Synergistic Chemo-Photothermal Therapy Using Doxorubicin-Loaded Gold Nanorods for Enhanced Apoptosis in Lung Cancer Cells

Synergistic Chemo-Photothermal Therapy Using Doxorubicin-Loaded Gold Nanorods for Enhanced Apoptosis in Lung Cancer Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Synergistic Chemo-Photothermal Therapy Using Doxorubicin-Loaded Gold Nanorods for Enhanced Apoptosis in Lung Cancer Cells Ghazalsadat Mousavi Ramhormozi, Saeid Reza Khatami, Hamid Galehdari, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7437340/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Dec, 2025 Read the published version in Scientific Reports → Version 1 posted 12 You are reading this latest preprint version Abstract Lung cancer remains one of the leading causes of cancer-related mortality worldwide, primarily due to late diagnosis, aggressive progression, and the emergence of therapeutic resistance. Although significant advances have been made in surgery, chemotherapy, radiotherapy, targeted therapy, and immunotherapy, long-term survival remains limited. Photothermal therapy (PTT), a minimally invasive strategy that utilizes near-infrared (NIR) light to generate localized hyperthermia, has emerged as a promising approach to overcome drug resistance and enhance therapeutic outcomes. In this study, we evaluated a combined therapeutic strategy involving doxorubicin (DOX)-loaded gold nanorods (AuNRs) functionalized with thiolated β-cyclodextrin (AuNRs@S-β-CD-DOX) and NIR laser irradiation (808 nm) in A549 human lung cancer cells. Apoptosis was assessed using gene expression analysis, TUNEL assay, and Western blotting. Mechanistically, this triple therapy activates both intrinsic (caspase-9) and extrinsic (caspase-8) apoptotic pathways, which revealed cleavage of procaspases into active forms (e.g., caspase-3 fragments at 17/19 kDa). Our results demonstrated that the triple combination (DOX 0.078 µM + AuNRs@S-β-CD + laser) significantly enhanced apoptosis—up to 60%—while enabling the use of a DOX concentration far below its IC50 level. This synergistic effect was attributed to improved intracellular delivery of DOX facilitated by AuNRs@S-β-CD-mediated photothermal release and increased membrane permeability induced by laser irradiation. These findings support the potential of chemo-photothermal therapy as a highly effective and targeted strategy against lung cancer. Biological sciences/Cancer Biological sciences/Drug discovery Health sciences/Oncology Photothermal therapy Doxorubicin Gold nanorods Lung cancer Drug resistance Apoptosis Synergistic therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Lung cancer, comprising non-small cell lung cancer (NSCLC, ~ 85%) and small cell lung cancer (SCLC, ~ 15%),( 1 , 2 ) is the most commonly diagnosed malignancy and a primary cause of cancer death globally.( 1 , 3 – 6 ) Despite the introduction of novel therapeutics, the 5-year survival rate remains under 20%, largely due to metastatic disease and resistance to therapy( 5 ). The search for more effective and selective treatments has catalyzed interest in nanotechnology-based approaches, such as photothermal therapy (PTT)( 7 – 10 ). Current strategies for combating lung cancer include standard therapies such as surgery, chemotherapy, radiotherapy, immunotherapy and PTT, which are then evaluated in terms of their effectiveness( 11 , 12 ). Surgical resection is often the first-line treatment for early-stage NSCLC. However, due to the late onset of the disease, only approximately 20–25% of patients are eligible for this treatment( 12 ). Due to its aggressive nature and early spread, surgery is less effective in SCLC. Limitations of this treatment include the invasive nature and associated morbidity, its unsuitability for metastatic or inoperable tumors, and the risk of postoperative recurrence( 2 , 13 ). Chemotherapy (e.g., cisplatin, carboplatin, doxorubicin(DOX)) remains standard for both NSCLC and SCLC( 14 , 15 ). These drugs damage DNA, triggering apoptosis in rapidly dividing cells. Non-specific toxicity( 16 – 18 ), development of drug resistance and poor efficacy in advanced or resistant cases are the most well-known obstacles( 19 , 20 ). Radiotherapy often used in conjunction with chemotherapy (chemo-radiotherapy), especially for locally advanced NSCLC and SCLC( 11 ). It works by inducing DNA damage through ionizing radiation with mostly off-target effects and radiation-induced pneumonitis( 16 , 17 ). PTT is a non-invasive approach that utilizes light-absorbing agents (photothermal agents, PTAs) to convert NIR light into heat, inducing localized tumor cell ablation. This method typically uses plasmonic nanoparticles as a medium, which, due to their plasmonic surface properties, generate cytotoxic heat by absorbing an NIR laser at 808 nm, heating the body much more than its surroundings. Irradiating the nanoparticle with the 808 nm laser at a certain power causes its temperature to rise rapidly; however, the surrounding environment, which includes water and other organic substances in the cells, barely changes its temperature and is only affected by the heat from the usually metallic nanoparticle. The generated heat can effectively damage and locally treat sensitive tumor cells. This differential temperature rise is caused by the metallic and non-metallic properties of the nanoparticle and the surrounding cellular structure. Furthermore, with this treatment method, the location of the laser irradiation can be freely selected, limiting the therapeutic effect to the desired point( 7 – 10 ). However PTT, relying only on photothermal agents, has limitations in fully eradicating cancer cells( 21 ). Due to light absorption and scattering, deeper tumor tissues receive less light penetration, reducing the efficacy of PTT( 22 ). To address these challenges, researchers have integrated PTT with other treatment methods to enhance its effectiveness. One particularly promising strategy involves the co-delivery of anticancer drugs alongside photothermal agents. It has been shown to increase the cytotoxicity of some chemotherapeutic agents( 23 , 24 ). Nowadays, various nanoscale materials have been developed to increase the temperature at targeted sites through heat absorption( 25 – 27 ). Elevated temperature can enhance the toxic effects of some chemotherapeutic agents. Therefore, treatment in which the photosensitizer is delivered to the targeted site along with the drug appears to be significantly more effective in reducing the side effects of the chemotherapeutic agent and enhancing its effect in tumor tissue.( 10 , 28 ) Nanoparticles are typically smaller than a few hundred nanometers, comparable to large biomolecules such as enzymes, receptors, and antibodies. With a size approximately one hundred to ten thousand times smaller than that of human cells, these nanoparticles can enable unprecedented interactions with biomolecules both on the surface and inside cells. They are also easily taken up by cancer cells by the way of endocytosis( 5 , 29 ). They have the potential to revolutionize cancer diagnosis and treatment. In recent years, more and more studies have focused on gold nanoparticles for cancer treatment, as their inherent optical properties for converting NIR light into heat have been an indicator( 30 ). Recent studies confirm the numerous advantages of gold nanoparticles over various nanomaterials. This is primarily due to optimized protocols for producing gold nanoparticles in numerous sizes and shapes with unique properties. The surface of the nanoparticles can be modified with various compounds and adapted to any medical purpose( 23 , 31 ). Gold nanoparticles do not react strongly with organic materials and are therefore significantly more efficient than some other nanoparticles such as silver nanoparticles( 32 ). Various types of gold nanoparticles are used, including gold nanorods, nanocages, nanostars, nanocubes and nanospheres. Gold nanorods (AuNRs) particularly have garnered significant attention for simultaneous cancer therapy because of their distinctive characteristics, including high biocompatibility, controllable size, adjustable surface plasmon resonance (SPR), efficient photothermal conversion, and straightforward surface modification( 33 , 34 ). Nevertheless, AuNRs may aggregate within the tumor microenvironment, leading to a decline in their optical properties and reduced effectiveness of photothermal therapy( 35 ). Therefore, modifying the surface of AuNRs with non-toxic, biocompatible stabilizers is essential to enhance their stability and improve the efficacy of photothermal treatment( 36 – 42 ). The AuNRs have a large surface area for drug loading, conjugation, or binding of selected genes or biological entities, thereby improving the solubility, stability, and pharmacokinetics of drug( 17 ). DOX is a valuable anticancer drug for hematological and solid tumors( 14 ). It is considered one of the most effective chemotherapeutic agents and is used as the drug of choice for many types of cancer( 1 , 43 ). Given the above points and the importance of combined treatment strategies, we decided to investigate the effects of AuNRs, laser, and DOX individually and in combination in human lung tissue cell lines. To determine the most effective method, we monitored cell apoptosis by evaluating the expression profile of key genes and the tunneling assay. 2. Results When AuNRs@S-β-CD was present in the culture medium, laser irradiation took an average of 40 seconds until the culture medium temperature reached 47°C. However, under DOX (0.078) + AuNRs@S-β-CD conditions, laser irradiation took longer, approximately 50 seconds. After laser irradiation of the DOX(0.078) + AuNRs@S-β-CD-containing culture medium, the temperature rise rate approximately doubled in subsequent irradiations. Figure 1 illustrates the events under above mentioned conditions. In continue, we monitored the gene expression of apoptosis key parameters, such as caspase 3, 8, and 9 in different combinatory groups (Fig. 2 ). The CASP3 gene expression under AuNRs@S-β-CD and laser as well as PTT (AuNRs@S-β-CD + laser) is lower than under control conditions. However, DOX (1.307) increases CASP3 expression compared to the control. The combination DOX (0.078) + AuNRs@S-β-CD shows expression at the same level as the control. The increase in expression of this gene when cells are treated with DOX (1.307) + laser is greater than under control conditions, but less than under DOX (1.307). CASP3 expression under chemo-photothermia treatment (DOX (0.078) + AuNRs@S-β-CD + laser) is increased compared to the control during the first 40 seconds of irradiation, when DOX release begins and is not yet complete. However, a decrease in expression below the control level is observed during the 50 seconds of irradiation, when DOX is completely released. The expression changes are statistically significant with p < 0.05. The CASP8 gene expression did not differ significantly between AuNRs@S-β-CD and laser treatments compared to the control. Treatment with DOX (1.307) + laser decreased CASP8 expression, and treatment with DOX, DOX(0.078) + AuNRs@S-β-CD, and AuNRs@S-β-CD + laser increased the expression of this gene compared to the control. Chemo-photothermia treatment (DOX(0.078) + AuNRs@S-β-CD + laser) did not significantly change CASP8 expression compared to the control during the first 40 seconds of irradiation, when DOX release began and was not complete. However, after 50 seconds of laser irradiation and complete release of DOX from the nanoparticles, a very significant increase in the expression of this gene was achieved. The expression changes were statistically significant at the P < 0.05 level. The CASP9 gene expression shows that treatment with DOX(1.307) increased expression of this gene the most compared to the control. Subsequently, AuNRs@S-β-CD increased expression of the CASP9 gene compared to the control. The binary combinations DOX(1.307) + laser, DOX(0.078) + AuNRs@S-β-CD, and AuNRs@S-β-CD + laser increased expression of this gene by the same amount compared to the control. The laser decreased expression of the CASP9 gene compared to the control. Chemo-photothermia treatment (DOX(0.078) + AuNRs@S-β-CD + laser) did not significantly change CASP9 expression compared to the control during the first 40 seconds of irradiation, when the DOX drug release began and was still ongoing. However, after 50 seconds of laser irradiation and complete release of DOX from the nanoparticle, a decrease in expression of this gene was observed. Expression changes are statistically significant at a level of p < 0.05. TUNNEL assay The results of the TUNEL assay in Fig. 3 show that the level of apoptosis in cells treated with AuNRs@S-β-CD is equivalent to that in the control group, indicating that AuNRs@S-β-CD alone had no effect on cell apoptosis. The apoptosis intensity under laser treatment and PTT(AuNRs@S-β-CD + laser) is almost the same and slightly higher than under the control condition. DOX (1.307) induced less than 40% apoptosis. Thus, DOX (1.307) only resulted in a 20% increase in apoptosis compared to the control group. However, laser irradiation with DOX resulted in an increase in apoptosis, increasing apoptosis by 30% compared to the control group. The DOX (0.078) + AuNRs@S-β-CD condition at acidic pH of the cancer cell induced the release of DOX and significantly increased apoptosis compared to the control. Finally, in the chemo-photothermia treatment (DOX(0.078) + AuNRs@S-β-CD + laser), 50 seconds of laser irradiation contributed to the complete release of 0.078 µM DOX from gold nanoparticles and increased the amount of apoptosis by 60% with a synergistic effect. This value represents a very good result in the field of targeted therapy and at a dose much lower than the IC50 concentration of DOX. Numerical data in the form of a graph facilitates the comparison of these treatments. Western Blot Results We examined three types of caspase proteins. Caspase proteins exist in two forms: the precursor form (procaspase) and the active form. The results are obvious in Fig. 4 . Caspase-8 Protein As Its obvious in Fig. 4 (A,C) the 57 kDa bands represent the uncleaved bands and the procaspase state. To activate this protein, cleavage occurs, forming the caspase-8 protein in smaller, lower molecular weight forms. Due to their lower weight, the active caspase fragments fall further down the gel and are visible at a lower level than the 57 kDa procaspase-8. The cleaved and active caspase-8 proteins have two forms, 43 kDa and 18 kDa, both of which play a functional role in apoptosis. The greatest increase and activation of caspase-8 protein were observed in DOX(0.078) + AuNRs@S-β-CD and chemo-photothermia (DOX(0.078) + AuNRs@S-β-CD + laser) treatments. Almost all of the protein in the cell was converted into the active 43 kDa and 18 kDa forms, and its amount was increased compared to the control. Under control conditions, the active 43 kDa form was observed, but the active 18 kDa form was absent. In addition, a large amount of this protein was observed in the inactive 57 kDa form. In AuNRs@S-β-CD treatment, there was no active form, and even the amount of this protein was lower than in the control. In laser treatment, both the active 43 kDa and 18 kDa forms were observed, but some amounts of the inactive 57 kDa form were also observed, indicating incomplete activation of this protein. During DOX(1,307) treatment, both active forms were observed, but the inactive 57 kDa form remained. Treatment with DOX(1,307) + Laser shows great similarity to DOX(1,307). PTT (AuNRs@S-β-CD + laser) shows an increase in the amount of caspase-8 protein, but the extent of its activation is lower in the two forms (43 kDa and 18 kDa) than in DOX(1,307). Caspase-3 protein As It is pointed at Fig. 4 (A,B) the 35 kDa bands are uncleaved bands and represent the procaspase state. The cleaved and active caspase-3 proteins exhibit two forms (19 kDa and 17 kDa), both of which play a functional role in apoptosis. The greatest increase and activation of caspase-3 protein were observed in DOX(0.078) + AuNRs@S-β-CD and chemo-photothermal (DOX(0.078) + AuNRs@S-β-CD + Laser) treatments. Almost all of the protein in the cell was converted to the active forms of 19 kDa and 17 kDa, and its amount was significantly increased compared to the control. Under control conditions, a portion of this protein was observed in the inactive form of 35 kDa. No active form was observed in AuNRs@S-β-CD treatment. In laser treatment, both the active forms were observed, but some amounts of the inactive form of 35 kDa were also observed. When treated with DOX (1,307), both active forms are visible, but the inactive 35 kDa form is still visible. Treatment with DOX (1,307) + laser shows complete activation of caspase-3 compared to DOX (1,307). PTT (AuNRs@S-β-CD + laser) results in conditions that are almost identical to those for DOX(1,307). Caspase-9 protein As Its obvious in Fig. 4 (A,D) the 47 kDa bands are uncleaved and represent the procaspase state. The active caspase-9 fragments fall deeper into the gel and are visible at a lower level than the 47 kDa procaspase-9. The cleaved and active caspase-9 proteins exhibit two forms of 37 kDa and 35 kDa, both of which play a functional role in apoptosis. The highest increase and activation of caspase-9 protein were observed in DOX(0.078) + AuNRs@S-β-CD and chemo-photothermia (DOX(0.078) + AuNRs@S-β-CD + laser) treatments. Almost all of the protein in the cell was converted to the active form of 37 kDa and 35 kDa, and its amount was significantly increased compared to the control. However, a very small amount of the inactive form of 47 kDa was also observed. Under control conditions, part of this protein was present in the inactive form of 47 kDa. In AuNRs@S-β-CD treatment, there was no active form, and its amount was even reduced compared to the control. In lase treatment, both the active forms of 37 kDa and 35 kDa were observed. 3. Discussion Despite initial responsiveness to chemotherapy, a substantial proportion of lung cancer patients experience tumor relapse due to acquired resistance-particularly against agents like DOX( 19 ). Mechanistically, resistance often results from enhanced drug efflux, impaired nuclear accumulation, or dysregulation of apoptotic pathways. In this context, innovative strategies are required to enhance drug delivery and therapeutic efficacy while minimizing systemic toxicity( 20 ). Our results demonstrate that the chemophotothermal strategy combining low-dose DOX (0.078 µM), gold nanorods (AuNRs@S-β-CD s), and 808 nm laser irradiation significantly enhances apoptosis in A549 lung cancer cells. The TUNEL assay confirmed up to a 60% apoptosis rate , far exceeding the ~ 15% baseline in controls and even outperforming high-dose DOX (1.307 µM), which induced only 37% apoptosis. This efficacy at sub-IC50 DOX concentration underscores the potential of nanoparticle-assisted delivery and localized hyperthermia. Mechanistically, the observed effect is driven by synergistic activation of both the extrinsic (caspase-8) and intrinsic (caspase-9) apoptotic pathways( 44 ). Gene expression and Western blot analyses revealed significant cleavage of procaspase-8 into its active 43 and 18 kDaa forms, accompanied by activation of caspase-3 and caspase-9. These results suggest that laser-mediated heating promotes rapid DOX release from AuNRs@S-β-CD s, leading to increased intracellular accumulation and bypassing P-glycoprotein-mediated efflux. This, in turn, overcomes cellular resistance mechanisms and enables effective induction of apoptosis( 45 ). Interestingly, AuNRs@S-β-CD s alone had no impact on apoptosis, and laser irradiation alone induced only modest effects. However, when DOX was combined with laser irradiation, a notable increase in apoptosis (47%) was observed likely due to enhanced membrane permeability and ROS generation( 46 – 48 ). The highest caspase-8 gene expression (~ 20-fold) occurred under the triple combination treatment, indicating robust activation of the death receptor-mediated pathway. These findings align with previous reports that photothermal stimulation facilitates endosomal escape and intracellular drug release. Notably, our data reveal that chemo-photothermal therapy not only improves DOX efficacy but also reprograms apoptotic signaling to overcome resistance in A549 cells, which are known to harbor KEAP1 mutations associated with elevated NRF2 activity and drug efflux( 49 ). While the results are promising, it is important to acknowledge limitations. The current study is confined to in vitro models, and further validation in animal models is essential to assess pharmacokinetics, bio-distribution, and potential off-target effects. Additionally, the limited penetration depth of NIR light (~ 1–2 cm) poses a challenge for treating deep-seated lung tumors. Integration with endoscopic laser delivery or fiber optics may offer solutions in clinical translation. In summary, our results support the application of gold nanorod-assisted chemo-photothermal therapy as an effective and targeted approach to enhance apoptosis in drug-resistant lung cancer cells. This strategy allows for reduced chemotherapy dosage, localized action, and dual-pathway apoptotic activation—making it a strong candidate for further preclinical development. 4. Conclusion Despite advancements in conventional lung cancer therapies, significant limitations persist, particularly in advanced-stage and resistant disease. Chemo-Photothermal therapy represents a promising alternative, offering high precision and synergy with existing modalities. However, significant challenges such as deep tissue delivery, biocompatibility, and clinical validation must be overcome. Continued research, especially in integrating PTT with multimodal therapies and imaging-guided platforms, could position PTT as a transformative tool in the lung cancer therapeutic arsenal. Materials and Methods Materials Cetyltrimethylammonium bromide (CTAB), sodium borohydride (NaBH 4 ), L-ascorbic acid, Silver Nitrate (AgNO 3 ), Gold (III) chloride solution (HAuCl 4 .3H 2 O), β-cyclodextrin (β-CD), p-toluenesulfonyl chloride (TsCl), and thiourea were purchased from Sigma-Aldrich. Deionized water, Chloroform, Ethanol, Trizol reagent, DEPC-treated water, DMEM cell culture medium, Fetal bovine serum (FBS), Penicillin-streptomycin, Doxorubicin (Cell culture Solarbio), cDNA synthesis kit (Yekta Tajhiz), SYBR green, DMSO (for cell culture), Trypsin-EDTA (0.25%), Phosphate-buffered saline (PBS), Tris buffer, TUNEL Assay kit (Roche), DAPI (9542D-Sigma), Sodium deoxycholate, NaCl, EDTA, HCl, Phosphoric acid, Coomassie Blue G250, NP-40, Triton, APS (Ammonium Persulfate), Bromophenol blue, β-mercaptoethanol, Distilled water, Glycerol, PVDF membrane, Bis-acrylamide, Acrylamide, Tetramethylethylenediamine (TEMED), Caspase-8 (1C12) antibody, Caspase-3 (D3R6Y) Rabbit mAb, Actin (2A3): sc-517582, Donkey anti-goat IgG-HRP, Caspase-9 antibody (human-specific), β-Actin (2A3): sc-517582،Caspase-3 (D3R6Y) Rabbit mAb ،Caspase-8 (1C12) Mouse mAb, ECL advanced reagents, Tween 20 (0.1% v/v). Human lung cancer cell line A549 was obtained from the Pasteur Institute of Iran. Methods Synthesis of AuNRs@S-β-CD-DOX Nanocomposite Gold nanorods (AuNRs) were synthesized via a seed-mediated growth method. Briefly, gold seed particles were prepared by reducing HAuCl 4 with NaBH 4 in the presence of CTAB, followed by the addition of the seed solution to a growth solution containing HAuCl 4 , CTAB, AgNO 3 , and ascorbic acid. The resulting AuNRs were purified by centrifugation. Mono-6-thio-β-cyclodextrin (β-CD-SH) was synthesized in a multi-step process: β-cyclodextrin was first functionalized with p-toluenesulfonyl chloride (β-CD-OTs), followed by nucleophilic substitution with thiourea and subsequent hydrolysis to yield β-CD-SH. The AuNRs were then functionalized with β-CD-SH by incubating the AuNRs with the thiolated β-cyclodextrin overnight. The resulting AuNRs@S-β-CD nanocomposite was purified via centrifugation to remove excess β-CD-SH. This functionalization step provides a platform for further drug loading, such as doxorubicin (DOX), leveraging the host–guest interaction capability of β-cyclodextrin for targeted drug delivery applications( 50 ). Fiber coupled diode laser In this study, we employed fiber-coupled diode lasers with a nominal output power of 15 W each. To ensure experimental safety and prevent potential damage to the equipment, two identical lasers were used. Each laser was operated at an output power of approximately 8 W. The emission wavelength was 808 nm, and opto-mechanical components were utilized to direct the laser beams into the samples. The lasers were positioned above the samples so that their beams were aligned to converge precisely at a single focal point at the bottom of the sample container. Prior to the final experiments, the temperature of the samples was measured using a digital thermocouple thermometer. Care was taken to prevent the laser beam from directly hitting the sensor head, which could result in artificially elevated temperature readings. A total laser power of 16 W was delivered to each sample, as confirmed by a power meter, and we ensured that this same power level was consistently applied in all irradiation procedures. The lasers were actively cooled using water circulation and a chiller system, maintaining the laser body at approximately 4°C. Cell Culture The A549 cell line was obtained from the cell bank of the Pasteur Institute of Iran. For all experimental conditions discussed, the cells were cultured in a 5% carbon dioxide incubator at 95% humidity, using DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. A total of 50,000 A549 cells were seeded in each well of a 12-well plate and divided into 8 treatment groups. The treatment groups were as follows: control (cont), gold nanorods modified with β-cyclodextrin (AuNRs@S-β-CD ), NIR laser 808nm (laser), doxorubicin (DOX(1.307)), doxorubicin-loaded gold nanorods (DOX(0.078) + AuNRs@S-β-CD), PTT with gold nanorods + NIR laser 808 nm (AuNRs@S-β-CD + laser), doxorubicin + NIR laser 808 nm (DOX(1.307) + laser), and chemo-photothermal treatment with doxorubicin-loaded gold nanorods + NIR laser 808 nm (DOX(0.078) + AuNRs@S-β-CD + laser). In the referenced study, utilizing data from previous research by Deinavizadeh et al., the cell viability changes under AuNRs@S-β-CD and DOX(0.078) + AuNRs@S-β-CD conditions, before and after laser exposure, showed optimal results at a concentration of 3/125 nm. Consequently, this concentration, which is approximately half of the IC50 for these materials, was selected for gene expression studies and other experiments. Treated cells from the AuNRs@S-β-CD, DOX(1.307), and DOX(0.078) + AuNRs@S-β-CD groups were evaluated after 48 hours of treatment, while the laser, AuNRs@S-β-CD + laser, DOX(1.307) + laser, and DOX(0.078) + AuNRs@S-β-CD + laser groups were examined 20 minutes post-laser exposure. Gene Expression Cells were seeded in 12-well plates according to the mentioned groupings and treated accordingly. The cells were then collected from the plates using Trizol and total RNA was extracted following the manufacturer’s protocols. The quality and quantity of the extracted RNA were assessed using a NanoDrop device based on the 260/280 and 260/230 ratios and were also analyzed on a 1% agarose gel. Subsequently, cDNA was synthesized using the cDNA synthesis kit from Yekta Tajhiz. The primers utilized are listed in the table. Quantitative PCR was performed using the SYBR Green kit from Yekta Tajhiz and the ABI 7500 real-time PCR system (ABI, USA), with the resulting data analyzed using the 2 −ΔCT formula. β-actin amplification was used as the housekeeping gene. Table 1 The primers used as well as their sequences and product lengths are presented here. Gene primer Sequence Annealing temp Length Casp3 Reverse TCTTTAGAAACATCACGCATC 48.5 147 bp Forward AAGCACTGGAATGACATCTC 49.7 Casp8 Reverse CTTTGCTGAATTCTTCATAGTCG 51.7 115 bp Forward ATGGAGAAGAGGGTCATCC 51.1 Casp9 Reverse GGTCTCAACGTACCAGGAGC 55.9 177 bp Forward CCTGGCAGTAACCCCGAG 54.9 B-act Reverse GGGACTTCCTGTAACAACGCA 61 103 bp Forward GAGCATCCCCCAAAGTTCACA 61 Western Blotting The seeded cells were treated according to their respective groups and harvested after 48 hours. They were then lysed using a lysis buffer (Tris-HCl, EDTA, NaCl, Sodium Deoxycholate, SDS, Protease Inhibitor Cocktail, and NP-40 (1% Triton)) to isolate the proteins. Proteins were separated on an SDS-PAGE polyacrylamide gel and subsequently transferred to PVDF membranes using a Western blot apparatus and transfer buffer at 120 mV for one and a half hours. To prevent non-specific reactions, a blocking solution was applied, and the proteins on the PVDF membrane were incubated for one hour with the blocking solution. Following the blocking step, the PVDF membrane was incubated for 16–18 hours at room temperature with the primary antibody. The membrane was then washed three times with TBS-T buffer and incubated for one hour with the secondary antibody at room temperature. Detection was performed using ECL advanced reagents. TUNEL Assay Cells were processed as described previously and treated according to the mentioned groupings after 24 hours. The culture medium was removed, and the cells were incubated and fixed with 4% formaldehyde for 20 minutes at 4°C. The samples were then washed with PBS. The samples were treated with X1 TBS solution (Sigma 5912-T) at boiling point for 20 minutes. After washing with PBS, Triton 3% was added for 30 minutes. To stop the reaction, the samples were exposed to secondary goat serum antibody (10%) for 45 minutes. After washing, the samples were incubated with the primary antibody for 24 hours at 2–8°C. Following additional washing, the samples were incubated with the secondary antibody for 90 minutes at 37°C. Declarations The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this manuscript. Ethics approval and consent to participate All authors agree to the ethics and consent to participate in this article and declare that this submission follows the policies of Scientific Reports . Accordingly, the material is the authors' original work, which has not been previously published elsewhere. The paper is not being considered for publication elsewhere. All authors have been personally and actively involved in substantial work leading to the paper and will take public responsibility for its content. Competing of interests The authors declare that they have no conflict of interest. Funding Declaration This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. It was supported solely by an internal grant from Shahid Chamran University of Ahvaz in the framework of a graduate thesis project. Author Contribution Gh. M. R.: Experimentation, Data Curation, Writing – Original Draft.S.R. Kh.: Project Administration, Funding Acquisition, Methodology, Supervision Conceptualization. H. G.: Co-supervision, Review & Editing.M.S.: Co-supervision, Experimentation, Methodology, Writing – Review & Editing.M.D.: Experimentation, Writing – Review & Editing.A.K.: Co-supervision, Writing-Review & Editing. Acknowledgements The authors would like to thank Shahid Chamran University of Ahvaz for supporting this research Data Availability The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. No specific repository deposition was required as the data fall outside the mandatory categories defined by the journal. References Zhang, X., Xu, B., Ni, J., Xiang, Y. & He, Z. Combined Chemo-and Photothermal Therapies of Non-Small Cell Lung Cancer Using Polydopamine/Au Hollow Nanospheres Loaded with Doxorubicin. Int. J. Nanomed. :9597–9612. (2024). Cersosimo, R. J. Lung cancer: a review. Am. J. health-system Pharm. 59 (7), 611–642 (2002). Bray, F. et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer. J. Clin. 74 (3), 229–263 (2024). Minna, J. D., Roth, J. A. & Gazdar, A. F. Focus on lung cancer. Cancer cell. 1 (1), 49–52 (2002). Luo, H. et al. Lung cancer cellular apoptosis induced by recombinant human endostatin gold nanoshell-mediated near-infrared thermal therapy. Int. J. Clin. Exp. Med. 8 (6), 8758 (2015). Timin, A. S. et al. Calcium carbonate carriers for combined chemo-and radionuclide therapy of metastatic lung cancer. J. Controlled Release . 344 , 1–11 (2022). Hu, J-J., Cheng, Y-J. & Zhang, X-Z. Recent advances in nanomaterials for enhanced photothermal therapy of tumors. Nanoscale 10 (48), 22657–22672 (2018). Nam, J. et al. Chemo-photothermal therapy combination elicits anti-tumor immunity against advanced metastatic cancer. Nat. Commun. 9 (1), 1074 (2018). Tao, Y. et al. Engineered, self-assembled near-infrared photothermal agents for combined tumor immunotherapy and chemo-photothermal therapy. Biomaterials 35 (24), 6646–6656 (2014). Zhang, W. et al. Synergistic effect of chemo-photothermal therapy using PEGylated graphene oxide. Biomaterials 32 (33), 8555–8561 (2011). Van Houtte, P. et al. Postoperative radiation therapy in lung cancer: a controlled trial after resection of curative design. Int. J. Radiation Oncology* Biology* Phys. 6 (8), 983–986 (1980). Blum, R. et al. Impact of positron emission tomography on the management of patients with small-cell lung cancer: preliminary experience. Am. J. Clin. Oncol. 27 (2), 164–171 (2004). Rudin, C. M., Brambilla, E., Faivre-Finn, C. & Sage, J. Small-cell lung cancer. Nat. Reviews Disease Primers . 7 (1), 3 (2021). Pugazhendhi, A., Edison, T. N. J. I., Velmurugan, B. K., Jacob, J. A. & Karuppusamy, I. Toxicity of Doxorubicin (Dox) to different experimental organ systems. Life Sci. 200 , 26–30 (2018). Checinska, A., Hoogeland, B. S., Rodriguez, J. A., Giaccone, G. & Kruyt, F. A. Role of XIAP in inhibiting cisplatin-induced caspase activation in non-small cell lung cancer cells: a small molecule Smac mimic sensitizes for chemotherapy-induced apoptosis by enhancing caspase-3 activation. Exp. Cell Res. 313 (6), 1215–1224 (2007). Srivastava, A. et al. Nanosomes carrying doxorubicin exhibit potent anticancer activity against human lung cancer cells. Sci. Rep. 6 (1), 38541 (2016). Singh, P. et al. Gold nanoparticles in diagnostics and therapeutics for human cancer. Int. J. Mol. Sci. 19 (7), 1979 (2018). Zhang, C. et al. Chemotherapeutic paclitaxel and cisplatin differentially induce pyroptosis in A549 lung cancer cells via caspase-3/GSDME activation. Apoptosis 24 , 312–325 (2019). Chen, C. et al. Autophagy and doxorubicin resistance in cancer. Anti-cancer drugs . 29 (1), 1–9 (2018). Cox, J. & Weinman, S. Mechanisms of doxorubicin resistance in hepatocellular carcinoma. Hepatic Oncol. 3 (1), 57–59 (2016). Cai, Y. et al. Phototherapy in cancer treatment: strategies and challenges. Signal. Transduct. Target. Therapy . 10 (1), 115 (2025). Shen, S., Qiu, J., Huo, D. & Xia, Y. Nanomaterial-enabled photothermal heating and its use for cancer therapy via localized hyperthermia. Small 20 (7), 2305426 (2024). Yang, S-J., Pai, J-A., Shieh, M-J., Chen, J. L. Y. & Chen, K-C. Cisplatin-loaded gold nanoshells mediate chemo-photothermal therapy against primary and distal lung cancers growth. Biomed. Pharmacother. 158 , 114146 (2023). Khafaji, M., Zamani, M. & Vossoughi, M. Iraji zad A. Doxorubicin/cisplatin-loaded superparamagnetic nanoparticles as a stimuli-responsive co-delivery system for chemo-photothermal therapy. Int. J. Nanomed. :8769–8786. (2019). Panikkanvalappil, S. R., Hooshmand, N. & El-Sayed, M. A. Intracellular assembly of nuclear-targeted gold nanosphere enables selective plasmonic photothermal therapy of cancer by shifting their absorption wavelength toward near-infrared region. Bioconjug. Chem. 28 (9), 2452–2460 (2017). Sharifi, M. et al. Plasmonic and chiroplasmonic nanobiosensors based on gold nanoparticles. Talanta 212 , 120782 (2020). Macchi, S. et al. Enhanced photothermal heating and combination therapy of NIR dye via conversion to self-assembled ionic nanomaterials. J. Mater. Chem. B . 10 (5), 806–816 (2022). Ouyang, R. et al. Efficient improvement in chemo/photothermal synergistic therapy against lung cancer using Bi@ Au nano-acanthospheres. Colloids Surf., B . 222 , 113116 (2023). Cai, W., Gao, T., Hong, H. & Sun, J. Applications of gold nanoparticles in cancer nanotechnology. Nanatechnol. Sci. Appl. :17–32. (2008). Shen, S. et al. Targeting mesoporous silica-encapsulated gold nanorods for chemo-photothermal therapy with near-infrared radiation. Biomaterials 34 (12), 3150–3158 (2013). Sztandera, K., Gorzkiewicz, M. & Klajnert-Maculewicz, B. Gold nanoparticles in cancer treatment. Mol. Pharm. 16 (1), 1–23 (2018). Lim, Z-Z-J., Li, J-E-J., Ng, C-T., Yung, L-Y-L. & Bay, B-H. Gold nanoparticles in cancer therapy. Acta Pharmacol. Sin. 32 (8), 983–990 (2011). Ren, R., Xiong, B. & Zhu, J. Surface Modification of Gold Nanorods: Multifunctional Strategies and Application Prospects. Chemistry–A Eur. J. 30 (70), e202400851 (2024). Khalilipour, M., Moshaii, A. & Siampour, H. Controlled electrochemical fabrication of large and stable gold nanorods with reduced cytotoxicity. Sci. Rep. 15 (1), 8171 (2025). Khoshnood, A. et al. Polyethyleneimine/gold nanorods conjugated with carbon quantum dots and hyaluronic acid for chemo-photothermal therapy of breast cancer. J. Mater. Chem. B . 13 (16), 4893–4909 (2025). Deinavizadeh, M. et al. Smart NIR-light and pH responsive doxorubicin-loaded GNRs@ SBA-15-SH nanocomposite for chemo-photothermal therapy of cancer. Nanophotonics 10 (12), 3303–3319 (2021). Deinavizadeh, M. et al. Near-infrared/pH dual-responsive nanosponges encapsulating gold nanorods for synergistic chemo-phototherapy of lung cancer. ACS Appl. Nano Mater. 6 (18), 16332–16342 (2023). Deinavizadeh, M. et al. Synergistic chemo-photothermal therapy using gold nanorods supported on thiol-functionalized mesoporous silica for lung cancer treatment. Sci. Rep. 14 (1), 4373 (2024). Si, S., Majumdar, A. G. & Mohanty, P. S. Silica-Coated Gold Nanorods (AuNR@ SiO2): Synthesis, Properties and Applications in Biomedicine and Beyond. BioNanoScience 15 (1), 1–29 (2025). Alqahtani, H. A. et al. Synergistic Gold Nanorod‐based Chemo‐Photothermal Therapy: A Promising Nanoparticle Approach for Refractory Multidrug‐Resistant Cancer. ChemBioEng Reviews . 11 (4), e202300046 (2024). Bao, Y. & Oluwafemi, A. Recent advances in surface modified gold nanorods and their improved sensing performance. Chem. Commun. 60 (5), 469–481 (2024). Ye, J. et al. Galloyl-boosted gold nanorods: Unleashing personalized cancer immunotherapy potential. J. Colloid Interface Sci. 678 , 272–282 (2025). Cagel, M., Grotz, E., Bernabeu, E., Moretton, M. A. & Chiappetta, D. A. Doxorubicin: nanotechnological overviews from bench to bedside. Drug discovery today . 22 (2), 270–281 (2017). Ferreira, C. G., Span, S. W., Peters, G. J., Kruyt, F. A. & Giaccone, G. Chemotherapy triggers apoptosis in a caspase-8-dependent and mitochondria-controlled manner in the non-small cell lung cancer cell line NCI-H460. Cancer Res. 60 (24), 7133–7141 (2000). Yang, X. et al. NIR-controlled treatment of multidrug-resistant tumor cells by mesoporous silica capsules containing gold nanorods and doxorubicin. ACS Appl. Mater. Interfaces . 13 (13), 14894–14910 (2021). Petrellis, M. C. et al. Laser photobiomodulation of pro-inflammatory mediators on Walker Tumor 256 induced rats. J. Photochem. Photobiol., B . 177 , 69–75 (2017). Liang, W. Z. et al. Selective cytotoxic effects of low-power laser irradiation on human oral cancer cells. Lasers Surg. Med. 47 (9), 756–764 (2015). Yao, C., Rudnitzki, F., Hüttmann, G., Zhang, Z. & Rahmanzadeh, R. Important factors for cell-membrane permeabilization by gold nanoparticles activated by nanosecond-laser irradiation. Int. J. Nanomed. :5659–5672. (2017). Paramasivan, P., Kumar, J. D., Baskaran, R., Weng, C. F. & Padma, V. V. Reversal of doxorubicin resistance in lung cancer cells by neferine is explained by nuclear factor erythroid-derived 2-like 2 mediated lung resistance protein down regulation. Cancer Drug Resist. 3 (3), 647 (2020). Deinavizadeh, M. et al. NIR/pH dual-responsive DOX-loaded AuNRs@ S-β-CD nanocomposite for highly effective chemo-photothermal synergistic therapy against lung cancer cells. J. Phys. Chem. C . 126 (44), 18754–18766 (2022). Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.rar floatimage1.png Cite Share Download PDF Status: Published Journal Publication published 04 Dec, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 15 Sep, 2025 Reviews received at journal 11 Sep, 2025 Reviews received at journal 10 Sep, 2025 Reviews received at journal 08 Sep, 2025 Reviewers agreed at journal 04 Sep, 2025 Reviewers agreed at journal 02 Sep, 2025 Reviewers agreed at journal 02 Sep, 2025 Reviewers invited by journal 02 Sep, 2025 Editor assigned by journal 02 Sep, 2025 Editor invited by journal 02 Sep, 2025 Submission checks completed at journal 30 Aug, 2025 First submitted to journal 30 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7437340","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":511506446,"identity":"7c870efa-f161-4a9c-86b0-46708a675d55","order_by":0,"name":"Ghazalsadat Mousavi Ramhormozi","email":"","orcid":"","institution":"Shahid Chamran University of Ahvaz","correspondingAuthor":false,"prefix":"","firstName":"Ghazalsadat","middleName":"Mousavi","lastName":"Ramhormozi","suffix":""},{"id":511506448,"identity":"b1fe9b8b-b4b5-446c-bd2f-3a4b942e6e71","order_by":1,"name":"Saeid Reza Khatami","email":"","orcid":"","institution":"Shahid Chamran University of Ahvaz","correspondingAuthor":false,"prefix":"","firstName":"Saeid","middleName":"Reza","lastName":"Khatami","suffix":""},{"id":511506449,"identity":"10e496c5-a522-4cf3-84c3-aff16294c4fe","order_by":2,"name":"Hamid Galehdari","email":"","orcid":"","institution":"Shahid Chamran University of Ahvaz","correspondingAuthor":false,"prefix":"","firstName":"Hamid","middleName":"","lastName":"Galehdari","suffix":""},{"id":511506450,"identity":"22ba57c9-b29a-4897-a408-0ca3e04198a9","order_by":3,"name":"Mohammad Sabaeian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYFACHiA2YGDgh/HZiNYi2UCaFpCuA8Q6S7797MEPHwrs8ozPH34mwVBjx8AnTUCzwZm8ZMkZBsnFZjfSzCQYjiUzsPElENDCkGMgzWPAnLjtBg+bBAPbAQY2HkIO639j/PuPQX3i5v4zQC3/iNDCcCPHTJrB4HDiBoYcNgnGNiK0GNx4l2bZY3A8ccaNNGOLxL5kHiIclnv4xo8/1Yn9/Ycf3vjwzU5OvoeQw1BAAjyaRsEoGAWjYBRQBAA5hjmolQ8MQwAAAABJRU5ErkJggg==","orcid":"","institution":"Shahid Chamran University of Ahvaz","correspondingAuthor":true,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Sabaeian","suffix":""},{"id":511506451,"identity":"6c45afa9-2067-4e22-8ab1-0a76d6dc2f7b","order_by":4,"name":"Maryam Deinavizadeh","email":"","orcid":"","institution":"Shahid Chamran University of Ahvaz","correspondingAuthor":false,"prefix":"","firstName":"Maryam","middleName":"","lastName":"Deinavizadeh","suffix":""},{"id":511506452,"identity":"faaffa42-3c1a-4568-bdcd-e5383c06680c","order_by":5,"name":"Alireza Kiasat","email":"","orcid":"","institution":"Shahid Chamran University of Ahvaz","correspondingAuthor":false,"prefix":"","firstName":"Alireza","middleName":"","lastName":"Kiasat","suffix":""}],"badges":[],"createdAt":"2025-08-22 20:53:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7437340/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7437340/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-29565-3","type":"published","date":"2025-12-04T15:57:14+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90905334,"identity":"bad5579b-fb56-4483-aacd-4df0d191e035","added_by":"auto","created_at":"2025-09-09 13:04:04","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":182656,"visible":true,"origin":"","legend":"\u003cp\u003eTime-dependent temperature profile using AuNRs@S-β-CD and in combination with DOX.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/673af1b5d3a924136ce1b6ab.jpeg"},{"id":90904729,"identity":"a2cbbf7b-fdf2-428a-8638-127f7ca5a2a5","added_by":"auto","created_at":"2025-09-09 12:56:04","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":262521,"visible":true,"origin":"","legend":"\u003cp\u003eExpression profiles of key genes in the cell apoptosis show significant variations in different groups.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/2dd3dc745f6116dde19af1e6.jpeg"},{"id":90903227,"identity":"67380ace-73a4-4441-93e5-0020f70ce0a7","added_by":"auto","created_at":"2025-09-09 12:48:04","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":509168,"visible":true,"origin":"","legend":"\u003cp\u003eThe cell apoptosis was monitored in intended groups using TUNNEL assay.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/b2d6052ca72e4ad323fc1c68.jpeg"},{"id":90905335,"identity":"9a8eefaa-060f-4c5e-bc15-54d2e9d7e2d4","added_by":"auto","created_at":"2025-09-09 13:04:04","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":658647,"visible":true,"origin":"","legend":"\u003cp\u003e(A) The picture of gel: (1) Control, (2) laser, (3) DOX (1.307), (4) AuNRs@S-β-CD , (5) DOX (1.307) +laser, (6) DOX (0.78) +AuNRs@S-β-CD , (7) AuNRs@S-β-CD + laser, (8) DOX (0.78) +AuNRs@S-β-CD +laser. (B), (C), and (D): The comparative graph between relative density of cleaved and uncleaved Caspase proteins. (E), (F), and (G): The comparative graph between total densities of Caspases by different treatments.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/82a8e1fbf79108659198e8c5.jpeg"},{"id":97723787,"identity":"ecc9a6ea-7e04-4511-b664-685ceab5f36b","added_by":"auto","created_at":"2025-12-08 16:06:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2397693,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/8713a834-ba3f-4a84-9525-ea8486bbd989.pdf"},{"id":90904724,"identity":"31a4abbc-d200-44af-a547-3b010f616510","added_by":"auto","created_at":"2025-09-09 12:56:04","extension":"rar","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":791039,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.rar","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/791055e6036495f6bfdbd6c6.rar"},{"id":90904725,"identity":"c11b6c1b-a4e3-4dc0-a459-4f33d4975b1b","added_by":"auto","created_at":"2025-09-09 12:56:04","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1019357,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7437340/v1/8af474d367918c78c2292d2c.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Synergistic Chemo-Photothermal Therapy Using Doxorubicin-Loaded Gold Nanorods for Enhanced Apoptosis in Lung Cancer Cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eLung cancer, comprising non-small cell lung cancer (NSCLC, ~\u0026thinsp;85%) and small cell lung cancer (SCLC, ~\u0026thinsp;15%),(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) is the most commonly diagnosed malignancy and a primary cause of cancer death globally.(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) Despite the introduction of novel therapeutics, the 5-year survival rate remains under 20%, largely due to metastatic disease and resistance to therapy(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). The search for more effective and selective treatments has catalyzed interest in nanotechnology-based approaches, such as photothermal therapy (PTT)(\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCurrent strategies for combating lung cancer include standard therapies such as surgery, chemotherapy, radiotherapy, immunotherapy and PTT, which are then evaluated in terms of their effectiveness(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSurgical resection is often the first-line treatment for early-stage NSCLC. However, due to the late onset of the disease, only approximately 20\u0026ndash;25% of patients are eligible for this treatment(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Due to its aggressive nature and early spread, surgery is less effective in SCLC. Limitations of this treatment include the invasive nature and associated morbidity, its unsuitability for metastatic or inoperable tumors, and the risk of postoperative recurrence(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eChemotherapy (e.g., cisplatin, carboplatin, doxorubicin(DOX)) remains standard for both NSCLC and SCLC(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). These drugs damage DNA, triggering apoptosis in rapidly dividing cells. Non-specific toxicity(\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), development of drug resistance and poor efficacy in advanced or resistant cases are the most well-known obstacles(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eRadiotherapy often used in conjunction with chemotherapy (chemo-radiotherapy), especially for locally advanced NSCLC and SCLC(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). It works by inducing DNA damage through ionizing radiation with mostly off-target effects and radiation-induced pneumonitis(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePTT is a non-invasive approach that utilizes light-absorbing agents (photothermal agents, PTAs) to convert NIR light into heat, inducing localized tumor cell ablation. This method typically uses plasmonic nanoparticles as a medium, which, due to their plasmonic surface properties, generate cytotoxic heat by absorbing an NIR laser at 808 nm, heating the body much more than its surroundings. Irradiating the nanoparticle with the 808 nm laser at a certain power causes its temperature to rise rapidly; however, the surrounding environment, which includes water and other organic substances in the cells, barely changes its temperature and is only affected by the heat from the usually metallic nanoparticle. The generated heat can effectively damage and locally treat sensitive tumor cells. This differential temperature rise is caused by the metallic and non-metallic properties of the nanoparticle and the surrounding cellular structure. Furthermore, with this treatment method, the location of the laser irradiation can be freely selected, limiting the therapeutic effect to the desired point(\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eHowever PTT, relying only on photothermal agents, has limitations in fully eradicating cancer cells(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Due to light absorption and scattering, deeper tumor tissues receive less light penetration, reducing the efficacy of PTT(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). To address these challenges, researchers have integrated PTT with other treatment methods to enhance its effectiveness. One particularly promising strategy involves the co-delivery of anticancer drugs alongside photothermal agents. It has been shown to increase the cytotoxicity of some chemotherapeutic agents(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Nowadays, various nanoscale materials have been developed to increase the temperature at targeted sites through heat absorption(\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Elevated temperature can enhance the toxic effects of some chemotherapeutic agents. Therefore, treatment in which the photosensitizer is delivered to the targeted site along with the drug appears to be significantly more effective in reducing the side effects of the chemotherapeutic agent and enhancing its effect in tumor tissue.(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e)\u003c/p\u003e\u003cp\u003eNanoparticles are typically smaller than a few hundred nanometers, comparable to large biomolecules such as enzymes, receptors, and antibodies. With a size approximately one hundred to ten thousand times smaller than that of human cells, these nanoparticles can enable unprecedented interactions with biomolecules both on the surface and inside cells. They are also easily taken up by cancer cells by the way of endocytosis(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). They have the potential to revolutionize cancer diagnosis and treatment. In recent years, more and more studies have focused on gold nanoparticles for cancer treatment, as their inherent optical properties for converting NIR light into heat have been an indicator(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Recent studies confirm the numerous advantages of gold nanoparticles over various nanomaterials. This is primarily due to optimized protocols for producing gold nanoparticles in numerous sizes and shapes with unique properties. The surface of the nanoparticles can be modified with various compounds and adapted to any medical purpose(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Gold nanoparticles do not react strongly with organic materials and are therefore significantly more efficient than some other nanoparticles such as silver nanoparticles(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Various types of gold nanoparticles are used, including gold nanorods, nanocages, nanostars, nanocubes and nanospheres. Gold nanorods (AuNRs) particularly have garnered significant attention for simultaneous cancer therapy because of their distinctive characteristics, including high biocompatibility, controllable size, adjustable surface plasmon resonance (SPR), efficient photothermal conversion, and straightforward surface modification(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Nevertheless, AuNRs may aggregate within the tumor microenvironment, leading to a decline in their optical properties and reduced effectiveness of photothermal therapy(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Therefore, modifying the surface of AuNRs with non-toxic, biocompatible stabilizers is essential to enhance their stability and improve the efficacy of photothermal treatment(\u003cspan additionalcitationids=\"CR37 CR38 CR39 CR40 CR41\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). The AuNRs have a large surface area for drug loading, conjugation, or binding of selected genes or biological entities, thereby improving the solubility, stability, and pharmacokinetics of drug(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). DOX is a valuable anticancer drug for hematological and solid tumors(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). It is considered one of the most effective chemotherapeutic agents and is used as the drug of choice for many types of cancer(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGiven the above points and the importance of combined treatment strategies, we decided to investigate the effects of AuNRs, laser, and DOX individually and in combination in human lung tissue cell lines. To determine the most effective method, we monitored cell apoptosis by evaluating the expression profile of key genes and the tunneling assay.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cp\u003eWhen AuNRs@S-β-CD was present in the culture medium, laser irradiation took an average of 40 seconds until the culture medium temperature reached 47\u0026deg;C. However, under DOX (0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD conditions, laser irradiation took longer, approximately 50 seconds. After laser irradiation of the DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD-containing culture medium, the temperature rise rate approximately doubled in subsequent irradiations. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e illustrates the events under above mentioned conditions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn continue, we monitored the gene expression of apoptosis key parameters, such as caspase 3, 8, and 9 in different combinatory groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eCASP3\u003c/em\u003e gene expression under AuNRs@S-β-CD and laser as well as PTT (AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) is lower than under control conditions. However, DOX (1.307) increases \u003cem\u003eCASP3\u003c/em\u003e expression compared to the control.\u003c/p\u003e\u003cp\u003eThe combination DOX (0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD shows expression at the same level as the control. The increase in expression of this gene when cells are treated with DOX (1.307)\u0026thinsp;+\u0026thinsp;laser is greater than under control conditions, but less than under DOX (1.307).\u003c/p\u003e\u003cp\u003e\u003cem\u003eCASP3\u003c/em\u003e expression under chemo-photothermia treatment (DOX (0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) is increased compared to the control during the first 40 seconds of irradiation, when DOX release begins and is not yet complete. However, a decrease in expression below the control level is observed during the 50 seconds of irradiation, when DOX is completely released. The expression changes are statistically significant with p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eCASP8\u003c/em\u003e gene expression did not differ significantly between AuNRs@S-β-CD and laser treatments compared to the control. Treatment with DOX (1.307)\u0026thinsp;+\u0026thinsp;laser decreased \u003cem\u003eCASP8\u003c/em\u003e expression, and treatment with DOX, DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD, and AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser increased the expression of this gene compared to the control. Chemo-photothermia treatment (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) did not significantly change \u003cem\u003eCASP8\u003c/em\u003e expression compared to the control during the first 40 seconds of irradiation, when DOX release began and was not complete. However, after 50 seconds of laser irradiation and complete release of DOX from the nanoparticles, a very significant increase in the expression of this gene was achieved. The expression changes were statistically significant at the P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 level.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eCASP9\u003c/em\u003e gene expression shows that treatment with DOX(1.307) increased expression of this gene the most compared to the control. Subsequently, AuNRs@S-β-CD increased expression of the \u003cem\u003eCASP9\u003c/em\u003e gene compared to the control. The binary combinations DOX(1.307)\u0026thinsp;+\u0026thinsp;laser, DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD, and AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser increased expression of this gene by the same amount compared to the control.\u003c/p\u003e\u003cp\u003eThe laser decreased expression of the \u003cem\u003eCASP9\u003c/em\u003e gene compared to the control. Chemo-photothermia treatment (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) did not significantly change \u003cem\u003eCASP9\u003c/em\u003e expression compared to the control during the first 40 seconds of irradiation, when the DOX drug release began and was still ongoing. However, after 50 seconds of laser irradiation and complete release of DOX from the nanoparticle, a decrease in expression of this gene was observed. Expression changes are statistically significant at a level of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTUNNEL assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe results of the TUNEL assay in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e show that the level of apoptosis in cells treated with AuNRs@S-β-CD is equivalent to that in the control group, indicating that AuNRs@S-β-CD alone had no effect on cell apoptosis. The apoptosis intensity under laser treatment and PTT(AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) is almost the same and slightly higher than under the control condition. DOX (1.307) induced less than 40% apoptosis. Thus, DOX (1.307) only resulted in a 20% increase in apoptosis compared to the control group. However, laser irradiation with DOX resulted in an increase in apoptosis, increasing apoptosis by 30% compared to the control group.\u003c/p\u003e\u003cp\u003eThe DOX (0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD condition at acidic pH of the cancer cell induced the release of DOX and significantly increased apoptosis compared to the control. Finally, in the chemo-photothermia treatment (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser), 50 seconds of laser irradiation contributed to the complete release of 0.078 \u0026micro;M DOX from gold nanoparticles and increased the amount of apoptosis by 60% with a synergistic effect. This value represents a very good result in the field of targeted therapy and at a dose much lower than the IC50 concentration of DOX. Numerical data in the form of a graph facilitates the comparison of these treatments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern Blot Results\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe examined three types of caspase proteins. Caspase proteins exist in two forms: the precursor form (procaspase) and the active form. The results are obvious in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCaspase-8 Protein\u003c/strong\u003e\u003cp\u003eAs Its obvious in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e(A,C) the 57 kDa bands represent the uncleaved bands and the procaspase state. To activate this protein, cleavage occurs, forming the caspase-8 protein in smaller, lower molecular weight forms. Due to their lower weight, the active caspase fragments fall further down the gel and are visible at a lower level than the 57 kDa procaspase-8. The cleaved and active caspase-8 proteins have two forms, 43 kDa and 18 kDa, both of which play a functional role in apoptosis.\u003c/p\u003e\u003c/p\u003e\u003cp\u003eThe greatest increase and activation of caspase-8 protein were observed in DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD and chemo-photothermia (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) treatments. Almost all of the protein in the cell was converted into the active 43 kDa and 18 kDa forms, and its amount was increased compared to the control. Under control conditions, the active 43 kDa form was observed, but the active 18 kDa form was absent. In addition, a large amount of this protein was observed in the inactive 57 kDa form. In AuNRs@S-β-CD treatment, there was no active form, and even the amount of this protein was lower than in the control. In laser treatment, both the active 43 kDa and 18 kDa forms were observed, but some amounts of the inactive 57 kDa form were also observed, indicating incomplete activation of this protein. During DOX(1,307) treatment, both active forms were observed, but the inactive 57 kDa form remained. Treatment with DOX(1,307)\u0026thinsp;+\u0026thinsp;Laser shows great similarity to DOX(1,307). PTT (AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) shows an increase in the amount of caspase-8 protein, but the extent of its activation is lower in the two forms (43 kDa and 18 kDa) than in DOX(1,307).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCaspase-3 protein\u003c/strong\u003e\u003cp\u003eAs It is pointed at Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e(A,B) the 35 kDa bands are uncleaved bands and represent the procaspase state. The cleaved and active caspase-3 proteins exhibit two forms (19 kDa and 17 kDa), both of which play a functional role in apoptosis. The greatest increase and activation of caspase-3 protein were observed in DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD and chemo-photothermal (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;Laser) treatments. Almost all of the protein in the cell was converted to the active forms of 19 kDa and 17 kDa, and its amount was significantly increased compared to the control. Under control conditions, a portion of this protein was observed in the inactive form of 35 kDa. No active form was observed in AuNRs@S-β-CD treatment. In laser treatment, both the active forms were observed, but some amounts of the inactive form of 35 kDa were also observed. When treated with DOX (1,307), both active forms are visible, but the inactive 35 kDa form is still visible. Treatment with DOX (1,307)\u0026thinsp;+\u0026thinsp;laser shows complete activation of caspase-3 compared to DOX (1,307). PTT (AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) results in conditions that are almost identical to those for DOX(1,307).\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCaspase-9 protein\u003c/strong\u003e\u003cp\u003eAs Its obvious in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e(A,D) the 47 kDa bands are uncleaved and represent the procaspase state. The active caspase-9 fragments fall deeper into the gel and are visible at a lower level than the 47 kDa procaspase-9. The cleaved and active caspase-9 proteins exhibit two forms of 37 kDa and 35 kDa, both of which play a functional role in apoptosis. The highest increase and activation of caspase-9 protein were observed in DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD and chemo-photothermia (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser) treatments. Almost all of the protein in the cell was converted to the active form of 37 kDa and 35 kDa, and its amount was significantly increased compared to the control. However, a very small amount of the inactive form of 47 kDa was also observed. Under control conditions, part of this protein was present in the inactive form of 47 kDa. In AuNRs@S-β-CD treatment, there was no active form, and its amount was even reduced compared to the control. In lase treatment, both the active forms of 37 kDa and 35 kDa were observed.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eDespite initial responsiveness to chemotherapy, a substantial proportion of lung cancer patients experience tumor relapse due to acquired resistance-particularly against agents like DOX(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Mechanistically, resistance often results from enhanced drug efflux, impaired nuclear accumulation, or dysregulation of apoptotic pathways. In this context, innovative strategies are required to enhance drug delivery and therapeutic efficacy while minimizing systemic toxicity(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOur results demonstrate that the chemophotothermal strategy combining low-dose DOX (0.078 \u0026micro;M), gold nanorods (AuNRs@S-β-CD s), and 808 nm laser irradiation significantly enhances apoptosis in A549 lung cancer cells. The TUNEL assay confirmed up to a \u003cb\u003e60% apoptosis rate\u003c/b\u003e, far exceeding the ~\u0026thinsp;15% baseline in controls and even outperforming high-dose DOX (1.307 \u0026micro;M), which induced only 37% apoptosis. This efficacy at sub-IC50 DOX concentration underscores the potential of nanoparticle-assisted delivery and localized hyperthermia.\u003c/p\u003e\u003cp\u003eMechanistically, the observed effect is driven by synergistic activation of both the \u003cb\u003eextrinsic (caspase-8)\u003c/b\u003e and \u003cb\u003eintrinsic (caspase-9)\u003c/b\u003e apoptotic pathways(\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Gene expression and Western blot analyses revealed significant cleavage of procaspase-8 into its active 43 and 18 kDaa forms, accompanied by activation of caspase-3 and caspase-9. These results suggest that laser-mediated heating promotes rapid DOX release from AuNRs@S-β-CD s, leading to increased intracellular accumulation and bypassing P-glycoprotein-mediated efflux. This, in turn, overcomes cellular resistance mechanisms and enables effective induction of apoptosis(\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eInterestingly, AuNRs@S-β-CD s alone had no impact on apoptosis, and laser irradiation alone induced only modest effects. However, when DOX was combined with laser irradiation, a notable increase in apoptosis (47%) was observed likely due to enhanced membrane permeability and ROS generation(\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). The highest caspase-8 gene expression (~\u0026thinsp;20-fold) occurred under the triple combination treatment, indicating robust activation of the death receptor-mediated pathway.\u003c/p\u003e\u003cp\u003eThese findings align with previous reports that photothermal stimulation facilitates endosomal escape and intracellular drug release. Notably, our data reveal that \u003cb\u003echemo-photothermal therapy\u003c/b\u003e not only improves DOX efficacy but also reprograms apoptotic signaling to overcome resistance in A549 cells, which are known to harbor KEAP1 mutations associated with elevated NRF2 activity and drug efflux(\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eWhile the results are promising, it is important to acknowledge limitations. The current study is confined to in vitro models, and further validation in animal models is essential to assess pharmacokinetics, bio-distribution, and potential off-target effects. Additionally, the limited penetration depth of NIR light (~\u0026thinsp;1\u0026ndash;2 cm) poses a challenge for treating deep-seated lung tumors. Integration with endoscopic laser delivery or fiber optics may offer solutions in clinical translation.\u003c/p\u003e\u003cp\u003eIn summary, our results support the application of gold nanorod-assisted chemo-photothermal therapy as an effective and targeted approach to enhance apoptosis in drug-resistant lung cancer cells. This strategy allows for reduced chemotherapy dosage, localized action, and dual-pathway apoptotic activation\u0026mdash;making it a strong candidate for further preclinical development.\u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eDespite advancements in conventional lung cancer therapies, significant limitations persist, particularly in advanced-stage and resistant disease. Chemo-Photothermal therapy represents a promising alternative, offering high precision and synergy with existing modalities. However, significant challenges such as deep tissue delivery, biocompatibility, and clinical validation must be overcome. Continued research, especially in integrating PTT with multimodal therapies and imaging-guided platforms, could position PTT as a transformative tool in the lung cancer therapeutic arsenal.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eMaterials\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCetyltrimethylammonium bromide (CTAB), sodium borohydride (NaBH\u003csub\u003e4\u003c/sub\u003e), L-ascorbic acid, Silver Nitrate (AgNO\u003csub\u003e3\u003c/sub\u003e), Gold (III) chloride solution (HAuCl\u003csub\u003e4\u003c/sub\u003e.3H\u003csub\u003e2\u003c/sub\u003eO), β-cyclodextrin (β-CD), p-toluenesulfonyl chloride (TsCl), and thiourea were purchased from Sigma-Aldrich. Deionized water, Chloroform, Ethanol, Trizol reagent, DEPC-treated water, DMEM cell culture medium, Fetal bovine serum (FBS), Penicillin-streptomycin, Doxorubicin (Cell culture Solarbio), cDNA synthesis kit (Yekta Tajhiz), SYBR green, DMSO (for cell culture), Trypsin-EDTA (0.25%), Phosphate-buffered saline (PBS), Tris buffer, TUNEL Assay kit (Roche), DAPI (9542D-Sigma), Sodium deoxycholate, NaCl, EDTA, HCl, Phosphoric acid, Coomassie Blue G250, NP-40, Triton, APS (Ammonium Persulfate), Bromophenol blue, β-mercaptoethanol, Distilled water, Glycerol, PVDF membrane, Bis-acrylamide, Acrylamide, Tetramethylethylenediamine (TEMED), Caspase-8 (1C12) antibody, Caspase-3 (D3R6Y) Rabbit mAb, Actin (2A3): sc-517582, Donkey anti-goat IgG-HRP, Caspase-9 antibody (human-specific), β-Actin (2A3): sc-517582،Caspase-3 (D3R6Y) Rabbit mAb ،Caspase-8 (1C12) Mouse mAb, ECL advanced reagents, Tween 20 (0.1% v/v). Human lung cancer cell line A549 was obtained from the Pasteur Institute of Iran.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSynthesis of AuNRs@S-β-CD-DOX Nanocomposite\u003c/b\u003e\u003c/p\u003e\u003cp\u003eGold nanorods (AuNRs) were synthesized via a seed-mediated growth method. Briefly, gold seed particles were prepared by reducing HAuCl\u003csub\u003e4\u003c/sub\u003e with NaBH\u003csub\u003e4\u003c/sub\u003e in the presence of CTAB, followed by the addition of the seed solution to a growth solution containing HAuCl\u003csub\u003e4\u003c/sub\u003e, CTAB, AgNO\u003csub\u003e3\u003c/sub\u003e, and ascorbic acid. The resulting AuNRs were purified by centrifugation. Mono-6-thio-β-cyclodextrin (β-CD-SH) was synthesized in a multi-step process: β-cyclodextrin was first functionalized with p-toluenesulfonyl chloride (β-CD-OTs), followed by nucleophilic substitution with thiourea and subsequent hydrolysis to yield β-CD-SH. The AuNRs were then functionalized with β-CD-SH by incubating the AuNRs with the thiolated β-cyclodextrin overnight. The resulting AuNRs@S-β-CD nanocomposite was purified via centrifugation to remove excess β-CD-SH. This functionalization step provides a platform for further drug loading, such as doxorubicin (DOX), leveraging the host\u0026ndash;guest interaction capability of β-cyclodextrin for targeted drug delivery applications(\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFiber coupled diode laser\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn this study, we employed fiber-coupled diode lasers with a nominal output power of 15 W each. To ensure experimental safety and prevent potential damage to the equipment, two identical lasers were used. Each laser was operated at an output power of approximately 8 W. The emission wavelength was 808 nm, and opto-mechanical components were utilized to direct the laser beams into the samples. The lasers were positioned above the samples so that their beams were aligned to converge precisely at a single focal point at the bottom of the sample container.\u003c/p\u003e\u003cp\u003ePrior to the final experiments, the temperature of the samples was measured using a digital thermocouple thermometer. Care was taken to prevent the laser beam from directly hitting the sensor head, which could result in artificially elevated temperature readings. A total laser power of 16 W was delivered to each sample, as confirmed by a power meter, and we ensured that this same power level was consistently applied in all irradiation procedures. The lasers were actively cooled using water circulation and a chiller system, maintaining the laser body at approximately 4\u0026deg;C.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell Culture\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe A549 cell line was obtained from the cell bank of the Pasteur Institute of Iran. For all experimental conditions discussed, the cells were cultured in a 5% carbon dioxide incubator at 95% humidity, using DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. A total of 50,000 A549 cells were seeded in each well of a 12-well plate and divided into 8 treatment groups. The treatment groups were as follows: control (cont), gold nanorods modified with β-cyclodextrin (AuNRs@S-β-CD ), NIR laser 808nm (laser), doxorubicin (DOX(1.307)), doxorubicin-loaded gold nanorods (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD), PTT with gold nanorods\u0026thinsp;+\u0026thinsp;NIR laser 808 nm (AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser), doxorubicin\u0026thinsp;+\u0026thinsp;NIR laser 808 nm (DOX(1.307)\u0026thinsp;+\u0026thinsp;laser), and chemo-photothermal treatment with doxorubicin-loaded gold nanorods\u0026thinsp;+\u0026thinsp;NIR laser 808 nm (DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser).\u003c/p\u003e\u003cp\u003eIn the referenced study, utilizing data from previous research by Deinavizadeh et al., the cell viability changes under AuNRs@S-β-CD and DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD conditions, before and after laser exposure, showed optimal results at a concentration of 3/125 nm. Consequently, this concentration, which is approximately half of the IC50 for these materials, was selected for gene expression studies and other experiments. Treated cells from the AuNRs@S-β-CD, DOX(1.307), and DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD groups were evaluated after 48 hours of treatment, while the laser, AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser, DOX(1.307)\u0026thinsp;+\u0026thinsp;laser, and DOX(0.078)\u0026thinsp;+\u0026thinsp;AuNRs@S-β-CD\u0026thinsp;+\u0026thinsp;laser groups were examined 20 minutes post-laser exposure.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGene Expression\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCells were seeded in 12-well plates according to the mentioned groupings and treated accordingly. The cells were then collected from the plates using Trizol and total RNA was extracted following the manufacturer\u0026rsquo;s protocols. The quality and quantity of the extracted RNA were assessed using a NanoDrop device based on the 260/280 and 260/230 ratios and were also analyzed on a 1% agarose gel. Subsequently, cDNA was synthesized using the cDNA synthesis kit from Yekta Tajhiz. The primers utilized are listed in the table. Quantitative PCR was performed using the SYBR Green kit from Yekta Tajhiz and the ABI 7500 real-time PCR system (ABI, USA), with the resulting data analyzed using the 2\u003csup\u003e\u0026minus;ΔCT\u003c/sup\u003e formula. β-actin amplification was used as the housekeeping gene.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe primers used as well as their sequences and product lengths are presented here.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eprimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAnnealing temp\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eLength\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCasp3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCTTTAGAAACATCACGCATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e48.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e147 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAGCACTGGAATGACATCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e49.7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCasp8\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTTTGCTGAATTCTTCATAGTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e51.7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e115 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATGGAGAAGAGGGTCATCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e51.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCasp9\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGTCTCAACGTACCAGGAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e55.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e177 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTGGCAGTAACCCCGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e54.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eB-act\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGGACTTCCTGTAACAACGCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e103 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGCATCCCCCAAAGTTCACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern Blotting\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe seeded cells were treated according to their respective groups and harvested after 48 hours. They were then lysed using a lysis buffer (Tris-HCl, EDTA, NaCl, Sodium Deoxycholate, SDS, Protease Inhibitor Cocktail, and NP-40 (1% Triton)) to isolate the proteins. Proteins were separated on an SDS-PAGE polyacrylamide gel and subsequently transferred to PVDF membranes using a Western blot apparatus and transfer buffer at 120 mV for one and a half hours. To prevent non-specific reactions, a blocking solution was applied, and the proteins on the PVDF membrane were incubated for one hour with the blocking solution. Following the blocking step, the PVDF membrane was incubated for 16\u0026ndash;18 hours at room temperature with the primary antibody. The membrane was then washed three times with TBS-T buffer and incubated for one hour with the secondary antibody at room temperature. Detection was performed using ECL advanced reagents.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTUNEL Assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCells were processed as described previously and treated according to the mentioned groupings after 24 hours. The culture medium was removed, and the cells were incubated and fixed with 4% formaldehyde for 20 minutes at 4\u0026deg;C. The samples were then washed with PBS. The samples were treated with X1 TBS solution (Sigma 5912-T) at boiling point for 20 minutes. After washing with PBS, Triton 3% was added for 30 minutes. To stop the reaction, the samples were exposed to secondary goat serum antibody (10%) for 45 minutes. After washing, the samples were incubated with the primary antibody for 24 hours at 2\u0026ndash;8\u0026deg;C. Following additional washing, the samples were incubated with the secondary antibody for 90 minutes at 37\u0026deg;C.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this manuscript.\u003c/p\u003e\u003cp\u003e\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\u003cp\u003eAll authors agree to the ethics and consent to participate in this article and declare that this submission follows the policies of \u003cem\u003eScientific Reports\u003c/em\u003e. Accordingly, the material is the authors' original work, which has not been previously published elsewhere. The paper is not being considered for publication elsewhere. All authors have been personally and actively involved in substantial work leading to the paper and will take public responsibility for its content.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCompeting of interests\u003c/h2\u003e\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eDeclaration\u003c/p\u003e\u003cp\u003eThis research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. It was supported solely by an internal grant from Shahid Chamran University of Ahvaz in the framework of a graduate thesis project.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eGh. M. R.: Experimentation, Data Curation, Writing \u0026ndash; Original Draft.S.R. Kh.: Project Administration, Funding Acquisition, Methodology, Supervision Conceptualization. H. G.: Co-supervision, Review \u0026amp; Editing.M.S.: Co-supervision, Experimentation, Methodology, Writing \u0026ndash; Review \u0026amp; Editing.M.D.: Experimentation, Writing \u0026ndash; Review \u0026amp; Editing.A.K.: Co-supervision, Writing-Review \u0026amp; Editing.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e\u003cp\u003eThe authors would like to thank Shahid Chamran University of Ahvaz for supporting this research\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. No specific repository deposition was required as the data fall outside the mandatory categories defined by the journal.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang, X., Xu, B., Ni, J., Xiang, Y. \u0026amp; He, Z. Combined Chemo-and Photothermal Therapies of Non-Small Cell Lung Cancer Using Polydopamine/Au Hollow Nanospheres Loaded with Doxorubicin. \u003cem\u003eInt. J. Nanomed.\u003c/em\u003e :9597\u0026ndash;9612. (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCersosimo, R. J. Lung cancer: a review. \u003cem\u003eAm. J. health-system Pharm.\u003c/em\u003e \u003cb\u003e59\u003c/b\u003e (7), 611\u0026ndash;642 (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBray, F. et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer. \u003cem\u003eJ. Clin.\u003c/em\u003e \u003cb\u003e74\u003c/b\u003e (3), 229\u0026ndash;263 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMinna, J. D., Roth, J. A. \u0026amp; Gazdar, A. F. Focus on lung cancer. \u003cem\u003eCancer cell.\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e (1), 49\u0026ndash;52 (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo, H. et al. Lung cancer cellular apoptosis induced by recombinant human endostatin gold nanoshell-mediated near-infrared thermal therapy. \u003cem\u003eInt. J. Clin. Exp. Med.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (6), 8758 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTimin, A. S. et al. Calcium carbonate carriers for combined chemo-and radionuclide therapy of metastatic lung cancer. \u003cem\u003eJ. Controlled Release\u003c/em\u003e. \u003cb\u003e344\u003c/b\u003e, 1\u0026ndash;11 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu, J-J., Cheng, Y-J. \u0026amp; Zhang, X-Z. Recent advances in nanomaterials for enhanced photothermal therapy of tumors. \u003cem\u003eNanoscale\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (48), 22657\u0026ndash;22672 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNam, J. et al. Chemo-photothermal therapy combination elicits anti-tumor immunity against advanced metastatic cancer. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (1), 1074 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao, Y. et al. Engineered, self-assembled near-infrared photothermal agents for combined tumor immunotherapy and chemo-photothermal therapy. \u003cem\u003eBiomaterials\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e (24), 6646\u0026ndash;6656 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, W. et al. Synergistic effect of chemo-photothermal therapy using PEGylated graphene oxide. \u003cem\u003eBiomaterials\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e (33), 8555\u0026ndash;8561 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Houtte, P. et al. Postoperative radiation therapy in lung cancer: a controlled trial after resection of curative design. \u003cem\u003eInt. J. Radiation Oncology* Biology* Phys.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e (8), 983\u0026ndash;986 (1980).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlum, R. et al. Impact of positron emission tomography on the management of patients with small-cell lung cancer: preliminary experience. \u003cem\u003eAm. J. Clin. Oncol.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e (2), 164\u0026ndash;171 (2004).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRudin, C. M., Brambilla, E., Faivre-Finn, C. \u0026amp; Sage, J. Small-cell lung cancer. \u003cem\u003eNat. Reviews Disease Primers\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e (1), 3 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePugazhendhi, A., Edison, T. N. J. I., Velmurugan, B. K., Jacob, J. A. \u0026amp; Karuppusamy, I. Toxicity of Doxorubicin (Dox) to different experimental organ systems. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cb\u003e200\u003c/b\u003e, 26\u0026ndash;30 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChecinska, A., Hoogeland, B. S., Rodriguez, J. A., Giaccone, G. \u0026amp; Kruyt, F. A. Role of XIAP in inhibiting cisplatin-induced caspase activation in non-small cell lung cancer cells: a small molecule Smac mimic sensitizes for chemotherapy-induced apoptosis by enhancing caspase-3 activation. \u003cem\u003eExp. Cell Res.\u003c/em\u003e \u003cb\u003e313\u003c/b\u003e (6), 1215\u0026ndash;1224 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSrivastava, A. et al. Nanosomes carrying doxorubicin exhibit potent anticancer activity against human lung cancer cells. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e (1), 38541 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh, P. et al. Gold nanoparticles in diagnostics and therapeutics for human cancer. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e (7), 1979 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, C. et al. Chemotherapeutic paclitaxel and cisplatin differentially induce pyroptosis in A549 lung cancer cells via caspase-3/GSDME activation. \u003cem\u003eApoptosis\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 312\u0026ndash;325 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, C. et al. Autophagy and doxorubicin resistance in cancer. \u003cem\u003eAnti-cancer drugs\u003c/em\u003e. \u003cb\u003e29\u003c/b\u003e (1), 1\u0026ndash;9 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCox, J. \u0026amp; Weinman, S. Mechanisms of doxorubicin resistance in hepatocellular carcinoma. \u003cem\u003eHepatic Oncol.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e (1), 57\u0026ndash;59 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai, Y. et al. Phototherapy in cancer treatment: strategies and challenges. \u003cem\u003eSignal. Transduct. Target. Therapy\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e (1), 115 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen, S., Qiu, J., Huo, D. \u0026amp; Xia, Y. Nanomaterial-enabled photothermal heating and its use for cancer therapy via localized hyperthermia. \u003cem\u003eSmall\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (7), 2305426 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang, S-J., Pai, J-A., Shieh, M-J., Chen, J. L. Y. \u0026amp; Chen, K-C. Cisplatin-loaded gold nanoshells mediate chemo-photothermal therapy against primary and distal lung cancers growth. \u003cem\u003eBiomed. Pharmacother.\u003c/em\u003e \u003cb\u003e158\u003c/b\u003e, 114146 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhafaji, M., Zamani, M. \u0026amp; Vossoughi, M. Iraji zad A. Doxorubicin/cisplatin-loaded superparamagnetic nanoparticles as a stimuli-responsive co-delivery system for chemo-photothermal therapy. \u003cem\u003eInt. J. Nanomed.\u003c/em\u003e :8769\u0026ndash;8786. (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanikkanvalappil, S. R., Hooshmand, N. \u0026amp; El-Sayed, M. A. Intracellular assembly of nuclear-targeted gold nanosphere enables selective plasmonic photothermal therapy of cancer by shifting their absorption wavelength toward near-infrared region. \u003cem\u003eBioconjug. Chem.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e (9), 2452\u0026ndash;2460 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSharifi, M. et al. Plasmonic and chiroplasmonic nanobiosensors based on gold nanoparticles. \u003cem\u003eTalanta\u003c/em\u003e \u003cb\u003e212\u003c/b\u003e, 120782 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMacchi, S. et al. Enhanced photothermal heating and combination therapy of NIR dye via conversion to self-assembled ionic nanomaterials. \u003cem\u003eJ. Mater. Chem. B\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e (5), 806\u0026ndash;816 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOuyang, R. et al. Efficient improvement in chemo/photothermal synergistic therapy against lung cancer using Bi@ Au nano-acanthospheres. \u003cem\u003eColloids Surf., B\u003c/em\u003e. \u003cb\u003e222\u003c/b\u003e, 113116 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai, W., Gao, T., Hong, H. \u0026amp; Sun, J. Applications of gold nanoparticles in cancer nanotechnology. \u003cem\u003eNanatechnol. Sci. Appl.\u003c/em\u003e :17\u0026ndash;32. (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen, S. et al. Targeting mesoporous silica-encapsulated gold nanorods for chemo-photothermal therapy with near-infrared radiation. \u003cem\u003eBiomaterials\u003c/em\u003e \u003cb\u003e34\u003c/b\u003e (12), 3150\u0026ndash;3158 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSztandera, K., Gorzkiewicz, M. \u0026amp; Klajnert-Maculewicz, B. Gold nanoparticles in cancer treatment. \u003cem\u003eMol. Pharm.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e (1), 1\u0026ndash;23 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLim, Z-Z-J., Li, J-E-J., Ng, C-T., Yung, L-Y-L. \u0026amp; Bay, B-H. Gold nanoparticles in cancer therapy. \u003cem\u003eActa Pharmacol. Sin.\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e (8), 983\u0026ndash;990 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen, R., Xiong, B. \u0026amp; Zhu, J. Surface Modification of Gold Nanorods: Multifunctional Strategies and Application Prospects. \u003cem\u003eChemistry\u0026ndash;A Eur. J.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e (70), e202400851 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhalilipour, M., Moshaii, A. \u0026amp; Siampour, H. Controlled electrochemical fabrication of large and stable gold nanorods with reduced cytotoxicity. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (1), 8171 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhoshnood, A. et al. Polyethyleneimine/gold nanorods conjugated with carbon quantum dots and hyaluronic acid for chemo-photothermal therapy of breast cancer. \u003cem\u003eJ. Mater. Chem. B\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e (16), 4893\u0026ndash;4909 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeinavizadeh, M. et al. Smart NIR-light and pH responsive doxorubicin-loaded GNRs@ SBA-15-SH nanocomposite for chemo-photothermal therapy of cancer. \u003cem\u003eNanophotonics\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (12), 3303\u0026ndash;3319 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeinavizadeh, M. et al. Near-infrared/pH dual-responsive nanosponges encapsulating gold nanorods for synergistic chemo-phototherapy of lung cancer. \u003cem\u003eACS Appl. Nano Mater.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e (18), 16332\u0026ndash;16342 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeinavizadeh, M. et al. Synergistic chemo-photothermal therapy using gold nanorods supported on thiol-functionalized mesoporous silica for lung cancer treatment. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e (1), 4373 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSi, S., Majumdar, A. G. \u0026amp; Mohanty, P. S. Silica-Coated Gold Nanorods (AuNR@ SiO2): Synthesis, Properties and Applications in Biomedicine and Beyond. \u003cem\u003eBioNanoScience\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (1), 1\u0026ndash;29 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlqahtani, H. A. et al. Synergistic Gold Nanorod‐based Chemo‐Photothermal Therapy: A Promising Nanoparticle Approach for Refractory Multidrug‐Resistant Cancer. \u003cem\u003eChemBioEng Reviews\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e (4), e202300046 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBao, Y. \u0026amp; Oluwafemi, A. Recent advances in surface modified gold nanorods and their improved sensing performance. \u003cem\u003eChem. Commun.\u003c/em\u003e \u003cb\u003e60\u003c/b\u003e (5), 469\u0026ndash;481 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYe, J. et al. Galloyl-boosted gold nanorods: Unleashing personalized cancer immunotherapy potential. \u003cem\u003eJ. Colloid Interface Sci.\u003c/em\u003e \u003cb\u003e678\u003c/b\u003e, 272\u0026ndash;282 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCagel, M., Grotz, E., Bernabeu, E., Moretton, M. A. \u0026amp; Chiappetta, D. A. Doxorubicin: nanotechnological overviews from bench to bedside. \u003cem\u003eDrug discovery today\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e (2), 270\u0026ndash;281 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFerreira, C. G., Span, S. W., Peters, G. J., Kruyt, F. A. \u0026amp; Giaccone, G. Chemotherapy triggers apoptosis in a caspase-8-dependent and mitochondria-controlled manner in the non-small cell lung cancer cell line NCI-H460. \u003cem\u003eCancer Res.\u003c/em\u003e \u003cb\u003e60\u003c/b\u003e (24), 7133\u0026ndash;7141 (2000).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang, X. et al. NIR-controlled treatment of multidrug-resistant tumor cells by mesoporous silica capsules containing gold nanorods and doxorubicin. \u003cem\u003eACS Appl. Mater. Interfaces\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e (13), 14894\u0026ndash;14910 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePetrellis, M. C. et al. Laser photobiomodulation of pro-inflammatory mediators on Walker Tumor 256 induced rats. \u003cem\u003eJ. Photochem. Photobiol., B\u003c/em\u003e. \u003cb\u003e177\u003c/b\u003e, 69\u0026ndash;75 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang, W. Z. et al. Selective cytotoxic effects of low-power laser irradiation on human oral cancer cells. \u003cem\u003eLasers Surg. Med.\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e (9), 756\u0026ndash;764 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYao, C., Rudnitzki, F., H\u0026uuml;ttmann, G., Zhang, Z. \u0026amp; Rahmanzadeh, R. Important factors for cell-membrane permeabilization by gold nanoparticles activated by nanosecond-laser irradiation. \u003cem\u003eInt. J. Nanomed.\u003c/em\u003e :5659\u0026ndash;5672. (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParamasivan, P., Kumar, J. D., Baskaran, R., Weng, C. F. \u0026amp; Padma, V. V. Reversal of doxorubicin resistance in lung cancer cells by neferine is explained by nuclear factor erythroid-derived 2-like 2 mediated lung resistance protein down regulation. \u003cem\u003eCancer Drug Resist.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e (3), 647 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeinavizadeh, M. et al. NIR/pH dual-responsive DOX-loaded AuNRs@ S-β-CD nanocomposite for highly effective chemo-photothermal synergistic therapy against lung cancer cells. \u003cem\u003eJ. Phys. Chem. C\u003c/em\u003e. \u003cb\u003e126\u003c/b\u003e (44), 18754\u0026ndash;18766 (2022).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Photothermal therapy, Doxorubicin, Gold nanorods, Lung cancer, Drug resistance, Apoptosis, Synergistic therapy","lastPublishedDoi":"10.21203/rs.3.rs-7437340/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7437340/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLung cancer remains one of the leading causes of cancer-related mortality worldwide, primarily due to late diagnosis, aggressive progression, and the emergence of therapeutic resistance. Although significant advances have been made in surgery, chemotherapy, radiotherapy, targeted therapy, and immunotherapy, long-term survival remains limited. Photothermal therapy (PTT), a minimally invasive strategy that utilizes near-infrared (NIR) light to generate localized hyperthermia, has emerged as a promising approach to overcome drug resistance and enhance therapeutic outcomes.\u003c/p\u003e\n\u003cp\u003eIn this study, we evaluated a combined therapeutic strategy involving doxorubicin (DOX)-loaded gold nanorods (AuNRs) functionalized with thiolated β-cyclodextrin (AuNRs@S-β-CD-DOX) and NIR laser irradiation (808 nm) in A549 human lung cancer cells. Apoptosis was assessed using gene expression analysis, TUNEL assay, and Western blotting. Mechanistically, this triple therapy activates both intrinsic (caspase-9) and extrinsic (caspase-8) apoptotic pathways, which revealed cleavage of procaspases into active forms (e.g., caspase-3 fragments at 17/19 kDa). Our results demonstrated that the triple combination (DOX 0.078 µM + AuNRs@S-β-CD + laser) significantly enhanced apoptosis—up to 60%—while enabling the use of a DOX concentration far below its IC50 level. This synergistic effect was attributed to improved intracellular delivery of DOX facilitated by AuNRs@S-β-CD-mediated photothermal release and increased membrane permeability induced by laser irradiation. These findings support the potential of chemo-photothermal therapy as a highly effective and targeted strategy against lung cancer.\u003c/p\u003e","manuscriptTitle":"Synergistic Chemo-Photothermal Therapy Using Doxorubicin-Loaded Gold Nanorods for Enhanced Apoptosis in Lung Cancer Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-09 12:47:59","doi":"10.21203/rs.3.rs-7437340/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-15T18:30:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-11T10:41:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-10T23:12:13+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-08T08:00:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"175916636877524144860670701576466155615","date":"2025-09-05T01:19:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"243854773321514916720199327306855702068","date":"2025-09-02T16:48:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"336925366068256249777684422197244979564","date":"2025-09-02T11:37:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-02T11:27:37+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-02T11:24:44+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-09-02T10:32:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-30T17:48:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-08-30T17:45:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"098da476-a7a4-4130-91fa-92943c114c98","owner":[],"postedDate":"September 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":54324581,"name":"Biological sciences/Cancer"},{"id":54324582,"name":"Biological sciences/Drug discovery"},{"id":54324583,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2025-12-08T15:59:47+00:00","versionOfRecord":{"articleIdentity":"rs-7437340","link":"https://doi.org/10.1038/s41598-025-29565-3","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-12-04 15:57:14","publishedOnDateReadable":"December 4th, 2025"},"versionCreatedAt":"2025-09-09 12:47:59","video":"","vorDoi":"10.1038/s41598-025-29565-3","vorDoiUrl":"https://doi.org/10.1038/s41598-025-29565-3","workflowStages":[]},"version":"v1","identity":"rs-7437340","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7437340","identity":"rs-7437340","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}