ID1 protein inhibitor depresses low-oscillating shear stress-mediated EndMT and atherosclerosis by Snail and Wnt/β-catenin signalling pathways

ID1 protein inhibitor depresses low-oscillating shear stress-mediated EndMT and atherosclerosis by Snail and Wnt/β-catenin signalling pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article ID1 protein inhibitor depresses low-oscillating shear stress-mediated EndMT and atherosclerosis by Snail and Wnt/β-catenin signalling pathways Qiu Jun, Xi Yang, Bingyu Wang, Xinyi Sun, Youhong Li, Jiangfang Lian, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3990718/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The lateral pressure exerted by blood on the vessel wall, called low oscillating shear stress(OSS), destroys the endothelial cell barrier function through a process called EndMT and promotes the occurrence of atherosclerosis. The specific mechanism by which OSS regulates EndMT is still unclear. Inhibitor of differentiation 1 (ID1) is controlled by shear stress as an essential force-sensitive factor, and little is known about the effect of ID1 on EndMT in OSS-mediated atherosclerosis. This study investigated the impact of ID1 inhibitors on OSS-mediated EndMT in ApoE−/− mice and TGF-β1-induced human aortic endothelial cells (HAECs). First, we found that the expression of ID1 was down-regulated. At the same time, EndMT and plaque formation occurred in the ligated left common carotid artery (OSS) compared with the unligated right common carotid artery. Then, our results showed that the ID1 inhibitor AGX51 attenuated EndMT in atherosclerosis plaques in OSS mice. However, in vitro studies show that ID1 is upregulated in TGF-β1-treated HAECs and induces EndMT.sh-ID1 or AGX51 to inhibit the EndMT process and restore the migratory ability of endothelial cells. Furthermore, ID1 overexpression promoted the occurrence of EndMT.In addition, inhibition of ID1 may inhibit OSS-induced EndMT by regulating EndMT-specific transcription factors Snail and Wnt/β-catenin signalling pathway in vivo and in vitro by Immunohistochemistry and Western blot. These results suggest that ID1 inhibitors regulate the occurrence and development of low oscillating shear stress-mediated EndMT and atherosclerosis by Ctrlling Snail and Wnt/β-catenin signalling pathways. ID1 AGX51 Endothelial-to-mesenchymal transition low oscillating shear stress Atherosclerosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Atherosclerosis (AS) is a vascular disease that significantly endangers human health. It is an essential pathological condition for vascular diseases such as ischemic heart disease, stroke, and peripheral arterial disease(Mena and Spite, 2021 ).AS mainly occurs in the branches and bends of arteries, where the blood flow is disturbed, and low oscillating shear stress(OSS) is easily generated. This promotes the occurrence and development of AS by inducing inflammation, excessive proliferation, and apoptosis of vascular endothelial cells(Marchio et al., 2019 ),(Libby, 2021 ). Endothelial–mesenchymal transition (EndMT) occurs in vascular endothelial cells under blood flow shear stress, inflammatory factors, high fat, and other factors, damaging the endothelial barrier and function(Sanchez-Duffhues et al., 2016 ).EndMT is a state of transition from endothelial cells to mesenchymal cell phenotype, with down-regulated expression of specific proteins in endothelial cells such as VE-cadherin and CD31 and up-regulated expression of particular proteins in mesenchymal cells such as α-SMA and SM22α characteristics, and changes in cell morphology, proliferation, migration, and collagen synthesis capacity(Li et al., 2018 ). Recent studies have found that EndMT plays an essential role in the pathogenesis of the cardiovascular disease(Qiu et al., 2022 ). The underlying mechanisms of biomechanical induction of EndMT and the contributions of potential regulators of this process require further study. DNA-binding inhibitory proteins, also known as Inhibitors of differentiation proteins (IDs), are members of the helix-loop-helix HLH transcription factor family. Family members have four IDs: ID1, ID2, ID3, and ID4, of which ID1 is the most widely studied protein in this family and runs through the entire development of the embryonic cardiovascular and cerebrovascular system(Zhao et al., 2020 ). Multiple studies have shown that ID1 is regulated by shear stress and may be an essential force-sensitive factor(Zhang et al., 2018 ). However, the changes in endothelial function caused by the regulation of ID1 expression by OSS and whether it will affect the subsequent development of AS plaques have not been reported. Therefore, in this article, we mainly study the effect of low oscillating shear stress on the EndMT state and ID1 expression of endothelial cells in AS and clarify the correlation between the three. In addition, it explains whether ID1 is a critical regulatory molecule in the process of EndMT mediated by the low oscillating shear stress of blood flow and explores its possible mechanism for EndMT.The data from this study provide new insights into the regulation of ID1 in OSS-induced EndMT. 2. Materials and methods 2.1. Materials TGF-β1 was purchased from PeproTech (Rocky Hill, NJ, USA). The anti-ID1 antibody, Anti-α-SMA antibody, Anti-SM22α antibody, Anti-TGF-β1 antibody, Anti-Snail antibody, Anti-Snail antibody and Anti-β-Tubulin were purchased from Abclonal (Wuhan, China). Anti-CD31 antibody was obtained from Cell signalling Technology (Trask Lane Danvers, MA, USA). Anti-β-catenin antibody and Anti-CyclinD1 were purchased from Proteintech (Wuhan, China). Goat anti-mouse and anti-rabbit IgG-HRP antibodies were ordered from Abclonal (Wuhan, China). ID1-specific inhibitor AGX51 was supplied by MedChemExpress(New Jersey, USA). TRIzol reagent, PrimeScript RT Master Mix and SYBR Premix Ex Taq II were purchased from TransGen Biotech(Beijing, China). A PVDF membrane and ECL Exposure Fluid were supplied by Millipore (Billerica, MA, USA). Oil Red O was provided by Solarbio (Beijing, China). ID1 minus expression plasmid༈sh-RNA༉ and ID1 overexpression plasmid༈OE-ID1༉ were purchased by GenePharma (Shanghai, China). Lipofectamine 6000 was supplied by Invitrogen (Carlsbad, CA, USA). Cell culture media and fetal bovine serum (FBS) were purchased from Hyclone (Logan, UT, USA). All other chemicals were ordered from commercial sources. 2.2. Cell culture Human aortic endothelial cells (HAECs) were purchased from the American Type Culture Collection (Beina Chuanglian Biotechnology, China). HAECs were cultured at 37°C, 5% carbon dioxide, and 95% sterile purified air. The medium formulation included 90% RPMI-1640, 10% fetal bovine serum (FBS), and 1% HEPES buffer (100 IU/mL). Cells are cultured at about six passages and passaged after they become confluent. 2.3. Animal experiments 30 male and transgenic ApoE-/- mice (6–8 weeks old) were purchased from the Institute of Animal Modeling, Nanjing University. All animals were numbered sequentially after purchase and randomly divided into cages, with four mice in each cage raised in the Experimental Animal Center of Ningbo University(SYXK(Zhe)2019-0005). One week after adaptive feeding, partial ligation of the left common carotid artery was performed under a microscope, warm before the operation, and abdominal anaesthesia with 4% chloral hydrate. The left muscle tissue was bluntly separated, the common carotid artery was found, the surrounding nerves were isolated, and its four branches were ligated along the common carotid artery, namely the internal carotid artery (ICA) and the external carotid artery (ECA), occipital artery (OA), and superior thyroid artery (STA). 4 − 0 Hanqin medical suture needle ligates the three branches of the left common carotid artery and retains the fourth branch—STA, which can cause disordered blood flow from the origin of the common carotid artery to the unit and can form low-oscillating shear stress (OSS). The right carotid artery was isolated but not ligated. During the operation, the anaesthesia state of the mice was continuously monitored, and the mice were kept warm and given penicillin anti-infective treatment. To examine changes in EndMT and ID1 in atherosclerosis, ApoE-/- mice were fed a diet containing 1% cholesterol and 5% lard (n = 10 for four weeks; n = 10 for 30 weeks). The mice' left common carotid artery (OSS) was taken as the experimental group, and the right common carotid artery was used as the Ctrl group for the experiment. To examine the effect of ID1 on atherosclerotic EndMT, the left common carotid artery was ligated from 10 ApoE-/- mice to establish the OSS mouse model, and they were given a high-fat diet.5 OSS ApoE-/- mice were intraperitoneally injected with the ID1 inhibitor AGX51 at a dose of 30 mg/kg body weight for four weeks as the experimental group. The other 5 OSS ApoE-/- mice were intraperitoneally injected with the same amount of DMSO as the Ctrl group, and the mice were euthanized by excessive chloral hydrate. The samples were taken from the origin of the left common carotid artery at the aortic arch to the root of the bifurcation of the internal and external carotid arteries. After serial sectioning, oil red O, H&E Staining, Masson staining, immunohistochemistry, and immunofluorescence staining were performed. Histochemical staining was performed using Image Pro Plus image analysis software (Bethesda, MD, USA). The experimental protocol complied with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The Laboratory Animal Care Committee of Ningbo University approved it. The blind experiment method was used in all experiments. 2.4. Quantitative real-time PCR After confluency, cells were lysed using TRIzol reagent, RNA was precipitated with isopropanol, washed with alcohol, and reversed to cDNA using a PrimeScript RT kit with gDNA Eraser. Perform 40 cycles of 95°C for 10s, 60°C for the 30s, and 60°C to collect fluorescence signals. Data were calculated by the ΔΔCt method and normalized to GAPDH levels. The primer sequences are shown in Table 1 . Table 1 Primer sequences used for quantitative real-time PCR. Gene Primer Sequence (5’–3’) CD31 F CTCCATCCTGTCGGGTAA R TCATTCACGGTTTCTTCG α-SMA F GGGCATCCACGAAACCACCT R GAGCCGCCGATCCAGACAGA ID1 F GATCATCCTTATACCGACGGG R CGGGGGAGCGCTTTTTCCAGG GAPDH F TCCCTGAGCTGAACGGGAAG R GGAGGAGTGGGTGTCGCTGT 2.5. Western blotting According to the manufacturer's instructions, after the cells are confluent, extract the protein with RIPA lysis buffer containing protease inhibitors, add the protein to a 5× loading buffer, then put it into a 10% SDS-PAGE gel for electrophoresis, and transfer the protein in the gel to methanol for activation On the PVDF membrane, and after blocking with the quick blocking solution, incubated with the primary antibody overnight at four °C on a refrigerator shaker. Membranes were then incubated with HRP-conjugated secondary antibodies and blotted using ECL chemical exposure solution, and band density was analyzed by Image J software (Bethesda, MD, USA). 2.6. Oil Red Stain The 12-week and 36-week ApoE-/- common carotid arteries were taken out, washed with normal saline and then placed in liquid nitrogen for embedding, pre-cooled in a cryostat for 30 min, then sliced, fixed with cold acetone at four °C for 20 min, washed with distilled water, Then add 60% isopropanol for internal immersion, and stain with the prepared modified oil red O staining solution. Nuclei were counterstained with Mayer's hematoxylin staining solution, returned to blue in PBS solution and mounted. Atherosclerotic plaques were observed under a microscope and photographed, and analyzed using Image Pro Plus software (Bethesda, MD, USA). 2.7.H&E Stain Tissue blocks were taken, fixed, embedded in paraffin, and sectioned. The tissue wax block was dewaxed and hydrated with xylene and graded alcohol, the nuclei were stained with hematoxylin, differentiated with the differentiation medium, and the residual dye was washed with distilled water. The cytoplasm was stained with eosin for 30 seconds, washed with tap water, dehydrated with gradient alcohol, transparent with xylene, and finally mounted with neutral gum, and the size of the lesions was statistically analyzed by Image Pro Plus software (Bethesda, MD, USA). 2.8.Masson stain After taking the material, the sections were dewaxed and hydrated, the nucleus was stained with hematoxylin, the muscle fibres were stained with Ponceau magenta, and the weak acid made the colour brighter. Subsequently, blue collagen fibres were dyed with aniline blue and washed with distilled water two times for 1 min. After rapid dehydration with gradient alcohol, the slides were mounted with Image Pro Plus software (Bethesda, MD, USA) for statistical analysis after clearing in xylene. 2.9.Immunohistochemistry and immunofluorescence Formalin-fixed, paraffin-embedded standard carotid artery sections were deparaffinized and rehydrated. Incubate in a 3% H2O2 wet box to remove endogenous peroxidase. After high-pressure repair with sodium citrate, the donkey serum was incubated at room temperature for 2 hours. The primary antibody was refrigerated at four °C overnight, and the secondary antibody was incubated for antigen-antibody reaction. Immunofluorescence should be protected from light. For processing, nuclei were stained with DAPI. The pre-configured DAB chromogenic solution was used for immunohistochemistry. The chromogenic reaction was observed under a microscope, terminated with PBS, stained with hematoxylin, and then dehydrated and transparentized with gradient alcohol xylene. The slides were mounted and photographed under a microscope, immunofluorescence was photographed with a laser confocal microscope (Leica, Germany), and 10× and 63× images were taken, respectively. For immunohistochemistry, 10×, 20×, and 40× photos were taken with an ordinary microscope. Protein expression-positive areas and mean fluorescence intensity were measured using Image-Pro Plus software (Bethesda, MD, USA). 2.10. Transfection experiment According to the manufacturer's requirements, the plasmids are ID1 overexpression Ctrl plasmid, ID1 overexpression plasmid (OE-ID1), ID1 reduction expression Ctrl plasmid (sh-NC), and ID1 reduction expression of three different interference sequences (sh-(1), sh -(2), sh-(3)); according to the manufacturer's instructions, when the density of HAECs reached 60–80% after the medium was changed, Lipofectamine 6000 and plasmid mixture were used to transfer into cells, and 24 h later, fluorescence microscopy (Leica, Germany) Observe the transfection efficiency. 2.11. Scratch assay HAECs were plated in a six-well plate, and the density was Ctrlled at 30%-40%. 10ng/mL TGF-β1 was added to intervene for 72 hours. The overgrown cells were taken under the ultra-clean bench for operation and fixed on the midline of the six-well plate with a ruler. The pipette tip was cross scratched, and the cell debris was washed with PBS, photographed with a microscope (Leica, Germany), and recorded as 0 h at this time. After the photograph was taken, serum-free medium and ID1 expression plasmid and its negative Ctrl were added to continue the culture; 48 hours later, the detection was performed. Cell migration was photographed and analyzed using Image Pro Plus (Bethesda, MD, USA) software. 2.12. Transwell assay Cells were cultured without serum for 12h and routinely digested; 100ul cell suspension was inoculated in the upper chamber of the Transwell chamber, 500ul medium containing 10% FBS was added to the lower section, and 1000ul/well methanol was added after culturing for 48h, and fixed with 4% paraformaldehyde, stained with crystal violet at room temperature for 20 min, washed dry cotton swabs and gently wiped unmigrated cells at the bottom of the upper chamber, observed five visual fields randomly under the microscope, took pictures, and analyzed with Image Pro Plus (Bethesda, MD, USA) software. 2.13. Statistical analysis Data are presented as the mean ± SD from three independent experiments. Two-tailed Student’s t tests and ANOVA were appropriately performed, P < 0.05 was considered statistically significant. All statistical analyses were conducted under the blind condition. 3. Results 3.1 Low oscillating shear stress promotes atherosclerotic plaque formation. To test whether OSS is related to the formation of AS plaques, 6–8 week-old male ApoE-/- mice were partially ligated to the left common carotid artery under a microscope to establish an OSS mice model. High-fat diet feeding for 4 and 30 weeks to develop mice models of early(12 weeks) and late(36 weeks) AS. The right common carotid artery was taken as the Ctrl group, the left common carotid artery was taken as the OSS experimental group, and lipid deposition was measured by Oil Red O staining. Compared with the Ctrl group, the OSS group had significant lipid deposition (P < 0.01), and with the increase in ligation time (36 weeks vs 12 weeks P < 0.05), the lipid deposition in the left carotid artery in the OSS group became more and more significant. In contrast, the contralateral right carotid artery showed no significant change (Fig. 1 A and D). We further performed H&E Staining to detect the size of AS lesions in 12-week-old mice and Masson staining to see whether there was collagen fibre deposition.H&E Staining showed that compared with the Ctrl group, the subendothelial layer in the OSS group was significantly thickened. A large number of foam cells were aggregated in the lesions (indicated by arrows) (P < 0.01)(Fig. 1 B and E). At the same time, Masson staining showed that compared with the Ctrl group, the OSS group had apparent collagen fibres deposition (blue) (P < 0.0001)(Fig. 1 C and F). These results suggest that low oscillating shear stress can promote early and late AS plaque formation. 3.2. In vitro and in vivo, low oscillating shear stress promotes EndMT and regulates ID1 protein expression. To explain whether OSS affects the EndMT process and the expression of ID1 protein, we examined the expression of endothelial and mesenchymal markers in the left and right common carotid arteries using immunohistochemistry. It can be seen from the data that, compared with the Ctrl group, the expression of CD31 in the OSS group showed a decreasing trend (P<0.05)(Figure 2 A). In contrast, the face of the mesenchymal marker α-SMA, compared with the Ctrl group, there was an increasing trend (p < 0.05), and the presentation of TGF-β1 protein, which represents the activation of EndMT, was also significantly increased under the action of OSS (p < 0.05)༈Figure 2 A༉. By staining ID1 protein and counting, it was found that the positive area of ID1 in the left common carotid artery with OSS was lower than that in the Ctrl group and decreased by three times (Fig. 2 A). According to the trend of immunohistochemistry, we used immunofluorescence double staining to observe the degree of EndMT and the expression of ID1 protein in the left and right common carotid arteries of 12 weeks old ApoE-/- mice. Consistent with the immunohistochemical results, compared with the Ctrl group, OSS could promote the accumulation of EndMT-positive cells in the endothelial cell layer, and compared with the Ctrl group, the fluorescence intensity of ID1 protein in the OSS group was significantly decreased (p < 0.05) (Fig. 2 B). Next, we tested whether OSS promotes EndMT and regulates ID1 protein in vitro. According to the above experiments, we found that TGF-β1 is enriched in the OSS region, which is consistent with Kouzbari et al. [13]. Therefore,10ng/mL TGF-β1 was used to intervene HAECs for 72 h in vitro to simulate an OSS environment. It can be found that compared with the Ctrl group, the changes of CD31 and α-SMA in the TGF-β intervention group proved that the EndMT cell model was successfully established, and it was found that after TGF-β treatment, the expression of ID1 was up-regulated compared with the Ctrl group ( P < 0.05)(Fig. 2 C). These findings confirm that OSS promotes EndMT progression and regulates the expression of ID1 protein. 3.3 Effects of ID1 protein inhibitor-AGX51 on the formation of atherosclerotic plaques. To evaluate whether ID1 regulates low-oscillating shear stress-induced AS. First, we injected the ID1 protein inhibitor AGX51 into 12-week-old ApoE-/ -OSS mice and took a right common carotid artery. Immunofluorescence staining showed that AGX51(30 mg/kg) could effectively inhibit the expression of ID1 protein (P < 0.05) (Fig. 3 A and B). We then selected the left common carotid artery to detect atherosclerotic plaque.Our oil red staining showed that injection of AGX51 alleviated OSS-induced AS lipid deposition, and there were significant differences in the lesion area between the AGX51 + OSS group and the OSS group (P<0.0001)(Fig. 3 C and D). And oil red staining results showed that after AGX51 treatment, foam cells were significantly reduced, and the degree of intimal thickening was restored(P<0.01)(Fig. 3 C and D). Through Masson staining experiments, we further confirmed that AGX51 could inhibit OSS-induced collagen fibre deposition (P<0.0001)(Fig. 3 C and D). This indicates that ID1 is involved in OSS-mediated lipid deposition in AS, and inhibition of ID1 expression can effectively inhibit the formation of AS plaques. 3.4 In vitro and in vivo studies examined the effect of ID1 protein inhibitor-AGX51 on EndMT mediated by OSS. To test whether the regulation of ID1 affects OSS-induced EndMT, we first detected the expression of endothelial markers and mesenchymal markers in endothelial cells of partial ligation of the left common carotid artery of mice by immunohistochemistry.ID1 protein inhibitor AGX51 attenuated the expression of α-SMA in the endothelial cell layer while restoring CD31 expression(P<0.05 and P <0.01) (Fig. 4 A). Similarly, we also demonstrated by immunofluorescence staining that the fluorescence intensity of EndMT double-positive in the AGX51-treated group was significantly reduced compared with the OSS group (P<0.05)(Fig. 4 B). Then we further studied the effect of ID1 on EndMT in vitro, treated HAECs with AGX51, screened the concentration that best inhibited ID1, and found that 20uM was the best inhibitory concentration (P<0.01)(Fig. 4 C and D). Therefore, we treated HAECs with 20uM AGX51 and found that AGX51 intervention alone did not affect EndMT.Inhibition of ID1 could inhibit the up-regulation of α-SMA and SM22α but could not restore the downregulation of endothelial cell marker CD31 after 10ng/mL TGF-β1 treatment (Fig. 4 E). The effect of AGX51 on CD31 was inconsistent in vitro and in vivo, possibly due to the single intervention condition at the cellular level in vitro. Therefore, these findings suggest that inhibition of ID1 protein in vitro and in vivo can alleviate some of the OSS-induced EndMT. 3.5 sh-RNA-mediated knockdown of ID1 inhibits EndMT and cell migration ability of HAECs At the pharmacological level, inhibition of ID1 protein inhibits the EndMT process. To further explore the effect of ID1 protein on EndMT, we down-regulated ID1 using sh-RNA-mediated transfection for 48 hours, followed by 10ng/mL TGF-β1 treatment for 72 hours. We transfected HAECs with three ID1-specific sh-RNAs and examined gene knockdown efficiency 48 hours after transfection using qRT-PCR technology. We found that sh-(1) had the most significant knockdown efficiency, reaching 90% at the mRNA level (P<0.01)(Fig. 5 A), which was also validated at the protein level (P<0.01)(Fig. 5 B). Therefore, the following experiments are performed using sh-(1). Compared with the sh-NC group, the sh-ID1 treatment group significantly attenuated TGF-β1-induced EndMT in HAECs.As shown in (Fig. 5 C and E), ID1 knockdown reduced TGF-β1-induced expression of mesenchymal markers α-SMA and SM22α.In contrast, inhibition of ID1 did not restore the decline in the EC marker CD31, consistent with the results generated by our pharmacology experiments. Next, we used Transwell and scratch assays to examine the migration ability of ECs, and sh-ID1 inhibited TGF-β1-induced migration of HEACs(Fig. 5 F, G, H and I). These experimental results show that targeting ID1 protein can inhibit TGF-β1-induced EndMT and restore endothelial cell migration ability. 3.6 Overexpression of ID1 protein promotes EndMT in endothelial cells. To determine whether ID1 is sufficient to drive EndMT in HAECs, we transformed the ID1 overexpression plasmid, cultured it for 72 hours, and examined the overexpression efficiency by qRT-PCR and WB. Cellular ID1 overexpression increased ID1 mRNA levels by approximately 220-fold and protein levels by about 2-fold (P<0.001)(Fig. 6A and C). Indeed, overexpression of ID1 resulted in changes in EndMT-related protein mRNA, as demonstrated in (Fig. 6B), a decrease in the mRNA level of CD31, and an increase in the mRNA level of α-SMA.In addition, WB detection also showed that the expression of CD31 was significantly decreased, while mesenchymal-related proteins such as α-SMA and SM22α were increased(P<0.05)(P<0.01). Interestingly, the EndMT-specific transcription factor Snail and its canonical signalling pathway, Wnt/β-catenin, were also activated in the forced overexpression of ID1(P<0.01) (Fig. 6C and D). In conclusion, the overexpression and inhibition of ID1 further verified that ID1 protein is indeed involved in the EndMT process. Figure 6. ID1 overexpression induces EndMT in HAECs.(Fig. A and C) qRT-PCR and WB analysis of the expression efficiency of ID1 at 72 hours after transfection of the overexpression plasmid into cells;(Fig. B) qRT-PCR detection of CD31 and α-SMA mRNA expression levels;(Fig. D) WB detection of relative protein levels of ID1, CD31, α-SMA, SM22α, Snail and β-catenin 72 hours after HAECs were transfected with ID1 overexpression plasmid. *P < 0.05, **P < 0.01 vs. Ctrl Group.Inhibitor of differentiation 1, ID1、Platelet endothelial cell adhesion molecule-1, CD31、Actin alpha 2, α-SMA、Smooth muscle 22α, SM22α. 3.7 ID1 protein regulates EndMT by regulating EndMT-related transcription factors Snail and Wnt/β-catenin signalling pathway. To investigate the related mechanism of ID1 on EndMT, our above experimental results found that EndMT-specific transcription factor Snail and the canonical Wnt/β-catenin signalling pathway were activated when ID1 was overexpressed. We inhibited ID1 with sh-ID1 also inhibited. Both were detected (Fig. 7 A and B), and the presentation of Snail and β-catenin-related proteins were detected by immunohistochemistry at the animal level (Fig. 7 C and D). The results showed that AGX51 could inhibit OSS-induced activation of Snail and Wnt/β-catenin signalling. In conclusion, we can conclude that ID1 may affect the EndMT process by regulating specific transcription factors Snail and Wnt/β-catenin signalling pathway. Discussion In recent years, several studies have confirmed that EndMT in endothelial cells can promote the progression of AS plaques(Qiu et al., 2022 ),(Wang et al., 2021 ). The role of shear stress in EndMT has received close attention, but the precise mechanism by which OSS activates EndMT and how it affects the progression of AS plaques need to be further elucidated. In this study, we confirmed that OSS promotes the formation of early and lately AS plaques in ApoE-/- mice by oil red staining analysis and immunohistochemical and immunofluorescence staining found that OSS activates the EndMT process and regulates ID1 protein expression. Multiple studies have shown that TGF-β signalling is enriched in the OSS region(Deng et al., 2021 ),(Suwittayarak et al., 2022 ), which is consistent with our immunohistochemical results. We used TGF-β1 to act on HAECs to simulate a low oscillating shear stress environment in vitro. Our results showed that TGF-β1 also activated the EndMT process and up-regulated the expression of ID1 protein.Furthermore, in vivo, the ID1 protein inhibitor AGX51 inhibited OSS-mediated EndMT and subsequent AS progression. The intervention of ID1 expression by molecular and pharmacological methods in vitro can deter EndMT and restore endothelial cell migration ability. On the contrary, ID1 overexpression promotes EndMT in ECs.These studies suggest that ID1 is involved in OSS-mediated EndMT and AS plaque formation. We also found that inhibition of ID1 abrogated low oscillating shear stress-induced EndMT signalling, including activation of specific transcription factors Snail and Wnt/β-catenin signalling. EndMT plays an essential role in various cardiovascular diseases, and its research on the occurrence and development of AS plaques is also deepening(Wang et al., 2021 ). Studies have found that there is a class of cells in the subendothelial layer of human AS plaques that have both endothelial and mesenchymal cell markers, so it is speculated that EndMT is involved in the progression of atherosclerosis(Moonen et al., 2015 ). Several studies have observed endothelial cells with EndMT within AS plaques(Evrard et al., 2016 ), and the loss of endothelial cells on the plaque surface may be related to their migration into the plaque(Chen et al., 2021 ). Vascular endothelial dysfunction is an essential feature of atherosclerosis, and biomechanical factors also play an irreplaceable role in the process of AS(Mazzi et al., 2021 ).In adults, AS lesions are preferentially located at arterial branches and bends, which produce low oscillating shear stress (OSS) on the vessel in the range of 0.5 ± 4 Dyn/cm2.OSS is one of the leading causes of atherosclerotic plaque formation and affects the development of vulnerable plaques, putting plaques at a higher risk of rupture, leading to unstable angina, myocardial infarction, and stroke(Timmins et al., 2017 ). OSS in atherosclerotic areas reduces protective endothelial FGFR1 signalling while activating TGF-β, suggesting that low oscillating shear stress is an activation signal for EndMT(Chen et al., 2015 ).In addition, OSS can also lead to ROS generation and inflammatory signalling during atherosclerosis, both of which promote the development of EndMT(Krenning et al., 2016 ). In this study, we confirmed that OSS could promote the occurrence and development of EndMT and AS plaques. In our present study, we found that OSS induces EndMT in ApoE-/- mice endothelial cells and promotes AS plaque progression but only induces upregulation of the mesenchymal gene α-SMA and preserve the expression of the endothelial gene CD31; that is, ECs are undergoing partial EndMT.This subset of ECs may be more easily reversible under certain circumstances, such as cardiac fibroblasts that can derive endothelial cells after acute ischemic heart injury(Ubil et al., 2014 ). The occurrence and development of AS plaques are more common in arterial bifurcations, and blood flows in disordered areas. We speculate that EndMT is involved, which causes a part of the endothelial layer to be destroyed. The blood continuously contacts the intimal surface lacking endothelial cells, which eventually leads to plaque formation and rupture. Consistent with this, Evrard et al.(Evrard et al., 2016 ) used an endothelial lineage tracing system and found that EndMT caused endothelial cells on the plaque surface to migrate into the plaque interior, further damaging the endothelial cell layer. The above findings suggest that the relationship between OSS, EndMT, and AS can promote EndMT, thereby affecting the occurrence and development of AS. IDs are closely related to tumours and cardiovascular diseases(Ling et al., 2014 ).In 1990, Benezra et al.(Benezra et al., 1990 ) first discovered that ID1 is widely present in mammalian cells and is known for its involvement in inhibiting nuclear transcription factors binding to DNA, including the inhibition of atomic transcription of proto-oncogenes(Jen et al., 1992 ). So there is a lot of research on ID1 protein and cancer. Atherosclerosis is similar to cancer in many ways, including angiogenesis, inflammation, and Epithelial-Mesenchymal Transition(EMT)/EndMT.In addition, several studies have shown that the ID1 protein is an essential force-sensitive factor(Ni et al., 2010 ). Through immunohistochemistry and immunofluorescence staining, we confirmed that the expression of ID1 protein in the common carotid artery of ApoE-/- mice were down-regulated under the action of OSS ensuring that ID1 protein is regulated by shear stress. In cell experiments, HAECs were treated with TGF-β1, and the corresponding changes in the expression of endothelial marker CD31 and mesenchymal marker α-SMA were detected by WB to confirm that the EndMT cell model was successfully established. However, the expression of ID1 protein is up-regulated under the stimulation of TGF-β1.In vitro and in vivo experiments seem to be contradictory. Still, in the complex pathological process of AS, inflammatory factors, oxidized LDL, or stress are all involved in the regulation of ID1, which may counteract part of the induction of ID1 expression by TGF-β. We have reason to believe that ID1 is a force-sensitive factor, and OSS plays a leading role in the regulation of ID1(Gadomski et al., 2020 ),(Edhayan et al., 2016 ),(Qiu et al., 2011 ). This is also an exciting aspect. Later, our experimental group will use a flat flow chamber device to truly explore the effect of OSS on ID1 at the cellular level. According to recent studies, IDs are closely related to the progression of atherosclerosis, and ID inhibitors successfully prevent the passage of atherosclerosis(Avecilla et al., 2017 ).Wojnarowicz et al.(Wojnarowicz et al., 2019 ) found that an ID1 protein inhibitor, AGX51, inhibits retinal pathological neovascularization by inhibiting the Id1-E47 interaction, resulting in ubiquitin-mediated ID1 degradation.Our study found that AGX51 can reduce the occurrence and development of OSS-mediated AS plaques. EndMT is considered a new therapeutic target for AS. Many studies have explored the relationship between ID1 and tumour EMT(Zhao and Liu, 2020 ). However, the regulatory role of ID1 on EndMT in AS has not been reported so far. In the present study, we confirmed that the ID1 protein inhibitor AGX51 inhibited partial OSS-mediated EndMT in the left common carotid artery of ApoE-/- mice using double immunofluorescence staining and immunohistochemistry of CD31 and α-SMA.In vitro, the WB assay found that ID1 silencing by AGX51 or sh-RNA inhibited part of the EndMT process in TGF-β1-treated HAECs.Statins reduce the concentration of CCR-5, the receptor for the proinflammatory cytokine CCL-4, decrease EndMT, and inhibit subsequent AS lesion formation(Yang et al., 2017 ). Increased cell migration ability is a feature of EndMT cells(Phan et al., 2021 ), we evaluated the migration of HAECs using scratch assay and Transwell, and the results showed that inhibition of ID1 protein could attenuate the TGF-β1-induced increase of HAECs migration ability. Paeoniflorin inhibits platelet-derived growth factor-bb (PDGF-BB)-stimulates increased proliferation and migration of human pulmonary artery smooth muscle cells, and inhibits EndMT(Yu et al., 2022 ).In addition, forced overexpression of ID1 can down-regulate the expression of endothelial markers (CD31, VE-cadherin) and up-regulate the expression of mesenchymal markers (α-SMA, SM22α). Further promotion of EndMT.Taken together, ID1 regulates OSS-mediated EndMT and atherosclerosis. The canonical Wnt/β-Catenin signalling pathway acts on the proliferation, differentiation, and migration of cardiomyocytes, cardiac endothelial cells, and primordial valve cells in different stages of cardiac development. It regulates the endothelial-mesenchymal process during the formation of the endocardial cushion—plasma cell transformation (EndMT) process(Tyson et al., 2020 ).ID1 protein is one of the downstream targets of Wnt/β-Catenin signalling regulation, and the positive feedback between ID1 protein and Wnt signalling plays a vital role in cardiac differentiation(Chien et al., 2004 ).Wnt/β-Catenin signalling drives EndMT by increasing Snail expression. Snail, a key transcription factor of EndMT, is regulated by shear stress and is preferentially expressed in the OSS region. Promotes AS plaque progression by promoting endothelial cell proliferation and migration and enhancing the permeability of the endothelial monolayer to macromolecules(Mahmoud et al., 2017 ). We observed upregulation of Snail and β-catenin expression in ApoE-/- mouse common carotid artery endothelial cells and TGF-β1-induced HAECs exposed to OSS, and inhibition of ID1 reduced OSS-mediated Snail and Wnt/β- Activation of Catenin and overexpression of ID1 increased the expression of these EndMT essential signalling pathway proteins. These results suggest that ID1 regulates the OSS-mediated EndMT process by Ctrlling the EndMT key transcription factor Snail and the canonical Wnt/β-Catenin signalling pathway. Taken together, ID1 is involved in OSS-mediated EndMT and the progression of atherosclerosis. Biomechanical factors-induced EndMT, which promotes the development of atherosclerotic plaques, is currently a hotspot.ID1 protein inhibitors reduce the effect of atherosclerotic plaques by inhibiting OSS-mediated Snail and Wnt/β-Catenin signalling pathways and inhibiting EndMT.Research on endogenous EndMT antagonists is still in its infancy, and our study provides valuable information for ID1 inhibitors in treating EndMT and atherosclerosis.ID1 is expected to be a potential therapeutic target for treating AS patients. Declarations Ethics approval and consent to participate The authors hereby agree that the study was conducted after approval by the Ethics Committee of the Animal Laboratory of Ningbo University. Consent for publication All authors consent for publication. Availability of data and materials Requests to access the data should be directed to the corresponding authors. Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding Our study was supported by Project of Zhejiang Medical and Health (Grant No. 2021RC124) Authors' contributions Qiu Jun: Experiment, article writing, data processing, analysis, drawing.Yang Xi: Modified. Wang Bingyu: Drawing, experiment. Sun Xinyi: Investigation, verification, drawing. Li Youhong: Drawing, investigation.Lian Jiangfang: Article writing, editing, funding.Zhou Jianqing: Supervision, writing review and editing. Acknowledgements The animal laboratory of Ningbo University provides us with a platform for mouse breeding and experimentation. References AVECILLA, V., DOKE, M. & FELTY, Q. 2017. Contribution of inhibitor of dna binding/differentiation-3 and endocrine disrupting chemicals to pathophysiological aspects of chronic disease. BioMed research international , 2017. BENEZRA, R., DAVIS, R. L., LOCKSHON, D., TURNER, D. L. & WEINTRAUB, H. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell, 61, 49–59. CHEN, L., WANG, G., HE, J., YANG, X., ZHENG, Z., DENG, Y., LIU, Y., CHEN, D., LIN, R. & WANG, W. 2021. SIRT6 inhibits endothelial-to-mesenchymal transition through attenuating the vascular endothelial inflammatory response. International Immunopharmacology, 101, 108240. CHEN, P.-Y., QIN, L., BAEYENS, N., LI, G., AFOLABI, T., BUDATHA, M., TELLIDES, G., SCHWARTZ, M. A. & SIMONS, M. 2015. Endothelial-to-mesenchymal transition drives atherosclerosis progression. The Journal of clinical investigation, 125, 4514–4528. CHIEN, K. R., MORETTI, A. & LAUGWITZ, K.-L. 2004. ES cells to the rescue. Science, 306, 239–240. DENG, H., MIN, E., BAEYENS, N., COON, B. G., HU, R., ZHUANG, Z. W., CHEN, M., HUANG, B., AFOLABI, T. & ZARKADA, G. 2021. Activation of Smad2/3 signaling by low fluid shear stress mediates artery inward remodeling. Proceedings of the National Academy of Sciences , 118, e2105339118. EDHAYAN, G., OHARA, R. A., STINSON, W. A., AMIN, M. A., ISOZAKI, T., HA, C. M., HAINES, G. K., MORGAN, R., CAMPBELL, P. L. & ARBAB, A. S. 2016. Inflammatory properties of inhibitor of DNA binding 1 secreted by synovial fibroblasts in rheumatoid arthritis. Arthritis research & therapy, 18, 1–12. EVRARD, S. M., LECCE, L., MICHELIS, K. C., NOMURA-KITABAYASHI, A., PANDEY, G., PURUSHOTHAMAN, K.-R., D’ESCAMARD, V., LI, J. R., HADRI, L. & FUJITANI, K. 2016. Endothelial to mesenchymal transition is common in atherosclerotic lesions and is associated with plaque instability. Nature communications, 7, 11853. GADOMSKI, S., SINGH, S. K., SINGH, S., SARKAR, T., KLARMANN, K. D., BERENSCHOT, M., SEAMAN, S., JAKUBISON, B., GUDMUNDSSON, K. O. & LOCKETT, S. 2020. Id1 and Id3 maintain steady-state hematopoiesis by promoting sinusoidal endothelial cell survival and regeneration. Cell reports , 31, 107572. JEN, Y., WEINTRAUB, H. & BENEZRA, R. 1992. Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins. Genes & development, 6, 1466–1479. KRENNING, G., BARAUNA, V. G., KRIEGER, J. E., HARMSEN, M. C. & MOONEN, J.-R. A. 2016. Endothelial plasticity: shifting phenotypes through force feedback. Stem cells international , 2016. LI, Y., LUI, K. & ZHOU, B. 2018. Reassessing endothelial-to-mesenchymal transition in cardiovascular diseases. Nature reviews. Cardiology, 15, 445–456. LIBBY, P. 2021. The changing landscape of atherosclerosis. Nature, 592, 524–533. LING, F., KANG, B. & SUN, X.-H. 2014. Id proteins: small molecules, mighty regulators. Current topics in developmental biology, 110, 189–216. MAHMOUD, M. M., SERBANOVIC-CANIC, J., FENG, S., SOUILHOL, C., XING, R., HSIAO, S., MAMMOTO, A., CHEN, J., ARIAANS, M. & FRANCIS, S. E. 2017. Shear stress induces endothelial-to-mesenchymal transition via the transcription factor Snail. Scientific reports , 7, 3375. MARCHIO, P., GUERRA-OJEDA, S., VILA, J. M., ALDASORO, M., VICTOR, V. M. & MAURICIO, M. D. 2019. Targeting Early Atherosclerosis: A Focus on Oxidative Stress and Inflammation. Oxid Med Cell Longev , 2019, 8563845. MAZZI, V., DE NISCO, G., HOOGENDOORN, A., CAL, K., CHIASTRA, C., GALLO, D., STEINMAN, D. A., WENTZEL, J. J. & MORBIDUCCI, U. 2021. Early atherosclerotic changes in coronary arteries are associated with endothelium shear stress contraction/expansion variability. Annals of Biomedical Engineering, 49, 2606–2621. MENA, H. & SPITE, M. 2021. Proresolving receptor tames inflammation in atherosclerosis. The Journal of clinical investigation, 131. MOONEN, J.-R. A., LEE, E. S., SCHMIDT, M., MALESZEWSKA, M., KOERTS, J. A., BROUWER, L. A., VAN KOOTEN, T. G., VAN LUYN, M. J., ZEEBREGTS, C. J. & KRENNING, G. 2015. Endothelial-to-mesenchymal transition contributes to fibro-proliferative vascular disease and is modulated by fluid shear stress. Cardiovascular research, 108, 377–386. NI, C.-W., QIU, H., REZVAN, A., KWON, K., NAM, D., SON, D. J., VISVADER, J. E. & JO, H. 2010. Discovery of novel mechanosensitive genes in vivo using mouse carotid artery endothelium exposed to disturbed flow. Blood, The Journal of the American Society of Hematology, 116, e66-e73. PHAN, T. H. G., PALIOGIANNIS, P., NASRALLAH, G. K., GIORDO, R., EID, A. H., FOIS, A. G., ZINELLU, A., MANGONI, A. A. & PINTUS, G. 2021. Emerging cellular and molecular determinants of idiopathic pulmonary fibrosis. Cellular and Molecular Life Sciences, 78, 2031–2057. QIU, J., LI, Y., WANG, B., SUN, X., QIAN, D., YING, Y. & ZHOU, J. 2022. The role and research progress of inhibitor of differentiation 1 in atherosclerosis. DNA and Cell Biology, 41, 71–79. QIU, J., WANG, G., ZHENG, Y., HU, J., PENG, Q. & YIN, T. 2011. Coordination of Id1 and p53 activation by oxidized LDL regulates endothelial cell proliferation and migration. Annals of biomedical engineering, 39, 2869–2878. SANCHEZ-DUFFHUES, G., ORLOVA, V. & TEN DIJKE, P. 2016. In Brief: Endothelial-to-mesenchymal transition. The Journal of pathology, 238, 378–80. SUWITTAYARAK, R., KLINCUMHOM, N., NGAOKRAJANG, U., NAMANGKALAKUL, W., FERREIRA, J. N., PAVASANT, P. & OSATHANON, T. 2022. Shear Stress Enhances the Paracrine-Mediated Immunoregulatory Function of Human Periodontal Ligament Stem Cells via the ERK Signalling Pathway. International Journal of Molecular Sciences, 23, 7119. TIMMINS, L. H., MOLONY, D. S., ESHTEHARDI, P., MCDANIEL, M. C., OSHINSKI, J. N., GIDDENS, D. P. & SAMADY, H. 2017. Oscillatory wall shear stress is a dominant flow characteristic affecting lesion progression patterns and plaque vulnerability in patients with coronary artery disease. Journal of The Royal Society Interface, 14, 20160972. TYSON, J., BUNDY, K., ROACH, C., DOUGLAS, H., VENTURA, V., SEGARS, M. F., SCHWARTZ, O. & SIMPSON, C. L. 2020. Mechanisms of the osteogenic switch of smooth muscle cells in vascular calcification: WNT signaling, BMPs, mechanotransduction, and EndMT. Bioengineering, 7, 88. UBIL, E., DUAN, J., PILLAI, I. C., ROSA-GARRIDO, M., WU, Y., BARGIACCHI, F., LU, Y., STANBOULY, S., HUANG, J. & ROJAS, M. 2014. Mesenchymal–endothelial transition contributes to cardiac neovascularization. Nature, 514, 585–590. WANG, B., QIU, J., LIAN, J., YANG, X. & ZHOU, J. 2021. Gut metabolite trimethylamine-N-oxide in atherosclerosis: from mechanism to therapy. Frontiers in cardiovascular medicine, 1560. WOJNAROWICZ, P. M., E SILVA, R. L., OHNAKA, M., LEE, S. B., CHIN, Y., KULUKIAN, A., CHANG, S.-H., DESAI, B., ESCOLANO, M. G. & SHAH, R. 2019. A small-molecule pan-Id antagonist inhibits pathologic ocular neovascularization. Cell reports, 29, 62–75. e7. YANG, Y., LUO, N.-S., YING, R., XIE, Y., CHEN, J.-Y., WANG, X.-Q., GU, Z.-J., MAI, J.-T., LIU, W.-H. & WU, M.-X. 2017. Macrophage-derived foam cells impair endothelial barrier function by inducing endothelial-mesenchymal transition via CCL-4. International journal of molecular medicine, 40, 558–568. YU, M., WU, X., WANG, J., HE, M., HAN, H., HU, S., XU, J., YANG, M., TAN, Q. & WANG, Y. 2022. Paeoniflorin attenuates monocrotaline-induced pulmonary arterial hypertension in rats by suppressing TAK1-MAPK/NF-κB pathways. International Journal of Medical Sciences, 19, 681. ZHANG, K., CHEN, Y., ZHANG, T., HUANG, L., WANG, Y., YIN, T., QIU, J., GREGERSEN, H. & WANG, G. 2018. A novel role of Id1 in regulating oscillatory shear stress-mediated lipid uptake in endothelial cells. Annals of biomedical engineering, 46, 849–863. ZHAO, Y.-X. & LIU, J. 2020. Inhibitor of differentiation 1 (ID1) facilitates the efficacy of sorafenib in non-small cell lung cancer cells through suppressing epithelial to mesenchymal transition. Medical Science Monitor: International Medical Journal of Experimental and Clinical Research, 26, e922148-1. ZHAO, Z., BO, Z., GONG, W. & GUO, Y. 2020. Inhibitor of differentiation 1 (Id1) in cancer and cancer therapy. International journal of medical sciences, 17, 995. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3990718","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":275583778,"identity":"0131bf59-d15f-4921-9e5c-fe52a311ef8e","order_by":0,"name":"Qiu Jun","email":"","orcid":"","institution":"Li Huili Hospital Affiliated to Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Qiu","middleName":"","lastName":"Jun","suffix":""},{"id":275583779,"identity":"cc9b9a32-1182-4066-9186-cafeb67d6f74","order_by":1,"name":"Xi Yang","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Yang","suffix":""},{"id":275583780,"identity":"02641802-3a88-43b3-b05d-c94aad0b7812","order_by":2,"name":"Bingyu Wang","email":"","orcid":"","institution":"Li Huili Hospital Affiliated to Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Bingyu","middleName":"","lastName":"Wang","suffix":""},{"id":275583781,"identity":"26f8b85c-1a07-4275-b524-97f1515bc512","order_by":3,"name":"Xinyi Sun","email":"","orcid":"","institution":"Li Huili Hospital Affiliated to Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Xinyi","middleName":"","lastName":"Sun","suffix":""},{"id":275583782,"identity":"83588637-40d6-47f3-bf3b-df671662c797","order_by":4,"name":"Youhong Li","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Youhong","middleName":"","lastName":"Li","suffix":""},{"id":275583783,"identity":"d4f63b33-9984-411c-87c1-05cfba78d2ce","order_by":5,"name":"Jiangfang Lian","email":"","orcid":"","institution":"Li Huili Hospital Affiliated to Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Jiangfang","middleName":"","lastName":"Lian","suffix":""},{"id":275583784,"identity":"3d4f3273-aa65-4470-bc6d-776946f50aa9","order_by":6,"name":"Jianqing Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIie2QsUrEQBCGNyyk2s21c03OR1hZCCkOX8QmS2ArFcEmcAceHMRO24g+xIEvEBnINYF7AJuAld0+gKAbg3abWAruBzPF8n/szBDi8fxFoC9hG7Vlio94Ril2v1aCqqVyfhNqMal8Q3lJ1e7AjsAZtywetg2klycX0Z7jW9WGUiIjgqyXpy4leGw0gMiv5hjp1BQsTpDXHWn0+cahUDhLrGLnQZYcVy3IBKNMBBt0KuGgXH8pkpdCPW2ZgDGFDQr2inzlZaZ2dEIB0HkKYq/u7S/2yLUEtEfORnZZVPnzC7yv1O2hlcYUdTy7Q+zMeulUhhP0vbZ7/TxlI/GewAwKNRNBj8fj+ad8Ap9KWMxLw/F3AAAAAElFTkSuQmCC","orcid":"","institution":"Li Huili Hospital Affiliated to Ningbo University","correspondingAuthor":true,"prefix":"","firstName":"Jianqing","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2024-02-26 11:00:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3990718/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3990718/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51931317,"identity":"dbe30559-e238-4f9b-875b-bde5395ef813","added_by":"auto","created_at":"2024-03-04 05:37:00","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":770129,"visible":true,"origin":"","legend":"\u003cp\u003eLow oscillating shear stress promotes the progression of atherosclerosis. Male ApoE-/- mice underwent partial ligation of the left common carotid artery and were fed a high-fat diet for four weeks and 30 weeks. (A) Oil red staining analysis of plaque formation in the common carotid artery in the Ctrl and OSS groups (12 weeks, 36 weeks). (B) H\u0026amp;E Staining was used to detect the size of AS lesions (dotted line, the arrow points to foam cells). (C) Collagen fibre deposition size (blue) was detected by Masson staining. (D) IPP6.0 statistical analysis of lipid deposition area, n=3. All data are mean±SD.**P\u0026lt;0.01 vs Ctrl group,*P\u0026lt;0.05 36 weeks OSS group vs 36 weeks Ctrl group or 12 weeks OSS group, Ctrl refers to the Ctrl group, and OSS refers to low oscillating shear stress group.(E and F) IPP6.0 statistical software was used to analyze the lesion size and collagen fibre deposition. **P \u0026lt; 0.01, ****P \u0026lt; 0.0001 vs. Ctrl group.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/d3acf6e6fe2981aec484a3b0.jpg"},{"id":51931319,"identity":"ae974021-1940-4cee-83c0-58bb221dc66a","added_by":"auto","created_at":"2024-03-04 05:37:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":926549,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of OSS on the expression of EndMT and ID1 in ApoE-/- mice and HAECs.(Fig. A) Immunohistochemical analysis of CD31, α-SMA, TGF-β1, and ID1 protein levels in left and right common carotid arteries of high-fat diet ApoE-/- mice for 12 weeks, n=3;(Fig. B) Quantifying endothelial α-SMA by immunofluorescence staining, red: CD31, ID1; green: α-SMA, blue fluorescence: DAPY, n=3. (Fig. C and D) TGF-β1 (10ng/mL) stimulated HAECs for 72h, and quantitative analysis was performed by ImageJ software. All data are mean ± SD, n = 3. *P \u0026lt; 0.05, **P \u0026lt; 0.01,***P \u0026lt; 0.001 vs. Ctrl group.Platelet endothelial cell adhesion molecule-1, CD31、Actin alpha 2,α-SMA、Transforming growth factor-β1, TGF-β1、Inhibitor of differentiation 1, ID1.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/0fc8f1e34ba9fcfffecebfe1.png"},{"id":51931321,"identity":"ba007c40-a632-4354-99a9-57afc04fd4f5","added_by":"auto","created_at":"2024-03-04 05:37:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":548850,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of ID1 protein inhibitor-AGX51 on the formation of atherosclerotic plaques. (A) Tissue immunofluorescence to quantify the expression level of ID1 protein in the common carotid artery. 8-week-old ApoE-/- mice with OSS were injected with ID1 protein inhibitor AGX51 (30 mg/kg) for four weeks and were fed a high-fat diet simultaneously. (B) Statistics for A, n=3;(C) Oil red staining was used to detect lipid deposition (red), H\u0026amp;E Staining was used to see the size of AS lesions (dotted line, the arrow points to foam cells), and Masson staining was used to detect the size of collagen fibre deposition (blue). (D) Statistics for C, n=3.All data are mean ±SD.*P＜0.05 VS.Ctrl group, ****P＜0.0001 VS.OSS group.(E and F) IPP6.0 statistical software was used to analyze the lesion size and collagen fibre deposition. **P \u0026lt; 0.01, ****P \u0026lt; 0.0001 vs. Ctrl group.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/862f182ccfa32b4dd41cfd0f.png"},{"id":51931316,"identity":"2e3f1c54-3867-4f72-b7e8-42441d12f63b","added_by":"auto","created_at":"2024-03-04 05:37:00","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":210431,"visible":true,"origin":"","legend":"\u003cp\u003eThe ID1 protein inhibitor AGX51 attenuates OSS-mediated EndMT.(A) CD31, α-SMA immunohistochemistry, and quantification of each in the common carotid artery of OSS. n=3.(B) CD31 and αSMA immunofluorescence double staining and quantification of each in the common carotid artery of OSS. n=3.(C and D) WB and qPCR screened the best AGX51 inhibitory ID1 protein concentration of 20uM and ImageJ analysis of the bands. (E) The relative protein levels of endothelial cell marker CD31, mesenchymal cell marker α-SMA, and SM22α were assessed by WB, and Tubulin was used as an internal Ctrl to determine the consistency of protein loading.NS: The difference was not statistically significant, *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001 VS OSS+ApoE-/- ,VS sh-NC; #P\u0026lt;0.05, ##P\u0026lt;0.01 VS TGF-β1 treatment group.Platelet endothelial cell adhesion molecule-1, CD31、Actin alpha 2,α-SMA、Smooth muscle 22α, SM22α、Inhibitor of differentiation 1, ID1.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/e28bfd06b24a9e0a053c8d88.jpg"},{"id":51931320,"identity":"ef08674c-4460-4628-b67f-713a3f4de18a","added_by":"auto","created_at":"2024-03-04 05:37:00","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":164860,"visible":true,"origin":"","legend":"\u003cp\u003eRNA-mediated knockdown of ID1 inhibits EndMT and cell migration ability of HAECs.HAECs were transfected with ID1-shRNA or sh-NC for 48 h; cells were stimulated with TGF-β (10 ng/ml) for an additional 48 h. (Fig. A ,Fig. B and Fig. C) qRT-PCR and WB detection of three different perturbations of ID1 Sequence knockdown efficiency;(Fig. D and Fig. E). WB detected the relative protein levels of CD31, α-SMA, and SM22; (Fig. F, G and Fig. H). Transwell and scratch experiments; The cells were cultured for 48 hours and photographed. Then the relevant data statistics were carried out(Fig. H). All data are mean ± SD, n = 3. *P\u0026lt;0.05,**P\u0026lt;0.01,***P\u0026lt;0.001 VS. sh-NC group,#P\u0026lt;0.05,##P\u0026lt;0.01,###P\u0026lt;0.001 VS.TGF-β1 Group.Platelet endothelial cell adhesion molecule-1, CD31、Actin alpha 2,α-SMA、Smooth muscle 22α, SM22α、Inhibitor of differentiation 1, ID1.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/79f3c47686033714daab7268.jpg"},{"id":51931322,"identity":"2e3b3763-391c-466e-8825-7761ab02d96d","added_by":"auto","created_at":"2024-03-04 05:37:01","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":103428,"visible":true,"origin":"","legend":"\u003cp\u003eID1 overexpression induces EndMT in HAECs.(Fig. A and C) qRT-PCR and WB analysis of the expression efficiency of ID1 at 72 hours after transfection of the overexpression plasmid into cells;(Fig. B) qRT-PCR detection of CD31 and α-SMA mRNA expression levels;(Fig. D) WB detection of relative protein levels of ID1, CD31, α-SMA, SM22α, Snail and β-catenin 72 hours after HAECs were transfected with ID1 overexpression plasmid. *P\u0026lt;0.05, **P\u0026lt;0.01 vs. Ctrl Group.Inhibitor of differentiation 1, ID1、Platelet endothelial cell adhesion molecule-1, CD31、Actin alpha 2, α-SMA、Smooth muscle 22α, SM22α.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/a89c9047f2d1f72076650776.jpg"},{"id":51931323,"identity":"dbc869ed-c18a-4c34-8b30-ce27d0431ecb","added_by":"auto","created_at":"2024-03-04 05:37:01","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":178583,"visible":true,"origin":"","legend":"\u003cp\u003eID1 regulates the expression of EndMT-related transcription factor Snail and regulates the Wnt/β-catenin signalling pathway. (Fig. A and Fig. B) WB detection of Snail, β-catenin, and CyclinD1 protein expression levels and their respective quantification;(Fig. C and Fig. D) OSS common carotid artery Snail and β-catenin immunohistochemistry and their respective quantification. n =3. All data are mean ± SD, n = 3. *P\u0026lt;0.05, **P\u0026lt;0.01, ****P\u0026lt;0.0001 VS. Sh-NC group, VS.ApoE-/- group;#P\u0026lt;0.05, ##P\u0026lt;0.01 VS. TGF-β1 group.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/9cf49be69ac19465555fa9d8.jpg"},{"id":52385634,"identity":"9960dea3-359c-47a1-97d9-a550cad47b97","added_by":"auto","created_at":"2024-03-10 21:25:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2448648,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3990718/v1/2edfe534-56f6-44ed-8a9f-298a97bf9c8f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"ID1 protein inhibitor depresses low-oscillating shear stress-mediated EndMT and atherosclerosis by Snail and Wnt/β-catenin signalling pathways","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAtherosclerosis (AS) is a vascular disease that significantly endangers human health. It is an essential pathological condition for vascular diseases such as ischemic heart disease, stroke, and peripheral arterial disease(Mena and Spite, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).AS mainly occurs in the branches and bends of arteries, where the blood flow is disturbed, and low oscillating shear stress(OSS) is easily generated. This promotes the occurrence and development of AS by inducing inflammation, excessive proliferation, and apoptosis of vascular endothelial cells(Marchio et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e),(Libby, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Endothelial\u0026ndash;mesenchymal transition (EndMT) occurs in vascular endothelial cells under blood flow shear stress, inflammatory factors, high fat, and other factors, damaging the endothelial barrier and function(Sanchez-Duffhues et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).EndMT is a state of transition from endothelial cells to mesenchymal cell phenotype, with down-regulated expression of specific proteins in endothelial cells such as VE-cadherin and CD31 and up-regulated expression of particular proteins in mesenchymal cells such as α-SMA and SM22α characteristics, and changes in cell morphology, proliferation, migration, and collagen synthesis capacity(Li et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Recent studies have found that EndMT plays an essential role in the pathogenesis of the cardiovascular disease(Qiu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The underlying mechanisms of biomechanical induction of EndMT and the contributions of potential regulators of this process require further study.\u003c/p\u003e \u003cp\u003eDNA-binding inhibitory proteins, also known as Inhibitors of differentiation proteins (IDs), are members of the helix-loop-helix HLH transcription factor family. Family members have four IDs: ID1, ID2, ID3, and ID4, of which ID1 is the most widely studied protein in this family and runs through the entire development of the embryonic cardiovascular and cerebrovascular system(Zhao et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Multiple studies have shown that ID1 is regulated by shear stress and may be an essential force-sensitive factor(Zhang et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, the changes in endothelial function caused by the regulation of ID1 expression by OSS and whether it will affect the subsequent development of AS plaques have not been reported. Therefore, in this article, we mainly study the effect of low oscillating shear stress on the EndMT state and ID1 expression of endothelial cells in AS and clarify the correlation between the three. In addition, it explains whether ID1 is a critical regulatory molecule in the process of EndMT mediated by the low oscillating shear stress of blood flow and explores its possible mechanism for EndMT.The data from this study provide new insights into the regulation of ID1 in OSS-induced EndMT.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials\u003c/h2\u003e \u003cp\u003eTGF-β1 was purchased from PeproTech (Rocky Hill, NJ, USA). The anti-ID1 antibody, Anti-α-SMA antibody, Anti-SM22α antibody, Anti-TGF-β1 antibody, Anti-Snail antibody, Anti-Snail antibody and Anti-β-Tubulin were purchased from Abclonal (Wuhan, China). Anti-CD31 antibody was obtained from Cell signalling Technology (Trask Lane Danvers, MA, USA). Anti-β-catenin antibody and Anti-CyclinD1 were purchased from Proteintech (Wuhan, China). Goat anti-mouse and anti-rabbit IgG-HRP antibodies were ordered from Abclonal (Wuhan, China). ID1-specific inhibitor AGX51 was supplied by MedChemExpress(New Jersey, USA). TRIzol reagent, PrimeScript RT Master Mix and SYBR Premix Ex Taq II were purchased from TransGen Biotech(Beijing, China). A PVDF membrane and ECL Exposure Fluid were supplied by Millipore (Billerica, MA, USA). Oil Red O was provided by Solarbio (Beijing, China). ID1 minus expression plasmid༈sh-RNA༉ and ID1 overexpression plasmid༈OE-ID1༉ were purchased by GenePharma (Shanghai, China). Lipofectamine 6000 was supplied by Invitrogen (Carlsbad, CA, USA). Cell culture media and fetal bovine serum (FBS) were purchased from Hyclone (Logan, UT, USA). All other chemicals were ordered from commercial sources.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Cell culture\u003c/h2\u003e \u003cp\u003eHuman aortic endothelial cells (HAECs) were purchased from the American Type Culture Collection (Beina Chuanglian Biotechnology, China). HAECs were cultured at 37\u0026deg;C, 5% carbon dioxide, and 95% sterile purified air. The medium formulation included 90% RPMI-1640, 10% fetal bovine serum (FBS), and 1% HEPES buffer (100 IU/mL). Cells are cultured at about six passages and passaged after they become confluent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Animal experiments\u003c/h2\u003e \u003cp\u003e30 male and transgenic ApoE-/- mice (6\u0026ndash;8 weeks old) were purchased from the Institute of Animal Modeling, Nanjing University. All animals were numbered sequentially after purchase and randomly divided into cages, with four mice in each cage raised in the Experimental Animal Center of Ningbo University(SYXK(Zhe)2019-0005). One week after adaptive feeding, partial ligation of the left common carotid artery was performed under a microscope, warm before the operation, and abdominal anaesthesia with 4% chloral hydrate. The left muscle tissue was bluntly separated, the common carotid artery was found, the surrounding nerves were isolated, and its four branches were ligated along the common carotid artery, namely the internal carotid artery (ICA) and the external carotid artery (ECA), occipital artery (OA), and superior thyroid artery (STA). 4\u0026thinsp;\u0026minus;\u0026thinsp;0 Hanqin medical suture needle ligates the three branches of the left common carotid artery and retains the fourth branch\u0026mdash;STA, which can cause disordered blood flow from the origin of the common carotid artery to the unit and can form low-oscillating shear stress (OSS). The right carotid artery was isolated but not ligated. During the operation, the anaesthesia state of the mice was continuously monitored, and the mice were kept warm and given penicillin anti-infective treatment. To examine changes in EndMT and ID1 in atherosclerosis, ApoE-/- mice were fed a diet containing 1% cholesterol and 5% lard (n\u0026thinsp;=\u0026thinsp;10 for four weeks; n\u0026thinsp;=\u0026thinsp;10 for 30 weeks). The mice' left common carotid artery (OSS) was taken as the experimental group, and the right common carotid artery was used as the Ctrl group for the experiment.\u003c/p\u003e \u003cp\u003eTo examine the effect of ID1 on atherosclerotic EndMT, the left common carotid artery was ligated from 10 ApoE-/- mice to establish the OSS mouse model, and they were given a high-fat diet.5 OSS ApoE-/- mice were intraperitoneally injected with the ID1 inhibitor AGX51 at a dose of 30 mg/kg body weight for four weeks as the experimental group. The other 5 OSS ApoE-/- mice were intraperitoneally injected with the same amount of DMSO as the Ctrl group, and the mice were euthanized by excessive chloral hydrate. The samples were taken from the origin of the left common carotid artery at the aortic arch to the root of the bifurcation of the internal and external carotid arteries. After serial sectioning, oil red O, H\u0026amp;E Staining, Masson staining, immunohistochemistry, and immunofluorescence staining were performed. Histochemical staining was performed using Image Pro Plus image analysis software (Bethesda, MD, USA). The experimental protocol complied with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The Laboratory Animal Care Committee of Ningbo University approved it. The blind experiment method was used in all experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Quantitative real-time PCR\u003c/h2\u003e \u003cp\u003eAfter confluency, cells were lysed using TRIzol reagent, RNA was precipitated with isopropanol, washed with alcohol, and reversed to cDNA using a PrimeScript RT kit with gDNA Eraser. Perform 40 cycles of 95\u0026deg;C for 10s, 60\u0026deg;C for the 30s, and 60\u0026deg;C to collect fluorescence signals. Data were calculated by the ΔΔCt method and normalized to GAPDH levels. The primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for quantitative real-time PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCD31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCATCCTGTCGGGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCATTCACGGTTTCTTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eα-SMA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGCATCCACGAAACCACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCCGCCGATCCAGACAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eID1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCATCCTTATACCGACGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGGGGAGCGCTTTTTCCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCTGAGCTGAACGGGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGAGTGGGTGTCGCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Western blotting\u003c/h2\u003e \u003cp\u003eAccording to the manufacturer's instructions, after the cells are confluent, extract the protein with RIPA lysis buffer containing protease inhibitors, add the protein to a 5\u0026times; loading buffer, then put it into a 10% SDS-PAGE gel for electrophoresis, and transfer the protein in the gel to methanol for activation On the PVDF membrane, and after blocking with the quick blocking solution, incubated with the primary antibody overnight at four \u0026deg;C on a refrigerator shaker. Membranes were then incubated with HRP-conjugated secondary antibodies and blotted using ECL chemical exposure solution, and band density was analyzed by Image J software (Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Oil Red Stain\u003c/h2\u003e \u003cp\u003eThe 12-week and 36-week ApoE-/- common carotid arteries were taken out, washed with normal saline and then placed in liquid nitrogen for embedding, pre-cooled in a cryostat for 30 min, then sliced, fixed with cold acetone at four \u0026deg;C for 20 min, washed with distilled water, Then add 60% isopropanol for internal immersion, and stain with the prepared modified oil red O staining solution. Nuclei were counterstained with Mayer's hematoxylin staining solution, returned to blue in PBS solution and mounted. Atherosclerotic plaques were observed under a microscope and photographed, and analyzed using Image Pro Plus software (Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7.H\u0026amp;E Stain\u003c/h2\u003e \u003cp\u003eTissue blocks were taken, fixed, embedded in paraffin, and sectioned. The tissue wax block was dewaxed and hydrated with xylene and graded alcohol, the nuclei were stained with hematoxylin, differentiated with the differentiation medium, and the residual dye was washed with distilled water. The cytoplasm was stained with eosin for 30 seconds, washed with tap water, dehydrated with gradient alcohol, transparent with xylene, and finally mounted with neutral gum, and the size of the lesions was statistically analyzed by Image Pro Plus software (Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8.Masson stain\u003c/h2\u003e \u003cp\u003eAfter taking the material, the sections were dewaxed and hydrated, the nucleus was stained with hematoxylin, the muscle fibres were stained with Ponceau magenta, and the weak acid made the colour brighter. Subsequently, blue collagen fibres were dyed with aniline blue and washed with distilled water two times for 1 min. After rapid dehydration with gradient alcohol, the slides were mounted with Image Pro Plus software (Bethesda, MD, USA) for statistical analysis after clearing in xylene.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9.Immunohistochemistry and immunofluorescence\u003c/h2\u003e \u003cp\u003eFormalin-fixed, paraffin-embedded standard carotid artery sections were deparaffinized and rehydrated. Incubate in a 3% H2O2 wet box to remove endogenous peroxidase. After high-pressure repair with sodium citrate, the donkey serum was incubated at room temperature for 2 hours. The primary antibody was refrigerated at four \u0026deg;C overnight, and the secondary antibody was incubated for antigen-antibody reaction. Immunofluorescence should be protected from light. For processing, nuclei were stained with DAPI. The pre-configured DAB chromogenic solution was used for immunohistochemistry. The chromogenic reaction was observed under a microscope, terminated with PBS, stained with hematoxylin, and then dehydrated and transparentized with gradient alcohol xylene. The slides were mounted and photographed under a microscope, immunofluorescence was photographed with a laser confocal microscope (Leica, Germany), and 10\u0026times; and 63\u0026times; images were taken, respectively. For immunohistochemistry, 10\u0026times;, 20\u0026times;, and 40\u0026times; photos were taken with an ordinary microscope. Protein expression-positive areas and mean fluorescence intensity were measured using Image-Pro Plus software (Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Transfection experiment\u003c/h2\u003e \u003cp\u003eAccording to the manufacturer's requirements, the plasmids are ID1 overexpression Ctrl plasmid, ID1 overexpression plasmid (OE-ID1), ID1 reduction expression Ctrl plasmid (sh-NC), and ID1 reduction expression of three different interference sequences (sh-(1), sh -(2), sh-(3)); according to the manufacturer's instructions, when the density of HAECs reached 60\u0026ndash;80% after the medium was changed, Lipofectamine 6000 and plasmid mixture were used to transfer into cells, and 24 h later, fluorescence microscopy (Leica, Germany) Observe the transfection efficiency.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Scratch assay\u003c/h2\u003e \u003cp\u003eHAECs were plated in a six-well plate, and the density was Ctrlled at 30%-40%. 10ng/mL TGF-β1 was added to intervene for 72 hours. The overgrown cells were taken under the ultra-clean bench for operation and fixed on the midline of the six-well plate with a ruler. The pipette tip was cross scratched, and the cell debris was washed with PBS, photographed with a microscope (Leica, Germany), and recorded as 0 h at this time. After the photograph was taken, serum-free medium and ID1 expression plasmid and its negative Ctrl were added to continue the culture; 48 hours later, the detection was performed. Cell migration was photographed and analyzed using Image Pro Plus (Bethesda, MD, USA) software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Transwell assay\u003c/h2\u003e \u003cp\u003eCells were cultured without serum for 12h and routinely digested; 100ul cell suspension was inoculated in the upper chamber of the Transwell chamber, 500ul medium containing 10% FBS was added to the lower section, and 1000ul/well methanol was added after culturing for 48h, and fixed with 4% paraformaldehyde, stained with crystal violet at room temperature for 20 min, washed dry cotton swabs and gently wiped unmigrated cells at the bottom of the upper chamber, observed five visual fields randomly under the microscope, took pictures, and analyzed with Image Pro Plus (Bethesda, MD, USA) software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Statistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD from three independent experiments. Two-tailed Student\u0026rsquo;s t tests and ANOVA were appropriately performed, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. All statistical analyses were conducted under the blind condition.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Low oscillating shear stress promotes atherosclerotic plaque formation.\u003c/h2\u003e \u003cp\u003eTo test whether OSS is related to the formation of AS plaques, 6–8 week-old male ApoE-/- mice were partially ligated to the left common carotid artery under a microscope to establish an OSS mice model. High-fat diet feeding for 4 and 30 weeks to develop mice models of early(12 weeks) and late(36 weeks) AS. The right common carotid artery was taken as the Ctrl group, the left common carotid artery was taken as the OSS experimental group, and lipid deposition was measured by Oil Red O staining. Compared with the Ctrl group, the OSS group had significant lipid deposition (P \u0026lt; 0.01), and with the increase in ligation time (36 weeks vs 12 weeks P \u0026lt; 0.05), the lipid deposition in the left carotid artery in the OSS group became more and more significant. In contrast, the contralateral right carotid artery showed no significant change (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and D). We further performed H\u0026amp;E Staining to detect the size of AS lesions in 12-week-old mice and Masson staining to see whether there was collagen fibre deposition.H\u0026amp;E Staining showed that compared with the Ctrl group, the subendothelial layer in the OSS group was significantly thickened. A large number of foam cells were aggregated in the lesions (indicated by arrows) (P \u0026lt; 0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and E). At the same time, Masson staining showed that compared with the Ctrl group, the OSS group had apparent collagen fibres deposition (blue) (P \u0026lt; 0.0001)(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and F). These results suggest that low oscillating shear stress can promote early and late AS plaque formation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2. In vitro and in vivo, low oscillating shear stress promotes EndMT and regulates ID1 protein expression.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo explain whether OSS affects the EndMT process and the expression of ID1 protein, we examined the expression of endothelial and mesenchymal markers in the left and right common carotid arteries using immunohistochemistry. It can be seen from the data that, compared with the Ctrl group, the expression of CD31 in the OSS group showed a decreasing trend (P\u0026lt;0.05)(Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In contrast, the face of the mesenchymal marker α-SMA, compared with the Ctrl group, there was an increasing trend (p \u0026lt; 0.05), and the presentation of TGF-β1 protein, which represents the activation of EndMT, was also significantly increased under the action of OSS (p \u0026lt; 0.05)༈Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA༉. By staining ID1 protein and counting, it was found that the positive area of ID1 in the left common carotid artery with OSS was lower than that in the Ctrl group and decreased by three times (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). According to the trend of immunohistochemistry, we used immunofluorescence double staining to observe the degree of EndMT and the expression of ID1 protein in the left and right common carotid arteries of 12 weeks old ApoE-/- mice. Consistent with the immunohistochemical results, compared with the Ctrl group, OSS could promote the accumulation of EndMT-positive cells in the endothelial cell layer, and compared with the Ctrl group, the fluorescence intensity of ID1 protein in the OSS group was significantly decreased (p \u0026lt; 0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eNext, we tested whether OSS promotes EndMT and regulates ID1 protein in vitro. According to the above experiments, we found that TGF-β1 is enriched in the OSS region, which is consistent with Kouzbari et al. [13]. Therefore,10ng/mL TGF-β1 was used to intervene HAECs for 72 h in vitro to simulate an OSS environment. It can be found that compared with the Ctrl group, the changes of CD31 and α-SMA in the TGF-β intervention group proved that the EndMT cell model was successfully established, and it was found that after TGF-β treatment, the expression of ID1 was up-regulated compared with the Ctrl group ( P \u0026lt; 0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). These findings confirm that OSS promotes EndMT progression and regulates the expression of ID1 protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effects of ID1 protein inhibitor-AGX51 on the formation of atherosclerotic plaques.\u003c/h2\u003e \u003cp\u003eTo evaluate whether ID1 regulates low-oscillating shear stress-induced AS. First, we injected the ID1 protein inhibitor AGX51 into 12-week-old ApoE-/ -OSS mice and took a right common carotid artery. Immunofluorescence staining showed that AGX51(30 mg/kg) could effectively inhibit the expression of ID1 protein (P \u0026lt; 0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). We then selected the left common carotid artery to detect atherosclerotic plaque.Our oil red staining showed that injection of AGX51 alleviated OSS-induced AS lipid deposition, and there were significant differences in the lesion area between the AGX51 + OSS group and the OSS group (P\u0026lt;0.0001)(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). And oil red staining results showed that after AGX51 treatment, foam cells were significantly reduced, and the degree of intimal thickening was restored(P\u0026lt;0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). Through Masson staining experiments, we further confirmed that AGX51 could inhibit OSS-induced collagen fibre deposition (P\u0026lt;0.0001)(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D).\u003c/p\u003e \u003cp\u003eThis indicates that ID1 is involved in OSS-mediated lipid deposition in AS, and inhibition of ID1 expression can effectively inhibit the formation of AS plaques.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4 In vitro and in vivo studies examined the effect of ID1 protein inhibitor-AGX51 on EndMT mediated by OSS.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo test whether the regulation of ID1 affects OSS-induced EndMT, we first detected the expression of endothelial markers and mesenchymal markers in endothelial cells of partial ligation of the left common carotid artery of mice by immunohistochemistry.ID1 protein inhibitor AGX51 attenuated the expression of α-SMA in the endothelial cell layer while restoring CD31 expression(P\u0026lt;0.05 and P \u0026lt;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Similarly, we also demonstrated by immunofluorescence staining that the fluorescence intensity of EndMT double-positive in the AGX51-treated group was significantly reduced compared with the OSS group (P\u0026lt;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Then we further studied the effect of ID1 on EndMT in vitro, treated HAECs with AGX51, screened the concentration that best inhibited ID1, and found that 20uM was the best inhibitory concentration (P\u0026lt;0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). Therefore, we treated HAECs with 20uM AGX51 and found that AGX51 intervention alone did not affect EndMT.Inhibition of ID1 could inhibit the up-regulation of α-SMA and SM22α but could not restore the downregulation of endothelial cell marker CD31 after 10ng/mL TGF-β1 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The effect of AGX51 on CD31 was inconsistent in vitro and in vivo, possibly due to the single intervention condition at the cellular level in vitro. Therefore, these findings suggest that inhibition of ID1 protein in vitro and in vivo can alleviate some of the OSS-induced EndMT.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.5 sh-RNA-mediated knockdown of ID1 inhibits EndMT and cell migration ability of HAECs\u003c/h2\u003e \u003cp\u003eAt the pharmacological level, inhibition of ID1 protein inhibits the EndMT process. To further explore the effect of ID1 protein on EndMT, we down-regulated ID1 using sh-RNA-mediated transfection for 48 hours, followed by 10ng/mL TGF-β1 treatment for 72 hours. We transfected HAECs with three ID1-specific sh-RNAs and examined gene knockdown efficiency 48 hours after transfection using qRT-PCR technology. We found that sh-(1) had the most significant knockdown efficiency, reaching 90% at the mRNA level (P\u0026lt;0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), which was also validated at the protein level (P\u0026lt;0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Therefore, the following experiments are performed using sh-(1). Compared with the sh-NC group, the sh-ID1 treatment group significantly attenuated TGF-β1-induced EndMT in HAECs.As shown in (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and E), ID1 knockdown reduced TGF-β1-induced expression of mesenchymal markers α-SMA and SM22α.In contrast, inhibition of ID1 did not restore the decline in the EC marker CD31, consistent with the results generated by our pharmacology experiments. Next, we used Transwell and scratch assays to examine the migration ability of ECs, and sh-ID1 inhibited TGF-β1-induced migration of HEACs(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF, G, H and I). These experimental results show that targeting ID1 protein can inhibit TGF-β1-induced EndMT and restore endothelial cell migration ability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Overexpression of ID1 protein promotes EndMT in endothelial cells.\u003c/h2\u003e \u003cp\u003eTo determine whether ID1 is sufficient to drive EndMT in HAECs, we transformed the ID1 overexpression plasmid, cultured it for 72 hours, and examined the overexpression efficiency by qRT-PCR and WB. Cellular ID1 overexpression increased ID1 mRNA levels by approximately 220-fold and protein levels by about 2-fold (P\u0026lt;0.001)(Fig.\u0026nbsp;6A and C). Indeed, overexpression of ID1 resulted in changes in EndMT-related protein mRNA, as demonstrated in (Fig.\u0026nbsp;6B), a decrease in the mRNA level of CD31, and an increase in the mRNA level of α-SMA.In addition, WB detection also showed that the expression of CD31 was significantly decreased, while mesenchymal-related proteins such as α-SMA and SM22α were increased(P\u0026lt;0.05)(P\u0026lt;0.01). Interestingly, the EndMT-specific transcription factor Snail and its canonical signalling pathway, Wnt/β-catenin, were also activated in the forced overexpression of ID1(P\u0026lt;0.01) (Fig.\u0026nbsp;6C and D). In conclusion, the overexpression and inhibition of ID1 further verified that ID1 protein is indeed involved in the EndMT process.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure\u0026nbsp;6.\u003c/b\u003e ID1 overexpression induces EndMT in HAECs.(Fig. A and C) qRT-PCR and WB analysis of the expression efficiency of ID1 at 72 hours after transfection of the overexpression plasmid into cells;(Fig. B) qRT-PCR detection of CD31 and α-SMA mRNA expression levels;(Fig. D) WB detection of relative protein levels of ID1, CD31, α-SMA, SM22α, Snail and β-catenin 72 hours after HAECs were transfected with ID1 overexpression plasmid. *P \u0026lt; 0.05, **P \u0026lt; 0.01 vs. Ctrl Group.Inhibitor of differentiation 1, ID1、Platelet endothelial cell adhesion molecule-1, CD31、Actin alpha 2, α-SMA、Smooth muscle 22α, SM22α.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.7 ID1 protein regulates EndMT by regulating EndMT-related transcription factors Snail and Wnt/β-catenin signalling pathway.\u003c/h2\u003e \u003cp\u003eTo investigate the related mechanism of ID1 on EndMT, our above experimental results found that EndMT-specific transcription factor Snail and the canonical Wnt/β-catenin signalling pathway were activated when ID1 was overexpressed. We inhibited ID1 with sh-ID1 also inhibited. Both were detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and B), and the presentation of Snail and β-catenin-related proteins were detected by immunohistochemistry at the animal level (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eC and D). The results showed that AGX51 could inhibit OSS-induced activation of Snail and Wnt/β-catenin signalling. In conclusion, we can conclude that ID1 may affect the EndMT process by regulating specific transcription factors Snail and Wnt/β-catenin signalling pathway.\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003eIn recent years, several studies have confirmed that EndMT in endothelial cells can promote the progression of AS plaques(Qiu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e),(Wang et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The role of shear stress in EndMT has received close attention, but the precise mechanism by which OSS activates EndMT and how it affects the progression of AS plaques need to be further elucidated. In this study, we confirmed that OSS promotes the formation of early and lately AS plaques in ApoE-/- mice by oil red staining analysis and immunohistochemical and immunofluorescence staining found that OSS activates the EndMT process and regulates ID1 protein expression. Multiple studies have shown that TGF-β signalling is enriched in the OSS region(Deng et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e),(Suwittayarak et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), which is consistent with our immunohistochemical results. We used TGF-β1 to act on HAECs to simulate a low oscillating shear stress environment in vitro. Our results showed that TGF-β1 also activated the EndMT process and up-regulated the expression of ID1 protein.Furthermore, in vivo, the ID1 protein inhibitor AGX51 inhibited OSS-mediated EndMT and subsequent AS progression. The intervention of ID1 expression by molecular and pharmacological methods in vitro can deter EndMT and restore endothelial cell migration ability. On the contrary, ID1 overexpression promotes EndMT in ECs.These studies suggest that ID1 is involved in OSS-mediated EndMT and AS plaque formation. We also found that inhibition of ID1 abrogated low oscillating shear stress-induced EndMT signalling, including activation of specific transcription factors Snail and Wnt/β-catenin signalling.\u003c/p\u003e\u003cp\u003eEndMT plays an essential role in various cardiovascular diseases, and its research on the occurrence and development of AS plaques is also deepening(Wang et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Studies have found that there is a class of cells in the subendothelial layer of human AS plaques that have both endothelial and mesenchymal cell markers, so it is speculated that EndMT is involved in the progression of atherosclerosis(Moonen et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Several studies have observed endothelial cells with EndMT within AS plaques(Evrard et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and the loss of endothelial cells on the plaque surface may be related to their migration into the plaque(Chen et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Vascular endothelial dysfunction is an essential feature of atherosclerosis, and biomechanical factors also play an irreplaceable role in the process of AS(Mazzi et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).In adults, AS lesions are preferentially located at arterial branches and bends, which produce low oscillating shear stress (OSS) on the vessel in the range of 0.5 ± 4 Dyn/cm2.OSS is one of the leading causes of atherosclerotic plaque formation and affects the development of vulnerable plaques, putting plaques at a higher risk of rupture, leading to unstable angina, myocardial infarction, and stroke(Timmins et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). OSS in atherosclerotic areas reduces protective endothelial FGFR1 signalling while activating TGF-β, suggesting that low oscillating shear stress is an activation signal for EndMT(Chen et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).In addition, OSS can also lead to ROS generation and inflammatory signalling during atherosclerosis, both of which promote the development of EndMT(Krenning et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this study, we confirmed that OSS could promote the occurrence and development of EndMT and AS plaques. In our present study, we found that OSS induces EndMT in ApoE-/- mice endothelial cells and promotes AS plaque progression but only induces upregulation of the mesenchymal gene α-SMA and preserve the expression of the endothelial gene CD31; that is, ECs are undergoing partial EndMT.This subset of ECs may be more easily reversible under certain circumstances, such as cardiac fibroblasts that can derive endothelial cells after acute ischemic heart injury(Ubil et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The occurrence and development of AS plaques are more common in arterial bifurcations, and blood flows in disordered areas. We speculate that EndMT is involved, which causes a part of the endothelial layer to be destroyed. The blood continuously contacts the intimal surface lacking endothelial cells, which eventually leads to plaque formation and rupture. Consistent with this, Evrard et al.(Evrard et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) used an endothelial lineage tracing system and found that EndMT caused endothelial cells on the plaque surface to migrate into the plaque interior, further damaging the endothelial cell layer. The above findings suggest that the relationship between OSS, EndMT, and AS can promote EndMT, thereby affecting the occurrence and development of AS.\u003c/p\u003e\u003cp\u003eIDs are closely related to tumours and cardiovascular diseases(Ling et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).In 1990, Benezra et al.(Benezra et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1990\u003c/span\u003e) first discovered that ID1 is widely present in mammalian cells and is known for its involvement in inhibiting nuclear transcription factors binding to DNA, including the inhibition of atomic transcription of proto-oncogenes(Jen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). So there is a lot of research on ID1 protein and cancer. Atherosclerosis is similar to cancer in many ways, including angiogenesis, inflammation, and Epithelial-Mesenchymal Transition(EMT)/EndMT.In addition, several studies have shown that the ID1 protein is an essential force-sensitive factor(Ni et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Through immunohistochemistry and immunofluorescence staining, we confirmed that the expression of ID1 protein in the common carotid artery of ApoE-/- mice were down-regulated under the action of OSS ensuring that ID1 protein is regulated by shear stress. In cell experiments, HAECs were treated with TGF-β1, and the corresponding changes in the expression of endothelial marker CD31 and mesenchymal marker α-SMA were detected by WB to confirm that the EndMT cell model was successfully established. However, the expression of ID1 protein is up-regulated under the stimulation of TGF-β1.In vitro and in vivo experiments seem to be contradictory. Still, in the complex pathological process of AS, inflammatory factors, oxidized LDL, or stress are all involved in the regulation of ID1, which may counteract part of the induction of ID1 expression by TGF-β. We have reason to believe that ID1 is a force-sensitive factor, and OSS plays a leading role in the regulation of ID1(Gadomski et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e),(Edhayan et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016\u003c/span\u003e),(Qiu et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). This is also an exciting aspect. Later, our experimental group will use a flat flow chamber device to truly explore the effect of OSS on ID1 at the cellular level. According to recent studies, IDs are closely related to the progression of atherosclerosis, and ID inhibitors successfully prevent the passage of atherosclerosis(Avecilla et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).Wojnarowicz et al.(Wojnarowicz et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) found that an ID1 protein inhibitor, AGX51, inhibits retinal pathological neovascularization by inhibiting the Id1-E47 interaction, resulting in ubiquitin-mediated ID1 degradation.Our study found that AGX51 can reduce the occurrence and development of OSS-mediated AS plaques. EndMT is considered a new therapeutic target for AS. Many studies have explored the relationship between ID1 and tumour EMT(Zhao and Liu, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the regulatory role of ID1 on EndMT in AS has not been reported so far. In the present study, we confirmed that the ID1 protein inhibitor AGX51 inhibited partial OSS-mediated EndMT in the left common carotid artery of ApoE-/- mice using double immunofluorescence staining and immunohistochemistry of CD31 and α-SMA.In vitro, the WB assay found that ID1 silencing by AGX51 or sh-RNA inhibited part of the EndMT process in TGF-β1-treated HAECs.Statins reduce the concentration of CCR-5, the receptor for the proinflammatory cytokine CCL-4, decrease EndMT, and inhibit subsequent AS lesion formation(Yang et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Increased cell migration ability is a feature of EndMT cells(Phan et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), we evaluated the migration of HAECs using scratch assay and Transwell, and the results showed that inhibition of ID1 protein could attenuate the TGF-β1-induced increase of HAECs migration ability. Paeoniflorin inhibits platelet-derived growth factor-bb (PDGF-BB)-stimulates increased proliferation and migration of human pulmonary artery smooth muscle cells, and inhibits EndMT(Yu et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).In addition, forced overexpression of ID1 can down-regulate the expression of endothelial markers (CD31, VE-cadherin) and up-regulate the expression of mesenchymal markers (α-SMA, SM22α). Further promotion of EndMT.Taken together, ID1 regulates OSS-mediated EndMT and atherosclerosis.\u003c/p\u003e\u003cp\u003eThe canonical Wnt/β-Catenin signalling pathway acts on the proliferation, differentiation, and migration of cardiomyocytes, cardiac endothelial cells, and primordial valve cells in different stages of cardiac development. It regulates the endothelial-mesenchymal process during the formation of the endocardial cushion—plasma cell transformation (EndMT) process(Tyson et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).ID1 protein is one of the downstream targets of Wnt/β-Catenin signalling regulation, and the positive feedback between ID1 protein and Wnt signalling plays a vital role in cardiac differentiation(Chien et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).Wnt/β-Catenin signalling drives EndMT by increasing Snail expression. Snail, a key transcription factor of EndMT, is regulated by shear stress and is preferentially expressed in the OSS region. Promotes AS plaque progression by promoting endothelial cell proliferation and migration and enhancing the permeability of the endothelial monolayer to macromolecules(Mahmoud et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). We observed upregulation of Snail and β-catenin expression in ApoE-/- mouse common carotid artery endothelial cells and TGF-β1-induced HAECs exposed to OSS, and inhibition of ID1 reduced OSS-mediated Snail and Wnt/β- Activation of Catenin and overexpression of ID1 increased the expression of these EndMT essential signalling pathway proteins. These results suggest that ID1 regulates the OSS-mediated EndMT process by Ctrlling the EndMT key transcription factor Snail and the canonical Wnt/β-Catenin signalling pathway.\u003c/p\u003e\u003cp\u003eTaken together, ID1 is involved in OSS-mediated EndMT and the progression of atherosclerosis. Biomechanical factors-induced EndMT, which promotes the development of atherosclerotic plaques, is currently a hotspot.ID1 protein inhibitors reduce the effect of atherosclerotic plaques by inhibiting OSS-mediated Snail and Wnt/β-Catenin signalling pathways and inhibiting EndMT.Research on endogenous EndMT antagonists is still in its infancy, and our study provides valuable information for ID1 inhibitors in treating EndMT and atherosclerosis.ID1 is expected to be a potential therapeutic target for treating AS patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors hereby agree that the study was conducted after approval by the Ethics Committee of the Animal Laboratory of Ningbo University.\u003c/p\u003e\n\u003ch3\u003eConsent for publication\u003c/h3\u003e\n\u003cp\u003eAll authors consent for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRequests to access the data should be directed to the corresponding authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur study was supported by\u0026nbsp;Project of Zhejiang Medical and Health (Grant No. 2021RC124)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQiu Jun: Experiment, article writing, data processing, analysis, drawing.Yang Xi: Modified. Wang Bingyu: Drawing, experiment. Sun Xinyi: Investigation, verification, drawing. Li Youhong: Drawing, investigation.Lian Jiangfang: Article writing, editing, funding.Zhou Jianqing: Supervision, writing review and editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal laboratory of Ningbo University provides us with a platform for mouse breeding and experimentation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAVECILLA, V., DOKE, M. \u0026amp; FELTY, Q. 2017. Contribution of inhibitor of dna binding/differentiation-3 and endocrine disrupting chemicals to pathophysiological aspects of chronic disease. \u003cem\u003eBioMed research international\u003c/em\u003e, 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBENEZRA, R., DAVIS, R. L., LOCKSHON, D., TURNER, D. L. \u0026amp; WEINTRAUB, H. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell, 61, 49\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHEN, L., WANG, G., HE, J., YANG, X., ZHENG, Z., DENG, Y., LIU, Y., CHEN, D., LIN, R. \u0026amp; WANG, W. 2021. SIRT6 inhibits endothelial-to-mesenchymal transition through attenuating the vascular endothelial inflammatory response. International Immunopharmacology, 101, 108240.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHEN, P.-Y., QIN, L., BAEYENS, N., LI, G., AFOLABI, T., BUDATHA, M., TELLIDES, G., SCHWARTZ, M. A. \u0026amp; SIMONS, M. 2015. Endothelial-to-mesenchymal transition drives atherosclerosis progression. The Journal of clinical investigation, 125, 4514\u0026ndash;4528.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHIEN, K. R., MORETTI, A. \u0026amp; LAUGWITZ, K.-L. 2004. ES cells to the rescue. Science, 306, 239\u0026ndash;240.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDENG, H., MIN, E., BAEYENS, N., COON, B. G., HU, R., ZHUANG, Z. W., CHEN, M., HUANG, B., AFOLABI, T. \u0026amp; ZARKADA, G. 2021. Activation of Smad2/3 signaling by low fluid shear stress mediates artery inward remodeling. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e, 118, e2105339118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEDHAYAN, G., OHARA, R. A., STINSON, W. A., AMIN, M. A., ISOZAKI, T., HA, C. M., HAINES, G. K., MORGAN, R., CAMPBELL, P. L. \u0026amp; ARBAB, A. S. 2016. Inflammatory properties of inhibitor of DNA binding 1 secreted by synovial fibroblasts in rheumatoid arthritis. Arthritis research \u0026amp; therapy, 18, 1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEVRARD, S. M., LECCE, L., MICHELIS, K. C., NOMURA-KITABAYASHI, A., PANDEY, G., PURUSHOTHAMAN, K.-R., D\u0026rsquo;ESCAMARD, V., LI, J. R., HADRI, L. \u0026amp; FUJITANI, K. 2016. Endothelial to mesenchymal transition is common in atherosclerotic lesions and is associated with plaque instability. Nature communications, 7, 11853.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGADOMSKI, S., SINGH, S. K., SINGH, S., SARKAR, T., KLARMANN, K. D., BERENSCHOT, M., SEAMAN, S., JAKUBISON, B., GUDMUNDSSON, K. O. \u0026amp; LOCKETT, S. 2020. Id1 and Id3 maintain steady-state hematopoiesis by promoting sinusoidal endothelial cell survival and regeneration. \u003cem\u003eCell reports\u003c/em\u003e, 31, 107572.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJEN, Y., WEINTRAUB, H. \u0026amp; BENEZRA, R. 1992. Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins. Genes \u0026amp; development, 6, 1466\u0026ndash;1479.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKRENNING, G., BARAUNA, V. G., KRIEGER, J. E., HARMSEN, M. C. \u0026amp; MOONEN, J.-R. A. 2016. Endothelial plasticity: shifting phenotypes through force feedback. \u003cem\u003eStem cells international\u003c/em\u003e, 2016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI, Y., LUI, K. \u0026amp; ZHOU, B. 2018. Reassessing endothelial-to-mesenchymal transition in cardiovascular diseases. Nature reviews. Cardiology, 15, 445\u0026ndash;456.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLIBBY, P. 2021. The changing landscape of atherosclerosis. Nature, 592, 524\u0026ndash;533.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLING, F., KANG, B. \u0026amp; SUN, X.-H. 2014. Id proteins: small molecules, mighty regulators. Current topics in developmental biology, 110, 189\u0026ndash;216.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMAHMOUD, M. M., SERBANOVIC-CANIC, J., FENG, S., SOUILHOL, C., XING, R., HSIAO, S., MAMMOTO, A., CHEN, J., ARIAANS, M. \u0026amp; FRANCIS, S. E. 2017. Shear stress induces endothelial-to-mesenchymal transition via the transcription factor Snail. \u003cem\u003eScientific reports\u003c/em\u003e, 7, 3375.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMARCHIO, P., GUERRA-OJEDA, S., VILA, J. M., ALDASORO, M., VICTOR, V. M. \u0026amp; MAURICIO, M. D. 2019. Targeting Early Atherosclerosis: A Focus on Oxidative Stress and Inflammation. \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e, 2019, 8563845.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMAZZI, V., DE NISCO, G., HOOGENDOORN, A., CAL, K., CHIASTRA, C., GALLO, D., STEINMAN, D. A., WENTZEL, J. J. \u0026amp; MORBIDUCCI, U. 2021. Early atherosclerotic changes in coronary arteries are associated with endothelium shear stress contraction/expansion variability. Annals of Biomedical Engineering, 49, 2606\u0026ndash;2621.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMENA, H. \u0026amp; SPITE, M. 2021. Proresolving receptor tames inflammation in atherosclerosis. The Journal of clinical investigation, 131.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMOONEN, J.-R. A., LEE, E. S., SCHMIDT, M., MALESZEWSKA, M., KOERTS, J. A., BROUWER, L. A., VAN KOOTEN, T. G., VAN LUYN, M. J., ZEEBREGTS, C. J. \u0026amp; KRENNING, G. 2015. Endothelial-to-mesenchymal transition contributes to fibro-proliferative vascular disease and is modulated by fluid shear stress. Cardiovascular research, 108, 377\u0026ndash;386.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNI, C.-W., QIU, H., REZVAN, A., KWON, K., NAM, D., SON, D. J., VISVADER, J. E. \u0026amp; JO, H. 2010. Discovery of novel mechanosensitive genes in vivo using mouse carotid artery endothelium exposed to disturbed flow. Blood, The Journal of the American Society of Hematology, 116, e66-e73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePHAN, T. H. G., PALIOGIANNIS, P., NASRALLAH, G. K., GIORDO, R., EID, A. H., FOIS, A. G., ZINELLU, A., MANGONI, A. A. \u0026amp; PINTUS, G. 2021. Emerging cellular and molecular determinants of idiopathic pulmonary fibrosis. Cellular and Molecular Life Sciences, 78, 2031\u0026ndash;2057.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQIU, J., LI, Y., WANG, B., SUN, X., QIAN, D., YING, Y. \u0026amp; ZHOU, J. 2022. The role and research progress of inhibitor of differentiation 1 in atherosclerosis. DNA and Cell Biology, 41, 71\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQIU, J., WANG, G., ZHENG, Y., HU, J., PENG, Q. \u0026amp; YIN, T. 2011. Coordination of Id1 and p53 activation by oxidized LDL regulates endothelial cell proliferation and migration. Annals of biomedical engineering, 39, 2869\u0026ndash;2878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSANCHEZ-DUFFHUES, G., ORLOVA, V. \u0026amp; TEN DIJKE, P. 2016. In Brief: Endothelial-to-mesenchymal transition. The Journal of pathology, 238, 378\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSUWITTAYARAK, R., KLINCUMHOM, N., NGAOKRAJANG, U., NAMANGKALAKUL, W., FERREIRA, J. N., PAVASANT, P. \u0026amp; OSATHANON, T. 2022. Shear Stress Enhances the Paracrine-Mediated Immunoregulatory Function of Human Periodontal Ligament Stem Cells via the ERK Signalling Pathway. International Journal of Molecular Sciences, 23, 7119.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTIMMINS, L. H., MOLONY, D. S., ESHTEHARDI, P., MCDANIEL, M. C., OSHINSKI, J. N., GIDDENS, D. P. \u0026amp; SAMADY, H. 2017. Oscillatory wall shear stress is a dominant flow characteristic affecting lesion progression patterns and plaque vulnerability in patients with coronary artery disease. Journal of The Royal Society Interface, 14, 20160972.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTYSON, J., BUNDY, K., ROACH, C., DOUGLAS, H., VENTURA, V., SEGARS, M. F., SCHWARTZ, O. \u0026amp; SIMPSON, C. L. 2020. Mechanisms of the osteogenic switch of smooth muscle cells in vascular calcification: WNT signaling, BMPs, mechanotransduction, and EndMT. Bioengineering, 7, 88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUBIL, E., DUAN, J., PILLAI, I. C., ROSA-GARRIDO, M., WU, Y., BARGIACCHI, F., LU, Y., STANBOULY, S., HUANG, J. \u0026amp; ROJAS, M. 2014. Mesenchymal\u0026ndash;endothelial transition contributes to cardiac neovascularization. Nature, 514, 585\u0026ndash;590.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG, B., QIU, J., LIAN, J., YANG, X. \u0026amp; ZHOU, J. 2021. Gut metabolite trimethylamine-N-oxide in atherosclerosis: from mechanism to therapy. Frontiers in cardiovascular medicine, 1560.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWOJNAROWICZ, P. M., E SILVA, R. L., OHNAKA, M., LEE, S. B., CHIN, Y., KULUKIAN, A., CHANG, S.-H., DESAI, B., ESCOLANO, M. G. \u0026amp; SHAH, R. 2019. A small-molecule pan-Id antagonist inhibits pathologic ocular neovascularization. Cell reports, 29, 62\u0026ndash;75. e7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYANG, Y., LUO, N.-S., YING, R., XIE, Y., CHEN, J.-Y., WANG, X.-Q., GU, Z.-J., MAI, J.-T., LIU, W.-H. \u0026amp; WU, M.-X. 2017. Macrophage-derived foam cells impair endothelial barrier function by inducing endothelial-mesenchymal transition via CCL-4. International journal of molecular medicine, 40, 558\u0026ndash;568.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYU, M., WU, X., WANG, J., HE, M., HAN, H., HU, S., XU, J., YANG, M., TAN, Q. \u0026amp; WANG, Y. 2022. Paeoniflorin attenuates monocrotaline-induced pulmonary arterial hypertension in rats by suppressing TAK1-MAPK/NF-κB pathways. International Journal of Medical Sciences, 19, 681.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG, K., CHEN, Y., ZHANG, T., HUANG, L., WANG, Y., YIN, T., QIU, J., GREGERSEN, H. \u0026amp; WANG, G. 2018. A novel role of Id1 in regulating oscillatory shear stress-mediated lipid uptake in endothelial cells. Annals of biomedical engineering, 46, 849\u0026ndash;863.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHAO, Y.-X. \u0026amp; LIU, J. 2020. Inhibitor of differentiation 1 (ID1) facilitates the efficacy of sorafenib in non-small cell lung cancer cells through suppressing epithelial to mesenchymal transition. Medical Science Monitor: International Medical Journal of Experimental and Clinical Research, 26, e922148-1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHAO, Z., BO, Z., GONG, W. \u0026amp; GUO, Y. 2020. Inhibitor of differentiation 1 (Id1) in cancer and cancer therapy. International journal of medical sciences, 17, 995.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"ID1, AGX51, Endothelial-to-mesenchymal transition, low oscillating shear stress, Atherosclerosis","lastPublishedDoi":"10.21203/rs.3.rs-3990718/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3990718/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe lateral pressure exerted by blood on the vessel wall, called low oscillating shear stress(OSS), destroys the endothelial cell barrier function through a process called EndMT and promotes the occurrence of atherosclerosis. The specific mechanism by which OSS regulates EndMT is still unclear. Inhibitor of differentiation 1 (ID1) is controlled by shear stress as an essential force-sensitive factor, and little is known about the effect of ID1 on EndMT in OSS-mediated atherosclerosis. This study investigated the impact of ID1 inhibitors on OSS-mediated EndMT in ApoE\u0026minus;/\u0026minus; mice and TGF-β1-induced human aortic endothelial cells (HAECs). First, we found that the expression of ID1 was down-regulated. At the same time, EndMT and plaque formation occurred in the ligated left common carotid artery (OSS) compared with the unligated right common carotid artery. Then, our results showed that the ID1 inhibitor AGX51 attenuated EndMT in atherosclerosis plaques in OSS mice. However, in vitro studies show that ID1 is upregulated in TGF-β1-treated HAECs and induces EndMT.sh-ID1 or AGX51 to inhibit the EndMT process and restore the migratory ability of endothelial cells. Furthermore, ID1 overexpression promoted the occurrence of EndMT.In addition, inhibition of ID1 may inhibit OSS-induced EndMT by regulating EndMT-specific transcription factors Snail and Wnt/β-catenin signalling pathway in vivo and in vitro by Immunohistochemistry and Western blot. These results suggest that ID1 inhibitors regulate the occurrence and development of low oscillating shear stress-mediated EndMT and atherosclerosis by Ctrlling Snail and Wnt/β-catenin signalling pathways.\u003c/p\u003e","manuscriptTitle":"ID1 protein inhibitor depresses low-oscillating shear stress-mediated EndMT and atherosclerosis by Snail and Wnt/β-catenin signalling pathways","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-04 05:36:53","doi":"10.21203/rs.3.rs-3990718/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3db3a590-34e6-461a-9146-1ad33b3e210d","owner":[],"postedDate":"March 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-10T21:17:06+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-04 05:36:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3990718","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3990718","identity":"rs-3990718","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}