Effects of Pomelo Polysaccharide on fat deposition and liver health of orange-spotted grouper (Epinephelus coioides)

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract High density and intensive aquaculture of fish often lead to some nutritional and metabolic related diseases. This experiment was designed to investigate the effect of Pomelo Polysaccharide on reducing fat deposition. Five groups of feeds were prepared: control group, low-fat diet group (7.57% fat content), low-fat diet with pomelo polysaccharide group (TDF1 group), high-fat diet group (15.48% fat content), and high-fat diet with pomelo polysaccharide group (TDF2 group). Orange-spotted groupers after 8 weeks of rearing, samples were taken to analyze the growth performance, nutrient composition, liver morphology, enzyme activities and the expression of immune-related genes in liver tissues. The results showed that the weight gain rate (WGR) of groupers in the low-fat diet group was significantly lower than the control group (P < 0.05), while the TDF1 group and TDF2 group were higher than those in the low-fat diet group and high-fat diet group, respectively. Liver damage occurred in the low-fat diet group and the high-fat diet group, while the TDF1 group and the TDF2 group showed improvement in liver tissue structure damage, and the liver lipid droplets in the TDF 2 group decreased significantly compared with the high-fat diet group. Moreover, the TDF2 group significantly inhibited the up-regulation of inflammation and apoptosis-related genes IL-1β, IL-8, caspase-3, and caspase-8. These results indicate that the addition of pomelo polysaccharide can reduce the fat deposition in the liver caused by feeding high-fat feeds, and can have a certain effect on the enhancement of immune function and improve the health of liver of groupers.
Full text 152,786 characters · extracted from preprint-html · click to expand
Effects of Pomelo Polysaccharide on fat deposition and liver health of orange-spotted grouper (Epinephelus coioides) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of Pomelo Polysaccharide on fat deposition and liver health of orange-spotted grouper (Epinephelus coioides) 潇潇 张, Yingxin Wu, Zizhen Sun, Xianzi Zeng, Li Lin, Yifan Liu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4295991/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract High density and intensive aquaculture of fish often lead to some nutritional and metabolic related diseases. This experiment was designed to investigate the effect of Pomelo Polysaccharide on reducing fat deposition. Five groups of feeds were prepared: control group, low-fat diet group (7.57% fat content), low-fat diet with pomelo polysaccharide group (TDF1 group), high-fat diet group (15.48% fat content), and high-fat diet with pomelo polysaccharide group (TDF2 group). Orange-spotted groupers after 8 weeks of rearing, samples were taken to analyze the growth performance, nutrient composition, liver morphology, enzyme activities and the expression of immune-related genes in liver tissues. The results showed that the weight gain rate (WGR) of groupers in the low-fat diet group was significantly lower than the control group ( P < 0.05), while the TDF1 group and TDF2 group were higher than those in the low-fat diet group and high-fat diet group, respectively. Liver damage occurred in the low-fat diet group and the high-fat diet group, while the TDF1 group and the TDF2 group showed improvement in liver tissue structure damage, and the liver lipid droplets in the TDF 2 group decreased significantly compared with the high-fat diet group. Moreover, the TDF2 group significantly inhibited the up-regulation of inflammation and apoptosis-related genes IL-1β, IL-8, caspase-3, and caspase-8. These results indicate that the addition of pomelo polysaccharide can reduce the fat deposition in the liver caused by feeding high-fat feeds, and can have a certain effect on the enhancement of immune function and improve the health of liver of groupers. Pomelo fruit polysaccharide Epinephelus coioides Liver injury Fat deposition Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction China is a large aquaculture country, our proportion of aquaculture output is as high as 70% of the world output. High-density intensive aquaculture has become an important development trend. In the context of the expansion of aquaculture scale, in order to improve fish production and make full use of resources and space, the breeding density and quantity continue to increase, resulting in a significant incidence of fish disease. The rise has seriously affected the healthy development of the aquaculture industry. Nutritional metabolic diseases are the general term for nutritional diseases and metabolic disorders or disruptive diseases, such as excessive accumulation of fat, fatty liver and cirrhosis (Zhang and Xie ,2020). This is due to excessive, insufficient or unbalanced certain nutrients in the fish, resulting in excessive nutrition, deficiency or abnormal metabolism (Lin ,et al,2024). Excessive fat accumulation and fatty liver disease in farmed fish are common phenomena in large-scale aquaculture (Huang ,et al,2022). There are various factors that induce excessive deposition of fish fat and fatty liver. Fat provides energy and essential fatty acids for fish (Baoshan ,et al,2019), which has the effect of saving protein and reasonably improving the fat level of feed which can promote the growth of fish (Chen ,et al,2021). Due to the productive demand for the rapid growth of breeding varieties, most of the breeding production uses excessive feeding of feed and high-fat feed to effectively improve the growth rate of breeding varieties in the short term. Therefore, it is easy to cause feed fat to exceed their own needs, leading to excessive deposition of fat in the liver or abdominal cavity of farmed fish (Lee ,et al ,2002). Natural plants and their extracts have the functions of promoting growth, improving immunity, enhancing intestinal barrier function, inhibiting and removing pathogens, and improving antioxidant properties. They are added to feed and are widely used in breeding production (Tainaka ,et al ,2011). China has a variety of grapefruit varieties, large yields and a wide range of planting. The main production areas are concentrated in the southeast coastal areas. Grapefruit has high edible value and medicinal value. In addition to the crisp and sweet pulp, grapefruit peel is rich in flavonoids, dietary fiber, polysaccharides, essential oils and other active ingredients, which have the effects of lowering cholesterol, lowering blood sugar, anti-aging, anti-cancer, etc. (Tocmo ,et al,2004). Grapefruit polysaccharide has a lipid-lowering effect on hyperlipidemia mice, and to a certain extent, it has a preventive effect on atherosclerosis (Giamperi ,et al ,2004). Grapefruit polysaccharide is a natural antioxidant with high safety performance. Its anti-oil oxidation ability has a dose effect relationship with its content (Ni ,et al,2023). Grapefruit peel polysaccharide is a natural antioxidant substance with high safety performance. Its anti-oil oxidation ability has a dose effect relationship with its content (Tocmo ,et al,2020). Grapefruit has a long history of planting in China and is very rich in resources. Its young fruits are usually discarded in the cultivation process. The bioactive ingredient of grapefruit is used as an effective additive to add to the feed for breeding production, which not only improves the comprehensive utilization rate of raw materials, turns waste into treasure, reduces costs, but also reduces environmental pollution. At present, grapefruit polysaccharides are not studied much in fish. Epinephelus coioides ( Epinephelus coioides ) is an important marine product creature in China with high economic value. Due to its huge market demand, with the continuous development of artificial breeding technology, it has become an important economic fish in China's coastal areas (Zhang and Xie ,2020;Ph ,et al,2022). This article aims to provide a reference for the in-depth development and utilization of grapefruit polysaccharide in the field of aquatic products by exploring the impact of grapefruit polysaccharide on reducing grouper fat deposition and keep liver health. Materials and methods 1.1 Materials and reagents The Orange-spotted grouper used for the test is provided by the Guangdong Marine Fisheries Test Center, and the average body mass is about 11 g. Alanine transaminase (ALT) determination kit, gluten transaminase (AST) determination kit, superoxide dismutase (SOD) determination kit, superoxide dismutase (SOD) determination kit were purchased in Nanjing Institute of Bioengineering; Hematoxylin staining solution and Eosin were purchased in Baso, Zhuhai. Technology Co., Ltd. 1.2 Test feed According to the nutritional needs of grouper, 5 groups of nitrogen feed were prepared, namely: control group, low-fat group, TDF1 group (low-fat feed with 400 mg/kg grapefruit polysaccharide), high-fat group, and TDF2 group (high-fat feed with 400 mg/kg grapefruit polysaccharide). The grapefruit polysaccharide used in this experiment is a plant polysaccharide extracted from the young fruit of Grapefruit. After the grapefruit is diced, a heteropolysaccharide with a molecular weight of 3.31 ku and a particle size of 101 µm is extracted from the laboratory (Lin ,et al,2023). The composition of the feed formula is shown in Table 1 . The feed raw materials of each group of the test are crushed with a grinder, then pass the 60-purpose sieve and stir it evenly in a certain proportion. Then squeeze it into about 1 mm through a double-helix squeezer, and then use the granulation machine to squeeze it into 2–3 mm of particles. Dry all the prepared feed naturally at room temperature, and then store it in the − 20℃ refrigerator for later use. Table 1 Composition of experimental diets for grouper (g·kg − 1 ) Raw material Control Low-fat group TDF1 group High-fat group TDF2 group White fish meal 460.00 460.00 460.00 460.00 460.00 Soybean meal 180.00 190.00 190.00 180.00 180.00 flour 220.00 250.00 249.60 190.00 189.60 Soybean oil 35.00 15.00 15.00 50.00 50.00 Fish oil 35.00 15.00 15.00 50.00 50.00 Beer yeast powder 20.00 20.00 20.00 20.00 20.00 Monocalcium phosphate 10.00 10.00 10.00 10.00 10.00 Lecithin 10.00 10.00 10.00 10.00 10.00 Choline chloride (50%) 5.00 5.00 5.00 5.00 5.00 Vitamin C 5.00 5.00 5.00 5.00 5.00 Compound vitamin mineral salt 20.00 20.00 20.00 20.00 20.00 Pomelo polysaccharide 0.00 0.00 0.40 0.00 0.40 Nutrient levels (%) Moisture 5.33 5.57 5.60 5.72 5.69 Crude protein 46.78 45.45 45.66 46.41 46.54 Crude lipid 11.06 7.57 7.15 15.48 15.22 Ash 12.64 11.83 12.17 12.36 11.85 1.3 Experimental Animals and Feeding Management Before the formal test, feed the grouper with basic feed for 2 weeks, so that the test fish has a good adaptability to the feed and the breeding environment. After the temporary adaption period, the formal experiment will begin. In this test, grouper was divided into 5 groups, with 3 repetitions in each group, each repeating 20 fish, the breeding period was lasted 8 weeks, and the feed was fed at 8:00 and 16:00 every day. During the breeding period, the water temperature is 24 ~ 26℃, the dissolved oxygen mass concentration is 7.5 ~ 8.0 mg·L-1, the ammonia nitrogen mass concentration ≤ 0.20 mg·L-1, the nitrite mass concentration < 0.01 mg·L-1, natural light and other test conditions. 1.3.1 Sample collection After the feeding test, the experimental fish will be fasted for 24 hours. Before sampling, the experimental fish was anesthetized with eugenol anesthetic, and then each group of experimental fish was counted and weighed to calculate the growth data. Take out the liver and viscera and weigh them, and calculate the hepatopancreas somatic indices(HSI) and viscerosomatic index (VSI). Cut the liver into small pieces and quickly freeze it in liquid nitrogen and store it in a -80℃ refrigerator for subsequent molecular experimental analysis. 1.4 Sample detection 1.4.1 Determination of growth performance At the beginning and the end of the test, each group of grouper is counted and weighed respectively, and then the growth measure of each group of grouper is calculated according to the following formula. Weight gain rate (WGR, %) = 100 × (final average weight - initial average weight) / initial average weight, fullness (CF, g·cm − 3 ) fullness = 100 × body mass/body length 3 , viscerosomatic index (VSI, %) = 100 × viscera weight/body mass, hepatopancreas somatic indices (HSI, %) = 100 × liver weight/body mass. 1.4.2 Determination of muscle structure characteristics Take out the thornless muscles in the sample to be tested and cut them into small cubes with a side length of 2.5cm. Use a disk probe with a diameter of 75mm, with a measuring range of 250N. The recovery height of the sample is 25mm, and the deformation percentage is 30%. The detection speed is set to 30, and the initial applied force is 0.375N. 1.4.3 Determination of conventional nutrients The analysis of conventional nutrients in feed and fish adopts the AOAC method (Horwitz ,1995). Among them, the moisture content was determined by 105℃ constant temperature drying weight loss method (GBT6435-2014); the crude protein content was determined by the Kjeldahl nitrogen determination method (GBT24318-2009); the crude fat content was determined by the Soxhlet extraction method (GB 5009.6–2010); coarse ash The content was determined by the high-temperature burning method of Muffle furnace (GBT6438-2007) (Hinz ,2007). 1.4.4 Detection of liver function indicators and enzyme activity The blood sample of the fish was centrifuged by a 3,000 r·min-1 centrifuge for 15 minutes at 4 ℃ to obtain the serum, and then the content was detected with alanine aminotransferase (ALT) and gluten transaminase (AST) kits. The enzyme activity detection takes about 1g of liver samples, then homogenizes them with a homogenizing machine, put the prepared liver homogenizing fluid into a low-temperature low-speed centrifuge, centrifuge at a speed of 3,000 r·min-1 for 10 minutes, take the supernatant, and determine the activity of superoxide dismutase (SOD) and malondialdehyde (MDA) according to the instructions on the kit. Please refer to the instructions for the determination steps. 1.4.5 Observation of liver tissue section Take an appropriate amount of 4% polyformaldehyde solution in the centrifuge tube and place the liver sample for fixation. For histological testing, the liver sample was put into alcohol for dehydration, and then embedded in the paraffin. Cut it into thin paraffin slices of about 6 µm with a slicer, and then dye it with H&E (Hematoxylin staining solution and Eosin). During histochemical observation, the liver tissue is made into frozen slices and stained with oil red O. Observe the slices with an optical microscope and take photos to save them. 1.4.6 Real-time fluorescence quantitative PCR detection The total RNA extraction of hepatocytes is extracted by TRIzol lysis. HiScript® Q Select RT Super Mix reverse transcription is used to dilute the cDNA by 5 times, followed by a 96-hole plate. With a 20µL reaction system, each hole is added 0. 4µL, Mix10µL, cDNA4µL, finally adjust to 20µL with water, then put into the instrument, fluorescence quantitative PCR reaction program: 94℃ 30s, 94℃ 5s, 50–60℃ 15s, 72℃ 10s, 40 cycles, QRT-pcr detect the expression level of the related gene, relative expression of the gene is calculated by using the 2 −ΔΔCT method. The primer is synthesized by Shanghai Jerry Biotechnology Co., Ltd. (Table 2 ) (Tan ,2018). Table 2 Primer design for related genes in this study. Primers qPCR primers, forward/reverse (5’to3’) IL-1β F: CTCCACCGACTGATGAGGATATG R: GGCTGTTATTGACCCGAACTAAG IL-8 F: GGCACCAAACAAACCAAAAAAC R: GTCAAGCAACTCCAGACCATCA IL-12 F: TTTTCCTGGTTATGTTTCGTGG R: TTGCTTGTAGAGCCCTTTTGC Caspase-3 F: AGAACACACCCTCGTCTCCAT R: AATTTCCCCAGCATCGGC Caspase-8 F: AGCCCAAATTGTTCTTCATCC R: CGACCTGCGTCTTCTTCCA β-Actin F: GCCCCACCAGAGCGTAAATA R: CATCGTACTCCTGCTTGCTGAT 1.5 Data and analysis The test data is analyzed by one-way ANOVA using SPSS 21.0 software. The results are expressed as "average ± standard deviation (x ± s)". If the difference between processing is significant, Duncan's is further used for multiple comparisons, when P < 0.05 , the difference is statistically significant. Results 2.1 Effects of adding grapefruit polysaccharides to feed on the growth performance of grouper After 8 weeks of breeding experiments, the impact of adding grapefruit polysaccharides to grouper feed on their growth performance is shown in Table 3 . Compared with the control group, the weight gain rate (WGR) of grouper in the low-fat group decreased significantly ( P < 0.05 ), and the condition factor (CF), viscerosomatic index (VSI) and hepatopancreas somatic indices (HSI) in the high-fat group increased significantly ( P < 0.05 ); while the viserosomatic index (VSI) in the TDF2 group was significantly lower than high. Fat group ( P < 0.05 ). Table 3 Effects of Pomelo Pectin Addition in Feed on the Growth Performance of Grouper Item Control Group Low-fat Group TDF1 Group High-fat Group TDF2 Group IBW (g) 11.18 ± 0.19 11.32 ± 0.51 11.06 ± 0.41 10.43 ± 0.44 10.40 ± 0.27 FBW (g) 54.36 ± 4.63 b 44.86 ± 2.26 a 47.74 ± 4.05 ab 45.12 ± 1.06 a 49.27 ± 1.33 ab WGR (%) 385.89 ± 32.82 b 296.22 ± 2.19 a 331.32 ± 20.64 ab 332.76 ± 8.03 ab 374.03 ± 25.02 b CF (g/cm 3 ) 1.42 ± 0.02 ab 1.29 ± 0.03 a 1.33 ± 0.09 a 1.56 ± 0.04 c 1.48 ± 0.02 bc VSI (%) 9.17 ± 0.32 a 9.20 ± 0.40 a 8.98 ± 0.06 a 12.16 ± 1.92 b 9.89 ± 0.09 ab HSI (%) 1.75 ± 0.25 a 1.41 ± 0.06 a 1.75 ± 0.01 a 2.62 ± 0.12 c 2.21 ± 0.08 b Note: Different letters on top of data columns indicate significant differences ( P < 0.05 ) 2.2 Effect of adding grapefruit polysaccharide to feed on the muscular properties of grouper The effect of adding grapefruit polysaccharides in the feed on the muscle structure characteristics of groupers is shown in Table 4 . Compared with the control group, the muscle first cycle hardness of the low-fat group and the muscle adhesion of the high-fat group are significantly reduced (P < 0.05), and the hardness and elasticity of the muscle second cycle of the TDF2 group are significantly higher than that of the high-fat group ( P < 0.05 ) . Table 4 Determination Results of Muscle Texture Characteristics of Grouper Fillets (n = 3) Item Control Group Low-fat Group TDF1 Group High-fat Group TDF2 Group First Cycle Hardness /N 7.39 ± 0.40 bc 6.01 ± 0.14 a 7.06 ± 0.43 abc 6.42 ± 0.42 ab 8.05 ± 0.44 c Second Cycle Hardness /N 8.81 ± 0.48 ab 7.72 ± 0.49 ab 7.78 ± 0.48 ab 7.06 ± 0.42 a 8.98 ± 0.70 b Adhesiveness /N·mm 0.33 ± 0.03 b 0.25 ± 0.01 ab 0.25 ± 0.01 ab 0.21 ± 0.02 a 0.31 ± 0.05 ab Cohesiveness /Ratio 0.35 ± 0.00 0.38 ± 0.01 0.38 ± 0.01 0.34 ± 0.01 0.36 ± 0.02 Springiness /mm 2.66 ± 0.11 ab 2.37 ± 0.14 ab 2.51 ± 0.09 ab 2.29 ± 0.10 a 2.71 ± 0.11 b Gumminess /N 7.18 ± 2.48 6.17 ± 0.97 5.78 ± 0.71 4.43 ± 0.33 5.86 ± 0.38 Chewiness /mJ 19.48 ± 7.06 13.31 ± 1.19 14.41 ± 1.40 10.12 ± 0.82 15.92 ± 1.41 Note: Different letters on top of data columns indicate significant differences ( P < 0.05 ) 2.3 Effects of adding grapefruit polysaccharides to feed on whole grouper fish and muscle nutrients The whole fish and muscle nutrients of groupers in the control group and each experimental group are shown in Table 5 . Compared with the control group, the crude protein content of whole fish in the low-fat group and the high-fat group was significantly reduced ( P < 0.05 ), the muscle crude protein content trend was consistent as well; the content of whole fish crude protein in the TDF2 group was significantly higher than that of the high-fat group ( P < 0.05 ), while the content of muscle crude protein in the TDF1 group was significantly higher than that of the low group. The crude fat content of whole fish and muscle in the low-fat group was significantly lower than that in the control group, the high-fat group was significantly higher, and the crude fat content of whole fish and muscle in the TDF2 group was significantly lower than that of the high-fat group ( P < 0.05 ). Table 5 Effects of Pomelo Pectin Addition in Feed on the Nutrient Composition of Whole Grouper and Muscle Item Control Group Low-fat Group TDF1 Group High-fat Group TDF2 Group Whole body(%) Moisture 66.65 ± 0.81 67.14 ± 1.99 68.07 ± 2.38 67.67 ± 2.7 67.79 ± 1.93 Crude protein 20.27 ± 0.37 c 18.71 ± 0.21 ab 19.16 ± 0.23 ab 18.26 ± 0.5 a 19.52 ± 0.35 bc Crude lipid 8.77 ± 0.26 c 5.74 ± 0.66 a 6.77 ± 0.05 b 10.53 ± 0.29 d 9.47 ± 0.27 c Ash 5.85 ± 0.16 5.72 ± 0.15 5.92 ± 0.24 6.01 ± 0.24 5.63 ± 0.17 Muscle(%) Moisture 75.47 ± 0.15 76.09 ± 3.33 77.79 ± 2.01 79.08 ± 0.71 77.27 ± 1.29 Crude protein 23.35 ± 0.08 b 21.57 ± 0.09 a 23.3 ± 0.57 b 21.65 ± 0.57 a 22.53 ± 0.68 ab Crude lipid 2.93 ± 0.09 b 2.12 ± 0.06 a 2.25 ± 0.05 a 3.67 ± 0.16 c 2.93 ± 0.02 b Ash 1.43 ± 0.04 ab 1.35 ± 0.02 a 1.45 ± 0.06 ab 1.56 ± 0.06 b 1.47 ± 0.09 ab Note: Different letters on top of data columns indicate significant differences ( P < 0.05 ) 2.4 Results of liver histopathology The liver tissue morphology of the oblique grouper was analyzed by HE staining (Fig. 1 ). The liver tissue cells of the control group were evenly distributed and the cell morphology was normal. The nucleus was located in the center of the cell, and there was no pyknosis offset, and it was round or elliptic (Fig. 1 -A). Compared with the control group, the gap between the liver tissue of the grouper fish in the low-fat group increased, the liver cells were loosely arranged, the liver cells were slightly vacuolated, and the cell membrane dissolution and nuclear offset occurred (Fig. 1 -B). Compared with the low-fat group, the gap between liver tissue in the TDF1 group was smaller, the cell arrangement was normal, and there were few cell Vacuoles (Fig. 1 -C). The cell structure of the high-fat group was not clear, the cell membrane boundary was blurred, the cells were seriously hollowed, the nucleus of some cells was offset, deformed and even dissolved, and liver tissue cells were seriously damaged (Fig. 1 -D). The gap between liver tissue in the TDF2 group was significantly reduced, the liver cells were neatly arranged, the shape was normal, the edges were clear, the nucleus was more distributed in the middle of the cells, and the phenomenon of cell vacuolization was significantly reduced (Fig. 1 -E). 2.5 Liver histochemical detection From the oil red O staining slice in Fig. 2 , it can be seen that the content of fat droplets in the low-fat group was less, and the area of liver fat droplets continues to increased with the increase of feed fat level. The phenomenon of fat droplet fusion occurred in the high-fat group, and the liver fat deposition increases significantly. After adding grapefruit polysaccharides, the area of fat droplets in the high-fat group was significantly reduced. 2.6 Liver function indicators and enzyme activity test results It can be seen from Fig. 3 that compared with the control group, the activity of alanine transaminase (ALT) and glutamate transaminase (AST) in the low-fat group and the high-fat group was significantly higher ( P < 0.05 ), and the activity of TDF1 and TDF2 group was significantly lower than that of the low-fat group and the high-fat group ( P < 0.05 ). The content of malondialdehyde (MDA) in the low-fat group and the high-fat group was significantly higher than that of the control group ( P < 0.05 ) (Fig. 3 C), and the content of malondialdehyde (MDA) in the TDF1 group and the TDF2 group was significantly lower than that of the low-fat group and the high-fat group ( P < 0.05 ). It can be seen from Fig. 3 D that the superoxide dismutase (SOD) activity of TDF1 and TDF2 group was significantly higher than that of the low-fat group and the high-fat group ( P < 0.05 ). 2.7 Expression of genes related to immune inflammation and apoptosis The effect of adding grapefruit polysaccharide in the feed on immune inflammation and apoptosis-related gene expression of grouper is shown in Fig. 4 . Compared with the control group, the expression level of IL-1β in the low-fat group and the high-fat group was higher ( P < 0.05 ), and the expression level of the TDF2 group was significantly lower than that in the high-fat group ( P < 0.05 ), the trend of IL-8 was also similar; the expression levels of caspase3 and caspase8 were significantly higher in the high-fat group than in the control group ( P < 0.05 ), the low-fat group was significantly lower than in the control group ( P < 0.05 ), and the TDF2 group was significantly lower than in the high-fat group ( P < 0.05 ); in the low-fat group The expression level of caspase8 was significantly higher than that of TDF1 group ( P < 0.05 ). Discussion Natural plant extracts are widely used in research and production due to their rich resources, low cost, green source, small toxic and side effects to animals, and no harmful drug residues. At present, a large number of studies have shown that plant extracts contribute to the growth of animals. The body composition of fish is affected by the nutritional level of feed, breeding environment, fish species, age, sex and other factors, among which feed is the main factor affecting the body composition of the fish. The protein and fat content in fish is an important factor that reflects the quality of muscle nutrition (Wang ,2024). The high fat content in the feed will cause fat deposition in the liver, abdominal cavity, muscles and other tissues of the fish, affecting the health of the fish (Yang ,2024). Liver ratio and visceral ratio are important indicators reflecting the development of the liver and viscera of fish. Studies have shown that the content of lipids in feed has a significant impact on the viscerosomatic index and hepatopancreas somatic indices of fish (Wang ,2023). When fish consumes too much fat, its viscerosomatic index and hepatopancreas somatic indices will also increase (Mi ,et al,2024 ;Wei ,et al,2024 ;Zhao ,et al,2023). Previous studies of the author's team have shown that when the fat content of grouper exceeds 15%, it will cause liver fat deposition, leading to lipid metabolism disorders, liver damage, and a decline in growth rate, which will also lead to large-scale death (Li ,et al,2018 ;Zou ,et al,2021 ;Zou ,et al,2019). In this test, the viscerosomatic index of grouper fish in the high-fat group fed with high-fat diet was significantly higher than that of other groups, indicating that there was excess fat accumulated in the fish. Adding plant extracts can reduce fish body fat deposition and improve fish quality. The study found that the addition of wolfberry polysaccharides to the feed can significantly reduce the hepatopancreas somatic indices of spotted sea bass (Huang ,et al,2023). The intake of a high-fat diet (HFD) will reduce the muscle mass of aquatic animals, and sanguinarine( sanguinarine ) can improve the muscle mass of Ctenopharyngodon Idella( Ctenopharyngodon Idella ) by reducing fat deposition and increasing protein content (Shi ,et al,2024). Sun and other learners’ research have found that supplementing 1.12 or 1.18 g/kg Taurine( Taurine ) in non-fish meal (NFM) diet can improve the fillet quality and muscle antioxidant capacity of grass carp (Sun ,et al,2024). The research results of this experiment are also consistent with it. After adding grapefruit polysaccharides to high-fat feed, the content of whole grouper fish fat and muscle coarse fat decreased significantly. At the same time, the content of fat droplets was observed by liver oil red O staining. It was found that after adding grapefruit polysaccharides, the content of fat droplets in the high-fat group was significantly reduced, indicating that grapefruit polysaccharides can reduce fat deposition. The texture characteristics of groupers are affected by many factors, including fish type, growth environment, feed composition, feeding management, growth stage, processing process, preservation and treatment methods, etc. (Wang ,et al,2024). The texture characteristics of fish are generally shown in terms of hardness, adhesion, cohesion, elasticity, adhesiveness and chewiness (Xu ,et al,2022). Usually, if the fish becomes more solid and more elastic, the taste will be better (Wu ,et al,2021). In this experiment, adding grapefruit polysaccharides to high-fat feed can improve muscle elasticity, indicating that grapefruit polysaccharides can improve the taste of fish. The liver is the center of fish energy metabolism and also an important organ for excretion. When the liver of fish is damaged, hepatocytes will cause vacuolation, nuclear pyknosis offset, fat precipitation and other phenomena (Rhind ,et al,2011). In the pathophysiological process of the liver, the oxygen free radicals produced by lipid peroxidation and biological oxidation are considered to be an important cause of liver damage, while malondialdehyde (MDA) is a lipid peroxidation product of the liver, which can reflect the degree of liver damage. Superoxide dismutase (SOD) can remove superoxide anion free radicals, reflecting the body's ability to remove free radicals (Zhang ,et al,2023). Su Yongteng's research shows that rhubarb anthraquinone extract can significantly improve SOD vitality and reduce MDA content, indicating that rhubarb anthraquinone extract can remove free radicals in the body, improve the body's antioxidant function to a certain extent, and protect the liver from damage (Yang ,et al,2023). Yuan eta. (Yuan ,et al,2018) Studies have shown that SCAP can relieve liver damage caused by ethanol in mice, reduce MDA levels and increase SOD activity. In this experiment, it was observed that the liver tissue of grouper fish fed with high-fat feed was seriously damaged. After adding grapefruit polysaccharide, the phenomenon of hepatocyte vacuolation was reduced, the cell morphology returned to normal, the MDA content of liver tissue decreased significantly, and the SOD activity increased significantly, indicating that grapefruit polysaccharide can effectively remove the harm of free radicals, protect cells from damage and improve the liver health of groupers. Plant polysaccharides also show immune regulatory activity (Liu ,et al,2011; Güroy ,et al,2022). The study found that polysaccharides extracted from Auricularia heimuer(Auricularia heimuer) can significantly inhibit the secretion of NO, TNF-α and IL-6 (Jen ,et al,2021). Ginger polysaccharide can promote myeloid-derived suppressor cell apoptosis by regulating lipid metabolism (Song ,et al,2023). After adding grapefruit polysaccharides in this test, the expression levels of IL-1β and IL-8 in the TDF2 group were significantly lower than that of the high-fat group. This shows that the addition of grapefruit polysaccharides to the feed has an anti-inflammatory effect, which helps to reduce the inflammatory reaction thus reduce the damage caused by excessive inflammation. The expression level of apoptosis-related genes caspase3 and caspase8 decreased significantly in the TDF2 group, indicating that grapefruit polysaccharide can inhibit the apoptosis process in groupers. Conclusion In summary, this test confirms that the addition of grapefruit polysaccharides to the feed can improve the quality of the fish body, reduce the fat content of the liver, muscles and whole fish, reduce the deposition of fat in the fish body, promote the immune function of grouper, and protect the liver from damage. The test results provide reference for plant extracts as feed additives to reduce fish fat deposition and improve seawater fish health. Declarations Data availability All data generated or analysed during this study are included in this published article. Acknowledgments This research was supported by grants from the Guangdong “Climbing” Program [pdjh2022a0247], College Student Innovation and Entrepreneurship Training Program Project (S202311347007), Research, development and application of quality assurance technology for Lingnan aquatic products prefabricated dishes, and key construction discipline scientific research capacity improvement project in Guangdong Province (2022ZDJS022), the National Natural Science Foundation of China (4210061024) and the Social Welfare and Basic Research Fund of Zhongshan City(2022B2003). Authors and Affiliations (作者和单位) College of Animal Science & Technology, Zhongkai University of Agriculture and Engineering , Guangzhou 510225, China Xiaoxiao Zhang, Yingxin Wu, Zizhen Sun, Xianzi Zeng, Li Lin, Yifan Liu, Zhendong Qin,Weidong Bai,Peiyaun Li,Cuiyun Zou Guangdong Provincial Agricultural Technology Extension Center, Guangzhou 510520, China Jinhui Wu Da Yu Aquatic Products Co., Ltd., Maoming City, Guangdong Province, 525027, China. Baiqiao Ou Author contributions All authors contributed to the study conception and design. Material preparation was performed by Xiaoxiao Zhang, Yingxin Wu and Cuiyun Zou. Visualization was in charge of Weifan Liu. Formal analyze and investigation were completed by Cuiyun Zou, Xiaoxiao Zhang. Manuscript was written by Xiaoxiao Zhang, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data was collated by Cuiyun Zou, accuracy and authority were assured. Funding was sponsored by Baiqiao Ou, Jinhui Wu, who have provided strong funding support. Project arrangement was performed by Yingxin Wu. The project was supervised by Li Lin, Weifan Liu, Zhendong Qin, Weidong Bai, Peiyuan Li, though which, the project was proceeded with order. Bioinformatics analysis was exactly performed by Xianzi Zeng, Zizhen Sun. Corresponding authors Correspondence to Cuiyun Zou or Jinhui Wu. Ethics declarations Ethical statement All applicable international, national, and/or institutional guidelines for the care and use of animals were followed by the authors Conflict of interest The authors declare no competing interests. References Zhang X, Xie J (2020) The differential effects of endogenous cathepsin and microorganisms on changes in the texture and flavor substances of grouper ( Epinephelus coioides ) fillets. RSC Adv 10(18):10764–10775. 10.1039/d0ra01028f Lin X, Liu Z, Xiao Y, Xie, Xiaocen, Wang Y, Li H, Wang R, Xie X, Zhang Y, Song Y, Hu W (2024) Metabolomics provides insights into the alleviating effect of dietary Caulerpa lentillifera on diquat-induced oxidative damage in zebrafish (Danio rerio) liver. Aquaculture 584:740630. https://doi.org/10.1016/j.aquaculture.2024.740630 Huang X, Liu S, Zhang H, Yao J, Geng Y, Ou Y, Chen D, Yang S, Yin L, Luo W (2022) Pathological characterization and cause of a novel liver disease in largemouth bass (Micropterus salmoides). Aquaculture Rep 23:101028. https://doi.org/10.1016/j.aqrep.2022.101028 Baoshan L, Jiying W, Yu H, Tiantian H, Shixin W, BingShan H, Yongzhi S (2019) Effects of replacing fish oil with wheat germ oil on growth, fat deposition, serum biochemical indices and lipid metabolic enzyme of juvenile hybrid grouper ( Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Aquaculture 505:54–62. https://doi.org/10.1016/j.aquaculture.2019.02.037 Chen W, Chang K, Chen J, Zhao X, Gao S (2021) Dietary sodium butyrate supplementation attenuates intestinal inflammatory response and improves gut microbiota composition in largemouth bass ( Micropterus salmoides ) fed with a high soybean meal diet. Fish Physiol Biochem 47(6):1805–1819. 10.1007/s10695-021-01004-w Lee SM, Jeon IG, Lee JY (2002) Effects of digestible protein and lipid levels in practical diets on growth, protein utilization and body composition of juvenile rockfish (Sebastes schlegeli). Aquaculture 211(1–4):227–239. http://doi-org-s.vpn.scau.edu.cn :443/10.1016/S0044-8486(01)00880-8 Tainaka T, Shimada Y, Kuroyanagi J et al (2011) Transcriptome analysis of anti-fatty liver action by Campari tomato using a zebrafish diet-induced obesity model. Nutr Metab (Lond) 8:88. 10.1186/1743-7075-8-88 Tocmo R, Pena-Fronteras J, Calumba KF, Mendoza M, Johnson JJ (2020) Valorization of pomelo (Citrus grandis Osbeck) peel: A review of current utilization, phytochemistry, bioactivities, and mechanisms of action. Compr Rev Food Sci Food Saf 19(4):1969–2012. 10.1111/1541-4337.12561 Giamperi L, Fraternale D, Bucchini A, Ricci D (2004) Antioxidant activity of Citrus paradisi seeds glyceric extract. Fitoterapia 75(2):221–224. 10.1016/j.fitote.2003.12.010 Ni J, Shangguan YC, Jiang LL et al (2023) Pomelo peel dietary fiber ameliorates alterations in obesity-related features and gut microbiota dysbiosis in mice fed on a high-fat diet. Food Chem X 20:100993. http://doi-org-s.vpn.scau.edu.cn:443/ 10.1016/j.fochx.2023.100993 Tocmo R, Pena-Fronteras J, Calumba KF, Mendoza M, Johnson JJ (2020) Valorization of pomelo (Citrus grandis Osbeck) peel: A review of current utilization, phytochemistry, bioactivities, and mechanisms of action. Compr Rev Food Sci Food Saf 19:1969–2012. https://doi.org/10.1111/1541-4337.12561 Ph L, Yj C, Xl Z, Jd Y, Sq Y, Sn WH, Jg WSZ, Qw W, Hy Q, S (2022) Epinephelus coioides Hsp27 negatively regulates innate immune response and apoptosis induced by Singapore grouper iridovirus (SGIV) infection. Fish Shellfish Immunol 120. https://doi.org/10.1016/j.fsi.2021.12.016 Lin B, Wang S, Zhou A, Hu Q, Huang G (2023) Ultrasound-assisted enzyme extraction and properties of Shatian pomelo peel polysaccharide. Ultrason Sonochem 98:106507. 10.1016/j.ultsonch.2023.106507 HORWITZ W (1995) Official methods of analysis of AOAC International[J]. Trends Food Sci Technol 6(11):382–382 Hinz DC (2007) Efficiency improvement for sulfated ash determination by usage of a microwave muffle furnace. J Pharm Biomed Anal 43(5):1881–1884. 10.1016/j.jpba.2007.01.005 Tan X, Sun Z, Liu Q et al (2018) Effects of dietary ginkgo biloba leaf extract on growth performance, plasma biochemical parameters, fish composition, immune responses, liver histology, and immune and apoptosis-related genes expression of hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀) fed high lipid diets. Fish Shellfish Immunol 72:399–409. 10.1016/j.fsi.2017.10.022 Wang L, Xiong J, Xu C, Qin C, Zhang Y, Yang L, Zhi S, Feng J, Nie G (2024) Comparison of muscle nutritional composition, texture quality, carotenoid metabolites and transcriptome to underling muscle quality difference between wild-caught and pond-cultured Yellow River carp ( Cyprinus carpio haematopterus ). Aquaculture 581, 740392. https://doi.org/10.1016/j.aquaculture.2023.740392 Yang B, Shen Y, Monroig Ó, Zhao W, Bao Y, Tao S, Jiao L, Zhou Q, Jin M (2024) The ameliorative role of methionine in hepatic steatosis and stress response in juvenile black seabream ( Acanthopagrus schlegelii ) fed with a high-fat diet. Aquaculture 580:740306. https://doi.org/10.1016/j.aquaculture.2023.740306 Wang Z, Wang X, Li J, Gong Y, Li Q, Bu X, Lai W, Wang Y, Liu Y, Yao C, Mai K, Ai Q (2023) Effects of cannabidiol on growth performance, appetite, antioxidant capacity and liver inflammatory gene expression of juvenile large yellow croaker (Larmichthys crocea) fed diets with high soybean oil level. Aquaculture 574:739658. https://doi.org/10.1016/j.aquaculture.2023.739658 Mi J, Liu D, Qin C, Yan X, Yang L, Xu X, Nie G (2024) (–)-Epigallocatechin-3-O-gallate or (–)-epicatechin enhances lipid catabolism and antioxidant defense in common carp (Cyprinus carpio L.) fed a high-fat diet: Mechanistic insights from the AMPK/Sirt1/PGC-1α signaling pathway. Aquaculture 587:740876. https://doi.org/10.1016/j.aquaculture.2024.740876 Wei M, Song L, Yuan X, Li H, Ji H, Sun J (2024) Dietary supplementation with a PPARγ agonist promotes adipocyte hyperplasia and improves high-fat diet tolerance and utilization in grass carp (Ctenopharyngodon idellus). Aquaculture 578:740081. https://doi.org/10.1016/j.aquaculture.2023.740081 Zhao W, Yao R, Wei H-L, Guo Y-C, Chen A-Q, Chen B-Y, Jin-Niu (2023) Astaxanthin, bile acid and chlorogenic acid attenuated the negative effects of high-fat diet on the growth, lipid deposition, and liver health of Oncorhynchus mykiss. Aquaculture 567:739255. https://doi.org/10.1016/j.aquaculture.2023.739255 LI SL, LI Z Q, CHEN NS et al (2018), Dietary lipid and carbohydrate interactions: implications on growth performance, feed utilization and non-specific immunity in hybrid grouper ( Epinephelus fuscoguttatus ♀× E. lanceolatus ♂).Aquaculture, 498:568–577. http://doi-org-s.vpn.scau.edu.cn:443/ 10.1016/j.aquaculture.2018.09.015 Zou C, Fang Y, Lin N, Liu H (2021) Polysaccharide extract from pomelo fruitlet ameliorates diet-induced nonalcoholic fatty liver disease in hybrid grouper ( Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀). Fish Shellfish Immunol 119:114–127. 10.1016/j.fsi.2021.09.034 Zou C, Su N, Wu J et al (2019) Dietary Radix Bupleuri extracts improves hepatic lipid accumulation and immune response of hybrid grouper ( Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀). Fish Shellfish Immunol 88:496–507. 10.1016/j.fsi.2019.02.052 Huang Z, Ye Y, Xu A, Li Z (2023) Effects of dietary crude polysaccharides from Lycium barbarum on growth performance, digestion, and serum physiology and biochemistry of spotted sea bass Lateolabrax maculatus. Aquaculture Rep 32:101710. https://doi.org/10.1016/j.aqrep.2023.101710。 Shi Y, Zhong L, Liu Y, Xu S, Dai J, Zhang Y, Hu Y (2024) Dietary sanguinarine supplementation recovers the decrease in muscle quality and nutrient composition induced by high-fat diets of grass carp ( Ctenopharyngodon idella ). Anim Nutr. https://doi.org/10.1016/j.aninu.2024.04.001 Sun S-S, Yan L-C, Feng L, Jiang W-D, Liu Y, Tang L, Wu P, Zhou X-Q (2024) Taurine prevented the decline of fillet quality and muscle antioxidant capacity in on-growing grass carp (Ctenopharyngodon idella) fed non-fishmeal diet. Aquaculture 740921. https://doi.org/10.1016/j.aquaculture.2024.740921 Wang Z, Qiao F, Zhang W-B, Parisi G, Du Z-Y, Zhang M-L (2024) The flesh texture of teleost fish: Characteristics and interventional strategies. Reviews Aquaculture 16:508–535. https://doi.org/10.1111/raq.12849 Xu X, Yang H, Xu Z, Li X, Leng X (2022) The comparison of largemouth bass (Micropterus salmoides) fed trash fish and formula feeds: Growth, flesh quality and metabolomics. Front Nutr 9:966248. 10.3389/fnut.2022.966248 Wu H-X, Li W-J, Shan C-J, Zhang Z-Y, Lv H-B, Qiao F, Du Z-Y, Zhang M-L (2021) Oligosaccharides improve the flesh quality and nutrition value of Nile tilapia fed with high carbohydrate diet. Food Chemistry: Mol Sci 3:100040. https://doi.org/10.1016/j.fochms.2021.100040 Rhind SM, Kyle CE, Kerr C, Osprey M, Zhang ZL (2011) Effect of duration of exposure to sewage sludge-treated pastures on liver tissue accumulation of persistent endocrine disrupting compounds (EDCs) in sheep. Sci Total Environ 409(19):3850–3856. 10.1016/j.scitotenv.2011.03.021 Zhang J, Wang Z, Shi Y, Xia L, Hu Y, Zhong L (2023) Protective effects of chlorogenic acid on growth, intestinal inflammation, hepatic antioxidant capacity, muscle development and skin color in channel catfish Ictalurus punctatus fed an oxidized fish oil diet. Fish Shellfish Immunol 134:108511. 10.1016/j.fsi.2022.108511 Yang Y, Zhu X, Liu Y, Xu N, Ai X, Zhang H (2023) Effects of diets rich in Agaricus bisporus polysaccharides on the growth, antioxidant, immunity, and resistance to Yersinia ruckeri in channel catfish. Fish Shellfish Immunol 140:108941. https://doi.org/10.1016/j.fsi.2023.10894 Yuan R, Tao X, Liang S et al (2018) Protective effect of acidic polysaccharide from Schisandra chinensis on acute ethanol-induced liver injury through reducing CYP2E1-dependent oxidative stress. Biomed Pharmacother 99:537–542. 10.1016/j.biopha.2018.01.079 Liu X-L, Xi Q-Y, Yang L, Li H-Y, Jiang Q-Y, Shu G, Wang S-B, Gao P, Zhu X-T, Zhang Y-L (2011) The effect of dietary Panax ginseng polysaccharide extract on the immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol 30:495–500. https://doi.org/10.1016/j.fsi.2010.11.018 Güroy D, Güroy B, Bilen S, Terzi E, Kenanoğlu ON, García-Suárez M, Marzin D, Mantoğlu S, Karadal O, Şahin İ, Kuşku H (2022) Effects of dietary marine sulphated polysaccharides (Algimun®) on growth performance, immune responses and disease resistance of juvenile gilthead seabream (Sparus aurata) to Photobacterium damselae subsp. piscicida Fish Shellfish Immunol 127:1139–1147. https://doi.org/10.1016/j.fsi.2022.07.054 Jen CI, Su CH, Lu MK, Lai MN, Ng LT (2021) Synergistic anti-inflammatory effects of different polysaccharide components from Xylaria nigripes. J Food Biochem 45(4):e13694. 10.1111/jfbc.13694 Song C, Ji Y, Wang W, Tao N (2023) Ginger polysaccharide promotes myeloid-derived suppressor cell apoptosis by regulating lipid metabolism. Phytother Res 37(7):2894–2901. 10.1002/ptr.7784 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4295991","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":294288205,"identity":"0449aa43-0065-4366-9208-5d46b1e5931b","order_by":0,"name":"潇潇 张","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"潇潇","middleName":"","lastName":"张","suffix":""},{"id":294288206,"identity":"34471297-3a2a-40a4-82f8-d0c8b78ee348","order_by":1,"name":"Yingxin Wu","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yingxin","middleName":"","lastName":"Wu","suffix":""},{"id":294288208,"identity":"d30f71cf-e3f2-4a5e-b397-ad41a7baa182","order_by":2,"name":"Zizhen Sun","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Zizhen","middleName":"","lastName":"Sun","suffix":""},{"id":294288210,"identity":"b08b46e6-3053-4711-91c2-5bbc8a8d35b3","order_by":3,"name":"Xianzi Zeng","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Xianzi","middleName":"","lastName":"Zeng","suffix":""},{"id":294288212,"identity":"89a8e28b-d5f0-4994-9396-1a370a063a94","order_by":4,"name":"Li Lin","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Lin","suffix":""},{"id":294288214,"identity":"0dc3522a-fe21-4126-96a5-1ad08442f596","order_by":5,"name":"Yifan Liu","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yifan","middleName":"","lastName":"Liu","suffix":""},{"id":294288216,"identity":"504100d7-4fcd-46e0-99a6-51ca1438e507","order_by":6,"name":"Zhendong Qin","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Zhendong","middleName":"","lastName":"Qin","suffix":""},{"id":294288218,"identity":"5d1875ef-19ce-4b2c-9752-95bbefb7cf21","order_by":7,"name":"Weidong Bai","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Weidong","middleName":"","lastName":"Bai","suffix":""},{"id":294288219,"identity":"e88338d4-0ce4-44dc-95e1-f5ebcf2b30ff","order_by":8,"name":"Baiqiao Ou","email":"","orcid":"","institution":"Da Yu Aquatic Products Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Baiqiao","middleName":"","lastName":"Ou","suffix":""},{"id":294288223,"identity":"45a62b0c-0510-4b14-bcb1-fd9ca2ed85c7","order_by":9,"name":"Peiyaun Li","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Peiyaun","middleName":"","lastName":"Li","suffix":""},{"id":294288240,"identity":"d8d4b62a-a338-4654-9ece-b5c093d2f6eb","order_by":10,"name":"Jinhui Wu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jinhui","middleName":"","lastName":"Wu","suffix":""},{"id":294288253,"identity":"b0795578-6db3-4a79-9f5b-a12bc1885cd5","order_by":11,"name":"Cuiyun Zou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYNACAyBmb2BjbABxDhCthecASVpAQCKBSC3y7T2Gn3kKDidul3z+7OHMNgY5vhsJjJ8L8Ghh7DljLM1jcDhx5+yEdMONbQzGkjcSmKVn4NHCLJFjxgzSsuF2wjHJh20MiRtuJLAx8+DRwgbXcvNgG0hLPUEtPHAtN5jZJIEOSzAgpEWC51ix5ByDdOMNZ9LYJGeckzCceeZhszQ+LfLtzRs/vPljLbvh+PFnkj1lNvJ8x5MPfsanBQqa4bYCMSR6CIE6YhSNglEwCkbBSAUALUtKVxHJmbAAAAAASUVORK5CYII=","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":true,"prefix":"","firstName":"Cuiyun","middleName":"","lastName":"Zou","suffix":""}],"badges":[],"createdAt":"2024-04-20 05:55:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4295991/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4295991/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55242746,"identity":"8de4208b-e1ca-4af3-9fd9-4a121606fbcc","added_by":"auto","created_at":"2024-04-24 15:23:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1969083,"visible":true,"origin":"","legend":"\u003cp\u003eLiver sections stained with Hematoxylin and Eosin (HE) in each group(400×).\u003c/p\u003e\n\u003cp\u003eNote: cn: cell nucleus; va: vacuolation. (A) Control Group; (B) Low-fat Group; (C) TDF1 Group; (D) High-fat Group; (E) TDF2 Group.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4295991/v1/f671e3b584a6155db595be80.png"},{"id":55242173,"identity":"3b9e393a-545d-4070-a1ca-bf979f512cec","added_by":"auto","created_at":"2024-04-24 15:15:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2178303,"visible":true,"origin":"","legend":"\u003cp\u003eThe liver histochemistry of hybrid grouper (Oil Red O staining, original magnification 400×).\u003c/p\u003e\n\u003cp\u003eNote: Ld: lipid droplet. (A) Control Group; (B) Low-fat Group; (C) TDF1 Group; (D) High-fat Group; (E) TDF2 Group.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4295991/v1/d7e7f208090c3e452d4b2b45.png"},{"id":55242171,"identity":"4b8bb2d4-a79d-418a-9d44-558a3495fff5","added_by":"auto","created_at":"2024-04-24 15:15:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":26304,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of Antioxidant Enzymes in the Liver.\u003c/p\u003e\n\u003cp\u003eNote: A. Alanine Aminotransferase (ALT); B. Aspartate Aminotransferase (AST); C. Malondialdehyde (MDA); D. Superoxide Dismutase (SOD).\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4295991/v1/fa5d78d0938aa26a4a444452.png"},{"id":55242174,"identity":"2aef4ad9-c8e4-4bbe-b62c-9bb474dfabff","added_by":"auto","created_at":"2024-04-24 15:15:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":152224,"visible":true,"origin":"","legend":"\u003cp\u003eExpression Levels of Genes Related to Immune Inflammation and Apoptosis in the Liver\u003c/p\u003e\n\u003cp\u003eNote: Interleukin-1β (IL-1β); Interleukin-8 (IL-8); Interleukin-8 (IL-8); Caspase-3; Caspase-8\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4295991/v1/196148ac9b2cdcd63c274aa4.png"},{"id":55244470,"identity":"db682286-0866-444c-beb8-b55c75fcf3e2","added_by":"auto","created_at":"2024-04-24 15:47:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4328615,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4295991/v1/4a5199c9-9ee4-4830-bc26-665c6ed3f8f8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of Pomelo Polysaccharide on fat deposition and liver health of orange-spotted grouper (Epinephelus coioides)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChina is a large aquaculture country, our proportion of aquaculture output is as high as 70% of the world output. High-density intensive aquaculture has become an important development trend. In the context of the expansion of aquaculture scale, in order to improve fish production and make full use of resources and space, the breeding density and quantity continue to increase, resulting in a significant incidence of fish disease. The rise has seriously affected the healthy development of the aquaculture industry. Nutritional metabolic diseases are the general term for nutritional diseases and metabolic disorders or disruptive diseases, such as excessive accumulation of fat, fatty liver and cirrhosis (Zhang and Xie ,2020). This is due to excessive, insufficient or unbalanced certain nutrients in the fish, resulting in excessive nutrition, deficiency or abnormal metabolism (Lin ,et al,2024). Excessive fat accumulation and fatty liver disease in farmed fish are common phenomena in large-scale aquaculture (Huang ,et al,2022). There are various factors that induce excessive deposition of fish fat and fatty liver. Fat provides energy and essential fatty acids for fish (Baoshan ,et al,2019), which has the effect of saving protein and reasonably improving the fat level of feed which can promote the growth of fish (Chen ,et al,2021). Due to the productive demand for the rapid growth of breeding varieties, most of the breeding production uses excessive feeding of feed and high-fat feed to effectively improve the growth rate of breeding varieties in the short term. Therefore, it is easy to cause feed fat to exceed their own needs, leading to excessive deposition of fat in the liver or abdominal cavity of farmed fish (Lee ,et al ,2002).\u003c/p\u003e\n\u003cp\u003eNatural plants and their extracts have the functions of promoting growth, improving immunity, enhancing intestinal barrier function, inhibiting and removing pathogens, and improving antioxidant properties. They are added to feed and are widely used in breeding production (Tainaka ,et al ,2011). China has a variety of grapefruit varieties, large yields and a wide range of planting. The main production areas are concentrated in the southeast coastal areas. Grapefruit has high edible value and medicinal value. In addition to the crisp and sweet pulp, grapefruit peel is rich in flavonoids, dietary fiber, polysaccharides, essential oils and other active ingredients, which have the effects of lowering cholesterol, lowering blood sugar, anti-aging, anti-cancer, etc. (Tocmo ,et al,2004). Grapefruit polysaccharide has a lipid-lowering effect on hyperlipidemia mice, and to a certain extent, it has a preventive effect on atherosclerosis (Giamperi ,et al ,2004). Grapefruit polysaccharide is a natural antioxidant with high safety performance. Its anti-oil oxidation ability has a dose effect relationship with its content (Ni ,et al,2023). Grapefruit peel polysaccharide is a natural antioxidant substance with high safety performance. Its anti-oil oxidation ability has a dose effect relationship with its content (Tocmo ,et al,2020). Grapefruit has a long history of planting in China and is very rich in resources. Its young fruits are usually discarded in the cultivation process. The bioactive ingredient of grapefruit is used as an effective additive to add to the feed for breeding production, which not only improves the comprehensive utilization rate of raw materials, turns waste into treasure, reduces costs, but also reduces environmental pollution. At present, grapefruit polysaccharides are not studied much in fish. Epinephelus coioides (\u003cem\u003eEpinephelus coioides\u003c/em\u003e) is an important marine product creature in China with high economic value. Due to its huge market demand, with the continuous development of artificial breeding technology, it has become an important economic fish in China's coastal areas (Zhang and Xie ,2020;Ph ,et al,2022). This article aims to provide a reference for the in-depth development and utilization of grapefruit polysaccharide in the field of aquatic products by exploring the impact of grapefruit polysaccharide on reducing grouper fat deposition and keep liver health.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003e1.1 Materials and reagents\u003c/h2\u003e \u003cp\u003eThe Orange-spotted grouper used for the test is provided by the Guangdong Marine Fisheries Test Center, and the average body mass is about 11 g. Alanine transaminase (ALT) determination kit, gluten transaminase (AST) determination kit, superoxide dismutase (SOD) determination kit, superoxide dismutase (SOD) determination kit were purchased in Nanjing Institute of Bioengineering; Hematoxylin staining solution and Eosin were purchased in Baso, Zhuhai. Technology Co., Ltd.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1.2 Test feed\u003c/h2\u003e \u003cp\u003eAccording to the nutritional needs of grouper, 5 groups of nitrogen feed were prepared, namely: control group, low-fat group, TDF1 group (low-fat feed with 400 mg/kg grapefruit polysaccharide), high-fat group, and TDF2 group (high-fat feed with 400 mg/kg grapefruit polysaccharide). The grapefruit polysaccharide used in this experiment is a plant polysaccharide extracted from the young fruit of Grapefruit. After the grapefruit is diced, a heteropolysaccharide with a molecular weight of 3.31 ku and a particle size of 101 \u0026micro;m is extracted from the laboratory (Lin ,et al,2023). The composition of the feed formula is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The feed raw materials of each group of the test are crushed with a grinder, then pass the 60-purpose sieve and stir it evenly in a certain proportion. Then squeeze it into about 1 mm through a double-helix squeezer, and then use the granulation machine to squeeze it into 2\u0026ndash;3 mm of particles. Dry all the prepared feed naturally at room temperature, and then store it in the \u0026minus;\u0026thinsp;20℃ refrigerator for later use.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComposition of experimental diets for grouper (g\u0026middot;kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRaw material\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow-fat group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTDF1 group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHigh-fat group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTDF2 group\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWhite fish meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e460.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e460.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e460.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e460.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e460.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e180.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e190.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e190.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e180.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e180.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eflour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e220.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e250.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e249.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e190.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e189.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e35.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e50.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e50.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e35.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e50.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e50.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBeer yeast powder\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMonocalcium phosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLecithin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholine chloride (50%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCompound vitamin mineral salt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePomelo polysaccharide\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNutrient levels (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMoisture\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e45.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e45.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e46.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e46.54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude lipid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e15.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e15.22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e12.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e1.3 Experimental Animals and Feeding Management\u003c/h2\u003e \u003cp\u003eBefore the formal test, feed the grouper with basic feed for 2 weeks, so that the test fish has a good adaptability to the feed and the breeding environment. After the temporary adaption period, the formal experiment will begin. In this test, grouper was divided into 5 groups, with 3 repetitions in each group, each repeating 20 fish, the breeding period was lasted 8 weeks, and the feed was fed at 8:00 and 16:00 every day. During the breeding period, the water temperature is 24\u0026thinsp;~\u0026thinsp;26℃, the dissolved oxygen mass concentration is 7.5\u0026thinsp;~\u0026thinsp;8.0 mg\u0026middot;L-1, the ammonia nitrogen mass concentration\u0026thinsp;\u0026le;\u0026thinsp;0.20 mg\u0026middot;L-1, the nitrite mass concentration\u0026thinsp;\u0026lt;\u0026thinsp;0.01 mg\u0026middot;L-1, natural light and other test conditions.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e1.3.1 Sample collection\u003c/h2\u003e \u003cp\u003eAfter the feeding test, the experimental fish will be fasted for 24 hours. Before sampling, the experimental fish was anesthetized with eugenol anesthetic, and then each group of experimental fish was counted and weighed to calculate the growth data. Take out the liver and viscera and weigh them, and calculate the hepatopancreas somatic indices(HSI) and viscerosomatic index (VSI). Cut the liver into small pieces and quickly freeze it in liquid nitrogen and store it in a -80℃ refrigerator for subsequent molecular experimental analysis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1.4 Sample detection\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e1.4.1 Determination of growth performance\u003c/h2\u003e \u003cp\u003eAt the beginning and the end of the test, each group of grouper is counted and weighed respectively, and then the growth measure of each group of grouper is calculated according to the following formula. Weight gain rate (WGR, %)\u0026thinsp;=\u0026thinsp;100 \u0026times; (final average weight - initial average weight) / initial average weight, fullness (CF, g\u0026middot;cm\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e) fullness\u0026thinsp;=\u0026thinsp;100 \u0026times; body mass/body length \u003csup\u003e3\u003c/sup\u003e, viscerosomatic index (VSI, %)\u0026thinsp;=\u0026thinsp;100 \u0026times; viscera weight/body mass, hepatopancreas somatic indices (HSI, %)\u0026thinsp;=\u0026thinsp;100 \u0026times; liver weight/body mass.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e1.4.2 Determination of muscle structure characteristics\u003c/h2\u003e \u003cp\u003eTake out the thornless muscles in the sample to be tested and cut them into small cubes with a side length of 2.5cm. Use a disk probe with a diameter of 75mm, with a measuring range of 250N. The recovery height of the sample is 25mm, and the deformation percentage is 30%. The detection speed is set to 30, and the initial applied force is 0.375N.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e1.4.3 Determination of conventional nutrients\u003c/h2\u003e \u003cp\u003eThe analysis of conventional nutrients in feed and fish adopts the AOAC method (Horwitz ,1995). Among them, the moisture content was determined by 105℃ constant temperature drying weight loss method (GBT6435-2014); the crude protein content was determined by the Kjeldahl nitrogen determination method (GBT24318-2009); the crude fat content was determined by the Soxhlet extraction method (GB 5009.6\u0026ndash;2010); coarse ash The content was determined by the high-temperature burning method of Muffle furnace (GBT6438-2007) (Hinz ,2007).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e1.4.4 Detection of liver function indicators and enzyme activity\u003c/h2\u003e \u003cp\u003eThe blood sample of the fish was centrifuged by a 3,000 r\u0026middot;min-1 centrifuge for 15 minutes at 4 ℃ to obtain the serum, and then the content was detected with alanine aminotransferase (ALT) and gluten transaminase (AST) kits. The enzyme activity detection takes about 1g of liver samples, then homogenizes them with a homogenizing machine, put the prepared liver homogenizing fluid into a low-temperature low-speed centrifuge, centrifuge at a speed of 3,000 r\u0026middot;min-1 for 10 minutes, take the supernatant, and determine the activity of superoxide dismutase (SOD) and malondialdehyde (MDA) according to the instructions on the kit. Please refer to the instructions for the determination steps.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e1.4.5 Observation of liver tissue section\u003c/h2\u003e \u003cp\u003eTake an appropriate amount of 4% polyformaldehyde solution in the centrifuge tube and place the liver sample for fixation. For histological testing, the liver sample was put into alcohol for dehydration, and then embedded in the paraffin. Cut it into thin paraffin slices of about 6 \u0026micro;m with a slicer, and then dye it with H\u0026amp;E (Hematoxylin staining solution and Eosin). During histochemical observation, the liver tissue is made into frozen slices and stained with oil red O. Observe the slices with an optical microscope and take photos to save them.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e1.4.6 Real-time fluorescence quantitative PCR detection\u003c/h2\u003e \u003cp\u003eThe total RNA extraction of hepatocytes is extracted by TRIzol lysis. HiScript\u0026reg; Q Select RT Super Mix reverse transcription is used to dilute the cDNA by 5 times, followed by a 96-hole plate. With a 20\u0026micro;L reaction system, each hole is added 0. 4\u0026micro;L, Mix10\u0026micro;L, cDNA4\u0026micro;L, finally adjust to 20\u0026micro;L with water, then put into the instrument, fluorescence quantitative PCR reaction program: 94℃ 30s, 94℃ 5s, 50\u0026ndash;60℃ 15s, 72℃ 10s, 40 cycles, QRT-pcr detect the expression level of the related gene, relative expression of the gene is calculated by using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method. The primer is synthesized by Shanghai Jerry Biotechnology Co., Ltd. (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) (Tan ,2018).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer design for related genes in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eqPCR primers, forward/reverse (5\u0026rsquo;to3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTCCACCGACTGATGAGGATATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GGCTGTTATTGACCCGAACTAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCACCAAACAAACCAAAAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GTCAAGCAACTCCAGACCATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTTTCCTGGTTATGTTTCGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TTGCTTGTAGAGCCCTTTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGAACACACCCTCGTCTCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AATTTCCCCAGCATCGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGCCCAAATTGTTCTTCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CGACCTGCGTCTTCTTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCCCCACCAGAGCGTAAATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CATCGTACTCCTGCTTGCTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e1.5 Data and analysis\u003c/h2\u003e \u003cp\u003eThe test data is analyzed by one-way ANOVA using SPSS 21.0 software. The results are expressed as \"average\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x\u0026thinsp;\u0026plusmn;\u0026thinsp;s)\". If the difference between processing is significant, Duncan's is further used for multiple comparisons, when \u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e, the difference is statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003e2.1 Effects of adding grapefruit polysaccharides to feed on the growth performance of grouper\u003c/h2\u003e\n\u003cp\u003eAfter 8 weeks of breeding experiments, the impact of adding grapefruit polysaccharides to grouper feed on their growth performance is shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. Compared with the control group, the weight gain rate (WGR) of grouper in the low-fat group decreased significantly (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), and the condition factor (CF), viscerosomatic index (VSI) and hepatopancreas somatic indices (HSI) in the high-fat group increased significantly (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e); while the viserosomatic index (VSI) in the TDF2 group was significantly lower than high. Fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eEffects of Pomelo Pectin Addition in Feed on the Growth Performance of Grouper\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eItem\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eControl Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLow-fat Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTDF1 Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eHigh-fat Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTDF2 Group\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIBW (g)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFBW (g)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e54.36\u0026thinsp;\u0026plusmn;\u0026thinsp;4.63\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e44.86\u0026thinsp;\u0026plusmn;\u0026thinsp;2.26\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e47.74\u0026thinsp;\u0026plusmn;\u0026thinsp;4.05\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e45.12\u0026thinsp;\u0026plusmn;\u0026thinsp;1.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e49.27\u0026thinsp;\u0026plusmn;\u0026thinsp;1.33\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eWGR (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e385.89\u0026thinsp;\u0026plusmn;\u0026thinsp;32.82\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e296.22\u0026thinsp;\u0026plusmn;\u0026thinsp;2.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e331.32\u0026thinsp;\u0026plusmn;\u0026thinsp;20.64\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e332.76\u0026thinsp;\u0026plusmn;\u0026thinsp;8.03\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e374.03\u0026thinsp;\u0026plusmn;\u0026thinsp;25.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCF (g/cm\u003csup\u003e3\u003c/sup\u003e )\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eVSI (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e12.16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.92\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHSI (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\"\u003eNote: Different letters on top of data columns indicate significant differences (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e)\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003e2.2 Effect of adding grapefruit polysaccharide to feed on the muscular properties of grouper\u003c/h2\u003e\n\u003cp\u003eThe effect of adding grapefruit polysaccharides in the feed on the muscle structure characteristics of groupers is shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e. Compared with the control group, the muscle first cycle hardness of the low-fat group and the muscle adhesion of the high-fat group are significantly reduced (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the hardness and elasticity of the muscle second cycle of the TDF2 group are significantly higher than that of the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) .\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab4\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eDetermination Results of Muscle Texture Characteristics of Grouper Fillets (n\u0026thinsp;=\u0026thinsp;3)\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eItem\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eControl Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLow-fat Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTDF1 Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eHigh-fat Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTDF2 Group\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFirst Cycle Hardness /N\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003csup\u003eabc\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSecond Cycle Hardness /N\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.70\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAdhesiveness /N\u0026middot;mm\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCohesiveness /Ratio\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSpringiness /mm\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGumminess /N\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.18\u0026thinsp;\u0026plusmn;\u0026thinsp;2.48\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eChewiness /mJ\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.48\u0026thinsp;\u0026plusmn;\u0026thinsp;7.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e14.41\u0026thinsp;\u0026plusmn;\u0026thinsp;1.40\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.92\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\"\u003eNote: Different letters on top of data columns indicate significant differences (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e)\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003e2.3 Effects of adding grapefruit polysaccharides to feed on whole grouper fish and muscle nutrients\u003c/h2\u003e\n\u003cp\u003eThe whole fish and muscle nutrients of groupers in the control group and each experimental group are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. Compared with the control group, the crude protein content of whole fish in the low-fat group and the high-fat group was significantly reduced (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), the muscle crude protein content trend was consistent as well; the content of whole fish crude protein in the TDF2 group was significantly higher than that of the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), while the content of muscle crude protein in the TDF1 group was significantly higher than that of the low group. The crude fat content of whole fish and muscle in the low-fat group was significantly lower than that in the control group, the high-fat group was significantly higher, and the crude fat content of whole fish and muscle in the TDF2 group was significantly lower than that of the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab5\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eEffects of Pomelo Pectin Addition in Feed on the Nutrient Composition of Whole Grouper and Muscle\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eItem\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eControl Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLow-fat Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTDF1 Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eHigh-fat Group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTDF2 Group\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eWhole body(%)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd colspan=\"4\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMoisture\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e66.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e67.14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.99\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e68.07\u0026thinsp;\u0026plusmn;\u0026thinsp;2.38\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e67.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e67.79\u0026thinsp;\u0026plusmn;\u0026thinsp;1.93\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCrude protein\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e20.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e18.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e18.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCrude lipid\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAsh\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eMuscle(%)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd colspan=\"4\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMoisture\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e75.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e76.09\u0026thinsp;\u0026plusmn;\u0026thinsp;3.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e77.79\u0026thinsp;\u0026plusmn;\u0026thinsp;2.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e79.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e77.27\u0026thinsp;\u0026plusmn;\u0026thinsp;1.29\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCrude protein\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e23.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e21.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e23.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e21.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e22.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCrude lipid\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAsh\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\"\u003eNote: Different letters on top of data columns indicate significant differences (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e)\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4 Results of liver histopathology\u003c/h2\u003e\n\u003cp\u003eThe liver tissue morphology of the oblique grouper was analyzed by HE staining (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The liver tissue cells of the control group were evenly distributed and the cell morphology was normal. The nucleus was located in the center of the cell, and there was no pyknosis offset, and it was round or elliptic (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e-A). Compared with the control group, the gap between the liver tissue of the grouper fish in the low-fat group increased, the liver cells were loosely arranged, the liver cells were slightly vacuolated, and the cell membrane dissolution and nuclear offset occurred (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e-B). Compared with the low-fat group, the gap between liver tissue in the TDF1 group was smaller, the cell arrangement was normal, and there were few cell Vacuoles (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e-C). The cell structure of the high-fat group was not clear, the cell membrane boundary was blurred, the cells were seriously hollowed, the nucleus of some cells was offset, deformed and even dissolved, and liver tissue cells were seriously damaged (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e-D). The gap between liver tissue in the TDF2 group was significantly reduced, the liver cells were neatly arranged, the shape was normal, the edges were clear, the nucleus was more distributed in the middle of the cells, and the phenomenon of cell vacuolization was significantly reduced (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e-E).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5 Liver histochemical detection\u003c/h2\u003e\n\u003cp\u003eFrom the oil red O staining slice in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, it can be seen that the content of fat droplets in the low-fat group was less, and the area of liver fat droplets continues to increased with the increase of feed fat level. The phenomenon of fat droplet fusion occurred in the high-fat group, and the liver fat deposition increases significantly. After adding grapefruit polysaccharides, the area of fat droplets in the high-fat group was significantly reduced.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003e2.6 Liver function indicators and enzyme activity test results\u003c/h2\u003e\n\u003cp\u003eIt can be seen from Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e that compared with the control group, the activity of alanine transaminase (ALT) and glutamate transaminase (AST) in the low-fat group and the high-fat group was significantly higher (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), and the activity of TDF1 and TDF2 group was significantly lower than that of the low-fat group and the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The content of malondialdehyde (MDA) in the low-fat group and the high-fat group was significantly higher than that of the control group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC), and the content of malondialdehyde (MDA) in the TDF1 group and the TDF2 group was significantly lower than that of the low-fat group and the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). It can be seen from Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD that the superoxide dismutase (SOD) activity of TDF1 and TDF2 group was significantly higher than that of the low-fat group and the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n\u003ch2\u003e2.7 Expression of genes related to immune inflammation and apoptosis\u003c/h2\u003e\n\u003cp\u003eThe effect of adding grapefruit polysaccharide in the feed on immune inflammation and apoptosis-related gene expression of grouper is shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e. Compared with the control group, the expression level of IL-1\u0026beta; in the low-fat group and the high-fat group was higher (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), and the expression level of the TDF2 group was significantly lower than that in the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), the trend of IL-8 was also similar; the expression levels of caspase3 and caspase8 were significantly higher in the high-fat group than in the control group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), the low-fat group was significantly lower than in the control group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), and the TDF2 group was significantly lower than in the high-fat group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e); in the low-fat group The expression level of caspase8 was significantly higher than that of TDF1 group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNatural plant extracts are widely used in research and production due to their rich resources, low cost, green source, small toxic and side effects to animals, and no harmful drug residues. At present, a large number of studies have shown that plant extracts contribute to the growth of animals. The body composition of fish is affected by the nutritional level of feed, breeding environment, fish species, age, sex and other factors, among which feed is the main factor affecting the body composition of the fish. The protein and fat content in fish is an important factor that reflects the quality of muscle nutrition (Wang ,2024). The high fat content in the feed will cause fat deposition in the liver, abdominal cavity, muscles and other tissues of the fish, affecting the health of the fish (Yang ,2024). Liver ratio and visceral ratio are important indicators reflecting the development of the liver and viscera of fish. Studies have shown that the content of lipids in feed has a significant impact on the viscerosomatic index and hepatopancreas somatic indices of fish (Wang ,2023). When fish consumes too much fat, its viscerosomatic index and hepatopancreas somatic indices will also increase (Mi ,et al,2024 ;Wei ,et al,2024 ;Zhao ,et al,2023). Previous studies of the author's team have shown that when the fat content of grouper exceeds 15%, it will cause liver fat deposition, leading to lipid metabolism disorders, liver damage, and a decline in growth rate, which will also lead to large-scale death (Li ,et al,2018 ;Zou ,et al,2021 ;Zou ,et al,2019). In this test, the viscerosomatic index of grouper fish in the high-fat group fed with high-fat diet was significantly higher than that of other groups, indicating that there was excess fat accumulated in the fish. Adding plant extracts can reduce fish body fat deposition and improve fish quality. The study found that the addition of wolfberry polysaccharides to the feed can significantly reduce the hepatopancreas somatic indices of spotted sea bass (Huang ,et al,2023). The intake of a high-fat diet (HFD) will reduce the muscle mass of aquatic animals, and sanguinarine(\u003cem\u003esanguinarine\u003c/em\u003e) can improve the muscle mass of Ctenopharyngodon Idella(\u003cem\u003eCtenopharyngodon Idella\u003c/em\u003e) by reducing fat deposition and increasing protein content (Shi ,et al,2024). Sun and other learners\u0026rsquo; research have found that supplementing 1.12 or 1.18 g/kg Taurine(\u003cem\u003eTaurine\u003c/em\u003e) in non-fish meal (NFM) diet can improve the fillet quality and muscle antioxidant capacity of grass carp (Sun ,et al,2024). The research results of this experiment are also consistent with it. After adding grapefruit polysaccharides to high-fat feed, the content of whole grouper fish fat and muscle coarse fat decreased significantly. At the same time, the content of fat droplets was observed by liver oil red O staining. It was found that after adding grapefruit polysaccharides, the content of fat droplets in the high-fat group was significantly reduced, indicating that grapefruit polysaccharides can reduce fat deposition.\u003c/p\u003e \u003cp\u003eThe texture characteristics of groupers are affected by many factors, including fish type, growth environment, feed composition, feeding management, growth stage, processing process, preservation and treatment methods, etc. (Wang ,et al,2024). The texture characteristics of fish are generally shown in terms of hardness, adhesion, cohesion, elasticity, adhesiveness and chewiness (Xu ,et al,2022). Usually, if the fish becomes more solid and more elastic, the taste will be better (Wu ,et al,2021). In this experiment, adding grapefruit polysaccharides to high-fat feed can improve muscle elasticity, indicating that grapefruit polysaccharides can improve the taste of fish.\u003c/p\u003e \u003cp\u003eThe liver is the center of fish energy metabolism and also an important organ for excretion. When the liver of fish is damaged, hepatocytes will cause vacuolation, nuclear pyknosis offset, fat precipitation and other phenomena (Rhind ,et al,2011). In the pathophysiological process of the liver, the oxygen free radicals produced by lipid peroxidation and biological oxidation are considered to be an important cause of liver damage, while malondialdehyde (MDA) is a lipid peroxidation product of the liver, which can reflect the degree of liver damage. Superoxide dismutase (SOD) can remove superoxide anion free radicals, reflecting the body's ability to remove free radicals (Zhang ,et al,2023). Su Yongteng's research shows that rhubarb anthraquinone extract can significantly improve SOD vitality and reduce MDA content, indicating that rhubarb anthraquinone extract can remove free radicals in the body, improve the body's antioxidant function to a certain extent, and protect the liver from damage (Yang ,et al,2023). Yuan eta. (Yuan ,et al,2018) Studies have shown that SCAP can relieve liver damage caused by ethanol in mice, reduce MDA levels and increase SOD activity. In this experiment, it was observed that the liver tissue of grouper fish fed with high-fat feed was seriously damaged. After adding grapefruit polysaccharide, the phenomenon of hepatocyte vacuolation was reduced, the cell morphology returned to normal, the MDA content of liver tissue decreased significantly, and the SOD activity increased significantly, indicating that grapefruit polysaccharide can effectively remove the harm of free radicals, protect cells from damage and improve the liver health of groupers.\u003c/p\u003e \u003cp\u003ePlant polysaccharides also show immune regulatory activity (Liu ,et al,2011; G\u0026uuml;roy ,et al,2022). The study found that polysaccharides extracted from \u003cem\u003eAuricularia heimuer(Auricularia heimuer)\u003c/em\u003e can significantly inhibit the secretion of NO, TNF-α and IL-6 (Jen ,et al,2021). Ginger polysaccharide can promote myeloid-derived suppressor cell apoptosis by regulating lipid metabolism (Song ,et al,2023). After adding grapefruit polysaccharides in this test, the expression levels of IL-1β and IL-8 in the TDF2 group were significantly lower than that of the high-fat group. This shows that the addition of grapefruit polysaccharides to the feed has an anti-inflammatory effect, which helps to reduce the inflammatory reaction thus reduce the damage caused by excessive inflammation. The expression level of apoptosis-related genes caspase3 and caspase8 decreased significantly in the TDF2 group, indicating that grapefruit polysaccharide can inhibit the apoptosis process in groupers.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConclusion\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn summary, this test confirms that the addition of grapefruit polysaccharides to the feed can improve the quality of the fish body, reduce the fat content of the liver, muscles and whole fish, reduce the deposition of fat in the fish body, promote the immune function of grouper, and protect the liver from damage. The test results provide reference for plant extracts as feed additives to reduce fish fat deposition and improve seawater fish health.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by grants from the Guangdong \u0026ldquo;Climbing\u0026rdquo; Program [pdjh2022a0247], College Student Innovation and Entrepreneurship Training Program Project (S202311347007), Research, development and application of quality assurance technology for Lingnan aquatic products prefabricated dishes, and key construction discipline scientific research capacity improvement project in Guangdong Province (2022ZDJS022), the National Natural Science Foundation of China (4210061024) and the Social Welfare and Basic Research Fund of Zhongshan City(2022B2003).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003cstrong\u003e(作者和单位)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCollege of Animal Science \u0026amp; Technology, Zhongkai University of Agriculture and Engineering , Guangzhou 510225, China\u003c/p\u003e\n\u003cp\u003eXiaoxiao Zhang, Yingxin Wu, Zizhen Sun, Xianzi Zeng, Li Lin, Yifan Liu, Zhendong Qin,Weidong Bai,Peiyaun Li,Cuiyun Zou\u003c/p\u003e\n\u003cp\u003eGuangdong Provincial Agricultural Technology Extension Center, Guangzhou 510520, China\u003c/p\u003e\n\u003cp\u003eJinhui Wu\u003c/p\u003e\n\u003cp\u003eDa Yu Aquatic Products Co., Ltd., Maoming City, Guangdong Province, 525027, China.\u003c/p\u003e\n\u003cp\u003eBaiqiao Ou\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation was performed by Xiaoxiao Zhang, Yingxin Wu and Cuiyun Zou. Visualization was in charge of Weifan Liu. Formal analyze and investigation were completed by Cuiyun Zou, Xiaoxiao Zhang. Manuscript was written by Xiaoxiao Zhang, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data was collated by Cuiyun Zou, accuracy and authority were assured. Funding was sponsored by Baiqiao Ou, Jinhui Wu, who have provided strong funding support. Project arrangement was performed by Yingxin Wu. The project was supervised by Li Lin, Weifan Liu, Zhendong Qin, Weidong Bai, Peiyuan Li, though which, the project was proceeded with order. Bioinformatics analysis was exactly performed by Xianzi Zeng, Zizhen Sun.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding authors\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Cuiyun Zou or Jinhui Wu.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll applicable international, national, and/or institutional guidelines for the care and use of animals were followed by the authors\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang X, Xie J (2020) The differential effects of endogenous cathepsin and microorganisms on changes in the texture and flavor substances of grouper (\u003cem\u003eEpinephelus coioides\u003c/em\u003e) fillets. RSC Adv 10(18):10764\u0026ndash;10775. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/d0ra01028f\u003c/span\u003e\u003cspan address=\"10.1039/d0ra01028f\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin X, Liu Z, Xiao Y, Xie, Xiaocen, Wang Y, Li H, Wang R, Xie X, Zhang Y, Song Y, Hu W (2024) Metabolomics provides insights into the alleviating effect of dietary Caulerpa lentillifera on diquat-induced oxidative damage in zebrafish (Danio rerio) liver. Aquaculture 584:740630. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2024.740630\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2024.740630\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X, Liu S, Zhang H, Yao J, Geng Y, Ou Y, Chen D, Yang S, Yin L, Luo W (2022) Pathological characterization and cause of a novel liver disease in largemouth bass (Micropterus salmoides). Aquaculture Rep 23:101028. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aqrep.2022.101028\u003c/span\u003e\u003cspan address=\"10.1016/j.aqrep.2022.101028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaoshan L, Jiying W, Yu H, Tiantian H, Shixin W, BingShan H, Yongzhi S (2019) Effects of replacing fish oil with wheat germ oil on growth, fat deposition, serum biochemical indices and lipid metabolic enzyme of juvenile hybrid grouper (\u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e♀ \u003cem\u003e\u0026times; Epinephelus lanceolatus\u003c/em\u003e♂). Aquaculture 505:54\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2019.02.037\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2019.02.037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen W, Chang K, Chen J, Zhao X, Gao S (2021) Dietary sodium butyrate supplementation attenuates intestinal inflammatory response and improves gut microbiota composition in largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e) fed with a high soybean meal diet. Fish Physiol Biochem 47(6):1805\u0026ndash;1819. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10695-021-01004-w\u003c/span\u003e\u003cspan address=\"10.1007/s10695-021-01004-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SM, Jeon IG, Lee JY (2002) Effects of digestible protein and lipid levels in practical diets on growth, protein utilization and body composition of juvenile rockfish (Sebastes schlegeli). Aquaculture 211(1\u0026ndash;4):227\u0026ndash;239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi-org-s.vpn.scau.edu.cn\u003c/span\u003e\u003cspan address=\"http://doi-org-s.vpn.scau.edu.cn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e:443/10.1016/S0044-8486(01)00880-8\u003c/span\u003e\u003cspan address=\":443/10.1016/S0044-8486(01)00880-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTainaka T, Shimada Y, Kuroyanagi J et al (2011) Transcriptome analysis of anti-fatty liver action by Campari tomato using a zebrafish diet-induced obesity model. Nutr Metab (Lond) 8:88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1743-7075-8-88\u003c/span\u003e\u003cspan address=\"10.1186/1743-7075-8-88\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTocmo R, Pena-Fronteras J, Calumba KF, Mendoza M, Johnson JJ (2020) Valorization of pomelo (Citrus grandis Osbeck) peel: A review of current utilization, phytochemistry, bioactivities, and mechanisms of action. Compr Rev Food Sci Food Saf 19(4):1969\u0026ndash;2012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1541-4337.12561\u003c/span\u003e\u003cspan address=\"10.1111/1541-4337.12561\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiamperi L, Fraternale D, Bucchini A, Ricci D (2004) Antioxidant activity of Citrus paradisi seeds glyceric extract. Fitoterapia 75(2):221\u0026ndash;224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fitote.2003.12.010\u003c/span\u003e\u003cspan address=\"10.1016/j.fitote.2003.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi J, Shangguan YC, Jiang LL et al (2023) Pomelo peel dietary fiber ameliorates alterations in obesity-related features and gut microbiota dysbiosis in mice fed on a high-fat diet. Food Chem X 20:100993. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi-org-s.vpn.scau.edu.cn:443/\u003c/span\u003e\u003cspan address=\"http://doi-org-s.vpn.scau.edu.cn:443/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fochx.2023.100993\u003c/span\u003e\u003cspan address=\"10.1016/j.fochx.2023.100993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTocmo R, Pena-Fronteras J, Calumba KF, Mendoza M, Johnson JJ (2020) Valorization of pomelo (Citrus grandis Osbeck) peel: A review of current utilization, phytochemistry, bioactivities, and mechanisms of action. Compr Rev Food Sci Food Saf 19:1969\u0026ndash;2012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1541-4337.12561\u003c/span\u003e\u003cspan address=\"10.1111/1541-4337.12561\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePh L, Yj C, Xl Z, Jd Y, Sq Y, Sn WH, Jg WSZ, Qw W, Hy Q, S (2022) Epinephelus coioides Hsp27 negatively regulates innate immune response and apoptosis induced by Singapore grouper iridovirus (SGIV) infection. Fish Shellfish Immunol 120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2021.12.016\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2021.12.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin B, Wang S, Zhou A, Hu Q, Huang G (2023) Ultrasound-assisted enzyme extraction and properties of Shatian pomelo peel polysaccharide. Ultrason Sonochem 98:106507. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ultsonch.2023.106507\u003c/span\u003e\u003cspan address=\"10.1016/j.ultsonch.2023.106507\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHORWITZ W (1995) Official methods of analysis of AOAC International[J]. Trends Food Sci Technol 6(11):382\u0026ndash;382\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHinz DC (2007) Efficiency improvement for sulfated ash determination by usage of a microwave muffle furnace. J Pharm Biomed Anal 43(5):1881\u0026ndash;1884. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jpba.2007.01.005\u003c/span\u003e\u003cspan address=\"10.1016/j.jpba.2007.01.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan X, Sun Z, Liu Q et al (2018) Effects of dietary ginkgo biloba leaf extract on growth performance, plasma biochemical parameters, fish composition, immune responses, liver histology, and immune and apoptosis-related genes expression of hybrid grouper (Epinephelus lanceolatus♂ \u0026times; Epinephelus fuscoguttatus♀) fed high lipid diets. Fish Shellfish Immunol 72:399\u0026ndash;409. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2017.10.022\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2017.10.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Xiong J, Xu C, Qin C, Zhang Y, Yang L, Zhi S, Feng J, Nie G (2024) Comparison of muscle nutritional composition, texture quality, carotenoid metabolites and transcriptome to underling muscle quality difference between wild-caught and pond-cultured Yellow River carp (\u003cem\u003eCyprinus carpio haematopterus\u003c/em\u003e). Aquaculture 581, 740392. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2023.740392\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2023.740392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang B, Shen Y, Monroig \u0026Oacute;, Zhao W, Bao Y, Tao S, Jiao L, Zhou Q, Jin M (2024) The ameliorative role of methionine in hepatic steatosis and stress response in juvenile black seabream (\u003cem\u003eAcanthopagrus schlegelii\u003c/em\u003e) fed with a high-fat diet. Aquaculture 580:740306. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2023.740306\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2023.740306\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Wang X, Li J, Gong Y, Li Q, Bu X, Lai W, Wang Y, Liu Y, Yao C, Mai K, Ai Q (2023) Effects of cannabidiol on growth performance, appetite, antioxidant capacity and liver inflammatory gene expression of juvenile large yellow croaker (Larmichthys crocea) fed diets with high soybean oil level. Aquaculture 574:739658. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2023.739658\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2023.739658\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMi J, Liu D, Qin C, Yan X, Yang L, Xu X, Nie G (2024) (\u0026ndash;)-Epigallocatechin-3-O-gallate or (\u0026ndash;)-epicatechin enhances lipid catabolism and antioxidant defense in common carp (Cyprinus carpio L.) fed a high-fat diet: Mechanistic insights from the AMPK/Sirt1/PGC-1α signaling pathway. Aquaculture 587:740876. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2024.740876\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2024.740876\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei M, Song L, Yuan X, Li H, Ji H, Sun J (2024) Dietary supplementation with a PPARγ agonist promotes adipocyte hyperplasia and improves high-fat diet tolerance and utilization in grass carp (Ctenopharyngodon idellus). Aquaculture 578:740081. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2023.740081\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2023.740081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao W, Yao R, Wei H-L, Guo Y-C, Chen A-Q, Chen B-Y, Jin-Niu (2023) Astaxanthin, bile acid and chlorogenic acid attenuated the negative effects of high-fat diet on the growth, lipid deposition, and liver health of Oncorhynchus mykiss. Aquaculture 567:739255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2023.739255\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2023.739255\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI SL, LI Z Q, CHEN NS et al (2018), Dietary lipid and carbohydrate interactions: implications on growth performance, feed utilization and non-specific immunity in hybrid grouper (\u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e♀\u0026times;\u003cem\u003eE. lanceolatus\u003c/em\u003e♂).Aquaculture, 498:568\u0026ndash;577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi-org-s.vpn.scau.edu.cn:443/\u003c/span\u003e\u003cspan address=\"http://doi-org-s.vpn.scau.edu.cn:443/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.aquaculture.2018.09.015\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2018.09.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou C, Fang Y, Lin N, Liu H (2021) Polysaccharide extract from pomelo fruitlet ameliorates diet-induced nonalcoholic fatty liver disease in hybrid grouper (\u003cem\u003eEpinephelus lanceolatus\u003c/em\u003e♂ \u0026times; \u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e♀). Fish Shellfish Immunol 119:114\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2021.09.034\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2021.09.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou C, Su N, Wu J et al (2019) Dietary Radix Bupleuri extracts improves hepatic lipid accumulation and immune response of hybrid grouper (\u003cem\u003eEpinephelus lanceolatus\u003c/em\u003e♂ \u0026times; \u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e♀). Fish Shellfish Immunol 88:496\u0026ndash;507. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2019.02.052\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2019.02.052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Z, Ye Y, Xu A, Li Z (2023) Effects of dietary crude polysaccharides from Lycium barbarum on growth performance, digestion, and serum physiology and biochemistry of spotted sea bass Lateolabrax maculatus. Aquaculture Rep 32:101710. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aqrep.2023.101710。\u003c/span\u003e\u003cspan address=\"10.1016/j.aqrep.2023.101710。\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi Y, Zhong L, Liu Y, Xu S, Dai J, Zhang Y, Hu Y (2024) Dietary sanguinarine supplementation recovers the decrease in muscle quality and nutrient composition induced by high-fat diets of grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). Anim Nutr. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aninu.2024.04.001\u003c/span\u003e\u003cspan address=\"10.1016/j.aninu.2024.04.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun S-S, Yan L-C, Feng L, Jiang W-D, Liu Y, Tang L, Wu P, Zhou X-Q (2024) Taurine prevented the decline of fillet quality and muscle antioxidant capacity in on-growing grass carp (Ctenopharyngodon idella) fed non-fishmeal diet. Aquaculture 740921. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2024.740921\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2024.740921\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Qiao F, Zhang W-B, Parisi G, Du Z-Y, Zhang M-L (2024) The flesh texture of teleost fish: Characteristics and interventional strategies. Reviews Aquaculture 16:508\u0026ndash;535. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/raq.12849\u003c/span\u003e\u003cspan address=\"10.1111/raq.12849\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Yang H, Xu Z, Li X, Leng X (2022) The comparison of largemouth bass (Micropterus salmoides) fed trash fish and formula feeds: Growth, flesh quality and metabolomics. Front Nutr 9:966248. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnut.2022.966248\u003c/span\u003e\u003cspan address=\"10.3389/fnut.2022.966248\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu H-X, Li W-J, Shan C-J, Zhang Z-Y, Lv H-B, Qiao F, Du Z-Y, Zhang M-L (2021) Oligosaccharides improve the flesh quality and nutrition value of Nile tilapia fed with high carbohydrate diet. Food Chemistry: Mol Sci 3:100040. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fochms.2021.100040\u003c/span\u003e\u003cspan address=\"10.1016/j.fochms.2021.100040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRhind SM, Kyle CE, Kerr C, Osprey M, Zhang ZL (2011) Effect of duration of exposure to sewage sludge-treated pastures on liver tissue accumulation of persistent endocrine disrupting compounds (EDCs) in sheep. Sci Total Environ 409(19):3850\u0026ndash;3856. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scitotenv.2011.03.021\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2011.03.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Wang Z, Shi Y, Xia L, Hu Y, Zhong L (2023) Protective effects of chlorogenic acid on growth, intestinal inflammation, hepatic antioxidant capacity, muscle development and skin color in channel catfish Ictalurus punctatus fed an oxidized fish oil diet. Fish Shellfish Immunol 134:108511. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2022.108511\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2022.108511\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Zhu X, Liu Y, Xu N, Ai X, Zhang H (2023) Effects of diets rich in Agaricus bisporus polysaccharides on the growth, antioxidant, immunity, and resistance to Yersinia ruckeri in channel catfish. Fish Shellfish Immunol 140:108941. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2023.10894\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2023.10894\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan R, Tao X, Liang S et al (2018) Protective effect of acidic polysaccharide from Schisandra chinensis on acute ethanol-induced liver injury through reducing CYP2E1-dependent oxidative stress. Biomed Pharmacother 99:537\u0026ndash;542. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2018.01.079\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2018.01.079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X-L, Xi Q-Y, Yang L, Li H-Y, Jiang Q-Y, Shu G, Wang S-B, Gao P, Zhu X-T, Zhang Y-L (2011) The effect of dietary Panax ginseng polysaccharide extract on the immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol 30:495\u0026ndash;500. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2010.11.018\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2010.11.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026uuml;roy D, G\u0026uuml;roy B, Bilen S, Terzi E, Kenanoğlu ON, Garc\u0026iacute;a-Su\u0026aacute;rez M, Marzin D, Mantoğlu S, Karadal O, Şahin İ, Kuşku H (2022) Effects of dietary marine sulphated polysaccharides (Algimun\u0026reg;) on growth performance, immune responses and disease resistance of juvenile gilthead seabream (Sparus aurata) to Photobacterium damselae subsp. piscicida Fish Shellfish Immunol 127:1139\u0026ndash;1147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2022.07.054\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2022.07.054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJen CI, Su CH, Lu MK, Lai MN, Ng LT (2021) Synergistic anti-inflammatory effects of different polysaccharide components from Xylaria nigripes. J Food Biochem 45(4):e13694. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jfbc.13694\u003c/span\u003e\u003cspan address=\"10.1111/jfbc.13694\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong C, Ji Y, Wang W, Tao N (2023) Ginger polysaccharide promotes myeloid-derived suppressor cell apoptosis by regulating lipid metabolism. Phytother Res 37(7):2894\u0026ndash;2901. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ptr.7784\u003c/span\u003e\u003cspan address=\"10.1002/ptr.7784\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Pomelo fruit polysaccharide, Epinephelus coioides, Liver injury, Fat deposition","lastPublishedDoi":"10.21203/rs.3.rs-4295991/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4295991/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHigh density and intensive aquaculture of fish often lead to some nutritional and metabolic related diseases. This experiment was designed to investigate the effect of Pomelo Polysaccharide on reducing fat deposition. Five groups of feeds were prepared: control group, low-fat diet group (7.57% fat content), low-fat diet with pomelo polysaccharide group (TDF1 group), high-fat diet group (15.48% fat content), and high-fat diet with pomelo polysaccharide group (TDF2 group). Orange-spotted groupers after 8 weeks of rearing, samples were taken to analyze the growth performance, nutrient composition, liver morphology, enzyme activities and the expression of immune-related genes in liver tissues. The results showed that the weight gain rate (WGR) of groupers in the low-fat diet group was significantly lower than the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while the TDF1 group and TDF2 group were higher than those in the low-fat diet group and high-fat diet group, respectively. Liver damage occurred in the low-fat diet group and the high-fat diet group, while the TDF1 group and the TDF2 group showed improvement in liver tissue structure damage, and the liver lipid droplets in the TDF 2 group decreased significantly compared with the high-fat diet group. Moreover, the TDF2 group significantly inhibited the up-regulation of inflammation and apoptosis-related genes IL-1β, IL-8, caspase-3, and caspase-8. These results indicate that the addition of pomelo polysaccharide can reduce the fat deposition in the liver caused by feeding high-fat feeds, and can have a certain effect on the enhancement of immune function and improve the health of liver of groupers.\u003c/p\u003e","manuscriptTitle":"Effects of Pomelo Polysaccharide on fat deposition and liver health of orange-spotted grouper (Epinephelus coioides)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-24 15:15:35","doi":"10.21203/rs.3.rs-4295991/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5408a491-c263-4326-bce2-59fcd14095ea","owner":[],"postedDate":"April 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-24T15:15:38+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-24 15:15:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4295991","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4295991","identity":"rs-4295991","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00