPERIOD-H1 ( Ppd-H1 ) gene was found to control stress-induced senescence in barley roots subjected to osmotic stress (Habte et al., 2014). and most recently it was found to control the plasticity of development in response to drought (Gol et al., 2021). In another study, barley genotypes carrying spring alleles of the VERNALIZATION-H1 ( Vrn-H1 ) gene showed an accelerated flowering under drought stress when compared to genotypes carrying winter alleles (Al-Ajlouni et al., 2016). Therefore, the interaction between environmental cues, such as day-length and low-temperatures, and the allelic variations in major flowering time genes might affect the flowering time and adaptation of barley to dry conditions (Campoli and von Korff, 2014). In this study, we analyzed the flowering time, reproductive meristem development, growth and physiological responses to stress conditions in selected barley genotypes with contrasting drought tolerance behavior. For this purpose, the flowering time and agronomic performance of drought-tolerant and drought-sensitive barley genotypes were studied at different contrasting environments and management practices for two growing seasons. Thereafter, the impact of drought stress on two selected barley genotypes, with contrasting drought tolerance behavior, was assessed under controlled conditions with different vernalization and photoperiod treatments. The expression patterns of major flowering time genes ( Ppd-H1, Vrn-H1 and Vrn-H3 ) in response to drought, vernalization and photoperiod treatments were investigated in both selected genotypes at specific time points. The presented results showed that drought effects varied in response to vernalization and photoperiod treatments in tested genotypes, highlighting the importance of phenological adjustment in barley for better adaption to dry environments. Materials And Methods Plant Material Four barley genotypes with contrasting drought tolerance behavior were used in this study (Al-Ajlouni et al., 2016): Rum cultivar (Harbinger-Arivat × Attiki; released in Jordan in 1986) was developed by CIMMYT/ICARDA and it is known for its stable productivity under semi-arid conditions and is considered a drought-tolerant genotype; Acsad176 (CM872-189-3Y-1B-2Y-1BX1Y-OB) × (Cr.366/16/2)) developed by ACSAD center and commonly grown in semi-arid regions in Jordan where supplementary irrigation is recommended; Steptoe (Washington Selection 3564/Unitan) is derived from coast-type barley originating in North Africa and is considered a drought-sensitive genotype (Al-Ajlouni et al., 2016); Morex is a spring smooth-awned spring barley cultivar derived from Manchurian barley (Cree/Bonanza). All selected genotypes are spring types but carrying different spring Vrn-H1 alleles ( Vrn-H1-7 in Rum and Acsad176, Vrn-H1-4 in Steptoe and Vrn-H1-1 in Morex (Cockram et al., 2007a; Al-Ajlouni et al., 2016) and all carry a functional Ppd-H1 allele conferring photoperiodic responses to LD conditions except for Morex, which carries a nonfunctional ppd-H1 allele (Al-Ajlouni et al., 2016). All four genotypes were used for field trials, while Rum and Steptoe were selected for the controlled conditions experiment. Field Trials The field trials were carried out in three agricultural stations across Jordan for two growing seasons (2011-2012 and 2012-2013). The first station was Jubeiha (JU) Agricultural Research Station located in the University of Jordan campus (Jubeiha/Amman; 32°00′40″ N, 35°52′24″ E; elevation: 990 m; average annual precipitation: 505 mm; soil type: clay loam) representing a semi-humid area. The second station was at the Jordan University of Science and Technology (JUST) campus research station (Ramtha; 32°28′47.4″ N, 35°59′11.1″ E; elevation: 520 m; average annual precipitation: 217 mm; soil type: clay loam) representing a dry area. The third station was at Rabbah (RB) Center for Agriculture Research-NARC (Rabbah/Al Karak; 31°16′37.1″ N, 35°44′26.9″ E; elevation: 920 m; average annual precipitation: 337 mm; soil type: clay) representing a semi-dry area. In each trial, the four tested genotypes were sown at two different dates: the 1 st of December and the 1 st of February. Furthermore, the genotypes were cultivated in each field trial under either rainfed or supplementary irrigation conditions. The weather data and the amount of supplementary irrigation applied are provided in Supplementary Table S1. A split-split plot design with four replications was used where each replicate contained two plots for irrigation and rainfed treatments and each plot contains two subplots for planting date treatments. Each subplot area contained the four tested genotypes randomly distributed with each genotype sown in two adjacent rows (1.5 m length and 0.3 m apart with a total plot area of 1 m 2 ). The seeding rates were adjusted according to the results of a seed germination test (based on 90% germination) to obtain a plant density from the viable seeds of 75 plants/row (approximately 150 plants/m 2 ). In irrigated plots, average soil moisture in the first 60 cm depth was maintained at 80% of field capacity, which was estimated each week using soil HH2 moisture meter (Profile Probe type PR2, DELTA-T Devices, Cambridge, England). All field experiments followed “a fallow in the crop rotation” and were established using hand broadcasting following conventional tillage operations performed with a chisel plow and disk harrow. In each location, experimental plots were managed following the standard agricultural practices including fertilizer application to match the crop needs, weed control (hand weeding and herbicides against broad-leaf weeds) and pesticide use against main pathogens. Weather stations at the field sites were used to record precipitation and temperatures during the growing seasons. Field Trials Data Analysis During plant growth and before harvest, the following data were collected: days to heading (HD: in days; Zadoks scale: GS59) was determined visually by calculating the number of days from emergence to the day when 50% of plants had spikes; days to physiological maturity (MD: in days; Zadoks scale: GS87) was determined visually by calculating the number of days from emergence to the day when 90% of the plants have reached the physiological maturity stage (no green tissue remained in 90% of the plants in the plot); Grain filling period (GFP: in days) was estimated by subtracting MD from HD; plant height (PH: cm) that was measured for each genotype at maturity from the ground to the spike tip (excluding awns) on three selected plants that were randomly distributed in each row; peduncle length (PL: cm) that was measured as the distance from the flag leaf collar to the base of the spike on the main stem of plants used to measure plant height and whenever the value is negative, this indicates that the spike remained inside the sheath of the flag leaf. At the end of the experiment, plants were harvested from each sub-plot and the following measurements were recorded: total plant weight (TW: g/m 2 ) that was measured as the whole dry weight of the harvested plants; spikes number (SN) as the number of spikes counted per m 2 ; spikes weight (SPW: g/m 2 ) that was measured by weighing the spikes obtained from harvested plants; Straw weight (STW: g/m 2 ) that was obtained by subtracting spikes weight from the total plant weight; for grain yield (GY: g/m 2 ), spikes were separated and threshed and the grains were cleaned from the chaff and weighed; grains per spike (G.S) was calculated by dividing grains number on the total spikes number; grains number (GN: grains/m 2 ) was obtained by counting the harvested seeds using a seed counter; thousand kernel weight (TKW: g) was calculated by dividing the GN by GY multiplied by 1000; harvest index (HI: %) was calculated by dividing GY over TW multiplied by 100. For statistical analysis, the multi-environment field trials data were analyzed as a split-split plot design using the GenStat statistical software (Release 16.1, 2013; VSN International L) and a combined analysis of variance (ANOVA) was obtained for each trait. For this purpose, each location-growing season combination was considered a single environment resulting in six environments: JU2012, JU2013, JUST2012, JUST2013, RB2012 and RB2013. The ANOVA was conducted to analyze the variations due to environments, sowing dates, water regimes, genotypes and all of their interactions. The coefficients of variation (CV%) for each trait were determined and when significant differences were detected, a comparison of means was conducted using the least significant difference test (LSD, P<0.05 ) to determine the performances of tested genotypes under all treatment combinations. Pearson correlation coefficients were calculated in the R software 4.0.2 using the metan package (Olivoto and Lúcio, 2020) using the means for all or selected combinations of environments, genotypes, water regimes and sowing dates. To analyze the specific adaptation, superiority, and stability of the genotypes across tested environments for the GY trait, the GGE function (Yan, 2001) of the metan package (Olivoto and Lúcio, 2020) was used. For this purpose, each environment-sowing date-water regime combination were considered as one distinctive environmental group. Controlled Conditions Experiment To test the effect of drought, vernalization and photoperiod on flowering time and physiological responses in Rum (drought tolerant) and Steptoe (drought sensitive), a pot experiment was conducted under controlled growth conditions. For the vernalization treatment, seeds of both genotypes were imbibed with distilled water and planted (2 seeds per pot) in foil-covered pots (30 cm height and 20 cm diameter) containing a mixture of sand and perlite (2:1) and were subjected to 45 days of vernalization at 4 ℃ under complete darkness as described previously (Hemming et al., 2008). After vernalization, the seedlings were transferred to growth chamber conditions, either under LD (16 h light/8 h dark) or short-day (SD: 8 h light/16 h dark) conditions depending on the photoperiod treatment, along with non-vernalized seven-days old seedlings (germinated under complete darkness at room temperature). After one week, leaf number was counted in vernalized and non-vernalized seedling and those plants with leaf numbers similar to that of seven days-old seedlings were selected for further analysis (Hemming et al., 2008). Both vernalized and non-vernalized selected seedlings were grown under either SD or LD conditions at 22±1 °C with a light intensity level of 255.5 μmol m −2 s −1 (at pot level) and the plants were allowed to grow up to 120 days. For drought treatment, the seeds of both vernalized and non-vernalized plants were exposed to well-watered and drought conditions under two different photoperiods (LD and SD) as described above. The treated seedlings of both tested genotypes were subjected to continuous drought conditions by withholding irrigation at the start of the experiment, while non-stressed seedlings were kept hydrated and were used as control. Water levels were maintained at 75% of pot capacity for non-stressed plants and at 15% of pot capacity for stressed plants (Al-Ajlouni et al., 2016). The soil moisture levels for pots were maintained at the targeted pot capacity by irrigating the calculated amounts of water after measuring pot water content using a Delta-T soil moisture probe device (Theta Probe type ML2X, Delta-T Devices, Cambridge, England). Physiological and Growth Measurements Leaf relative water content (RWC) was measured biweekly for the first eight weeks of the experiment as described previously (Al Abdallat et al., 2014) and the RWC was calculated according to (Barrs and Weatherley, 1962). Stomatal resistance was measured on the most upper fully expanded leaf biweekly for the first eight weeks of the experiment by using a Porometer device (AP4, Delta-T Devices, Cambridge, UK). For leaf chlorophyll fluorescence yield, measurements were recorded directly by using a Pulse-Modulated Fluorometer (OS1-FL modulated chlorophyll fluorometer, ADC Bio Scientific Ltd., Hertford, UK) as described previously (Al Abdallat et al., 2014). Fluorescence measurements were taken after 20 min of acclimation to darkness under leaf clips (FL-DC; Opti-Sciences). The maximum quantum efficiency ( Fv/Fm ) of photosystem II was calculated as Fv/Fm = ( Fm - F0 )/ Fm , where Fm and F0 are the maximal and minimal chlorophyll fluorescence measured in darkness-adapted leaves, respectively. For shoot apical meristem development, plants were sampled biweekly for the first eight weeks of the experiment. Shoot apices were dissected under a binocular dissecting microscope (LAS EZ, Leica Microsystems, Switzerland) and digitally photographed by using an integrated digital camera. Phenotypic meristem development was scored according to the Waddington scale (Waddington et al., 1983) using four plants per experimental treatment. The HD was recorded based on the number of days between emergence and heading following the Zadoks scale (Zadoks et al., 1974). A comparison between means was conducted using standard error of means to determine the performances of the two genotypes under all treatment combinations. Gene Expression Analysis For quantitative real-time PCR (qRT-PCR) analysis of treated barley plants (controlled conditions experiment), total RNA was isolated from leaf samples collected after 10 hours from the onset of light conditions for LD and eight hours for SD conditions irrespective of vernalization or stress conditions. The leaf samples were collected after two and four weeks for LD treated plants and after four and six weeks for SD treated plants. Specific primers pairs for three major flowering genes in barley Ppd-H1 : fwd: 5`- CAAATCAAAGAGCGGCGATG-3` and Rev: 5`- TCTGACTTGGGATGGTTCACA-3` (Hemming et al., 2012); Vrn-H1 : fwd: 5`-TGAAGCTCAGAAATGGATTCG-3` and Rev: 5`-TATGAGCGCTACTCTTATGC-3` (Trevaskis et al., 2006); Vrn-H3 : fwd: 5`- ATCTCCACTGGTTGGTGACAGA and Rev: 5` TTGTAGAGCTCGGCAAAGTCC-3` (Yan et al., 2006) were used. For the stress-inducible gene expression, specific primers pair for the HVA22 gene (Shen et al., 2001) were used (fwd: 5`-ATGGGCAAATCATGGGCGCT-3` and Rev: 5`-TGCACCTTGTGATCGGCGTC-3`). Two internal-reference controls for the relative gene expression analysis were used: HvActin (encoding actin, a house-keeping gene (Al Abdallat et al., 2014)) and Hvu-SnoR14 (Small nucleolar RNA (Ferdous et al., 2015). The amplification of the targeted genes was carried out using the GoTaq® qPCR Master Mix Kit following the manufacturers’ instructions (Promega, Madison, WI, USA), and the real-time detection of the amplified products was performed in a Mini-Opticon Real-Time PCR System (BioRad, Hercules, CA, USA). All cDNA samples were analyzed in triplicate, and each replicate was derived from two biological samples. Thermal cycling conditions consisted of an initial denaturation step of 94 °C for 5 minutes followed by 40 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 45 s, followed with a final extension at 72 °C for 5 min. The relative changes in gene expression between tested genotypes for all vernalization and drought treatment combinations at specific time points for photoperiod treatment were quantified as described in (Vandesompele et al., 2002). Results Field Trials Analyzing weather data during the two growing seasons indicates that January and February were the coldest months (Supplementary Table S1). During this time, all field trials were exposed to temperatures less than 5 ℃ indicating that the tested genotypes were exposed to vernalization conditions. For rainfall amounts, RB station received ~10% (33.5 mm) less precipitation than the long-term rainfall average during the first growing season, while JU and JUST stations received 11.5% (58 mm) and 40% (86.5 mm) more, respectively (Supplementary Table S1). During the second growing season, all locations received more rainfall than the long-term average where RB received 3% (11 mm), JU 6% (28 mm) and JUST 10% (20.6 mm) above the long-term average. The rainy season in 2012 was terminated in April in all stations and was accompanied by high temperatures at the end of the season (Supplementary Table S1). In 2013, the rainy season was terminated earlier than expected in RB in March, while only 7.8 mm were received only in JUST that resulted in severe terminal drought conditions. The amounts of water provided by supplementary irrigation for irrigated plots are given in Supplementary Table S1. The combined ANOVA for the studied traits showed highly significant differences ( P<0.001 ) between genotypes, locations, water regimes, sowing dates, and their interactions (Supplementary Table S2). The mean values for the studied traits across the six environments and their combinations with the sowing date and water regime are given in Supplementary Table S3. For correlation analysis, positive high significant correlations ( P<0.001 ) were found between all traits where GY showed a strong correlation with yield component-related traits and with HD, MD and GFP (Figure S1). For GY, the percentage of variance explained by main factors varied where genotypic effect attributed 12.95%, environment (location-year) attributed 12.54%, water regime attributed 42.75% and sowing date attributed 23.78% from the total variance. Mean values of GY differed significantly between genotypes and ranged from 585 g/m 2 in Rum to 367 g/m 2 in Steptoe. For the sowing date, GY mean values differed significantly with December produced the highest GY mean value (605 g/m 2 ) compared to February (341 g/m 2 ). The GY mean values of water regime treatment differed significantly with the irrigation treatment produced 650 g/m 2 compared to rainfed 296 g/m 2 . In addition, the interaction between sowing date, water regime and genotype on GY was highly significant ( P<0.001 ; Supplementary Table S2). Rum produced the highest mean value of GY (889 g/m 2 ) under irrigated conditions and December sowing date, while Steptoe produced the lowest mean value of GY (73 g/m 2 ) under rainfed conditions and February sowing date where Rum produced 188 g/m 2 (LSD (0.05) = 13.9). The interaction effect between environments, water regime, sowing date and genotypes on the GY showed highly significant differences ( P<0.001 ) (Supplementary Table S1; Supplementary Table S3; Figure 1A). For instance, Steptoe produced the lowest mean value (50 g/m 2 ) for GY under rainfed conditions in JUST-2013 for the December sowing date, while Rum under the same conditions produced 388 g/m 2 (LSD (0.05) = 42.2) (Supplementary Table S3). In JUST-2013, no significant differences were found between GY mean values of all tested genotypes under rainfed treatment for the February sowing date, however, Steptoe produced significantly the lowest GY mean values in all remaining environments (Supplementary Table S3). Under irrigated conditions, mean values of GY differed significantly between genotypes where Rum and Acsad176 produced the highest mean values for GY across all environments irrespective of sowing date treatment except when compared to Steptoe sown in December in JU2012 (Supplementary Table S3). For HD, the percentage of variance explained by main factors varied where genotypic effect attributed 9.03%, environment (location-year) attributed 5.05%, water regime attributed 0.47% and sowing date attributed 82.31% from the total variance. Heading date mean values of tested genotypes ranged from 90.2 days in Rum (significantly the earliest genotype to flower) to the significantly latest mean value (107.6 days) recorded in Steptoe. For the main effect of the sowing date, December produced significantly the highest HD mean value (116.7 days) when compared to February (75.7 days). For the water regime effect, the irrigation treatment produced significantly the highest HD mean value (97.8 days) when compared to rainfed (94.7 days). The interaction effect between sowing date and water regime on HD was significant ( P<0.05 ), and this indicates that the effect of water availability depended on the sowing date (Supplementary Table S2). The interaction effect between environments, water regime, sowing date and genotype on the HD showed a significant effect ( P<0.001 ) (Supplementary Table S2; Supplementary Table S3; Figure 1B). Steptoe produced the highest mean values for HD in any given environment × water regime combinations for December sowing date treatment (Figure 1B; Supplementary Table S3). For February sowing date treatment, clear significant differences were identified only in 2013 environments (JU-2013, RB-2013 and JUST-2013) between the HD mean values of Steptoe and other genotypes irrespective of water regime treatments (Supplementary Table S3). To analyze genotype-specific adaptation to specific environments for the GY trait, the GGE biplot was used. For this purpose, environments were reclassified based on the combination of each location, year, sowing date and water regime treatments to produce 24 distinct environmental groups. The relationships between the GY of tested genotypes and the 24 environmental groups and the degree by which each group is represented are shown in Figure 2A. The two principal components (PC1 and PC2) together captured 98.32% of the interaction effects and the variations due to GGE. Three irrigated environments from the 2013 season fell in the sector in which Acsad176 cultivar was the vertex genotype, which means that Acsad176 was the best genotype in these environments (Figure 2A). On the other hand, Rum was the best cultivar in the rest of the environments (21 out of 24) and specifically in all rainfed environments irrespective of location, sowing date, or season. By contrast, Morex and Steptoe did not perform well in all testing environments and the two genotypes were considered the poorest across all tested environments (Figure 2A). Interestingly, both genotypes were placed on different sectors indicating different responses to tested environments. For stability as measured by projection to the Average-Tester Axis y-axis, Rum was the most stable followed by Acsad176, while Steptoe and Morex were considered the least stable genotypes (Figure 2B). Based on the results above and to analyze the relationship between HD and agronomic performance, a new correlation analysis was performed using the field data of Rum and Steptoe alone after reclassifying the environments into four different groups based on the combination of sowing dates and water regime treatments (December-irrigated, December-rainfed, February-irrigated and February-rainfed). As shown in Figure S2, negative significant correlations were found across the four environmental groups between HD with GY and SPW. For December-irrigated conditions, the negative significant correlations with HD included HI and TKW, while for December-rainfed conditions the negative significant correlations with HD included TW and STW. For the February sowing date and irrespective of water regime treatment, negative significant correlations were detected between HD with TW, SN, GN, GS, TKW and HI (Figure S2). Controlled Conditions Experiment In this study, the transition to the reproductive stage under LD was significantly more advanced in Rum genotype when compared to Steptoe irrespective of photoperiod, vernalization and water regime combinations (Figure 3; Figure S3). After four weeks under LD and well-watered conditions, a difference was observed between non-vernalized and vernalized Rum plants. On the other hand, Steptoe reproductive meristem was in an advanced developmental stage under LD and well-watered conditions when compared to stressed plants irrespective of vernalization treatment (Figure 3A; Figure S3). After eight weeks of LD incubation under well-watered conditions, non-vernalized Steptoe reproductive meristem was in an advanced developmental stage when compared to well-watered and vernalized Steptoe plants. Under SD and irrespective of the vernalization and water regime treatments, the progression of reproductive meristem development in both genotypes was less advanced when compared to LD conditions (Figure 3; Figure S3). Significant differences were observed between the tested genotypes after eight weeks of incubation where stressed Rum plants subjected to vernalization showed a clear advanced developmental stage. Under the same conditions, stressed Steptoe plants showed a clear less advanced reproductive meristem when compared to other treated plants. After eight weeks of SD conditions and irrespective of water regime treatment, non-vernalized Rum plants showed a clear advanced developmental stage when compared to Steptoe (Figure 3B; Figure S3). At the end of the experiment, the mean values of HD of Rum plants grown under LD conditions were significantly lower than the mean values of Steptoe (Figure S4). On the other hand, vernalized Rum plants showed a significantly earlier HD under LD conditions when compared to non-vernalized Rum plants. Under LD conditions and irrespective of vernalization treatment, a significant delay in heading was observed in stressed Steptoe plants when compared to well-watered plants (Figure S4). Under SD and vernalization conditions, stressed Rum plants were significantly the earliest to flower when compared to well-watered plants. The effects of water stress on RWC, stomatal resistance, maximum quantum efficiency ( Fv/Fm ) of photosystem II was analyzed in treated plants as an index for drought tolerance in the two tested genotypes. Significant differences between well-watered and stressed in the two genotypes were observed for the tested physiological parameters under different photoperiod and vernalization conditions (Figure S5). For instance, the mean values of RWC of the tested genotypes were lower in stressed plants when compared with well-watered (Figure S5). Starting the 4 th week, the mean value of RWC of non-vernalized Steptoe plants grown under LD and drought conditions was significantly the lowest. Clear effects of drought stress on stomatal resistance and maximum quantum efficiency ( Fv/Fm ) of photosystem II were also observed in both genotypes (Figure S5). The expression patterns of Ppd-H1, Vrn-H1 , Vrn-H3 and HVA22 genes were investigated in both tested genotypes in response to drought and vernalization treatments after two and four weeks for LD conditions and after four and six weeks for SD conditions. After two weeks of LD conditions and irrespective of water regime treatment, the Ppd-H1 expression in vernalized Rum plants showed the highest levels when compared to other treated plants (Figure 4). After four weeks of LD incubation and irrespective of water regime treatment, the expression levels of Ppd-H1 in vernalized Rum plants were lower compared to non-vernalized Steptoe and Rum plants (Figure 4). For SD conditions, no major changes in Ppd-H1 expression levels were observed between the treated genotypes (Figure 4). After two weeks of LD conditions, the relative expression levels of Vrn-H1 were higher in vernalized plants when compared to non-vernalized for both tested genotypes (Figure 4). Irrespective of vernalization treatment, Rum showed higher Vrn-H1 expression after two weeks of LD incubation when compared to Steptoe. Irrespective of water regime treatment, Vrn-H1 expression levels after two weeks of LD incubation were significantly lower in non-vernalized Steptoe plants compared to vernalized plants (Figure 4). After four weeks of LD incubation, the same trend of high expression of Vrn-H1 was observed in vernalized plants when compared to non-vernalized plants (Figure 4). However, the expression levels of Vrn-H1 in vernalized and stressed Steptoe plants were significantly lower when compared to stressed Rum plants and when compared to well-watered Steptoe (Figure 4). After six weeks of SD conditions, the expression of Vrn-H1 was significantly higher in stressed and vernalized Rum plants when compared with other plants subjected to different treatment combinations. After eight weeks of SD conditions, Rum showed higher Vrn-H1 expression levels when compared to Steptoe (Figure 4) After two weeks of LD conditions, the expression levels of Vrn-H3 were significantly higher in vernalized Rum plants when compared to other plants subjected to different treatment combinations (Figure 4). Under LD conditions, non-vernalized Rum plants showed significant differences of Vrn-H3 expression levels when compared to non-vernalized Steptoe. The relative expression levels of Vrn-H3 under LD conditions were higher in vernalized Steptoe plants when compared to non-vernalized plants (Figure 4). After four weeks of LD conditions, non-vernalized Rum plant showed higher Vrn-H3 expression when compared to other treated plants. On the other hand, well-watered and vernalized-Steptoe plants showed higher Vrn-H3 expression when compared to stressed and vernalized-Steptoe plants (Figure 4). Under SD conditions, stressed and vernalized Rum plants showed higher Vrn-H3 expression levels when compared to other plants subjected to other treatment combinations (Figure 4). Furthermore, the expression levels of Vrn-H3 in vernalized and well-watered Rum plants were also significantly higher when compared to Steptoe plants, irrespective of treatment combinations. For HVA22 gene expression, no major changes were observed between the different growth conditions and treatments for both Rum and Steptoe where a clear increment in its expression level was observed under stress conditions (Figure 4). Discussion The occurrence of abiotic stresses in marginal Mediterranean environments, primarily heat and drought, are strongly variable over space and time (Baum et al., 2007). In these environments, terminal drought under rainfed conditions can lead to premature termination of plant growth before grain maturity and consequently can affect grain yield severely (Al-Abdallat et al., 2017). In this study, late sowing accompanied by terminal drought stress resulted in lower GY when compared to early sowing treatment. This is expected knowing that late sowing will subject barley plants to different abiotic stresses, such as drought and heat, which are expected to negatively affect the growth and yield (Samarah et al., 2009). In addition, late sowing of photoperiod responsive plants will result in faster development and pleotropic effects that will reduce yield in barley plants and particularly under drought. Furthermore, variations in the response of barley genotypes to different environments and treatments were obvious, confirming that GY was greatly affected by genotypic effects where the adapted local cultivars Rum and Acsad176, outperformed the non-adapted cultivars, Steptoe and Morex. In this study, Rum was superior and the most stable genotype under all tested environments, which indicated its general adaptability to multiple environments. In previous studies, Rum outperformed several Jordanian landraces and cultivars and was considered the most stable genotype under mild drought conditions (Samarah et al., 2009; Al-Sayaydeh et al., 2019). Nevertheless, Rum performance was relatively moderate when compared to 150 Jordanian landraces under severe drought conditions and therefore, it is more suited to areas with milder drought conditions (Al-Abdallat et al., 2017). On the other hand, Steptoe was the poorest and the least stable genotype across all tested environments and in particular under rainfed conditions. Similar results were reported recently where Rum outperformed Steptoe in field trials under drought conditions (Wiegmann et al., 2019) and it was the most drought-affected genotype under controlled conditions (Al-Ajlouni et al., 2016). In this study, drought seemingly accelerated HD under field conditions when compared to irrigated conditions. This is in general agreement with (Tavakol et al., 2016), who observed accelerated heading in barley plants under stress conditions. Steptoe was the last genotype to flower across different environments and was the most affected genotype by drought stress. Steptoe was described previously as a late flowering genotype that has a reduced peduncle and few tillers per plant (Al-Ajlouni et al., 2016). Such late HD was correlated with a severe reduction in GY when compared to early HD observed in Rum (Figure S2). This behavior was reported previously under controlled greenhouse conditions, where HD was negatively correlated with GY irrespective of water stress treatment (Al-Ajlouni et al., 2016). In the same study, Rum flowered earlier and outperformed Steptoe for GY and other yield-related traits under controlled drought conditions. In another study, Rum flowered earlier under field conditions when compared to Steptoe with a strong positive correlation between early flowering and GY under drought conditions (Wiegmann et al., 2019). This is supported further by the fact that any delay in flowering time in dry environments is commonly correlated with yield reductions (Rollins et al., 2013). In barley, flowering time is governed by genetic networks and allelic variations in key regulatory genes that fine-tune barley flowering in response to environmental stimuli (Campoli et al., 2012; Campoli and von Korff, 2014). During the fall, when barley seeds start to germinate, Vrn-H3 is repressed by Vrn-H2 (Distelfeld et al., 2009; Mulki and von Korff, 2016), while in winter, vernalization up-regulates Vrn-H1 , which results in the repression of Vrn-H2 in the leaves and, consequently, the activation of Vrn-H3 transcription in the spring (Fu et al., 2005; Chen and Dubcovsky, 2012; Mulki and von Korff, 2016). Furthermore, the allelic differences in Ppd-H1 and Ppd-H2 genes in barley are known to be associated with natural variations in the responses to day length (Turner et al., 2005). The Vrn-H2 functional allele was detected previously in Rum, while it was absent in Steptoe (Al-Ajlouni et al., 2016). The presence of Vrn-H2 is required to prevent premature flowering in winter barley under LD conditions particularly after fall sowing (Cockram et al., 2007b). No repression effect of Vrn-H2 on flowering was observed in Rum, which carries a spring Vrn-H1 allele ( Vrn-H1-7 ), which can overcome Vrn-H2 (Mulki and von Korff, 2016). Under controlled conditions, vernalization treatment seems to accelerate floral meristem development and heading in Rum under LD, irrespective of stress treatment, and in drought-stressed plants under SD conditions. Steptoe lacks functional Vrn-H2 alleles and carries the Vrn-H1-4 allele, which requires some vernalization (Hemming et al., 2009; Casao et al., 2011b), but still, Steptoe behaved differently from Rum, which might indicate that the genetic network governing heading under LD conditions is different. An LD-responsive Ppd-H1 allele was identified in both Rum and Steptoe, which explains their accelerated flowering responses under LDs conditions when compared to SD conditions (Campoli et al., 2012). A positive role of the LD-responsive Ppd-H1 allele on GY was observed recently, which was associated with shorter growing seasons under drought conditions (Wiegmann et al., 2019). Under these conditions, the functional Ppd-H1 allele was associated with increased GFP and increased TKW in barley plants. Ppd-H2 is another gene that has been long acknowledged as responsible for the acceleration of flowering in facultative barley types in response to the SD photoperiod and under mild winter conditions (Casao et al., 2011b). Ppd-H2 was identified previously in Rum but not in Steptoe (Al-Ajlouni et al., 2016), which might explain the failure of Steptoe to flower under SDs conditions. It was proposed that Ppd-H2 promotes the early flowering of winter cultivars irrespective of photoperiod conditions and the existence of a dominant allele can promote flowering in plants that have not satisfied their vernalization requirement under SD conditions (Casao et al., 2011b). Under LD conditions, Rum showed early response to vernalization treatments that accelerated heading when compared to non-vernalized Rum plants and this was accompanied with higher expression levels of Vrn-H1 (Figure 4). Inducible expression of different spring alleles of Vrn-H1 in response to cold treatment was reported previously (Hemming et al., 2009; Casao et al., 2011b). Furthermore, higher Vrn-H1 levels under LD conditions were observed in non-vernalized Rum when compared with non-vernalized Steptoe, which is consistent with Hemming et al. (2009), who found higher levels in a line carrying Vrn-H1-7 allele when compared with a line carrying Vrn-H1-4 . Differential expression of Vrn-H1 was also observed between different genotypes under LD conditions (Gol et al., 2021). In addition, different Vrn-H1 expression levels were previously reported in barley lines carrying the same spring Vrn-H1 allele (Casao et al., 2011b). After four weeks of LD, stressed Steptoe plants showed significantly lower expression levels of Vrn-H1 and Vrn-H3 genes when compared with well-watered Steptoe plants and this could explain the delayed meristem development and late heading in stressed plants. This is in general agreement with Gol et al. (2021), who observed reduced Vrn-H1 and Vrn-H3 expression levels under drought conditions in selected genotypes when compared with control treatments. Under SD conditions, stressed and vernalized Rum plants showed significantly higher levels of Vrn-H1 and Vrn-H3 that resulted in advanced meristem development and early heading in stressed plants. The high Vrn-H1 expression levels in vernalized Rum plants under SD and drought stress conditions were associated with a clear advanced developmental stage when compared to Steptoe, which showed a clear slower reproductive meristem development (Figure 3B; Figure 4; Figure S3). This also indicates that even though both genotypes are vernalization independent, there are still responses to vernalization in combination with other growth conditions and drought stress, which might have implications for field-grown plants (Casao et al 2011a). In this study, both tested genotypes carried different Vrn-H1 alleles where Rum has the Vrn-H1-7 allele and Steptoe has the Vrn-H1-4 allele (Al-Ajlouni et al., 2016), and this might explain the differential gene expression of flowering time genes in response to different treatments (Hemming et al., 2009). Nevertheless, gene expression data of this study are representing the levels at specific time points, while clear differences between tested genotypes for growth stages and meristem development at each selected time point were observed, which might explain that the high expression levels in Rum plants are associated with advanced growth stages beside allelic differences in targeted genes (Casao et al., 2011b). In this study, Rum was found to be hyper-responsive to LD conditions compared to Steptoe indicating the existence of different genetic networks to perceive photoperiod signals in the Rum plant (Faure et al., 2007; Karsai et al., 2008). This is further supported by the Ppd-H1 expression data under LD conditions, where both genotypes behaved differently in response to vernalization treatment (Figure 4). In Rum genotype, the expression level of Ppd-H1 after two weeks of LD incubation was higher under vernalization when compared to non-vernalized conditions, while the opposite was observed after four weeks of LD incubation. Notably, this was associated with the flowering time under LD conditions where vernalized Rum plants flowered earlier than non-vernalized plants (Figure S4). This pattern was also similar to Vrn-H3 expression, which is consistent with Hemming et al. (2008), who observed a correlation between Ppd-H1 and Vrn-H3 expression and early heading in barley plant. No clear effect of drought on meristem development in Rum plants was observed under LD conditions. A similar trend was reported by (Haile, 2013) where the developmental stage of the apical meristem was similar in introgression lines carrying Ppd-H1 under control and stress conditions. In a recent study, Gol et al. (2021) found that the expression of Ppd-H1 was not affected by drought under LD conditions in selected barley genotypes, except for Golden Promise, which had significantly lower levels under drought conditions and this was associated with reduced Vrn-H3 expression levels. Furthermore, the expression of Ppd-H1 levels varied significantly between tested genotypes and the stress treatment, which is in general agreement with the results of this study. The same study concluded that Ppd-H1 integrates photoperiod and drought stress signals to fine-tune reproductive development in barley. In Steptoe, there was no major difference in Ppd-H1 expression under LD conditions after two weeks of incubation, but after four weeks, the expression levels under vernalized conditions were higher when compared to non-vernalized Steptoe plants but still, it was similar to vernalized Rum plants. Nevertheless, this induced expression in Steptoe was not associated with increased Vrn-H3 as observed in Rum plants. Under SD and stress conditions, the expression levels of Vrn-H1 and Vrn-H3 were higher in vernalized Rum plants (Figure 4). Barley genotypes carrying the dominant allele of Ppd-H2 showed higher expression levels of Vrn-H1 and Vrn-H3 and this might explain their higher levels in Rum plants under SD conditions. An interplay between Vrn-H1, Vrn-H2, Vrn-H3, Ppd-H1 and Ppd-H2 to fine-tune plant development under SD and LD conditions in response to vernalization was previously suggested (Casao et al., 2011b; Maurer et al., 2015; Wiegmann et al., 2019) and a potential interplay between flowering time genes and stress tolerance was recently reported (Gol et al., 2021) that align with the results of this study. Conclusion In this study, the field performance of four selected spring barley genotypes was assessed across different environments and treatments. Rum and Acsad176 were well-adapted and stable across different environments and management practices when compared to Morex and Steptoe. The delayed heading in Steptoe was correlated negatively with GY under drought conditions, while it was associated with better performance in Rum. Analyzing the responses of both genotypes under controlled conditions identified a link between shoot apical meristem development under SD and drought stress conditions in vernalized Rum plants that was associated with higher gene expression of the Vrn-H1 and Vrn-H3 gene. Furthermore, accelerated flowering in Rum plants was observed in response to vernalization under LD conditions and this was also reflected in the early expression of Ppd-H1, Vrn-H1 and Vrn-H3 under these conditions. Under rainfed conditions, the early sowing of Rum subjects the plants to SD and vernalization and under such conditions early flowering was observed in Rum that had a 30% reduction in GY compared to a 60% reduction in Steptoe. This highlights the importance of selecting genotypes that can fine-tune flowering time in response to vernalization and photoperiod to secure stable yield production in dry environments. Matching the developmental behavior of barley genotypes using different management procedures and dissecting the genetic information of flowering time in adapted cultivars will help in developing new genotypes with stable performance under dry conditions. Further studies are needed to dissect the genetic basis of floral meristem development and to identify QTL associated with flowering time, yield stability under drought conditions. Declarations Funding This research was funded partially by the Deanship of Scientific Research, The University of Jordan (Amman, Jordan) and the Arab Fund for Economic and Social Development (AFESD; Kuwait) project through ICARDA. Conflict of Interest Statement The authors have declared that no conflict of interest exists. Acknowledgments We sincerely acknowledge Mr. Talal Ebdah (The University of Jordan) and Mr. Mahmmoud Al-Qudah (Rabba Center for Agriculture Research, NARC) for their assistant in the field work. We sincerely acknowledge Dr. Aladdin Hamwieh for his assistant in the statistical analysis. We sincerely acknowledge the financial support of the Arab Fund for Economic and Social Development (AFESD; Kuwait) project to JAE and ZA and the Deanship of Scientific Research, The University of Jordan for the financial support to AMA. Author Contributions AMA, JAE and JYA conceived, designed the experiments, analyzed the data and wrote the manuscript. JAE, RAS, ZAA and AAB supervised the field work, collected the phenotypic data and helped in data analysis. RB helped in site analysis, weather data and related measurements and their analysis. ZA helped in controlled experiments, meristem dissecting and their data analysis. RAS and JYA helped in controlled experiments, physiological measurements and their data analysis. SH and TH helped in molecular work, gene expression and data analysis. All authors edited and provided a critical review of the manuscript. All authors read and approved the final manuscript. Availability of data and materials The data sets supporting the results of this article will be freely available upon request to corresponding author: [email protected] and for non-commercial use only. References Al Abdallat, A. M., Ayad, J. Y., Elenein, J. A., Al Ajlouni, Z., and Harwood, W. A. (2014). Overexpression of the transcription factor HvSNAC1 improves drought tolerance in barley ( Hordeum vulgare L.). Mol. Breeding . 33,401-414. https://doi.org/10.1007/s11032-013-9958-1 Al-Abdallat, A. M., Karadsheh, A., Hadadd, N.I., Akash, M.W., Ceccarelli, S., Baum, M., Hasan, M., Jighly, A., and Elenein, J.A. (2017). Assessment of genetic diversity and yield performance in Jordanian barley ( Hordeum vulgare L.) landraces grown under Rainfed conditions. BMC Plant Biol. 17,1-3. https://doi.org/10.1186/s12870-017-1140-1 Al-Ajlouni, Z. I., Al-Abdallat, A. M., Al-Ghzawi, A. L., Ayad, J. Y., Abu Elenein, J. M., Al-Quraan, N. A., Baenziger, P. S. (2016). Impact of pre-anthesis water deficit on yield and yield components in barley ( Hordeum vulgare L.) plants grown under controlled conditions. Agronomy . 6,33. https://doi:10.3390/agronomy6020033 Al-Sayaydeh, R., Al-Bawalize, A., Al-Ajlouni, Z., Akash, M.W., Abu-Elenein, J., and Al-Abdallat, A.M. (2019). Agronomic evaluation and yield performance of selected barley ( Hordeum vulgare L.) landraces from Jordan. Int. J. Agron. 2019,1-12. https://doi.org/10.1155/2019/9575081 Anderson, R., Bayer, P.E., and Edwards, D. (2020). Climate change and the need for agricultural adaptation. Curr. Opin. Plant Biol. 56,197-202. https ://doi.org/10.1016/j.pbi.2019.12.006 Araus, J. L., Slafer, G. A., Royo, C., and Serret, M. D. (2008). Breeding for yield potential and stress adaptation in cereals. Crit. Rev. Plant Sci. 27,377-412. https://doi.org/10.1080/07352680802467736 Barrs, H. D., and Weatherley, P. E. (1962). A re-examination of the relative turgidity technique for estimating water deficits in leaves. Aust. J. Biol. Sci. 15,413-428. https://doi.org/10.1071/BI9620413 . Baum, M., Von Korff, M., Guo, P., Lakew, B., Hamwieh, A., Lababidi, S., Udupa, S. M., Sayed, H., Choumane, W., Grando, S., Ceccarelli, S. (2007). “Molecular approaches and breeding strategies for drought tolerance in barley,” In Genomics-assisted crop improvement , eds. R. K. Varshney, and R. Tuberosa, (Springer, Dordrecht), 51-79. https://doi.org/10.1007/978-1-4020-6297-1_3 Campoli, C., Shtaya, M., Davis, S. J., and von Korff, M. (2012). Expression conservation within the circadian clock of a monocot: natural variation at barley Ppd-H1 affects circadian expression of flowering time genes, but not clock orthologs. BMC Plant Biol. 12,97. https://doi.org/10.1186/1471-2229-12-97 Campoli, C., and von Korff, M. (2014). Genetic control of reproductive development in temperate cereals. Adv. Bot. Res. 72,131-158. https://doi.org/10.1016/B978-0-12-417162-6.00005-5 Casao, M. C., Igartua, E., Karsai, I., Bhat, P. R., Cuadrado, N., Gracia, M. P., Lasa, J. M. and Casas, A. M. (2011a). Introgression of an intermediate VRNH1 allele in barley ( Hordeum vulgare L.) leads to reduced vernalization requirement without affecting freezing tolerance. Mol. Breed. 28,475-484. https://doi.org/10.1007/s11032-010-9497-y Casao, M. C., Karsai, I., Igartua, E., Gracia, M. P., Veisz, O., and Casas, A. M. (2011b). Adaptation of barley to mild winters: a role for PPDH2 . BMC Plant Biol. 11,1-13. https://doi.org/10.1186/1471-2229-11-164 Chen, A., and Dubcovsky, J. (2012). Wheat TILLING mutants show that the vernalization gene VRN1 down-regulates the flowering repressor VRN2 in leaves but is not essential for flowering. PLoS Genet. 8,e1003134. https://doi.org/10.1371/journal.pgen.1003134 Cockram, J., Chiapparino, E., Taylor, S. A., Stamati, K., Donini, P., Laurie, D. A., and O’Sullivan, D. M. (2007a). Haplotype analysis of vernalization loci in European barley germplasm reveals novel VRN-H1 alleles and a predominant winter VRN-H1/VRN-H2 multi-locus haplotype. Theor. Appl. Genet. 115,993-1001. https://doi.org/10.1007/s00122-007-0626-x Cockram, J., Jones, H., Leigh, F. J., O'Sullivan, D., Powell, W., Laurie, D. A., and Greenland, A. J. (2007b). Control of flowering time in temperate cereals: genes, domestication, and sustainable productivity. J. Exp. Bot. 58,1231-1244. https://doi.org/10.1093/jxb/erm042 Digel, B., Pankin, A., and von Korff, M. (2015). Global transcriptome profiling of developing leaf and shoot apices reveals distinct genetic and environmental control of floral transition and inflorescence development in barley. The Plant Cell. 27,2318-2334. https://doi.org/10.1105/tpc.15.00203 Distelfeld, A., Li, C., and Dubcovsky, J. (2009). Regulation of flowering in temperate cereals. Curr. Opin. Plant Biol. 12,178-184. https://doi.org/10.1016/j.pbi.2008.12.010 Faure, S., Higgins, J., Turner, A., and Laurie, D. A. (2007). The FLOWERING LOCUS T- like gene family in barley ( Hordeum vulgare ). Genetics . 176,599-609. https://doi.org/10.1534/genetics.106.069500 Ferdous, J., Li, Y., Reid, N., Langridge, P., Shi, B. J., & Tricker, P. J. (2015). Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One. 10,e0118503. https://doi.org/10.1371/journal.pone.0118503 Fu, D., Szűcs, P., Yan, L., Helguera, M., Skinner, J. S., Von Zitzewitz, J., Hayes, P. M. and Dubcovsky, J. (2005). Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol. Genet. Genom. 273,54-65. https://doi.org/10.1007/s00438-004-1095-4 Galiba, G., Vágújfalvi, A., Li, C., Soltész, A., and Dubcovsky, J. (2009) Regulatory genes involved in the determination of frost tolerance in temperate cereals. Plant Sci. 176,12-19. https://doi.org/10.1016/j.plantsci.2008.09.016 Gol, L., Haraldsson, E. B., and von Korff, M. (2021). Ppd-H1 integrates drought stress signals to control spike development and flowering time in barley. J. Exp. Bot. 72,122-136. https://doi.org/10.1093/jxb/eraa261 Gol, L., Tomé, F., and von Korff, M. (2017). Floral transitions in wheat and barley: interactions between photoperiod, abiotic stresses, and nutrient status. J. Exp. Bot. 68,1399-1410. https://doi.org/10.1093/jxb/erx055 Habte, E., Müller, L. M., Shtaya, M., Davis, S. J., and von Korff, M. (2014). Osmotic stress at the barley root affects expression of circadian clock genes in the shoot. Plant Cell Environ. 37,1321-1337. https://doi.org/10.1111/pce.12242 Haile, E. H., (2013). The effect of natural variation at Ppd - H1 and HvELF3 on responses to osmotic stress in barley ( Hordeum vulgare ). Doctoral dissertation, Cologne, University of Cologne. Hemming, M. N., Fieg, S., Peacock, W. J., Dennis, E. S., and Trevaskis, B. (2009). Regions associated with repression of the barley ( Hordeum vulgare ) VERNALIZATION1 gene are not required for cold induction. Mol. Genet. Genom. 282,107-117. https://doi.org/10.1007/s00438-009-0449-3 Hemming, M. N., Peacock, W. J., Dennis, E. S., and Trevaskis, B. (2008). Low-temperature and daylength cues are integrated to regulate FLOWERING LOCUS T in barley. Plant Physiol. 147,355-366. https://doi.org/10.1104/pp.108.116418 Hemming, M. N., Walford, S. A., Fieg, S., Dennis, E. S., and Trevaskis, B. (2012). Identification of high-temperature-responsive genes in cereals. Plant Physiol. 158,1439-1450. https://doi.org/10.1104/pp.111.192013 Horsley, R. D., Franckowiak, J. D., Schwarz, P. B. (2009). “Barley” In Cereals , ed. M. J. Carena (Springer, New York, NY), 227-250. https://doi.org/10.1007/978-0-387-72297-9_7 Jedmowski, C., Ashoub, A., Momtaz, O., and Brüggemann W. (2015). Impact of drought, heat, and their combination on chlorophyll fluorescence and yield of wild barley ( Hordeum spontaneum ). J. Bot. Article ID 120868:1-9. http://dx.doi.org/10.1155/2015/120868 Jung, C., Pillen, K., Staiger, D., Coupland, G., and von Korff, M. (2017). Recent advances in flowering time control. Front. Plant Sci. 7,2011. https://doi.org/10.3389/fpls.2016.02011 Karsai, I., Szűcs, P., Kőszegi, B., Hayes, P. M., Casas, A., Bedő, Z., and Veisz, O. (2008). Effects of photo and thermo cycles on flowering time in barley: a genetical phenomics approach. J. Exp. Bot . 59,2707-2715. https://doi.org/10.1093/jxb/ern131 Lu, H. D., Xue, J. Q., and Guo, D. W. (2017). Efficacy of planting date adjustment as a cultivation strategy to cope with drought stress and increase rainfed maize yield and water-use efficiency. Agric. Water Manag. 179,227-235. https://doi.org/10.1016/j.agwat.2016.09.001 Maurer, A., Draba, V., Jiang, Y., Schnaithmann, F., Sharma, R., Schumann, E., Kilian, B., Reif, J.C. and Pillen, K. (2015). Modelling the genetic architecture of flowering time control in barley through nested association mapping. BMC Genomics. 16,1-12. https://doi.org/10.1186/s12864-015-1459-7 Mulki, M. A., and von Korff, M. (2016). CONSTANS controls floral repression by up-regulating VERNALIZATION2 (VRN-H2) in barley. Plant Physiol. 170,325-337. https://doi.org/10.1104/pp.15.01350 Newman, R. K., Newman, C. W. (2008). Barley for food and health: Science, technology, and products . Hoboken; John Wiley & Sons. p.56-94. Olivoto, T., and Lúcio, A. D. (2020). Metan: An R package for multi‐environment trial analysis. Methods Ecol. Evol. 11,783-789. https://doi.org/10.1111/2041-210X.13384 Rollins, J. A., Drosse, B., Mulki, M. A., Grando, S., Baum, M., Singh, M., Ceccarelli, S. and von Korff, M. (2013). Variation at the vernalisation genes Vrn-H1 and Vrn-H2 determines growth and yield stability in barley ( Hordeum vulgare ) grown under dryland conditions in Syria. Theor. Appl. Genet. 126,2803-2824. Saisho, D., Ishii, M., Hori, K., and Sato, K. (2011). Natural variation of barley vernalization requirements: implication of quantitative variation of winter growth habit as an adaptive trait in East Asia. Plant Cell Physiol. 52,775-784. https://doi.org/10.1093/pcp/pcr046 Samarah, N. H., Alqudah, A. M., Amayreh, J. A., and McAndrews, G. M. (2009). The effect of late‐terminal drought stress on yield components of four barley cultivars. J. Agron. Crop. Sci. 195,427-441. https://doi.org/10.1111/j.1439-037X.2009.00387.x Sasani, S., Hemming, M. N., Oliver, S. N., Greenup, A., Tavakkol-Afshari, R., Mahfoozi, S., Poustini, K., Sharifi, H. R., Dennis, E.S., Peacock, W. J. and Trevaskis, B. (2009). The influence of vernalization and daylength on expression of flowering-time genes in the shoot apex and leaves of barley ( Hordeum vulgare ). J. Exp. Bot. 60,2169-2178. https://doi.org/10.1093/jxb/erp098 Shen, Q., Chen, C. N., Brands, A., Pan, S. M., and Tuan-Hua, D. H. (2001). The stress-and abscisic acid-induced barley gene HVA22 : developmental regulation and homologues in diverse organisms. Plant Mol. Biol. 45,327-340. https://doi.org/10.1023/A:1006460231978 Tavakol, E., Elbadry, N., Tondelli, A., Cattivelli, L., and Rossini, L. (2016). Genetic dissection of heading date and yield under Mediterranean dry climate in barley ( Hordeum vulgare L.). Euphytica . 212,343-353. https://doi.org/10.1007/s10681-016-1785-0 Trevaskis, B., Hemming, M. N., Peacock, W. J., and Dennis, E. S. (2006). HvVRN2 responds to daylength, whereas HvVRN1 is regulated by vernalization and developmental status. Plant Physiol. 140,1397-1405. https://doi.org/10.1104/pp.105.073486 Trevaskis, B., Tadege, M., Hemming, M. N., Peacock, W. J., Dennis, E. S., and Sheldon, C. (2007). Short vegetative phase-like MADS-box genes inhibit floral meristem identity in barley. Plant Physiol. 143,225-235. https://dx.doi.org/10.1104%2Fpp.106.090860 Turner, A., Beales, J., Faure, S., Dunford, R. P., and Laurie, D. A. (2005). The pseudo-response regulator Ppd-H1 provides adaptation to photoperiod in barley. Science . 310,1031-1034. DOI: 10.1126/science.1117619. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, and A., Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3,1-2. https://doi.org/10.1186/gb-2002-3-7-research0034 Visioni, A., Al-Abdallat, A. M., Elenien, J. A., Verma, R. P., Gyawali, S., Baum, M. (2019). “Genomics and molecular breeding for improving tolerance to abiotic stress in barley ( Hordeum vulgare L.),” In Genomics Assisted Breeding of Crops for Abiotic Stress Tolerance , eds V. R. Rajpal., D. Sehgal., A. Kumar, S. N. Raina (Springer, Cham), 2 ,49-68. https://doi.org/10.1007/978-3-319-99573-1_4 von Korff, M., Grando, S., Del Greco, A., This, D., Baum, M., and Ceccarelli, S. (2008). Quantitative trait loci associated with adaptation to Mediterranean dryland conditions in barley. Theor. Appl. Genet. 117,653-669. https://doi.org/10.1007/s00122-008-0787-2 Waddington, S. R., Cartwright, P. M., and Wall, P. C. (1983). A quantitative scale of spike initial and pistil development in barley and wheat. Ann. Bot. 51,119-130. https://doi.org/10.1093/oxfordjournals.aob.a086434 Wiegmann, M., Maurer, A., Pham, A., March, T. J., Al-Abdallat, A., Thomas, WT., Bull, H. J., Shahid, M., Eglinton, J., Baum, M., Flavell, A. J., Tester, M., and Pillen, K. (2019). Barley yield formation under abiotic stress depends on the interplay between flowering time genes and environmental cues. Sci. Rep. 9,1-6. https://doi.org/10.1038/s41598-019-42673-1 Yan, L., Fu, D., Li, C., Blechl, A., Tranquilli, G., Bonafede, M. A. Sanchez, A.L., Valarik, M., Yasuda, S.H., Dubcovsky, J. (2006). The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc. Natl. Acad. Sci. 103,19581-19586. https://doi.org/10.1073/pnas.0607142103 Yan, W. (2001). GGEbiplot—A Windows application for graphical analysis of multienvironment trial data and other types of two‐way data. Agron. J. 93,1111-1118. https://doi.org/10.2134/agronj2001.9351111x Zadoks, J. C., Chang, T. T., and Konzak, C. F. (1974). A decimal code for the growth stages of cereals. Weed Res. 14,415-421. https://doi.org/10.1111/j.1365-3180.1974.tb01084.x Additional Declarations No competing interests reported. Supplementary Files SupplementaryTableS1.xlsx SupplementaryTableS2.xlsx SupplementaryTableS3.xlsx FigureS1.png FigureS2.png FigureS3.png FigureS4.jpg FigureS5.pptx Cite Share Download PDF Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-289948","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":16807123,"identity":"e04f377d-be10-4c74-968a-7fe73cc749e7","order_by":0,"name":"Jamal Abu-Elenein","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jamal","middleName":"","lastName":"Abu-Elenein","suffix":""},{"id":16807124,"identity":"c33808b1-51c8-4f11-90cc-03795956186e","order_by":1,"name":"Rabea Al-Sayaydeh","email":"","orcid":"","institution":"Al-Balqa Applied University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rabea","middleName":"","lastName":"Al-Sayaydeh","suffix":""},{"id":16807125,"identity":"a4aa7276-50fd-418e-9205-62bcdccbadbe","order_by":2,"name":"Zahera Akkeh","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zahera","middleName":"","lastName":"Akkeh","suffix":""},{"id":16807126,"identity":"79bfff8b-2e40-4093-b609-e09a743f8beb","order_by":3,"name":"Zakaria Al-Ajlouni","email":"","orcid":"","institution":"Jordan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zakaria","middleName":"","lastName":"Al-Ajlouni","suffix":""},{"id":16807127,"identity":"7730a8d9-c801-4b84-ad68-073e7e4ee7d6","order_by":4,"name":"AbdRaheem A. Al-Bawalize","email":"","orcid":"","institution":"NARC","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"AbdRaheem","middleName":"A.","lastName":"Al-Bawalize","suffix":""},{"id":16807128,"identity":"e234bb38-d6d2-4d81-aa0d-e039d8e7da79","order_by":5,"name":"Shireen Hasan","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shireen","middleName":"","lastName":"Hasan","suffix":""},{"id":16807129,"identity":"2b7917da-949a-4904-bb08-52750b901d4c","order_by":6,"name":"Tareaq Alhindi","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tareaq","middleName":"","lastName":"Alhindi","suffix":""},{"id":16807130,"identity":"997926bf-8cd9-4370-ba15-9e3861271a84","order_by":7,"name":"Randa Albdaiwi","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Randa","middleName":"","lastName":"Albdaiwi","suffix":""},{"id":16807131,"identity":"151d0969-f9db-4421-a98d-247a55db79d7","order_by":8,"name":"Jamal Y. Ayad","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jamal","middleName":"Y.","lastName":"Ayad","suffix":""},{"id":16807132,"identity":"3dba889f-3869-407d-9049-e760acaaab75","order_by":9,"name":"Ayed M. Al-Abdallat","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYHACxgOMDcwMfOxA5gcekEACA4MEAT1gLWzMDIyNM0jW0gzWAdKCD/A3MD848HOHtTwbM/PzxzYyhxn42XMMGCwqcGuROMBmcLD3TLphGzObYXMOz2EGyZ43BgwSZ/C5isHgAG/bYcY2ZgaIFoMbQFsk23DrkD/A/uHg37bD9m3M7B+bLYBa7AlpMTjAY3AYaEtiGzOPYTMDyBYJAloMD/MUHJY9k54M1FI4s4cnnUfizLOCA/j8Ine8fePDtzusbfvZ2zd8+NljLcffnrzxsQSeEGNgRuYw9jCAo+YwoahEAj+gWj8Qr2UUjIJRMAqGPwAAuh1Nh4OLumAAAAAASUVORK5CYII=","orcid":"","institution":"The University of Jordan","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ayed","middleName":"M.","lastName":"Al-Abdallat","suffix":""}],"badges":[],"createdAt":"2021-03-02 10:44:07","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.3.rs-289948/v2","doiUrl":"https://doi.org/10.21203/rs.3.rs-289948/v2","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":12342311,"identity":"7da9de3d-cdf1-49da-80a2-6d0ce6713ee0","added_by":"auto","created_at":"2021-08-11 19:23:43","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1402278,"visible":true,"origin":"","legend":"Box-Whisker plots showing genotypic variations for GY (a) and HD (b) traits per sowing date and water regime treatments combinations. ","description":"","filename":"f1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/73ae51cd9d13a06d125645f5.jpg"},{"id":12342312,"identity":"04235066-9e4c-46cb-a195-377ba2cad4ee","added_by":"auto","created_at":"2021-08-11 19:23:43","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":863087,"visible":true,"origin":"","legend":"GGE biplot analysis of GY for four barley genotypes across 24 environmental groups (season: 2012 (12) and 2013 (13); location: JU, JUST and RB; sowing dates: December (D) and February (F); water regimes: Irrigated (Ir) and Rainfed (Rf)). (A) Which won and where pattern for the tested genotypes across 24 environments. (B) Stability analysis for the tested genotypes across 24 environments.","description":"","filename":"f2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/72f39b6350b77407716a6fb5.jpg"},{"id":12342310,"identity":"de89bfc3-5a0c-46f5-9c69-1a30fa0560d5","added_by":"auto","created_at":"2021-08-11 19:23:43","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1672296,"visible":true,"origin":"","legend":"Shoot apex development in two barley genotypes (Rum and Steptoe) in response to different combinations of vernalization, photoperiod and drought treatments after 2, 4, 6 and 8 weeks post emergence. (A) Shoot apex development under LD conditions. (B) Shoot apex development under SD conditions. At each time-point, four plants were dissected and the shoot apex developmental stage was scored according to the Waddington scale [62]. Values are mean ± SD of four replicates.","description":"","filename":"f3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/5740acf87b86f282c2377d02.jpg"},{"id":12342308,"identity":"10dc1c9a-8f24-4cdb-8237-3360e87de9d3","added_by":"auto","created_at":"2021-08-11 19:23:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3134697,"visible":true,"origin":"","legend":"Gene expression analysis of Ppd-H1, Vrn-H1, Vrn-H3 and HVA22 in two barley genotypes (Rum and Steptoe) subjected to different combinations of vernalization, photoperiod and drought treatments. For LD, samples were collected after two and four weeks post emergence. For SD, samples were collected after four and six weeks post emergence weeks. Values are mean ± SD of three technical replicates and each replicate was derived from two biological samples.","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/4c4c3f7a73ab5618ea06e7a0.png"},{"id":12342457,"identity":"464b64b0-8455-44c8-8127-89e234faa27f","added_by":"auto","created_at":"2021-08-11 19:26:43","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":19098,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/fc42afa8669ce4fee168a5ca.xlsx"},{"id":12342314,"identity":"5fef5b41-7d37-47d9-bfe8-72c9d545a22a","added_by":"auto","created_at":"2021-08-11 19:23:43","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":110945,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/cbdb897430033d0aa150e93d.xlsx"},{"id":12342458,"identity":"9a7fc0b3-ebe3-4ba8-9bd2-cbace56eb4a7","added_by":"auto","created_at":"2021-08-11 19:26:43","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":112267,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/25952b47702d6cccb69103e2.xlsx"},{"id":12342632,"identity":"f6eaa0d9-63fa-4dfa-91dc-cee39357bae5","added_by":"auto","created_at":"2021-08-11 19:32:43","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1586540,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.png","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/5c7f95c1927f4b60c2e1cd2f.png"},{"id":12342576,"identity":"310264a2-e0f3-49f1-ad75-b8942ed9a4b8","added_by":"auto","created_at":"2021-08-11 19:29:43","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":16910830,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.png","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/b1f646bcca4963f362cd965c.png"},{"id":12342317,"identity":"78bd710a-0188-47c0-a37f-91f39b3abad4","added_by":"auto","created_at":"2021-08-11 19:23:43","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":25961382,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.png","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/28ac7f11924b74000570a788.png"},{"id":12342462,"identity":"5589cb0f-8080-4ced-8fb5-f144aa9bfcf3","added_by":"auto","created_at":"2021-08-11 19:26:43","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":658611,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/5bf4b5fdc61e0e089c8fea74.jpg"},{"id":12342460,"identity":"6039612a-ec6a-40d7-a002-9e2ea91b085a","added_by":"auto","created_at":"2021-08-11 19:26:43","extension":"pptx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":1368588,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS5.pptx","url":"https://assets-eu.researchsquare.com/files/rs-289948/v2/00438a1c03fe76f4779b0ae1.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eAgronomic Performance and Flowering Behavior in Response to Photoperiod and Vernalization in Barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.) Genotypes with Contrasting Drought Tolerance Behavior\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBarley is considered one of the most important cereal crops in the world in terms of harvested area, trade value and human nutrition (Newman and Newman, 2008). It is commonly used for human consumption, animal feed and malting and it is considered the crop of choice in marginal and dry areas (Horsley et al., 2009). In eastern parts of the Mediterranean basin, barley is generally grown in arid and semi-arid areas that are characterized by low amounts of precipitation and prolonged drought conditions (Visioni et al., 2019). As a rainfed crop, barley is frequently suffering from drought conditions that occur when the soil water content is not available in sufficient amounts to support normal growth and development (Jedmowski et al., 2015). To maintain a sustainable increase in barley yield, the development of location-specific and high-yielding varieties with improved tolerance to abiotic stresses is needed (Visioni et al., 2019).\u003c/p\u003e\n\u003cp\u003eDrought stress has always played an important selective role in the evolution of plant growth, development and physiology (Araus et al., 2008). Plant adaptation to dry conditions is considered a key factor that will determine crop productivity in response to climate change and associated conditions (Anderson et al., 2020). In this perspective, shifting planting dates or switching to short growing-season varieties are considered a useful strategy to reduce the negative impact of climatic change and associated stresses such as drought and heat stress (Lu et al., 2017). The ability to regulate flowering time in cereal plants will enable them to complete their life cycle successfully under a wide range of environments (Distelfeld et al., 2009).\u0026nbsp;Therefore, flowering time is considered an important trait for crop improvement in dry environments (Jung et al., 2017).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFlowering is a crucial event in the life cycle of seed propagated plants and is usually affected by different environmental stimuli (Jung et al., 2017). Flowering time, also known as heading date in cereals, is a major trait that is linked to the adaptation to particular environments and it determines the crop performance under field conditions (Campoli and von Korff,\u0026nbsp;2014;\u0026nbsp;Gol et al., 2017). In temperate cereals, photoperiod sensitivity and vernalization requirements are major cues that determine flowering time (Distelfeld et al., 2009). Vernalization accelerates flowering by promoting inflorescence initiation, the first step in the transition of the shoot apex to the reproductive phase (Sasani et al., 2009). Vernalization is an adaptation process that prevents the exposure of sensitive floral meristems to freezing winter temperatures (Distelfeld et al., 2009). Winter barley requires vernalization and therefore, it is planted in the fall and requires long exposures to cold temperatures during winter to initiate flowering (Saisho et al., 2011). On the other hand, spring barley is planted in spring and does not require vernalization to flower, while in facultative type, vernalization accelerate flowering time, but still, plant can flower without it (Campoli and von Korff,\u0026nbsp;2014). On the other hand, photoperiod is a major factor determining cereal plant flowering and crop performance in response to day length (Jung et al., 2017). In barley, floret primordia are initiated under long and short days, whereas successful inflorescence development occurred only under long days (LD) in photoperiod responsive genotypes when the day becomes longer than a critical day length (Trevaskis et al., 2007; Digel et al., 2015).\u003c/p\u003e\n\u003cp\u003eThe manipulation of flowering time in barley may strongly affect its adaptation to marginal areas and dry conditions (Maurer et al., 2015;\u0026nbsp;Wiegmann et al., 2019). Early genetic analysis indicates the presence of a correlation between growth habit and stress tolerance where spring barley genotypes were less freezing tolerant when compared to winter types (Galiba et al., 2009). Allelic differences and their combinations in vernalization- (\u003cem\u003eVRN\u003c/em\u003e) and photoperiod-related (\u003cem\u003ePPD\u003c/em\u003e) genes seem to have large effects on stress tolerance in temperate cereals (Von Korff et al., 2008; Casao et al., 2011a). For instance, the \u003cem\u003ePHOTOPERIOD-H1\u003c/em\u003e (\u003cem\u003ePpd-H1\u003c/em\u003e) gene was found to control stress-induced senescence in barley roots subjected to osmotic stress (Habte et al., 2014).\u0026nbsp;\u0026nbsp;and most recently it was found to control the plasticity of development in response to drought (Gol et al., 2021).\u0026nbsp;In another study, barley genotypes carrying spring alleles of the \u003cem\u003eVERNALIZATION-H1\u003c/em\u003e (\u003cem\u003eVrn-H1\u003c/em\u003e) gene showed an accelerated flowering under drought stress when compared to genotypes carrying winter alleles (Al-Ajlouni et al., 2016).\u0026nbsp;Therefore, the interaction between environmental cues, such as day-length and low-temperatures, and the allelic variations in major flowering time genes might affect the flowering time and adaptation of barley to dry conditions (Campoli and von Korff,\u0026nbsp;2014).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, we analyzed the flowering time, reproductive meristem development, growth and physiological responses to stress conditions in selected barley genotypes with contrasting drought tolerance behavior. For this purpose, the flowering time and agronomic performance of drought-tolerant and drought-sensitive barley genotypes were studied at different contrasting environments and management practices for two growing seasons. Thereafter, the impact of drought stress on two selected barley genotypes, with contrasting drought tolerance behavior, was assessed under controlled conditions with different vernalization and photoperiod treatments. The expression patterns of major flowering time\u0026nbsp;genes (\u003cem\u003ePpd-H1, Vrn-H1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eVrn-H3\u003c/em\u003e) in response to drought, vernalization and photoperiod treatments were investigated in both selected genotypes at specific time points. The presented results showed that drought effects varied in response to vernalization and photoperiod treatments in tested genotypes, highlighting the importance of phenological adjustment in barley for better adaption to dry environments.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003ePlant Material\u003c/p\u003e\n\u003cp\u003eFour barley genotypes with contrasting drought tolerance behavior were used in this study (Al-Ajlouni et al., 2016): Rum cultivar (Harbinger-Arivat \u0026times; Attiki; released in Jordan in 1986) was developed by CIMMYT/ICARDA and it is known for its stable productivity under semi-arid conditions and is considered a drought-tolerant genotype; Acsad176 (CM872-189-3Y-1B-2Y-1BX1Y-OB) \u0026times; (Cr.366/16/2)) developed by ACSAD center and commonly grown in semi-arid regions in Jordan where supplementary irrigation is recommended; Steptoe (Washington Selection 3564/Unitan) is derived from coast-type barley originating in North Africa and is considered a drought-sensitive genotype (Al-Ajlouni et al., 2016); Morex is a spring smooth-awned spring barley cultivar derived from Manchurian barley (Cree/Bonanza). All selected genotypes are spring types but carrying different spring \u003cem\u003eVrn-H1\u003c/em\u003e alleles (\u003cem\u003eVrn-H1-7\u0026nbsp;\u003c/em\u003ein Rum and Acsad176, \u003cem\u003eVrn-H1-4\u0026nbsp;\u003c/em\u003ein Steptoe and \u003cem\u003eVrn-H1-1\u0026nbsp;\u003c/em\u003ein Morex (Cockram et al., 2007a;\u0026nbsp;Al-Ajlouni et al., 2016) and all carry a functional \u003cem\u003ePpd-H1\u0026nbsp;\u003c/em\u003eallele conferring photoperiodic responses to LD conditions except for Morex, which carries a nonfunctional \u003cem\u003eppd-H1\u0026nbsp;\u003c/em\u003eallele (Al-Ajlouni et al., 2016).\u0026nbsp;All four genotypes were used for field trials, while Rum and Steptoe were selected for the controlled conditions experiment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eField Trials\u003c/p\u003e\n\u003cp\u003eThe field trials were carried out in three agricultural stations across Jordan for two growing seasons (2011-2012 and 2012-2013). The first station was Jubeiha (JU) Agricultural Research Station located in the University of Jordan campus (Jubeiha/Amman; 32\u0026deg;00\u0026prime;40\u0026Prime; N, 35\u0026deg;52\u0026prime;24\u0026Prime; E; elevation: 990 m; average annual precipitation: 505 mm; soil type: clay loam) representing a semi-humid area. The second station was at the Jordan University of Science and Technology (JUST) campus research station (Ramtha; 32\u0026deg;28\u0026prime;47.4\u0026Prime; N, 35\u0026deg;59\u0026prime;11.1\u0026Prime; E; elevation: 520 m; average annual precipitation: 217 mm; soil type: clay loam) representing a dry area. The third station was at Rabbah (RB) Center for Agriculture Research-NARC (Rabbah/Al Karak; 31\u0026deg;16\u0026prime;37.1\u0026Prime; N, 35\u0026deg;44\u0026prime;26.9\u0026Prime; E; elevation: 920 m; average annual precipitation: 337 mm; soil type: clay) representing a semi-dry area. In each trial, the four tested genotypes were sown at two different dates: the 1\u003csup\u003est\u003c/sup\u003e of December and the 1\u003csup\u003est\u003c/sup\u003e of February. Furthermore, the genotypes were cultivated in each field trial under either rainfed or supplementary irrigation conditions. The weather data and the\u0026nbsp;amount of supplementary irrigation applied\u0026nbsp;are provided in Supplementary Table S1.\u003c/p\u003e\n\u003cp\u003eA split-split plot design with four replications was used where each replicate contained two plots for irrigation and rainfed treatments and each plot contains two subplots for planting date treatments. Each subplot area contained the four tested genotypes randomly distributed with each genotype sown in two adjacent rows (1.5 m length and 0.3 m apart with a total plot area of 1 m\u003csup\u003e2\u003c/sup\u003e). The seeding rates were adjusted according to the results of a seed germination test (based on 90% germination) to obtain a plant density from the viable seeds of 75 plants/row (approximately 150 plants/m\u003csup\u003e2\u003c/sup\u003e). In irrigated plots, average soil moisture in the first 60 cm depth was maintained at 80% of field capacity, which was estimated each week using soil HH2 moisture meter (Profile Probe type PR2, DELTA-T Devices, Cambridge, England). All field experiments followed \u0026ldquo;a fallow in the crop rotation\u0026rdquo; and were established using hand broadcasting following conventional tillage operations performed with a chisel plow and disk harrow. In each location, experimental plots were managed following the standard agricultural practices including fertilizer application to match the crop needs, weed control (hand weeding and herbicides against broad-leaf weeds) and pesticide use against main pathogens. Weather stations at the field sites were used to record precipitation and temperatures during the growing seasons. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eField Trials Data Analysis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDuring plant growth and before harvest, the following data were collected: days to heading (HD: in days; Zadoks scale: GS59) was determined visually by calculating the number of days from emergence to the day when 50% of plants had spikes; days to physiological maturity (MD: in days; Zadoks scale: GS87) was determined visually by calculating the number of days from emergence to the day when 90% of the plants have reached the physiological maturity stage (no green tissue remained in 90% of the plants in the plot); Grain filling period (GFP: in days) was estimated by subtracting MD from HD; plant height (PH: cm) that was measured for each genotype at maturity from the ground to the spike tip (excluding awns) on three selected plants that were randomly distributed in each row; peduncle length (PL: cm) that was measured as the distance from the flag leaf collar to the base of the spike on the main stem of plants used to measure plant height and whenever the value is negative, this indicates that the spike remained inside the sheath of the flag leaf. At the end of the experiment, plants were harvested from each sub-plot and the following measurements were recorded: total plant weight (TW: g/m\u003csup\u003e2\u003c/sup\u003e) that was measured as the whole dry weight of the harvested plants; spikes number (SN) as the number of spikes counted per m\u003csup\u003e2\u003c/sup\u003e; spikes weight (SPW: g/m\u003csup\u003e2\u003c/sup\u003e) that was measured by weighing the spikes obtained from harvested plants; Straw weight (STW: g/m\u003csup\u003e2\u003c/sup\u003e) that was obtained by subtracting spikes weight from the total plant weight; for grain yield (GY: g/m\u003csup\u003e2\u003c/sup\u003e), spikes were separated and threshed and the grains were cleaned from the chaff and weighed; grains per spike (G.S) was calculated by dividing grains number on the total spikes number; grains number (GN: grains/m\u003csup\u003e2\u003c/sup\u003e) was obtained by counting the harvested seeds using a seed counter; thousand kernel weight (TKW: g) was calculated by dividing the GN by GY multiplied by 1000; harvest index (HI: %) was calculated by dividing GY over TW multiplied by 100.\u003c/p\u003e\n\u003cp\u003eFor statistical analysis, the multi-environment field trials data were analyzed as a split-split plot design using the GenStat statistical software (Release 16.1, 2013; VSN International L) and a combined analysis of variance (ANOVA) was obtained for each trait. For this purpose, each location-growing season combination was considered a single environment resulting in six environments: JU2012, JU2013, JUST2012, JUST2013, RB2012 and RB2013. The ANOVA was conducted to analyze the variations due to environments, sowing dates, water regimes, genotypes and all of their interactions. The coefficients of variation (CV%) for each trait were determined and when significant differences were detected, a comparison of means was conducted using the least significant difference test (LSD, \u003cem\u003eP\u0026lt;0.05\u003c/em\u003e) to determine the performances of tested genotypes under all treatment combinations. Pearson correlation coefficients were calculated in the R software 4.0.2 using the metan package (Olivoto and L\u0026uacute;cio, 2020) using the means for all or selected combinations of environments, genotypes, water regimes and sowing dates. To analyze the specific adaptation, superiority, and stability of the genotypes across tested environments for the GY trait, the GGE function (Yan, 2001) of the metan package (Olivoto and L\u0026uacute;cio, 2020) was used. For this purpose, each environment-sowing date-water regime combination were considered as one distinctive environmental group.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eControlled Conditions Experiment\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo test the effect of drought, vernalization and photoperiod on flowering time and physiological responses in Rum (drought tolerant) and Steptoe (drought sensitive), a pot experiment was conducted under controlled growth conditions.\u0026nbsp;For the vernalization treatment, seeds of both genotypes were imbibed with distilled water and planted (2 seeds per pot) in foil-covered pots (30 cm height and 20 cm diameter) containing a mixture of sand and perlite (2:1) and were subjected to 45 days of vernalization at 4 ℃ under complete darkness as described previously (Hemming et al., 2008). After vernalization, the seedlings were transferred to growth chamber conditions, either under LD (16 h light/8 h dark) or short-day (SD: 8 h light/16 h dark) conditions depending on the photoperiod treatment, along with non-vernalized seven-days old seedlings (germinated under complete darkness at room temperature). After one week, leaf number was counted in vernalized and non-vernalized seedling and those plants with leaf numbers similar to that of seven\u0026thinsp;days-old seedlings were selected for further analysis (Hemming et al., 2008). Both vernalized and non-vernalized selected seedlings were grown under either SD or LD conditions at 22\u0026plusmn;1 \u0026deg;C with a light intensity level of 255.5 \u0026mu;mol m\u003csup\u003e\u0026minus;2\u003c/sup\u003e s\u003csup\u003e\u0026minus;1\u003c/sup\u003e (at pot level) and the plants were allowed to grow up to 120 days.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor drought treatment, the seeds of both vernalized and non-vernalized plants were exposed to well-watered and drought conditions under two different photoperiods (LD and SD) as described above. The treated seedlings of both tested genotypes were subjected to continuous drought conditions by withholding irrigation at the start of the experiment, while non-stressed seedlings were kept hydrated and were used as control. Water levels were maintained at 75% of pot capacity for non-stressed plants and at 15% of pot capacity for stressed plants (Al-Ajlouni et al., 2016). The soil moisture levels for pots were maintained at the targeted pot capacity by irrigating the calculated amounts of water after measuring pot water content using a Delta-T soil moisture probe device (Theta Probe type ML2X, Delta-T Devices, Cambridge, England).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePhysiological and Growth Measurements\u003c/p\u003e\n\u003cp\u003eLeaf relative water content (RWC) was measured biweekly for the first eight weeks of the experiment as described previously (Al Abdallat et al., 2014) and the RWC was calculated according to (Barrs and Weatherley, 1962). Stomatal resistance was measured on the most upper fully expanded leaf biweekly for the first eight weeks of the experiment by using a Porometer device (AP4, Delta-T Devices, Cambridge, UK). For leaf chlorophyll fluorescence yield, measurements were recorded directly by using a Pulse-Modulated Fluorometer (OS1-FL modulated chlorophyll fluorometer, ADC Bio Scientific Ltd., Hertford, UK) as described previously (Al Abdallat et al., 2014). Fluorescence measurements were taken after 20 min of acclimation to darkness under leaf clips (FL-DC; Opti-Sciences). The maximum quantum efficiency (\u003cem\u003eFv/Fm\u003c/em\u003e) of photosystem II was calculated as \u003cem\u003eFv/Fm\u003c/em\u003e = (\u003cem\u003eFm\u003c/em\u003e-\u003cem\u003eF0\u003c/em\u003e)/\u003cem\u003eFm\u003c/em\u003e, where \u003cem\u003eFm\u003c/em\u003e and \u003cem\u003eF0\u003c/em\u003e are the maximal and minimal chlorophyll fluorescence measured in darkness-adapted leaves, respectively.\u003c/p\u003e\n\u003cp\u003eFor shoot apical meristem development, plants were sampled biweekly for the first eight weeks of the experiment. Shoot apices were dissected under a binocular dissecting microscope (LAS EZ, Leica Microsystems, Switzerland) and digitally photographed by using an integrated digital camera. Phenotypic meristem development was scored according to the Waddington scale (Waddington\u0026nbsp;et al., 1983) using four plants per experimental treatment. The HD was recorded based on the number of days between emergence and heading following the Zadoks scale (Zadoks et al., 1974). A comparison between means was conducted using standard error of means to determine the performances of the two genotypes under all treatment combinations.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGene Expression Analysis\u003c/p\u003e\n\u003cp\u003eFor quantitative real-time PCR (qRT-PCR) analysis of treated barley plants (controlled conditions experiment), total RNA was isolated from leaf samples collected after 10 hours from the onset of light conditions for LD and eight hours for SD conditions irrespective of vernalization or stress conditions. The leaf samples were collected after two and four weeks for LD treated plants and after four and six weeks for SD treated plants. Specific primers pairs for three major flowering genes in barley \u003cem\u003ePpd-H1\u003c/em\u003e: fwd: 5`- CAAATCAAAGAGCGGCGATG-3` and Rev: 5`- TCTGACTTGGGATGGTTCACA-3` (Hemming et al., 2012); \u003cem\u003eVrn-H1\u003c/em\u003e: fwd: 5`-TGAAGCTCAGAAATGGATTCG-3` and Rev: 5`-TATGAGCGCTACTCTTATGC-3` (Trevaskis et al., 2006); \u003cem\u003eVrn-H3\u003c/em\u003e: fwd: 5`- ATCTCCACTGGTTGGTGACAGA and Rev: 5` TTGTAGAGCTCGGCAAAGTCC-3` (Yan et al., 2006) were used. For the stress-inducible gene expression, specific primers pair for the \u003cem\u003eHVA22\u003c/em\u003e gene (Shen et al., 2001) were used (fwd: 5`-ATGGGCAAATCATGGGCGCT-3` and Rev: 5`-TGCACCTTGTGATCGGCGTC-3`). Two internal-reference controls for the relative gene expression analysis were used: \u003cem\u003eHvActin\u003c/em\u003e (encoding actin, a house-keeping gene (Al Abdallat et al., 2014)) and \u003cem\u003eHvu-SnoR14\u003c/em\u003e (Small nucleolar RNA (Ferdous et al., 2015). The amplification of the targeted genes was carried out using the GoTaq\u0026reg; qPCR Master Mix Kit following the manufacturers\u0026rsquo; instructions (Promega, Madison, WI, USA), and the real-time detection of the amplified products was performed in a Mini-Opticon Real-Time PCR System (BioRad, Hercules, CA, USA). All cDNA samples were analyzed in triplicate, and each replicate was derived from two biological samples. Thermal cycling conditions consisted of an initial denaturation step of 94 \u0026deg;C for 5 minutes followed by 40 cycles of 94 \u0026deg;C for 30 s, 55 \u0026deg;C for 30 s and 72 \u0026deg;C for 45 s, followed with a final extension at 72 \u0026deg;C for 5 min. The relative changes in gene expression between tested genotypes for all vernalization and drought treatment combinations at specific time points for photoperiod treatment were quantified as described in (Vandesompele et al., 2002).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eField Trials\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnalyzing weather data during the two growing seasons indicates that January and February were the coldest months (Supplementary Table S1). During this time, all field trials were exposed to temperatures less than 5 ℃ indicating that the tested genotypes were exposed to vernalization conditions. For rainfall amounts, RB station received ~10% (33.5 mm) less precipitation than the long-term rainfall average during the first growing season, while JU and JUST stations received 11.5% (58 mm) and 40% (86.5 mm) more, respectively (Supplementary Table S1). During the second growing season, all locations received more rainfall than the long-term average where RB received 3% (11 mm), JU 6% (28 mm) and JUST 10% (20.6 mm) above the long-term average. The rainy season in 2012 was terminated in April in all stations and was accompanied by high temperatures at the end of the season (Supplementary Table S1). In 2013, the rainy season was terminated earlier than expected in RB in March, while only 7.8 mm were received only in JUST that resulted in severe terminal drought conditions. The amounts of water provided by supplementary irrigation for irrigated plots are given in\u0026nbsp;Supplementary Table S1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe combined ANOVA for the studied traits showed highly significant differences (\u003cem\u003eP\u0026lt;0.001\u003c/em\u003e) between genotypes, locations, water regimes, sowing dates, and their interactions (Supplementary Table S2). The mean values for the studied traits across the six environments and their combinations with the sowing date and water regime are given in\u0026nbsp;Supplementary Table S3. For correlation analysis, positive high significant correlations (\u003cem\u003eP\u0026lt;0.001\u003c/em\u003e) were found between all traits where GY showed a strong correlation with yield component-related traits and with HD, MD and GFP (Figure S1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;For GY, the percentage of variance explained by main factors varied where genotypic effect attributed 12.95%, environment (location-year) attributed 12.54%, water regime attributed 42.75% and sowing date attributed 23.78% from the total variance. Mean values of GY differed significantly between genotypes and ranged from 585 g/m\u003csup\u003e2\u003c/sup\u003e in Rum to 367 g/m\u003csup\u003e2\u003c/sup\u003e in Steptoe. For the sowing date, GY mean values differed significantly with December produced the highest GY mean value (605 g/m\u003csup\u003e2\u003c/sup\u003e) compared to February (341 g/m\u003csup\u003e2\u003c/sup\u003e). The GY mean values of water regime treatment differed significantly with the irrigation treatment produced 650 g/m\u003csup\u003e2\u003c/sup\u003e compared to rainfed 296 g/m\u003csup\u003e2\u003c/sup\u003e. \u0026nbsp;In addition, the interaction between sowing date, water regime and genotype on GY was highly significant (\u003cem\u003eP\u0026lt;0.001\u003c/em\u003e;\u0026nbsp;Supplementary Table S2). Rum produced the highest mean value of GY (889 g/m\u003csup\u003e2\u003c/sup\u003e) under irrigated conditions and December sowing date, while Steptoe produced the lowest mean value of GY (73 g/m\u003csup\u003e2\u003c/sup\u003e) under rainfed conditions and February sowing date where Rum produced 188 g/m\u003csup\u003e2\u003c/sup\u003e (LSD\u003csub\u003e\u0026nbsp;(0.05)\u003c/sub\u003e = 13.9). The interaction effect between environments, water regime, sowing date and genotypes on the GY showed highly significant differences (\u003cem\u003eP\u0026lt;0.001\u003c/em\u003e) (Supplementary Table S1;\u0026nbsp;Supplementary Table S3; Figure 1A). For instance, Steptoe produced the lowest mean value (50 g/m\u003csup\u003e2\u003c/sup\u003e) for GY under rainfed conditions in JUST-2013 for the December sowing date, while Rum under the same conditions produced 388 g/m\u003csup\u003e2\u0026nbsp;\u003c/sup\u003e(LSD\u003csub\u003e\u0026nbsp;(0.05)\u003c/sub\u003e = 42.2) (Supplementary Table S3). In JUST-2013, no significant differences were found between GY mean values of all tested genotypes under rainfed treatment for the February sowing date, however, Steptoe produced significantly the lowest GY mean values in all remaining environments (Supplementary Table S3). Under irrigated conditions, mean values of GY differed significantly between genotypes where Rum and Acsad176 produced the highest mean values for GY across all environments irrespective of sowing date treatment except when compared to Steptoe sown in December in JU2012 (Supplementary Table S3). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor HD, the percentage of variance explained by main factors varied where genotypic effect attributed 9.03%, environment (location-year) attributed 5.05%, water regime attributed 0.47% and sowing date attributed 82.31% from the total variance. Heading date mean values of tested genotypes ranged from 90.2 days in Rum (significantly the earliest genotype to flower) to the significantly latest mean value (107.6 days) recorded in Steptoe. For the main effect of the sowing date, December produced significantly the highest HD mean value (116.7 days) when compared to February (75.7 days). For the water regime effect, the irrigation treatment produced significantly the highest HD mean value (97.8 days) when compared to rainfed (94.7 days). The interaction effect between sowing date and water regime on HD was significant (\u003cem\u003eP\u0026lt;0.05\u003c/em\u003e), and this indicates that the effect of water availability depended on the sowing date (Supplementary Table S2). The interaction effect between environments, water regime, sowing date and genotype on the HD showed a significant effect (\u003cem\u003eP\u0026lt;0.001\u003c/em\u003e) (Supplementary Table S2;\u0026nbsp;Supplementary Table S3; Figure 1B). Steptoe produced the highest mean values for HD in any given environment \u0026times; water regime combinations for December sowing date treatment\u003csup\u003e\u0026nbsp;\u003c/sup\u003e(Figure 1B;\u0026nbsp;Supplementary Table S3). For February sowing date treatment, clear significant differences were identified only in 2013 environments (JU-2013, RB-2013 and JUST-2013) between the HD mean values of Steptoe and other genotypes irrespective of water regime treatments (Supplementary Table S3).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo analyze genotype-specific adaptation to specific environments for the GY trait, the GGE biplot was used. For this purpose, environments were reclassified based on the combination of each location, year, sowing date and water regime treatments to produce 24 distinct environmental groups. The relationships between the GY of tested genotypes and the 24 environmental groups and the degree by which each group is represented are shown in Figure 2A. The two principal components (PC1 and PC2) together captured 98.32% of the interaction effects and the variations due to GGE. Three irrigated environments from the 2013 season fell in the sector in which Acsad176 cultivar was the vertex genotype, which means that Acsad176 was the best genotype in these environments (Figure 2A). On the other hand, Rum was the best cultivar in the rest of the environments (21 out of 24) and specifically in all rainfed environments irrespective of location, sowing date, or season. By contrast, Morex and Steptoe did not perform well in all testing environments and the two genotypes were considered the poorest across all tested environments (Figure 2A). Interestingly, both genotypes were placed on different sectors indicating different responses to tested environments. For stability as measured by projection to the Average-Tester Axis y-axis, Rum was the most stable followed by Acsad176, while Steptoe and Morex were considered the least stable genotypes (Figure 2B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on the results above and to analyze the relationship between HD and agronomic performance, a new correlation analysis was performed using the field data of Rum and Steptoe alone after reclassifying the environments into four different groups based on the combination of sowing dates and water regime treatments (December-irrigated, December-rainfed, February-irrigated and February-rainfed). As shown in Figure S2, negative significant correlations were found across the four environmental groups between HD with GY and SPW. For December-irrigated conditions, the negative significant correlations with HD included HI and TKW, while for December-rainfed conditions the negative significant correlations with HD included TW and STW. For the February sowing date and irrespective of water regime treatment, negative significant correlations were detected between HD with TW, SN, GN, GS, TKW and HI (Figure S2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eControlled Conditions Experiment\u003c/p\u003e\n\u003cp\u003eIn this study, the transition to the reproductive stage under LD was significantly more advanced in Rum genotype when compared to Steptoe irrespective of photoperiod, vernalization and water regime combinations (Figure 3; Figure S3). After four weeks under LD and well-watered conditions, a difference was observed between non-vernalized and vernalized Rum plants. On the other hand, Steptoe reproductive meristem was in an advanced developmental stage under LD and well-watered conditions when compared to stressed plants irrespective of vernalization treatment (Figure 3A; Figure S3). After eight weeks of LD incubation under well-watered conditions, non-vernalized Steptoe reproductive meristem was in an advanced developmental stage when compared to well-watered and vernalized Steptoe plants.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eUnder SD and irrespective of the vernalization and water regime treatments, the progression of reproductive meristem development in both genotypes was less advanced when compared to LD conditions (Figure 3; Figure S3). Significant differences were observed between the tested genotypes after eight weeks of incubation where stressed Rum plants subjected to vernalization showed a clear advanced developmental stage. Under the same conditions, stressed Steptoe plants showed a clear less advanced reproductive meristem when compared to other treated plants. After eight weeks of SD conditions and irrespective\u0026nbsp;of water regime treatment, non-vernalized Rum plants showed a clear advanced developmental stage when compared to Steptoe (Figure 3B; Figure S3).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt the end of the experiment, the mean values of HD of Rum plants grown under LD conditions were significantly lower than the mean values of Steptoe (Figure S4). On the other hand, vernalized Rum plants showed a significantly earlier HD under LD conditions when compared to non-vernalized Rum plants. Under LD conditions and irrespective\u0026nbsp;of vernalization treatment, a significant delay in heading was observed in stressed Steptoe plants when compared to well-watered plants (Figure S4). Under SD and vernalization conditions, stressed Rum plants were significantly the earliest to flower when compared to well-watered plants.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe effects of water stress on RWC, stomatal resistance, maximum quantum efficiency (\u003cem\u003eFv/Fm\u003c/em\u003e) of photosystem II was analyzed in treated plants as an index for drought tolerance in the two tested genotypes. Significant differences between well-watered and stressed in the two genotypes were observed for the tested physiological parameters under different photoperiod and vernalization conditions (Figure S5). For instance, the mean values of RWC of the tested genotypes were lower in stressed plants when compared with well-watered (Figure S5). Starting the 4\u003csup\u003eth\u003c/sup\u003e week, the mean value of RWC of non-vernalized Steptoe plants grown under LD and drought conditions was significantly the lowest. Clear effects of drought stress on stomatal resistance and maximum quantum efficiency (\u003cem\u003eFv/Fm\u003c/em\u003e) of photosystem II were also observed in both genotypes (Figure S5).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe expression patterns of\u003cem\u003e\u0026nbsp;Ppd-H1,\u003c/em\u003e \u003cem\u003eVrn-H1\u003c/em\u003e, \u003cem\u003eVrn-H3\u0026nbsp;\u003c/em\u003eand \u003cem\u003eHVA22\u003c/em\u003e genes were investigated in both tested genotypes in response to drought and vernalization treatments after two and four weeks for LD conditions and after four and six weeks for SD conditions. After two weeks of LD conditions and irrespective of water regime treatment, the \u003cem\u003ePpd-H1\u003c/em\u003e expression in vernalized Rum plants showed the highest levels when compared to other treated plants (Figure 4). After four weeks of LD incubation and irrespective of water regime treatment, the expression levels of \u003cem\u003ePpd-H1\u003c/em\u003e in vernalized Rum plants were lower compared to non-vernalized Steptoe and Rum plants (Figure 4). For SD conditions, no major changes in \u003cem\u003ePpd-H1\u003c/em\u003e expression levels were observed between the treated genotypes (Figure 4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter two weeks of LD conditions, the relative expression levels of \u003cem\u003eVrn-H1\u003c/em\u003e were higher in vernalized plants when compared to non-vernalized for both tested genotypes (Figure 4). Irrespective of vernalization treatment, Rum showed higher \u003cem\u003eVrn-H1\u003c/em\u003e expression after two weeks of LD incubation when compared to Steptoe. Irrespective of water regime treatment, \u003cem\u003eVrn-H1\u003c/em\u003e expression levels after two weeks of LD incubation were significantly lower in non-vernalized Steptoe plants compared to vernalized plants (Figure 4). After four weeks of LD incubation, the same trend of high expression of \u003cem\u003eVrn-H1\u003c/em\u003e was observed in vernalized plants when compared to non-vernalized plants (Figure 4). However, the expression levels of \u003cem\u003eVrn-H1\u003c/em\u003e in vernalized and stressed Steptoe plants were significantly lower when compared to stressed Rum plants and when compared to well-watered Steptoe (Figure 4). After six weeks of SD conditions, the expression of \u003cem\u003eVrn-H1\u003c/em\u003e was significantly higher in stressed and vernalized Rum plants when compared with other plants subjected to different treatment combinations. After eight weeks of SD conditions, Rum showed higher \u003cem\u003eVrn-H1\u003c/em\u003e expression levels when compared to Steptoe (Figure 4)\u003c/p\u003e\n\u003cp\u003eAfter two weeks of LD conditions, the expression levels of \u003cem\u003eVrn-H3\u003c/em\u003e were significantly higher in vernalized Rum plants when compared to other plants subjected to different treatment combinations (Figure 4). Under LD conditions, non-vernalized Rum plants showed significant differences of \u003cem\u003eVrn-H3\u003c/em\u003e expression levels when compared to non-vernalized Steptoe. The relative expression levels of \u003cem\u003eVrn-H3\u003c/em\u003e under LD conditions were higher in vernalized Steptoe plants when compared to non-vernalized plants (Figure 4). After four weeks of LD conditions, non-vernalized Rum plant showed higher \u003cem\u003eVrn-H3\u003c/em\u003e expression when compared to other treated plants. On the other hand, well-watered and vernalized-Steptoe plants showed higher \u003cem\u003eVrn-H3\u003c/em\u003e expression when compared to stressed and vernalized-Steptoe plants (Figure 4). Under SD conditions, stressed and vernalized Rum plants showed higher \u003cem\u003eVrn-H3\u003c/em\u003e expression levels when compared to other plants subjected to other treatment combinations (Figure 4). Furthermore, the expression levels of \u003cem\u003eVrn-H3\u003c/em\u003e in vernalized and well-watered Rum plants were also significantly higher when compared to Steptoe plants, irrespective of treatment combinations. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor \u003cem\u003eHVA22\u003c/em\u003e gene expression, no major changes were observed between the different growth conditions and treatments for both Rum and Steptoe where a clear increment in its expression level was observed under stress conditions (Figure 4).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe occurrence of abiotic stresses in marginal Mediterranean environments, primarily heat and drought, are strongly variable over space and time (Baum et al., 2007). In these environments, terminal drought under rainfed conditions can lead to premature termination of plant growth before grain maturity and consequently can affect grain yield severely (Al-Abdallat et al., 2017). In this study, late sowing accompanied by terminal drought stress resulted in lower GY when compared to early sowing treatment. This is expected knowing that late sowing will subject barley plants to different abiotic stresses, such as drought and heat, which are expected to negatively affect the growth and yield (Samarah et al., 2009). In addition, late sowing of photoperiod responsive plants will result in faster development and pleotropic effects that will reduce yield in barley plants and particularly under drought. Furthermore, variations in the response of barley genotypes to different environments and treatments were obvious, confirming that GY was greatly affected by genotypic effects where the adapted local cultivars Rum and Acsad176, outperformed the non-adapted cultivars, Steptoe and Morex. In this study, Rum was superior and the most stable genotype under all tested environments, which indicated its general adaptability to multiple environments. In previous studies, Rum outperformed several Jordanian landraces and cultivars and was considered the most stable genotype under mild drought conditions (Samarah et al., 2009; Al-Sayaydeh et al., 2019). Nevertheless, Rum performance was relatively moderate when compared to 150 Jordanian landraces under severe drought conditions and therefore, it is more suited to areas with milder drought conditions (Al-Abdallat et al., 2017). On the other hand, Steptoe was the poorest and the least stable genotype across all tested environments and in particular under rainfed conditions. Similar results were reported recently where Rum outperformed Steptoe in field trials under drought conditions (Wiegmann et al., 2019) and it was the most drought-affected genotype under controlled conditions (Al-Ajlouni et al., 2016).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, drought seemingly accelerated HD under field conditions when compared to irrigated conditions. This is in general agreement with (Tavakol et al., 2016), who observed accelerated heading in barley plants under stress conditions. Steptoe was the last genotype to flower across different environments and was the most affected genotype by drought stress. Steptoe was described previously as a late flowering genotype that has a reduced peduncle and few tillers per plant (Al-Ajlouni et al., 2016). Such late HD was correlated with a severe reduction in GY when compared to early HD observed in Rum (Figure S2). This behavior was reported previously under controlled greenhouse conditions, where HD was negatively correlated with GY irrespective of water stress treatment (Al-Ajlouni et al., 2016). \u0026nbsp;In the same study, Rum flowered earlier and outperformed Steptoe for GY and other yield-related traits under controlled drought conditions. In another study, Rum flowered earlier under field conditions when compared to Steptoe with a strong positive correlation between early flowering and GY under drought conditions (Wiegmann et al., 2019). This is supported further by the fact that any delay in flowering time in dry environments is commonly correlated with yield reductions (Rollins et al., 2013).\u003c/p\u003e\n\u003cp\u003eIn barley, flowering time is governed by genetic networks and allelic variations in key regulatory genes that fine-tune barley flowering in response to environmental stimuli (Campoli et al., 2012; Campoli and von Korff, 2014). During the fall, when barley seeds start to germinate, \u003cem\u003eVrn-H3\u003c/em\u003e is repressed by Vrn-H2 (Distelfeld et al., 2009; Mulki and von Korff, 2016), while in winter, vernalization up-regulates \u003cem\u003eVrn-H1\u003c/em\u003e, which results in the repression of \u003cem\u003eVrn-H2\u003c/em\u003e in the leaves and, consequently, the activation of \u003cem\u003eVrn-H3\u003c/em\u003e transcription in the spring (Fu et al., 2005; Chen and Dubcovsky, 2012; Mulki and von Korff, 2016).\u0026nbsp;Furthermore,\u0026nbsp;the allelic differences in \u003cem\u003ePpd-H1\u0026nbsp;\u003c/em\u003eand \u003cem\u003ePpd-H2\u0026nbsp;\u003c/em\u003egenes\u003cem\u003e\u0026nbsp;\u003c/em\u003ein\u003cem\u003e\u0026nbsp;\u003c/em\u003ebarley are known to be associated with natural variations in the responses to day length (Turner et al., 2005). The \u003cem\u003eVrn-H2\u003c/em\u003e functional allele was detected previously in Rum, while it was absent in Steptoe (Al-Ajlouni et al., 2016). The presence of \u003cem\u003eVrn-H2\u003c/em\u003e is required to prevent premature flowering in winter barley under LD conditions particularly after fall sowing (Cockram et al., 2007b). No repression effect of Vrn-H2 on flowering was observed in Rum, which carries a spring \u003cem\u003eVrn-H1\u003c/em\u003e allele (\u003cem\u003eVrn-H1-7\u003c/em\u003e), which can overcome Vrn-H2\u003cem\u003e\u0026nbsp;\u003c/em\u003e(Mulki and von Korff, 2016). Under controlled conditions, vernalization treatment seems to accelerate floral meristem development and heading in Rum under LD, irrespective of stress treatment, and in drought-stressed plants under SD conditions. Steptoe lacks functional \u003cem\u003eVrn-H2\u003c/em\u003e alleles and carries the \u003cem\u003eVrn-H1-4\u0026nbsp;\u003c/em\u003eallele, which requires some vernalization (Hemming et al., 2009; Casao et al., 2011b), but still, Steptoe behaved differently from Rum, which might indicate that the genetic network governing heading under LD conditions is different. An LD-responsive \u003cem\u003ePpd-H1\u003c/em\u003e allele was identified in both Rum and Steptoe, which explains their accelerated flowering responses under LDs conditions when compared to SD conditions (Campoli et al., 2012). A positive role of the LD-responsive \u003cem\u003ePpd-H1\u003c/em\u003e allele on GY was observed recently, which was associated with shorter growing seasons under drought conditions (Wiegmann et al., 2019). Under these conditions, the functional \u003cem\u003ePpd-H1\u003c/em\u003e allele was associated with increased GFP and increased TKW in barley plants. \u003cem\u003ePpd-H2\u003c/em\u003e is another gene that has been long acknowledged as responsible for the acceleration of flowering in facultative barley types in response to the SD photoperiod and under mild winter conditions (Casao et al., 2011b). \u003cem\u003ePpd-H2\u003c/em\u003e was identified previously in Rum but not in Steptoe (Al-Ajlouni et al., 2016), which might explain the failure of Steptoe to flower under SDs conditions. It was proposed that \u003cem\u003ePpd-H2\u0026nbsp;\u003c/em\u003epromotes the early flowering of winter cultivars irrespective of photoperiod conditions and the existence of a dominant allele can promote flowering in plants that have not satisfied their vernalization requirement under SD conditions (Casao et al., 2011b).\u003c/p\u003e\n\u003cp\u003eUnder LD conditions, Rum showed early response to vernalization treatments that accelerated heading when compared to non-vernalized Rum plants and this was accompanied with higher expression levels of \u003cem\u003eVrn-H1\u003c/em\u003e (Figure 4). Inducible expression of different spring alleles of \u003cem\u003eVrn-H1\u0026nbsp;\u003c/em\u003ein response to cold treatment was reported previously (Hemming et al., 2009; Casao et al., 2011b). Furthermore, higher \u003cem\u003eVrn-H1\u0026nbsp;\u003c/em\u003elevels\u003cem\u003e\u0026nbsp;\u003c/em\u003eunder LD conditions were observed in non-vernalized Rum when compared with non-vernalized Steptoe, which is consistent with Hemming et al. (2009), who found higher levels in a line carrying \u003cem\u003eVrn-H1-7\u003c/em\u003e allele when compared with a line carrying \u003cem\u003eVrn-H1-4\u003c/em\u003e. Differential expression of \u003cem\u003eVrn-H1\u0026nbsp;\u003c/em\u003ewas also observed between different genotypes under LD conditions (Gol et al., 2021). In addition, different \u003cem\u003eVrn-H1\u003c/em\u003e expression levels were previously reported in barley lines carrying the same spring \u003cem\u003eVrn-H1\u003c/em\u003e allele (Casao et al., 2011b). After four weeks of LD, stressed Steptoe plants showed significantly lower expression levels of \u003cem\u003eVrn-H1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eVrn-H3\u0026nbsp;\u003c/em\u003egenes when compared with well-watered Steptoe plants and this could explain the delayed meristem development and late heading in stressed plants. This is in general agreement with Gol et al. (2021),\u0026nbsp;who observed reduced \u003cem\u003eVrn-H1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eVrn-H3\u0026nbsp;\u003c/em\u003eexpression levels under drought conditions in selected genotypes when compared with control treatments. Under SD conditions, stressed and vernalized Rum plants showed significantly higher levels of \u003cem\u003eVrn-H1\u003c/em\u003e and \u003cem\u003eVrn-H3\u0026nbsp;\u003c/em\u003ethat resulted in advanced meristem development and early heading in stressed plants. The high \u003cem\u003eVrn-H1\u003c/em\u003e expression levels in vernalized Rum plants under SD and drought stress conditions were associated with a clear advanced developmental stage when compared to Steptoe, which showed a clear slower reproductive meristem development (Figure 3B; Figure 4; Figure S3). This also indicates that even though both genotypes are vernalization independent, there are still responses to vernalization in combination with other growth conditions and drought stress, which might have implications for field-grown plants (Casao et al 2011a). In this study, both tested genotypes carried different \u003cem\u003eVrn-H1\u0026nbsp;\u003c/em\u003ealleles where Rum has the \u003cem\u003eVrn-H1-7\u003c/em\u003e allele and Steptoe has the \u003cem\u003eVrn-H1-4\u003c/em\u003e allele (Al-Ajlouni et al., 2016), and this might explain the differential gene expression of flowering time genes in response to different treatments (Hemming et al., 2009). Nevertheless, gene expression data of this study are representing the levels at specific time points, while clear differences between tested genotypes for growth stages and meristem development at each selected time point were observed, which might explain that the high expression levels in Rum plants are associated with advanced growth stages beside allelic differences in targeted genes (Casao et al., 2011b).\u003c/p\u003e\n\u003cp\u003eIn this study, Rum was found to be hyper-responsive to LD conditions compared to Steptoe indicating the existence of different genetic networks to perceive photoperiod signals in the Rum plant (Faure et al., 2007; Karsai et al., 2008). This is further supported by the \u003cem\u003ePpd-H1\u003c/em\u003e expression data under LD conditions, where both genotypes behaved differently in response to vernalization treatment (Figure 4). In Rum genotype, the expression level of \u003cem\u003ePpd-H1\u003c/em\u003e after two weeks of LD incubation was higher under vernalization when compared to non-vernalized conditions, while the opposite was observed after four weeks of LD incubation. Notably, this was associated with the flowering time under LD conditions where vernalized Rum plants flowered earlier than non-vernalized plants (Figure S4). This pattern was also similar to \u003cem\u003eVrn-H3\u003c/em\u003e expression, which is consistent with Hemming et al. (2008), who observed a correlation between Ppd-H1 and \u003cem\u003eVrn-H3\u003c/em\u003e expression and early heading in barley plant. No clear effect of drought on meristem development in Rum plants was observed under LD conditions. A similar trend was reported by (Haile, 2013) where the developmental stage of the apical meristem was similar in introgression lines carrying \u003cem\u003ePpd-H1\u003c/em\u003e under control and stress conditions. In a recent study, Gol et al. (2021) found that the expression of \u003cem\u003ePpd-H1\u003c/em\u003e was not affected by drought under LD conditions in selected barley genotypes, except for Golden Promise, which had significantly lower levels under drought conditions and this was associated with reduced \u003cem\u003eVrn-H3\u0026nbsp;\u003c/em\u003eexpression levels. Furthermore, the expression of \u003cem\u003ePpd-H1\u003c/em\u003e levels varied significantly between tested genotypes and the stress treatment, which is in general agreement with the results of this study. The same study concluded that \u003cem\u003ePpd-H1\u003c/em\u003e integrates photoperiod and drought stress signals to fine-tune reproductive development in barley. In Steptoe, there was no major difference in \u003cem\u003ePpd-H1\u003c/em\u003e expression under LD conditions after two weeks of incubation, but after four weeks, the expression levels under vernalized conditions were higher when compared to non-vernalized Steptoe plants but still, it was similar to vernalized Rum plants. Nevertheless, this induced expression in Steptoe was not associated with increased \u003cem\u003eVrn-H3\u003c/em\u003e as observed in Rum plants. Under SD and stress conditions, the expression levels of \u003cem\u003eVrn-H1\u003c/em\u003e and \u003cem\u003eVrn-H3\u003c/em\u003e were higher in vernalized Rum plants (Figure 4). Barley genotypes carrying the dominant allele of \u003cem\u003ePpd-H2\u0026nbsp;\u003c/em\u003eshowed higher expression levels of \u003cem\u003eVrn-H1\u003c/em\u003e and \u003cem\u003eVrn-H3\u003c/em\u003e and this might explain their higher levels in Rum plants under SD conditions. An interplay between \u003cem\u003eVrn-H1,\u003c/em\u003e \u003cem\u003eVrn-H2,\u003c/em\u003e \u003cem\u003eVrn-H3,\u003c/em\u003e \u003cem\u003ePpd-H1\u003c/em\u003e and \u003cem\u003ePpd-H2\u003c/em\u003e to fine-tune plant development under SD and LD conditions in response to vernalization was previously suggested (Casao et al., 2011b; Maurer et al., 2015; Wiegmann et al., 2019) and a potential interplay between flowering time genes and stress tolerance was recently reported (Gol et al., 2021) that align with the results of this study.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, the field performance of four selected spring barley genotypes was assessed across different environments and treatments. Rum and Acsad176 were well-adapted and stable across different environments and management practices when compared to Morex and Steptoe. The delayed heading in Steptoe was correlated negatively with GY under drought conditions, while it was associated with better performance in Rum. Analyzing the responses of both genotypes under controlled conditions identified a link between shoot apical meristem development under SD and drought stress conditions in vernalized Rum plants that was associated with higher gene expression of the \u003cem\u003eVrn-H1\u003c/em\u003e and \u003cem\u003eVrn-H3\u003c/em\u003e gene. Furthermore, accelerated flowering in Rum plants was observed in response to vernalization under LD conditions and this was also reflected in the early expression of \u003cem\u003ePpd-H1, Vrn-H1\u003c/em\u003e and \u003cem\u003eVrn-H3\u003c/em\u003e under these conditions. Under rainfed conditions, the early sowing of Rum subjects the plants to SD and vernalization and under such conditions early flowering was observed in Rum that had a 30% reduction in GY compared to a 60% reduction in Steptoe. This highlights the importance of selecting genotypes that can fine-tune flowering time in response to vernalization and photoperiod to secure stable yield production in dry environments. Matching the developmental behavior of barley genotypes using different management procedures and dissecting the genetic information of flowering time in adapted cultivars will help in developing new genotypes with stable performance under dry conditions. Further studies are needed to dissect the genetic basis of floral meristem development and to identify QTL associated with flowering time, yield stability under drought conditions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded partially by the\u0026nbsp;Deanship of Scientific Research, The University of Jordan (Amman, Jordan) and the Arab Fund for Economic and Social Development (AFESD; Kuwait) project through ICARDA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe\u0026nbsp;sincerely\u0026nbsp;acknowledge Mr. Talal Ebdah (The University of Jordan) and Mr. Mahmmoud Al-Qudah (Rabba Center for Agriculture Research, NARC)\u0026nbsp;for their assistant in the field work. We\u0026nbsp;sincerely\u0026nbsp;acknowledge Dr. Aladdin Hamwieh for his assistant in the statistical analysis. We\u0026nbsp;sincerely\u0026nbsp;acknowledge the financial support of the Arab Fund for Economic and Social Development (AFESD; Kuwait) project to JAE and ZA and the Deanship of Scientific Research, The University of Jordan for the financial support to AMA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAMA, JAE and JYA conceived, designed the experiments, analyzed the data and wrote the manuscript. JAE, RAS, ZAA and AAB supervised the field work, collected the phenotypic data and helped in data analysis. RB helped in site analysis, weather data and related measurements and their analysis. ZA helped in controlled experiments, meristem dissecting and their data analysis. RAS and JYA helped in controlled experiments, physiological measurements and their data analysis. SH and TH helped in molecular work, gene expression and data analysis. All authors edited and provided a critical review of the manuscript. All authors read and approved the final manuscript.\u0026emsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data sets supporting the results of this article will be freely available upon request to corresponding author:
[email protected] and for non-commercial use only.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAl Abdallat, A. M., Ayad, J. Y., Elenein, J. A., Al Ajlouni, Z., and Harwood, W. A. (2014). Overexpression of the transcription factor HvSNAC1 improves drought tolerance in barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e L.). \u003cem\u003eMol. Breeding\u003c/em\u003e. 33,401-414.\u0026nbsp;https://doi.org/10.1007/s11032-013-9958-1\u003c/li\u003e\n \u003cli\u003eAl-Abdallat, A. M., Karadsheh, A., Hadadd, N.I., Akash, M.W., Ceccarelli, S., Baum, M., Hasan, M., Jighly, A., and Elenein, J.A. (2017). Assessment of genetic diversity and yield performance in Jordanian barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e L.) landraces grown under Rainfed conditions. \u003cem\u003eBMC Plant Biol.\u003c/em\u003e 17,1-3.\u0026nbsp;\u003ca href=\"https://doi.org/10.1186/s12870-017-1140-1\"\u003ehttps://doi.org/10.1186/s12870-017-1140-1\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAl-Ajlouni, Z. I., Al-Abdallat, A. M., Al-Ghzawi, A. L., Ayad, J. Y., Abu Elenein, J. M., Al-Quraan, N. A., Baenziger, P. S. (2016). Impact of pre-anthesis water deficit on yield and yield components in barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e L.) plants grown under controlled conditions. \u003cem\u003eAgronomy\u003c/em\u003e. 6,33.\u0026nbsp;\u003ca href=\"https://doi:10.3390/agronomy6020033\"\u003ehttps://doi:10.3390/agronomy6020033\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAl-Sayaydeh, R., Al-Bawalize, A., Al-Ajlouni, Z., Akash, M.W., Abu-Elenein, J., and Al-Abdallat, A.M. (2019). Agronomic evaluation and yield performance of selected barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e L.) landraces from Jordan. \u003cem\u003eInt. J. Agron.\u003c/em\u003e 2019,1-12.\u0026nbsp;\u0026nbsp;\u003ca href=\"https://doi.org/10.1155/2019/9575081\"\u003ehttps://doi.org/10.1155/2019/9575081\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAnderson, R., Bayer, P.E., and Edwards, D. (2020). Climate change and the need for agricultural adaptation. \u003cem\u003eCurr. Opin. Plant Biol.\u003c/em\u003e 56,197-202.\u0026nbsp;https ://doi.org/10.1016/j.pbi.2019.12.006\u0026nbsp;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAraus, J. L., Slafer, G. A., Royo, C., and Serret, M. D. (2008). Breeding for yield potential and stress adaptation in cereals. \u003cem\u003eCrit. Rev. Plant Sci.\u003c/em\u003e 27,377-412.\u0026nbsp;\u003ca href=\"https://doi.org/10.1080/07352680802467736\"\u003ehttps://doi.org/10.1080/07352680802467736\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eBarrs, H. D., and Weatherley, P. E. (1962). A re-examination of the relative turgidity technique for estimating water deficits in leaves. \u003cem\u003eAust.\u0026nbsp;J. Biol. Sci.\u003c/em\u003e 15,413-428.\u0026nbsp;\u003ca href=\"https://doi.org/10.1071/BI9620413\"\u003ehttps://doi.org/10.1071/BI9620413\u003c/a\u003e.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eBaum, M., Von Korff, M., Guo, P., Lakew, B., Hamwieh, A., Lababidi, S., Udupa, S. M., Sayed, H., Choumane, W., Grando, S., Ceccarelli, S. (2007). \u0026ldquo;Molecular approaches and breeding strategies for drought tolerance in barley,\u0026rdquo; In \u003cem\u003eGenomics-assisted crop improvement\u003c/em\u003e, eds. R. \u0026nbsp;K. Varshney, and R. Tuberosa, (Springer, Dordrecht), 51-79.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/978-1-4020-6297-1_3\"\u003ehttps://doi.org/10.1007/978-1-4020-6297-1_3\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCampoli, C., Shtaya, M., Davis, S. J., and von Korff, M. (2012). Expression conservation within the circadian clock of a monocot: natural variation at barley \u003cem\u003ePpd-H1\u003c/em\u003e affects circadian expression of flowering time genes, but not clock orthologs. \u003cem\u003eBMC Plant Biol.\u003c/em\u003e 12,97.\u0026nbsp;\u003ca href=\"https://doi.org/10.1186/1471-2229-12-97\"\u003ehttps://doi.org/10.1186/1471-2229-12-97\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCampoli, C., and von Korff, M. (2014). Genetic control of reproductive development in temperate cereals. \u003cem\u003eAdv. Bot. Res.\u003c/em\u003e 72,131-158.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/B978-0-12-417162-6.00005-5\"\u003ehttps://doi.org/10.1016/B978-0-12-417162-6.00005-5\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCasao, M. C., Igartua, E., Karsai, I., Bhat, P. R., Cuadrado, N., Gracia, M. P., Lasa, J. M. and Casas, A. M. (2011a). Introgression of an intermediate \u003cem\u003eVRNH1\u003c/em\u003e allele in barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e L.) leads to reduced vernalization requirement without affecting freezing tolerance.\u0026nbsp;\u003cem\u003eMol. Breed.\u003c/em\u003e 28,475-484.\u003ca href=\"https://doi.org/10.1007/s11032-010-9497-y\"\u003ehttps://doi.org/10.1007/s11032-010-9497-y\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCasao, M. C., Karsai, I., Igartua, E., Gracia, M. P., Veisz, O., and Casas, A. M. (2011b). Adaptation of barley to mild winters: a role for \u003cem\u003ePPDH2\u003c/em\u003e. \u003cem\u003eBMC Plant Biol.\u003c/em\u003e 11,1-13.\u0026nbsp;\u003ca href=\"https://doi.org/10.1186/1471-2229-11-164\"\u003ehttps://doi.org/10.1186/1471-2229-11-164\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eChen, A., and Dubcovsky, J. (2012). Wheat TILLING mutants show that the vernalization gene VRN1 down-regulates the flowering repressor VRN2 in leaves but is not essential for flowering. \u003cem\u003ePLoS Genet.\u003c/em\u003e 8,e1003134.\u0026nbsp;\u003ca href=\"https://doi.org/10.1371/journal.pgen.1003134\"\u003ehttps://doi.org/10.1371/journal.pgen.1003134\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCockram, J., Chiapparino, E., Taylor, S. A., Stamati, K., Donini, P., Laurie, D. A., and O\u0026rsquo;Sullivan, D. M. (2007a). Haplotype analysis of vernalization loci in European barley germplasm reveals novel \u003cem\u003eVRN-H1\u003c/em\u003e alleles and a predominant winter \u003cem\u003eVRN-H1/VRN-H2\u003c/em\u003e multi-locus haplotype. \u003cem\u003eTheor.\u0026nbsp;Appl.\u0026nbsp;Genet.\u003c/em\u003e 115,993-1001.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s00122-007-0626-x\"\u003ehttps://doi.org/10.1007/s00122-007-0626-x\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCockram, J., Jones, H., Leigh, F. J., O\u0026apos;Sullivan, D., Powell, W., Laurie, D. A., and Greenland, A. J. (2007b). Control of flowering time in temperate cereals: genes, domestication, and sustainable productivity. \u003cem\u003eJ. Exp. Bot.\u003c/em\u003e 58,1231-1244.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/erm042\"\u003ehttps://doi.org/10.1093/jxb/erm042\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eDigel, B., Pankin, A., and von Korff, M. (2015). Global transcriptome profiling of developing leaf and shoot apices reveals distinct genetic and environmental control of floral transition and inflorescence development in barley. \u003cem\u003eThe Plant Cell.\u003c/em\u003e 27,2318-2334.\u0026nbsp;\u003ca href=\"https://doi.org/10.1105/tpc.15.00203\"\u003ehttps://doi.org/10.1105/tpc.15.00203\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eDistelfeld, A., Li, C., and Dubcovsky, J. (2009). Regulation of flowering in temperate cereals. \u003cem\u003eCurr. Opin. Plant Biol.\u003c/em\u003e 12,178-184.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.pbi.2008.12.010\"\u003ehttps://doi.org/10.1016/j.pbi.2008.12.010\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eFaure, S., Higgins, J., Turner, A., and Laurie, D. A. (2007). The \u003cem\u003eFLOWERING LOCUS T-\u003c/em\u003elike gene family in barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e). \u003cem\u003eGenetics\u003c/em\u003e. 176,599-609.\u0026nbsp;\u003ca href=\"https://doi.org/10.1534/genetics.106.069500\"\u003ehttps://doi.org/10.1534/genetics.106.069500\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eFerdous, J., Li, Y., Reid, N., Langridge, P., Shi, B. J., \u0026amp; Tricker, P. J. (2015). Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. \u003cem\u003ePLoS One.\u003c/em\u003e 10,e0118503.\u0026nbsp;\u003ca href=\"https://doi.org/10.1371/journal.pone.0118503\"\u003ehttps://doi.org/10.1371/journal.pone.0118503\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eFu, D., Szűcs, P., Yan, L., Helguera, M., Skinner, J. S., Von Zitzewitz, J., Hayes, P. M. and Dubcovsky, J. (2005). Large deletions within the first intron in \u003cem\u003eVRN-1\u003c/em\u003e are associated with spring growth habit in barley and wheat. \u003cem\u003eMol. Genet. Genom.\u003c/em\u003e 273,54-65.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s00438-004-1095-4\"\u003ehttps://doi.org/10.1007/s00438-004-1095-4\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eGaliba, G., V\u0026aacute;g\u0026uacute;jfalvi, A., Li, C., Solt\u0026eacute;sz, A., and Dubcovsky, J. (2009) Regulatory genes involved in the determination of frost tolerance in temperate cereals. \u003cem\u003ePlant Sci.\u003c/em\u003e 176,12-19.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.plantsci.2008.09.016\"\u003ehttps://doi.org/10.1016/j.plantsci.2008.09.016\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eGol, L., Haraldsson, E. B., and von Korff, M. (2021). \u003cem\u003ePpd-H1\u003c/em\u003e integrates drought stress signals to control spike development and flowering time in barley. \u003cem\u003eJ. Exp. Bot.\u003c/em\u003e 72,122-136.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/eraa261\"\u003ehttps://doi.org/10.1093/jxb/eraa261\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eGol, L., Tom\u0026eacute;, F., and von Korff, M. (2017). Floral transitions in wheat and barley: interactions between photoperiod, abiotic stresses, and nutrient status. \u003cem\u003eJ. Exp. Bot.\u003c/em\u003e 68,1399-1410.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/erx055\"\u003ehttps://doi.org/10.1093/jxb/erx055\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHabte, E., M\u0026uuml;ller, L. M., Shtaya, M., Davis, S. J., and von Korff, M. (2014). Osmotic stress at the barley root affects expression of circadian clock genes in the shoot. \u003cem\u003ePlant Cell Environ.\u003c/em\u003e 37,1321-1337.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/pce.12242\"\u003ehttps://doi.org/10.1111/pce.12242\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHaile, E. H., (2013). The effect of natural variation at \u003cem\u003ePpd\u003c/em\u003e-\u003cem\u003eH1\u003c/em\u003e and \u003cem\u003eHvELF3\u003c/em\u003e on responses to osmotic stress in barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e). Doctoral dissertation, Cologne, University of Cologne.\u003c/li\u003e\n \u003cli\u003eHemming, M. N., Fieg, S., Peacock, W. J., Dennis, E. S., and Trevaskis, B. (2009). Regions associated with repression of the barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e) \u003cem\u003eVERNALIZATION1\u003c/em\u003e gene are not required for cold induction. \u0026nbsp;\u003cem\u003eMol. Genet. Genom.\u003c/em\u003e\u0026nbsp; 282,107-117.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s00438-009-0449-3\"\u003ehttps://doi.org/10.1007/s00438-009-0449-3\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHemming, M. N., Peacock, W. J., Dennis, E. S., and Trevaskis, B. (2008). Low-temperature and daylength cues are integrated to regulate \u003cem\u003eFLOWERING LOCUS T\u003c/em\u003e in barley. \u003cem\u003ePlant Physiol.\u003c/em\u003e 147,355-366.\u0026nbsp;\u003ca href=\"https://doi.org/10.1104/pp.108.116418\"\u003ehttps://doi.org/10.1104/pp.108.116418\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHemming, M. N., Walford, S. A., Fieg, S., Dennis, E. S., and Trevaskis, B. (2012). Identification of high-temperature-responsive genes in cereals. \u003cem\u003ePlant Physiol.\u003c/em\u003e 158,1439-1450.\u0026nbsp;\u003ca href=\"https://doi.org/10.1104/pp.111.192013\"\u003ehttps://doi.org/10.1104/pp.111.192013\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHorsley, R. D., Franckowiak, J. D., Schwarz, P. B. (2009). \u0026ldquo;Barley\u0026rdquo; In \u003cem\u003eCereals\u003c/em\u003e, ed. M. J. Carena (Springer, New York, NY), 227-250.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/978-0-387-72297-9_7\"\u003ehttps://doi.org/10.1007/978-0-387-72297-9_7\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eJedmowski, C., Ashoub, A., Momtaz, O., and Br\u0026uuml;ggemann W. (2015). Impact of drought, heat, and their combination on chlorophyll fluorescence and yield of wild barley (\u003cem\u003eHordeum spontaneum\u003c/em\u003e). \u003cem\u003eJ. Bot.\u003c/em\u003e Article ID 120868:1-9.\u0026nbsp;\u003ca href=\"http://dx.doi.org/10.1155/2015/120868\"\u003ehttp://dx.doi.org/10.1155/2015/120868\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eJung, C., Pillen, K., Staiger, D., Coupland, G., and von Korff, M. (2017). Recent advances in flowering time control. \u003cem\u003eFront. Plant Sci.\u003c/em\u003e 7,2011. \u0026nbsp;\u0026nbsp;\u003ca href=\"https://doi.org/10.3389/fpls.2016.02011\"\u003ehttps://doi.org/10.3389/fpls.2016.02011\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKarsai, I., Szűcs, P., Kőszegi, B., Hayes, P. M., Casas, A., Bedő, Z., and Veisz, O. (2008). Effects of photo and thermo cycles on flowering time in barley: a genetical phenomics approach. \u003cem\u003eJ. Exp. Bot\u003c/em\u003e. 59,2707-2715.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/ern131\"\u003ehttps://doi.org/10.1093/jxb/ern131\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eLu, H. D., Xue, J. Q., and Guo, D. W. (2017). Efficacy of planting date adjustment as a cultivation strategy to cope with drought stress and increase rainfed maize yield and water-use efficiency. \u003cem\u003eAgric. Water Manag.\u003c/em\u003e 179,227-235.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.agwat.2016.09.001\"\u003ehttps://doi.org/10.1016/j.agwat.2016.09.001\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMaurer, A., Draba, V., Jiang, Y., Schnaithmann, F., Sharma, R., Schumann, E., Kilian, B., Reif, J.C. and Pillen, K. (2015). Modelling the genetic architecture of flowering time control in barley through nested association mapping. \u003cem\u003eBMC Genomics.\u0026nbsp;\u003c/em\u003e16,1-12.\u0026nbsp;\u003ca href=\"https://doi.org/10.1186/s12864-015-1459-7\"\u003ehttps://doi.org/10.1186/s12864-015-1459-7\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eMulki, M. A., and von Korff, M. (2016). CONSTANS controls floral repression by up-regulating \u003cem\u003eVERNALIZATION2\u0026nbsp;\u003c/em\u003e(VRN-H2) in barley. \u003cem\u003ePlant Physiol.\u003c/em\u003e 170,325-337.\u0026nbsp;\u003ca href=\"https://doi.org/10.1104/pp.15.01350\"\u003ehttps://doi.org/10.1104/pp.15.01350\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eNewman, R. K., Newman, C. W. (2008). \u003cem\u003eBarley for food and health: Science, technology, and products\u003c/em\u003e. Hoboken; John Wiley \u0026amp; Sons. p.56-94.\u003c/li\u003e\n \u003cli\u003eOlivoto, T., and L\u0026uacute;cio, A. D. (2020). Metan: An R package for multi‐environment trial analysis. \u003cem\u003eMethods Ecol. Evol.\u003c/em\u003e 11,783-789.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/2041-210X.13384\"\u003ehttps://doi.org/10.1111/2041-210X.13384\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eRollins, J. A., Drosse, B., Mulki, M. A., Grando, S., Baum, M., Singh, M., Ceccarelli, S. and von Korff, M. (2013). Variation at the vernalisation genes \u003cem\u003eVrn-H1\u003c/em\u003e and \u003cem\u003eVrn-H2\u003c/em\u003e determines growth and yield stability in barley (\u003cem\u003eHordeum\u003c/em\u003e \u003cem\u003evulgare\u003c/em\u003e) grown under dryland conditions in Syria. \u003cem\u003eTheor. Appl. Genet.\u003c/em\u003e 126,2803-2824.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSaisho, D., Ishii, M., Hori, K., and Sato, K. (2011). Natural variation of barley vernalization requirements: implication of quantitative variation of winter growth habit as an adaptive trait in East Asia. \u003cem\u003ePlant Cell Physiol.\u003c/em\u003e 52,775-784.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/pcp/pcr046\"\u003ehttps://doi.org/10.1093/pcp/pcr046\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSamarah, N. H., Alqudah, A. M., Amayreh, J. A., and McAndrews, G. M. (2009). The effect of late‐terminal drought stress on yield components of four barley cultivars. \u003cem\u003eJ. Agron. Crop. Sci.\u003c/em\u003e 195,427-441.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/j.1439-037X.2009.00387.x\"\u003ehttps://doi.org/10.1111/j.1439-037X.2009.00387.x\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSasani, S., Hemming, M. N., Oliver, S. N., Greenup, A., Tavakkol-Afshari, R., Mahfoozi, S., Poustini, K., Sharifi, H. R., Dennis, E.S., Peacock, W. J. and Trevaskis, B. (2009). The influence of vernalization and daylength on expression of flowering-time genes in the shoot apex and leaves of barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e). \u003cem\u003eJ. Exp. Bot.\u003c/em\u003e 60,2169-2178.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/erp098\"\u003ehttps://doi.org/10.1093/jxb/erp098\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eShen, Q., Chen, C. N., Brands, A., Pan, S. M., and Tuan-Hua, D. H. (2001). The stress-and abscisic acid-induced barley gene \u003cem\u003eHVA22\u003c/em\u003e: developmental regulation and homologues in diverse organisms. \u003cem\u003ePlant Mol. Biol.\u003c/em\u003e 45,327-340.\u0026nbsp;\u003ca href=\"https://doi.org/10.1023/A:1006460231978\"\u003ehttps://doi.org/10.1023/A:1006460231978\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eTavakol, E., Elbadry, N., Tondelli, A., Cattivelli, L., and Rossini, L. (2016). Genetic dissection of heading date and yield under Mediterranean dry climate in barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.). \u003cem\u003eEuphytica\u003c/em\u003e. 212,343-353.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s10681-016-1785-0\"\u003ehttps://doi.org/10.1007/s10681-016-1785-0\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eTrevaskis, B., Hemming, M. N., Peacock, W. J., and Dennis, E. S. (2006). HvVRN2 responds to daylength, whereas HvVRN1 is regulated by vernalization and developmental status. \u003cem\u003ePlant Physiol.\u003c/em\u003e 140,1397-1405.\u0026nbsp;\u003ca href=\"https://doi.org/10.1104/pp.105.073486\"\u003ehttps://doi.org/10.1104/pp.105.073486\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eTrevaskis, B., Tadege, M., Hemming, M. N., Peacock, W. J., Dennis, E. S., and Sheldon, C. (2007). Short vegetative phase-like MADS-box genes inhibit floral meristem identity in barley. \u003cem\u003ePlant Physiol.\u003c/em\u003e 143,225-235.\u0026nbsp;\u003ca href=\"https://dx.doi.org/10.1104%2Fpp.106.090860\"\u003ehttps://dx.doi.org/10.1104%2Fpp.106.090860\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eTurner, A., Beales, J., Faure, S., Dunford, R. P., and Laurie, D. A. (2005). The pseudo-response regulator Ppd-H1 provides adaptation to photoperiod in barley. \u003cem\u003eScience\u003c/em\u003e. 310,1031-1034. DOI: 10.1126/science.1117619.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eVandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, and A., Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. \u003cem\u003eGenome Biol.\u003c/em\u003e 3,1-2.\u0026nbsp;\u003ca href=\"https://doi.org/10.1186/gb-2002-3-7-research0034\"\u003ehttps://doi.org/10.1186/gb-2002-3-7-research0034\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eVisioni, A., Al-Abdallat, A. M., Elenien, J. A., Verma, R. P., Gyawali, S., Baum, M. (2019). \u0026ldquo;Genomics and molecular breeding for improving tolerance to abiotic stress in barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.),\u0026rdquo; In \u003cem\u003eGenomics Assisted Breeding of Crops for Abiotic Stress Tolerance\u003c/em\u003e, eds V. R. Rajpal., D. Sehgal., A. Kumar, S. N. Raina (Springer, Cham), 2 ,49-68.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/978-3-319-99573-1_4\"\u003ehttps://doi.org/10.1007/978-3-319-99573-1_4\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003evon Korff, M., Grando, S., Del Greco, A., This, D., Baum, M., and Ceccarelli, S. (2008). Quantitative trait loci associated with adaptation to Mediterranean dryland conditions in barley. \u003cem\u003eTheor. Appl. Genet.\u003c/em\u003e 117,653-669.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s00122-008-0787-2\"\u003ehttps://doi.org/10.1007/s00122-008-0787-2\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWaddington, S. R., Cartwright, P. M., and Wall, P. C. (1983). A quantitative scale of spike initial and pistil development in barley and wheat. \u003cem\u003eAnn. Bot.\u003c/em\u003e 51,119-130.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/oxfordjournals.aob.a086434\"\u003ehttps://doi.org/10.1093/oxfordjournals.aob.a086434\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWiegmann, M., Maurer, A., Pham, A., March, T. J., Al-Abdallat, A., Thomas, WT., Bull, H. J., Shahid, M., Eglinton, J., Baum, M., Flavell, A. J., Tester, M., and Pillen, K. (2019). Barley yield formation under abiotic stress depends on the interplay between flowering time genes and environmental cues. \u003cem\u003eSci. Rep.\u003c/em\u003e 9,1-6.\u0026nbsp;\u003ca href=\"https://doi.org/10.1038/s41598-019-42673-1\"\u003ehttps://doi.org/10.1038/s41598-019-42673-1\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eYan, L., Fu, D., Li, C., Blechl, A., Tranquilli, G., Bonafede, M. A. Sanchez, A.L., Valarik, M., Yasuda, S.H., Dubcovsky, J. (2006). The wheat and barley vernalization gene \u003cem\u003eVRN3\u003c/em\u003e is an orthologue of FT. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 103,19581-19586.\u0026nbsp;\u003ca href=\"https://doi.org/10.1073/pnas.0607142103\"\u003ehttps://doi.org/10.1073/pnas.0607142103\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eYan, W. (2001). GGEbiplot\u0026mdash;A Windows application for graphical analysis of multienvironment trial data and other types of two‐way data. \u003cem\u003eAgron. J.\u0026nbsp;\u003c/em\u003e93,1111-1118.\u0026nbsp;\u003ca href=\"https://doi.org/10.2134/agronj2001.9351111x\"\u003ehttps://doi.org/10.2134/agronj2001.9351111x\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eZadoks, J. C., Chang, T. T., and Konzak, C. F. (1974). A decimal code for the growth stages of cereals. \u003cem\u003eWeed Res.\u003c/em\u003e 14,415-421.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/j.1365-3180.1974.tb01084.x\"\u003ehttps://doi.org/10.1111/j.1365-3180.1974.tb01084.x\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Barley, Drought, Flowering time, Gene Expression, Photoperiod, Vernalization","lastPublishedDoi":"10.21203/rs.3.rs-289948/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-289948/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\tIn dry environments, the appropriate matching of reproductive development with water availability is considered very crucial for crop success. In this study, the role of variations in flowering time and drought tolerance in selected barley genotypes with contrasting drought tolerance behavior was studied under field and controlled conditions. For this purpose, field trials were conducted for two consecutive seasons at three diverse locations where the studied genotypes were subjected to either rainfed conditions or rainfed plus supplementary irrigation under two different sowing dates. Furthermore, reproductive meristem development was assessed in two selected barley genotypes, Rum (drought tolerant) and Steptoe (drought-sensitive), in response to both vernalization and water stress under two different photoperiod conditions.\u003cstrong\u003e \u003c/strong\u003eVariation in the number of days to heading was more pronounced under rainfed conditions than under well-water conditions. For agronomic performance, Rum was superior under all tested environments, which assures its general adaptability to dry environments. Under controlled conditions, the transition to reproductive meristem was faster under vernalized long-day conditions compared to vernalized short-day conditions. The progress of shoot apical meristem development and heading under long-day conditions was significantly faster in Rum compared to Steptoe. A pronounced effect of drought stress was observed on shoot apical meristem development in Steptoe. Under short-day conditions, vernalized Rum plants subjected to drought showed an advanced meristem development stage and a significantly earlier heading compared to non-stressed plants. This early heading in stressed Rum plants under short-day conditions was accompanied by higher gene expression of the\u0026nbsp;\u003cem\u003eVrn-H1\u003c/em\u003e\u0026nbsp;and \u003cem\u003eVrn-H3\u003c/em\u003e genes. In conclusion, the integration of vernalization and photoperiod signals in drought-tolerant barley genotypes was associated with early flowering time and higher productivity in dry environments.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Agronomic Performance and Flowering Behavior in Response to Photoperiod and Vernalization in Barley (Hordeum vulgare L.) Genotypes with Contrasting Drought Tolerance Behavior","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2021-08-11 19:23:41","doi":"10.21203/rs.3.rs-289948/v2","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2021-03-15 20:36:01","doi":"10.21203/rs.3.rs-289948/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"66d2a9a9-e983-48d6-9e7f-69d645b12f38","owner":[],"postedDate":"August 11th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":6391155,"name":"Plant Physiology and Morphology"},{"id":6391156,"name":"Plant Molecular Biology and Genetics"}],"tags":[],"updatedAt":"2021-07-02T12:44:04+00:00","versionOfRecord":[],"versionCreatedAt":"2021-08-11 19:23:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v2","identity":"rs-289948","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-289948","identity":"rs-289948","version":["v2"]},"buildId":"pf3fE39SIOqb-0xH_OWvX","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.