LncRNA MALAT1 promotes METTL3-mediated m6A modification to promote progression in non-small cell lung cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncRNA MALAT1 promotes METTL3-mediated m6A modification to promote progression in non-small cell lung cancer Shuhong Tian, Fayu Ling, Dunzhi Fu, Qiongyu Wang, Fan Li, Biao Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5243760/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective: This study aims to examine whether lncRNA MALAT1 targets METTL3 and modulates its expression, subsequently influencing the expression of INPP5B and LRIG2 genes. Additionally, the research seeks to determine how these interactions regulate the tumor immune microenvironment and impact the progression of non-small cell lung cancer (NSCLC). Methods: Non-small cell lung cancer cells (NCI-H226) served as the experimental model in this study. The cells were transfected with si-MALAT1 and OE-METTL3 constructs. Fluorescence in situ hybridization (FISH) was employed to determine the subcellular localization of MALAT1. Apoptosis was quantified using flow cytometry, whereas cell proliferation was assessed through the 5-ethynyl-2'-deoxyuridine (EDU) incorporation assay. The Transwell assay was utilized to evaluate cell migration capability and m6A methylation levels. Quantitative PCR (qPCR) and Western blot (WB) analyses were conducted to measure the expression levels of cancer-related genes. Furthermore, an RNA immunoprecipitation (RIP) assay was conducted to validate the interaction between MALAT1 and METTL3. To investigate the functional implications of this interaction, a BALB/c nude mouse subcutaneous xenograft model was utilized, wherein NSCLC cells with silenced MALAT1 expression were employed, both with and without the overexpression of METTL3. Results: The MALAT1 is primarily localized within the nucleus. Under conditions of low expression, MALAT1 remains confined to the nucleus, whereas at elevated expression levels, it translocates to the cytoplasm. Following the application of siRNA targeting MALAT1 (si-MALAT1), a reduction in cell proliferation and migration capabilities was observed, although no significant change in cell colony formation ability was detected. Additionally, an increase in cell apoptosis was noted, with cells exhibiting arrest in the G0/G1 phase of the cell cycle. In parallel, the expression levels of MALAT1 and the oncogenic gene LRIG2 were both diminished, concomitant with a reduction in m6A methylation levels. Subsequent to the interference with MALAT1, transfection with a METTL3 overexpression vector led to a notable decrease in apoptosis, retention of cells in the S phase, and a significant downregulation of the tumor suppressor gene INPP5B. Results from the RIP assay indicated an interaction between MALAT1 and the MALAT1 protein. Furthermore, MALAT1 modulates the impact of METTL3 on the immune microenvironment of NSCLC tumors. Conclusion: The long non-coding RNA MALAT1 facilitates the progression of NSCLC and holds potential as a novel prognostic biomarker and therapeutic target. NSCLC lncRNA MALAT1 METTL3 targeted binding tumor immune microenvironment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1 | INTRODUCTION Statistical data indicate that 2.2 million new lung cancer cases are diagnosed and 1.8 million lung cancer-related deaths occur annually worldwide. Non-small cell lung cancer (NSCLC) accounts for approximately 85% of lung cancer cases. 1 In China, lung cancer is still considered one of the most malignant tumors and has high incidence and mortality rates. Every year in China, approximately 828000 new cases, accounting for 24.6% of all new cancer cases, are diagnosed, and approximately 657000 deaths, accounting for 29.71% of all cancer deaths, occur. 2,3 Thus, NSCLC imposes a substantial burden on society as a whole and on families and individuals. m 6 A RNA methylation is the most prominent and abundant internal modification that is widely present in mRNAs, long noncoding RNAs (lncRNAs), and microRNAs (miRNAs) in eukaryotic cells. 4,5 m 6 A is installed by methyltransferases (writers), removed by demethylases (erasers), and recognized by binding proteins (readers). 6 m 6 A modification plays an important role in tumor initiation, proliferation, and metastasis. 7,8 LncRNAs have two main mechanisms of action, namely, transcriptional regulation and posttranscriptional regulation. Previous studies have shown that m 6 A modification commonly occurs on lncRNAs. 9 Previous studies have focused mainly on the impact of m 6 A modification-related proteins on mRNA stability and translation. However, there is little research on whether lncRNAs are involved in regulating the function of m 6 A modification-related proteins during tumor development. Research has shown that LNC942, which is highly expressed in breast cancer (BRCA), promotes the progression of BRCA by increasing the mRNA stability of the m 6 A methyltransferase METTL14, increasing METTL14 mRNA and protein expression, and subsequently upregulating the expression of the downstream target genes CXCR4 and CYP1B1. 10 m 6 A modification affects the functions of lncRNAs through various regulatory mechanisms. 11,12 On the one hand, m 6 A modification acts on DNA:RNA triple helix structures, regulating the relationship between lncRNAs and specific sites in DNA. On the other hand, m 6 A modification can provide binding sites for proteins that recognize methylation modifications (readers) or regulate the local structure of RNA, thereby inducing the binding of RNA binding proteins (RBPs) and regulating the function of lncRNAs. Research has shown that the m 6 A methyltransferase METTL3 regulates YAP expression and activity through the lncRNA MALAT1 (LncMALAT1), promoting the molecular mechanism underlying chemoresistance in NSCLC. 13 On the one hand, METTL3 can directly promote YAP protein translation and thus upregulate YAP protein expression; on the other hand, METTL3 increases the stability of MALAT1 by increasing its m 6 A modification level. MALAT1 acts as a competing endogenous RNA (ceRNA) by binding miR-1914-3p to further regulate the protein expression of YAP. 13,14 However, whether the lncRNA MALAT1 affects the progression of NSCLC through targeted regulation of METTL3 remains unclear, and the molecular mechanism involved remains unidentified. In this study, we confirmed that the lncRNA MALAT1 is localized in the nucleus and interacts with the METTL3 protein. After interference with MALAT1 expression, the proliferation, migration, and colony formation abilities of cells were significantly decreased, apoptosis was increased, and G0/G1 arrest was induced. Moreover, METTL3 expression was downregulated, the expression of the oncoprotein LRIG2 was downregulated, the expression of the tumor suppressor protein INPP5B was upregulated, and the m 6 A level was decreased. Furthermore, the infiltration of dendritic cells (DCs) and CD8+ T cells in the tumor microenvironment was increased. In summary, the lncRNA MALAT1 targets METTL3 and regulates its expression, in turn regulating the expression of the INPP5B and LRIG2 genes, modulating the tumor immune microenvironment, and affecting the progression of NSCLC. 2 | MATERIALS AND METHODS 2.1 | Bioinformatics analysis The clinical data of non-small cell lung cancer patients were downloaded from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/). The R original was used for m 6 A RNA methylation analysis, tumor classification, PCA analysis, survival analysis, and Cox regression analysis. ENCORI website was used to predict the targeted binding of lncRNA MALAT1 and METTL3. 2.2 | Cell culture NCI-H226 cells (BNCC100405, BeNa Bio) were cultured in RPMI-1640 medium (KGM31800S, KeyGEN BioTECH) in a 5% CO 2 incubator at 37°C. When the cell confluence reached 70%, the cells were considered ready for transfection. The culture medium was changed to serum-free RPMI-1640 medium (1 mL). Then, 125 μL of Opti-MEM was added to each of two sterilized Eppendorf (EP) tubes, 5 μL of Lipofectamine 3000 was added to one tube, and 5 μL of P3000 and 2.5 μg of the overexpression plasmid were added to the other tube. Each tube was mixed separately and incubated at room temperature for 5 min. Then, the contents of the each of the two EP tubes were mixed together, the mixture was incubated at room temperature for 15 min and added to the corresponding six-well plates, and the plates were returned to the incubator for culture. Four hours after transfection, 1 mL of RPMI-1640 medium supplemented with 20% serum was added to the wells of the six-well plate, and subsequent experiments were performed after culture for 48 h. 2.3 | Mouse models All experimental procedures on animals were approved the by the Animal Ethics Committee of the research center for drug safety evaluation of Hainan, Hainan Medical University. (protocol code 2022004DE, approval date April 1, 2022). All testing method were reported according to the ARRIVE guidelines34. Twenty male huHSC-NCG humanized mice (6 weeks old, 18 g–22 g) were ordered from ji Cui Yao Kang (Jiangsu, China) and housed under SPF animal lab condition(temperature 20–26℃, humidity 50–70%), all mice have free accessible to water and chow. NCI-H226 cells with a concentration of 1 × 10 6 cells were injected subcutaneously into the axilla of the right forelimb of the animals after 7 days of quarantine.Tumor volumes were subsequently assessed at three-day intervals through caliper measurements and computed utilizing the formula: (length × height × width)/2. On the 26th day of the experiment, all mice were euthanized by small animal anesthesia system (Matrx, 5% isoflurane). 2.4 | Human samples NSCLC tissue and adjacent noncancer tissue were obtained from patients who underwent surgery at the Second Affiliated Hospital of Hainan Medical University (Haikou, China). This study was approved by the Ethics Committee of Hainan Medical University. All study methods conformed to the principles set by the Declaration of Helsinki. Each patient was required to sign an informed consent form before sample collection. During surgery, the excised tissue sample was quickly placed in liquid nitrogen. 2.5 | Immunofluorescence assay Cells were fixed with paraformaldehyde (4%) and were then washed 3 times by immersion with PBS in Petri dishes. Then, 5% bovine serum albumin (BSA) was added dropwise to each dish, and the dishes were incubated at 37°C for 30 min. A sufficient amount of the diluted primary antibody, namely, the anti-METTL3 (DF12020, Affinity; 1/200) antibody, was added to each Petri dish, and the dishes were stored at 4°C overnight. Then, the diluted Cy3-conjugated fluorescent secondary antibody (Goat Anti-Rabbit IgGA, H+L, S007, ABclonal; 1/100) was added, and the dishes were incubated at 37°C for 30 min and washed thoroughly with PBS. 4’,6-Diamidino-2-phenylindole (DAPI) was added, and the dishes were incubated for 3 min in the dark. After this nuclear staining step, the culture dishes were observed under a fluorescence microscope (CKX53, Olympus), and images were acquired. 2.6 | Cell migration assay Cultured cells were resuspended in serum-free medium and seeded into the upper compartment of a Transwell chamber, and medium containing FBS was added to the lower compartment. After 24 h of culture in a CO 2 incubator at 37°C, the plates were removed, the medium was discarded, and the migrated cells were stained with 0.1% crystal violet for 1 h. The cells remaining in the chamber were wiped with a cotton swab and observed under a microscope. After imaging, the staining solution was removed, 33% acetic acid was added, and the absorbance of each well was measured with a microplate reader at a wavelength of 562 nm. 2.7 | Flow cytometric analyses of the cell cycle and apoptosis A total of 1×10 6 cells were collected, washed twice with PBS, and centrifuged for 3 min (1500 rpm). The cells were resuspended with 300 µL of precooled 1× Annexin V-FITC binding solution; then, 5 μL of Annexin V-FITC and 10 μL of propidium iodide (PI) were added to each well, and the plate was mixed gently and incubated at room temperature for 10 min in the dark. The cell cycle and apoptosis were then analyzed by flow cytometry. 2.8 | Evaluation of cell proliferation by a 5-ethynyl-2-deoxyuridine (EdU) incorporation assay A volume of EdU working solution (20 μM) equal to the volume of culture medium was preheated to 37°C and added to each well of a 6-well plate, the plate was incubated for 18 h, the medium was removed, and the cells were washed twice with 1 mL of washing solution per well for 3 min each. Click reaction solution (0.5 mL) was then added to each well, and the plate was incubated for 30 min. The click reaction solution was removed by centrifugation, and the cells were washed with washing solution 3 times for 3 min each and then resuspended in 500 µL of PBS for analysis. 2.9 | m 6 A RNA methylation assay Total RNA was extracted from cells, and m 6 A levels were measured using an EpiQuik m 6 A RNA Methylation Quantification Kit (Colorimetric, Base Catalog # P-9005). 2.10 | Fluorescence in situ hybridization (FISH) The localization of the lncRNAs MALAT1 and METTL3 in cells was detected by FISH. Paraffin sections were dewaxed with xylene and rehydrated. The sections were treated with pepsin diluted with citric acid (3%). ISH was performed with a MALAT1 in situ hybridization kit (CY3, MK3969-h) and a METTL3 in situ hybridization kit (Boster), fluorescence staining was performed with a Cy3-conjugated fluorescent secondary antibody (Boster), and nuclear staining was performed with DAPI. 2.11 | RNA immunoprecipitation (RIP) assay Cells were lysed, and the lysates were then pretreated with magnetic beads for 30 min. An anti-METTL3 antibody (15073-1-AP, Proteintech), a negative control antibody (rabbit IgG, GB111738, Servicebio), and a positive reference antibody (U1 snRNP 70, sc-390899, Santa Cruz) were added, and the mixture was incubated with magnetic beads for 3 h. A precipitation kit (Cat. No. P0102, GENESEED) was used for IP (antigen capture) for 2 h. The magnetic bead mixture was washed, RNA was purified and extracted, and the quantitative PCR (qPCR) samples were placed in the thermal cycler for analysis. 2.12 | RNA isolation and reverse transcription–quantitative PCR (RT‒qPCR) TRIzol reagent was used to extract total RNA from cells, mRNA/lncRNA was extracted with an RNA ultrapure extraction kit, RNA concentration and purity (OD260/OD280) were measured with a UV‒visible spectrophotometer, cDNA was synthesized with an RNA RT kit, and fluorescence qPCR was performed with a fluorescence PCR system. The reaction steps were as follows: 40 cycles of predenaturation at 95°C for 10 min; denaturation at 95°C for 10 s; annealing at 58°C for 30 s; and extension at 72°C for 30 s. With β-actin as the internal reference, relative gene expression was calculated by the 2 - △△Ct method. The sequences of the primers used for target gene amplification were as follows: 5’TGGCACCCAGCACAATGAA3’ (β-actin F) 5’CTAAGTCATAGTCCGCCTAGAAGCA3’(β-actin R) 5’TGGAGTTGGGGAGAGAATGTCTA3’ (METTL3 F) 5’TTTCCTTTGACACCAACCAAGC3’(METTL3 R) 5’ACACAGCAAGCAAACAGGTCAT3’ (INPP5B F) 5’GCCATCAAGTAGTGGAAGACATTT3’(INPP5B R) 5’GGGAGATACCATGATCACGAAGGT3’ (RIP Positive primer-U1-F) 5’CCACAAATTATGCAGTCGAGTTTCCC3’ (RIP Positive primer-U1-R) 5’AAATCCGTGAGGTCGGCAAT3’ (LncRNA MALAT1 F) 5’TCTCCAGGACTTGGCAGTCT3’ (LncRNA MALAT1 R) 2.13 | Protein extraction and western blot (WB) analysis Western blotting was performed to measure target protein levels, which were normalized to β-actin levels. The cell samples were harvested for lysis, placed on ice for 15 min, and centrifuged for 10 min at 12000 r/min. The supernatant was added to buffer solution, and the mixture was boiled for 5 min and stored at -20°C. The protein concentration in the cell supernatant was measured with a quantitative bicinchoninic acid (BCA) kit. A 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‒PAGE) resolving gel and 5% stacking gel were prepared, and protein samples and a marker were then loaded into the wells for separation by electrophoresis. The gel was then cut and placed in a transfer system for membrane transfer at a constant current of 300 mA for 90 min, and the membrane was blocked with 3% skim milk at room temperature for 1 h. The polyvinylidene fluoride (PVDF) membrane was incubated with a mouse anti-beta-Actin antibody (HC201, TransGen Biotech; 1/2000) overnight. After washing, the PVDF membrane was incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (GB23303, Servicebio; 1/2000) for 2 h. After the PVDF membrane was washed, it was immersed in chemiluminescence solution and then placed in the sample placement area of an ultrasensitive chemiluminescence imaging system to run the imaging program. 2.14 | Statistical analysis All the data were statistically analyzed using IBM SPSS Statistics 26.0 software. The significance of differences in quantitative values between two groups was determined via the independent samples t test, and the significance of differences in quantitative values between multiple groups was determined via one-way analysis of variance, with the least significant difference (LSD) and the Student–Newman–Keuls (S-N-K) tests used for pairwise comparisons. The significance level was set at α=0.05. Differences were considered significant if P < 0.05 (*P < 0.05; **P < 0.01; and ***P < 0.001). 3 │ RESULTS 3.1 │ Clinical significance of the m6A RNA methyltransferase gene METTL3 Data for NSCLC tumor and paracancerous tissues were downloaded from the TCGA database for bioinformatics analysis. The expression of m 6 A RNA methyltransferase genes in tumor tissues was significantly greater than that in paracancerous tissues (Figure 1A). According to the expression levels of the m 6 A RNA methyltransferase genes, the tumor samples were divided into 2 groups: group 1, with low expression; and group 2, with high expression (Figure 1B). Principal component analysis (PCA) was subsequently performed (Figure 1C). Survival analysis was conducted according to the expression levels of the m 6 A RNA methyltransferase genes and the survival times of the patients in group 1 and group 2. The lower the expression level of an m 6 A RNA methyltransferase gene was, the longer the survival time of patients (Figure 1D). Cox regression analysis revealed that the m 6 A RNA methyltransferase gene METTL3 had the greatest impact on the prognosis of NSCLC patients (Figure 1E). Survival analysis was then conducted according to the METTL3 gene expression level, and the results showed that the METTL3 gene expression level was significantly correlated with patient survival. The lower the METTL3 gene expression level was, the longer the patient survival time (Figure 1F). 3.2 │MALAT1 interacts with METTL3 Our previous study revealed that the expression level of METTL3 was closely related to that of the lncRNA MALAT1. The possibility of targeted binding between the lncRNA MALAT1 and METTL3 was predicted via the ENCORI website (Figure 1G). The RIP assay showed that the lncRNA MALAT1 targeted METTL3 for binding (Figure 1H,I). These results suggest that in NSCLC, METTL3 gene expression is closely related to the survival and prognosis of patients and may be related to the targeted binding of the lncRNA MALAT1. Next, we studied the colocalization of the lncRNA MALAT1 and METTL3 in NSCLC cells with interference with MALAT1 expression and METTL3 overexpression through FISH. The results showed that MALAT1 and METTL3 exhibited nuclear colocalization. The lncRNA MALAT1 is expressed mainly in the nucleus, and METTL3 mRNA is also located mainly in the nucleus when its expression is low. However, after METTL3 was overexpressed, a portion of the METTL3 mRNA overflowed into the cytoplasm (Figure 2). 3.3 │ Effect of MALAT1 on the phenotype of NSCLC cells To verify the effect of LncMALAT1 on NSCLC, we designed three targeted interference sequences according to the human lncRNA MALAT1 sequence in GenBank (NR_002819.4, Gene ID: 378938): Si-1, Si-889, and Si-1808. The silencing efficiency of the Si-1 interference sequence was the highest (Figure 3A). The RNA electrophoresis results clearly revealed the bands for 18S RNA and 28S RNA separated by electrophoresis, the intensity ratio of the 28S to the 18S band was 2:1, and the RNA integrity was good (Figure 3B). In addition, the DNA electrophoresis results showed that the β-actin and MALAT1 bands had the expected intensities and the correct locations and corresponded to the target products (Figure 3C). Therefore, Si-1 was selected for subsequent generation of si-MALAT1 cells. After silencing of lncRNA MALAT1 in the NSCLC cell line NCI-h226, the proliferation ability of the cells was evaluated by an immunofluorescence assay, the migration ability of the cells was evaluated by a Transwell migration assay, the cell cycle distribution and apoptosis were analyzed by flow cytometry, and the colony formation ability of the cells was evaluated by a colony formation assay. After lncRNA MALAT1 silencing, cell proliferation was significantly decreased (Figure 3D), cell migration was significantly decreased (Figure 3E), apoptosis was increased (Figure 3F,G), G0/G1 arrest was induced (Figure 3H,I), and colony formation was significantly decreased (Figure 3J,K). These results suggest that inhibition of the lncRNA MALAT1 has an inhibitory effect on the progression of NSCLC. 3.4 │ Effect of MALAT1 on METTL3, INPP5B and LRIG2 expression Next, we confirmed the effect of LncMALAT1 on the expression of the m 6 A RNA methyltransferase METTL3 in NSCLC cells. After interference with LncMALAT1 expression, the qPCR results showed a significant decrease in the mRNA transcript level of MALAT1 (Figure 4A), and the immunofluorescence staining results showed a significant decrease in the protein expression of METTL3 (Figure 4B). Next, we studied the effects of LncMALAT1 interference on the expression of the tumor suppressor INPP5B and the tumor promoter LRIG2 by transcriptome sequencing. The WB results showed that after MALAT1 silencing, INPP5B protein expression was significantly upregulated, and LRIG2 protein expression was significantly downregulated (Figure 4C, D, E). In addition, after interference with MALAT1 expression, the cellular m 6 A levels were significantly decreased (Figure 4F, G). These results indicate that the lncRNA MALAT1 can regulate the expression of the tumor suppressor gene INPP5B and the oncoprotein LRIG2 in NSCLC cells and affect the overall level of m 6 A RNA methylation in the cells. To further confirm that LncMALAT1 may affect the progression of NSCLC through targeted binding to the m 6 A RNA methyltransferase gene METTL3, we constructed a METTL3 overexpression plasmid (Figure 5A) and transfected it into NSCLC cells with MALAT1 silencing. We then measured the mRNA and protein expression levels of METTL3 as well as the protein expression levels of INPP5B and LRIG2. The mRNA expression of METTL3 in the cells was significantly upregulated (Figure 5 B), and the WB results showed that the protein expression of METTL3 was also significantly upregulated (Figure 5 C, D). In addition, the expression of the INPP5B protein was significantly downregulated (Figure 5E, F), and the expression of the LRIG2 protein was significantly upregulated (Figure 5E, G). These results indicate that LncMALAT1 regulates the expression of INPP5B and LRIG2 in NSCLC cells through targeted binding to METTL3 and further confirm that the m 6 A RNA methyltransferase gene METTL3 can promote the progression of NSCLC. Next, we further verified the effects of METTL3 overexpression on the proliferation, migration, cell cycle and apoptosis of NSCLC cells. The cell proliferation capacity was significantly increased (Figure 6A), as was the cell migration capacity (Figure 6B, C). Apoptosis was significantly reduced (Figure 6D, E), and the cells exhibited S-phase arrest(Figure 6F, G). 3.5 │ MALAT1 regulates the effect of METTL3 on the immune microenvironment of NSCLC tumors To confirm that MALAT1 affects the NSCLC tumor immune microenvironment by regulating METTL3, we constructed a BALB/c nude mouse subcutaneous xenograft model using NSCLC cells with MALAT1 silencing with and without METTL3 overexpression. The results of immunofluorescence staining showed that, compared with that in the control group, the infiltration of CD8+ T cells into NSCLC tumors with MALAT1 silencing was significantly increased (Figure 7A, B, D). NSCLC tumors with both METTL3 overexpression an MALAT1 silencing showed significantly reduced infiltration of dendritic cells and CD8+ T cells (Figure 7A, C, D). NSCLC tumor growth was inhibited by interference with MALAT1 expression, and overexpression of METTL3 promoted tumor growth (Figure 7 E, F). 3.6 │ Correlation analysis of INPP5B, LRIG2 and METTL3 expression in clinical samples In the previous in vitro experiments, we investigated the regulatory effects of METTL3 on NSCLC and the mechanisms involved. Next, we further analyzed the cellular localization of METTL3 and the correlation between the expression of METTL3 and that of INPP5B and LRIG2 in clinical samples of NSCLC. The FISH results showed that METTL3 was localized in the nucleus (Figure 8A-C). Immunohistochemical analysis revealed that INPP5B protein expression was downregulated and LRIG2 protein expression was upregulated in clinical samples with high METTL3 expression (Figure 8D-K). These results further confirmed that the m 6 A RNA methyltransferase gene METTL3 promotes the progression of NSCLC by inhibiting the expression of the tumor suppressor INPP5B and upregulating the expression of the oncoprotein LRIG2. 4 | DISCUSSION m 6 A modification is actively involved in the maintenance of tumor cell function and characteristics during tumorigenesis and development. 15,16 As a core component of the m 6 A methyltransferase complex, METTL3 has methyltransferase activity and is a catalytic subunit of the complex, which is associated with mitogen-activated protein kinase cascades, ubiquitin-dependent degradation, RNA splicing and cellular regulatory processes. 17,18 High METTL3 expression is positively correlated with poor tumor differentiation, high tumor stage and tumor metastasis, and METTL3 expression is significantly greater in NSCLC tissues than in normal paracancerous tissues. 19-21 In addition, studies have shown that after endogenous METTL3 is knocked out, the abundance and profile of m 6 A in mRNAs are also changed, which was found to directly affect the colony formation of H1299 cells (a NSCLC cell line) in soft agar and the growth of xenograft tumors. 22 The mechanisms of action of lncRNAs are transcriptional regulation and posttranscriptional regulation. Studies have shown that m 6 A modification is prevalent in lncRNAs in tumor cells. 23,24 In NSCLC, previous studies have focused mainly on the effect of the m 6 A methyltransferase METTL3 on mRNA stability and translation. 25-27 However, there are few studies on whether lncRNAs are involved in the regulation of METTL3 and affect METTL3 target gene expression and the tumor immune microenvironment during tumor development, thus affecting tumor progression. In this study, we found that the lncRNA MALAT1 can target METTL3 to regulate its expression and affect the progression of NSCLC. After interference MALAT1 lncRNA expression, the expression of METTL3 was downregulated, and the growth of NSCLC cells was inhibited. LRIG2 is highly expressed in osteosarcoma (OS) tissues and cell lines, and downregulation of LRIG2 expression significantly inhibits the proliferation and migration of OS cells and increases apoptosis. 28 INPP5B is downregulated in a variety of solid tumors, especially lung adenocarcinoma (LUAD). Overexpression of INPP5B was found to significantly inhibit the proliferation and migration of LUAD cells and to block G2/M transition. 29 Our results showed that after interference with MALAT1 expression, METTL3 expression was downregulated, and the expression of the oncoprotein LRIG2 was significantly downregulated but that of the tumor suppressor protein INPP5B was significantly upregulated. After overexpression of METTL3, the expression of LRIG2 was significantly upregulated, and the expression of INPP5B was significantly downregulated. This result was also confirmed in NSCLC clinical samples. The expression levels of LRIG2 and INPP5B may thus be regulated by METTL3-mediated methylation. Tumor immunity is a specific immune response activated by the body to tumor cells. Studies have shown that m 6 A modification mediated by the RNA methyltransferase METTL3 regulates the functional activation of dendritic cells by altering mRNA translation. 30 In 2018, Song Erwei et al. revealed a new mechanism by which lncRNAs change the balance of T-cell subsets in the tumor microenvironment by regulating the apoptotic sensitivity of T-cell subsets, resulting in tumor immune escape. 31 Our experimental results showed that the infiltration of dendritic cells and CD8+ T cells was significantly increased in NSCLC tumors with MALAT1 silencing and was significantly reduced after METTL3 overexpression. This finding suggests that the lncRNA MALAT1 may affect the NSCLC immune microenvironment by regulating METTL3 expression. In summary, our findings suggest that the lncRNA MALAT1 affects the tumor immune microenvironment by targeting METTL3 and plays a key role in promoting the progression of NSCLC (Figure 9). Our data also confirm the regulatory effect of METTL3 on the oncoprotein LRIG2 and the tumor suppressor protein INPP5B, but the specific mechanism of action needs to be further studied. In future studies, we will continue to evaluate how METTL3 affects the NSCLC immune microenvironment, providing new directions for the treatment of NSCLC. Abbreviations m 6 A N6-methyladenosine lncRNA Long non-coding RNA MALAT1 metastasis associated in lung denocarcinoma transcript 1 NSCLC non-small cell lung cancer METTL3 methyltransferase-like 3 INPP5B inositol polyphosphate-5-phosphatase B LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 Si+NO-NC LncRNA MATTL1 interferes Si+NO LncRNA MATTL1 interferes with + overexpression of METTL3 EdU 5-ethynyl-2-deoxyuridine RIP RNA Immunoprecipitation Declarations Acknowledgments: This work was supported by the Hainan Provincial Natural Science Foundation High level Talent Project(NO. 822RC843). Disclosure : Funding Information Hainan Provincial Natural Science Foundation High level Talent Project(NO. 822RC843). Conflict of Interest The authors have no conflict of interest. Ethics Statement The experiment involving mice has been approved by the Animal Ethics Committee of the research center for drug safety evaluation of Hainan, Hainan Medical University. The collection of NSCLC tissues and adjacent non-cancer tissues was approved by the Ethics Committee of the Second Affiliated Hospital of Hainan Medical University. - Approval of the research protocol by an Institutional Reviewer Board. no - Informed Consent. All informed consent was obtained from the subject(s) and/or guardian(s). - Registry and the Registration No. of the study/trial. no - Animal Studies. Wild-type Balb/c mice were obtained from the Guangdong Medical Laboratory Animal Center (Foshan, China). The humanized peripheral-blood-mononuclear- cell-engrafted (hu-PBMC) mice were sourced from Gempharmatech Co., Ltd. (Nanjing, China). The research center for drug safety evaluation of Hainan approved the animal protocols used in this study. Author’s contributions S. T. and F. L. performed the experiments, analyzed the data, drafted the figures, and co-wrote the manuscript. D. F. and Q. W. analyzed and discussed the data. S. T. assisted with the animal experiments. F. L. and B.L. conceived the study, supervised the experiments, analyzed the data, and co-wrote the manuscripts. References Wang R, Yamada T, Kita K, et al. Transient IGF-1R inhibition combined with osimertinib eradicates AXL-low expressing EGFR mutated lung cancer[J]. Nat Commun. 2020, 11(1):4607. Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin. 2021,1:41. Castellano JJ, Marrades RM, Molins L, et al. Extracellular vesicle lincRNA-p21 expression in tumor-draining pulmonary vein defines prognosis in NSCLC and modulates endothelial cell behavior[J]. Cancers (Basel). 2020,2(3):734. Wilson C, Chen PJ, Miao Z, et al. Programmable m 6 A modification of cellular RNAs with a Cas13-directed methyltransferase[J]. Nat Biotechnol. 2020, 38(12):1431- 1440. Yang Y, Hsu PJ, Chen YS, et al. Dynamic transcriptomic m 6 A decoration: writers, erasers, readers and functions in RNA metabolism[J]. Cell Res. 2018, 28(6):616-624. Ji L, Chen S, Gu L, et al. Exploration of Potential Roles of m 6 A Regulatorsin Colorectal Cancer Prognosis[J]. Front Oncol. 2020, 10:768. Liu T, Wei Q, Jin J, et al. The m 6 A reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation[J]. Nucleic Acids Res. 2020, 48(7):3816-3831. Wang Y, He Y, Su C, et al. Nuclear Localized O-Fucosyl- transferase SPY Facilitates PRR5 Proteolysis to Fine-Tune the Pace of Arabidopsis Circadian Clock[J]. Mol Plant. 2020, 13(3):446-458. Zhang M, Han Y, Zheng Y, et al. ZEB1-activated LINC01123 accelerates the malignancy in lung adenocarcinoma through NOTCH signaling pathway[J]. Cell Death Dis. 2020, 11(11):981. Sun T, Wu Z, Wang X, et al. LNC942 promoting METTL14- mediated m6A methylation in breast cancer cell proliferation and progression[J]. Oncogene. 2020, 39(31):5358-5372. Han M, Wang S, Fritah S, et al. Interfering with long non-coding RNA MIR22HG processing inhibits glioblastoma progression through suppression of Wnt/ β-catenin signalling[J]. Brain. 2020, 143(2):512-530. Jia R, Chai P, Wang S, et al. m 6 A modification suppresses ocular melanoma through modulating HINT2 mRNA translation[J]. Mol Cancer. 2019, 18(1):161. Jin D, Guo J, Wu Y, et al. Correction to: m 6 A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis[J]. J Hematol Oncol. 2020, 13(1):106. Jin D, Guo J, Wu Y, et al. m 6 A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis[J]. J Hematol Oncol. 2021, 14(1):32. Liu L, Li H, Hu D, et al. Insights into N6-methyladenosine and rogrammed cell death in cancer. Mol Cancer . 2022;21(1):32. Cheng C, Wang P, Yang Y, et al. Smoking-Induced M2-TAMs, via ircEML4 in EVs, Promote the Progression of NSCLC through LKBH5-Regulated m 6 A Modification of SOCS2 in NSCLC Cells. Adv Sci (Weinh) . 2023;10(22):e2300953. Guo YQ, Wang Q, Wang JG, et al. METTL3 modulates m 6 A odification of CDC25B and promotes head and neck squamous cell carcinoma malignant progression. Exp Hematol Oncol . 2022;11(1):14. Tang J, Wang X, Xiao D, Liu S, Tao Y. The chromatin-associated RNAs in gene regulation and cancer. Mol Cancer . 2023;22(1):27. Zhang K, Dong Y, Li M, et al. Clostridium butyricum inhibits epithelial-mesenchymal transition of intestinal carcinogenesis through downregulating METTL3. Cancer Sci . 2023;114(8):3114-3127. Jiang R, Dai Z, Wu J, Ji S, Sun Y, Yang W. METTL3 stabilizes HDAC5 mRNA in an m 6 A-dependent manner to facilitate malignant proliferation of osteosarcoma cells. Cell Death Discov . 2022;8(1):179. Zhang Y, Liu S, Zhao T, Dang C. METTL3‑mediated m 6 A modification of Bcl‑2 mRNA promotes non‑small cell lung cancer progression [published correction appears in Oncol Rep. 2023 Apr;49(4):]. Oncol Rep . 2021;46(2):163. HAN Y, JIANG J J, SANG S L, et al. Research progress on mechanisms of m 6 A RNA methylated modification regulating non-small cell lung cancer[J]. Academic Journal of Shanghai University of Traditional Chinese Medicine, 2023, 37(4): 83-89. Li B, Zhao R, Qiu W, et al. The N6-methyladenosine-mediated lncRNA WEE2-AS1 promotes glioblastoma progression by stabilizing RPN2. Theranostics . 2022;12(14):6363-6379. Deng LJ, Deng WQ, Fan SR, et al. m 6 A modification: recent advances, anticancer targeted drug discovery and beyond. Mol Cancer . 2022;21(1):52. Feng Y, Wu F, Wu Y, Guo Z, Ji X. LncRNA DGUOK-AS1 facilitates non-small cell lung cancer growth and metastasis through increasing TRPM7 stability via m 6 A modification. Transl Oncol. 2023;32:101661. Zhang W, Zhang S, Dong C, et al. A bibliometric analysis of RNA methylation in diabetes mellitus and its complications from 2002 to 2022. Front Endocrinol (Lausanne). 2022;13:997034. Wu L, Cheng D, Yang X, et al. M2-TAMs promote immunoresistance in lung adenocarcinoma by enhancing METTL3 -mediated m 6 A methylation. Ann Transl Med . 2022;10(24):1380. Hu J, Dong F, He Y, et al. LRIG2 promotes glioblastoma progression by modulating innate antitumor immunity through macrophage infiltration and polarization. J Immunother Cancer . 2022;10(9):e004452. Deng J, Lin X, Li Q, et al. Decreased INPP5B expression predicts poor prognosis in lung adenocarcinoma. Cancer Cell Int . 2022;22(1):189. Wang H, Hu X, Huang M, et al. Mettl3-mediated mRNA m 6 A methylation promotes dendritic cell activation[J]. Nat Commun. 2019, 10(1):1898. Huang D, Chen J, Yang L, et al. NKILA lncRNA promotes tumor immune evasion by sensitizing T cells to activation-induced cell death[J]. Nat Immunol. 2018 , 19(10):1112-1125. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5243760","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":366695642,"identity":"284df6cd-63fe-4c1e-af8c-efdb6ab820a5","order_by":0,"name":"Shuhong Tian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYBACNvbGxgcfKmzk+JkZGx8kVNQQ1sLHc/iw4YwzacaS7c2HDR6cOUZYi5xEWpo0b9uhxA1njqVJPmxhJsJhPGeMjXnOHGDccCPHrCKxgY2Bv707gYBfegwfzqm4wywJ1HIjcYcMg8SZsxsI2mLw5swzNj6wljNsDAYSuQS0SOSYSfC2HeZhAGopSGxjJkZLWpokUIuEAND7DMRpgQayASiQJRLOHOMh6Bf5dkhU1vcDo/Ljj4oaOf72XvxaMAAPacpHwSgYBaNgFGAFAJtmUiNuEpztAAAAAElFTkSuQmCC","orcid":"","institution":"Hainan Medical University","correspondingAuthor":true,"prefix":"","firstName":"Shuhong","middleName":"","lastName":"Tian","suffix":""},{"id":366695643,"identity":"670219cf-bd1a-4e4e-884b-6048ee8cabc7","order_by":1,"name":"Fayu Ling","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Fayu","middleName":"","lastName":"Ling","suffix":""},{"id":366695644,"identity":"8ad04828-b7fa-460a-81cc-ecc4acda37e9","order_by":2,"name":"Dunzhi Fu","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Dunzhi","middleName":"","lastName":"Fu","suffix":""},{"id":366695645,"identity":"19e32e53-bcc4-4f94-ba48-c033a4c9b2b0","order_by":3,"name":"Qiongyu Wang","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qiongyu","middleName":"","lastName":"Wang","suffix":""},{"id":366695646,"identity":"c1d9cfc0-2971-470f-a173-801f85ab3b65","order_by":4,"name":"Fan Li","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Li","suffix":""},{"id":366695647,"identity":"266bcc27-284e-4f0a-9281-dbd311ec90d9","order_by":5,"name":"Biao Li","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Biao","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-10-11 06:23:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5243760/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5243760/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":66946920,"identity":"647f2408-dd0e-41d8-b4cf-5e127767d0ba","added_by":"auto","created_at":"2024-10-18 09:49:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":92607,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of m\u003csup\u003e6\u003c/sup\u003eA RNA methylation in clinical data for non-small cell lung cancer patients. A, Differential analysis of m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene expression. B, Classification of tumors based on the expression levels of m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase genes. C, PCA was performed based on the tumor classification. D, Survival analysis was conducted based on the expression levels of m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase genes in different tumor subtypes. E, Cox regression analysis was performed based on m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene expression. F, Survival analysis of NSCLC patients based on METTL3 gene expression. G, Prediction of the targeted binding of the lncRNA MALAT1 to METTL3. H-I, RIP assays were conducted to verify the targeted binding of the lncRNA MALAT1 to METTL3.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/ad886f1154847df9a5972370.png"},{"id":66946928,"identity":"26a2da50-cf0c-4750-9513-52814ad5a10d","added_by":"auto","created_at":"2024-10-18 09:49:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":157780,"visible":true,"origin":"","legend":"\u003cp\u003eFISH assays were performed to confirm the subcellular localization of the long noncoding RNA MALAT1 and METTL3 in non-small cell lung cancer (NSCLC) cells. A, Localization of 18S and U6 in NSCLC cells. B, Colocalization of the lncRNA MALAT1 and METTL3 in NSCLC cells.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/0f236dab6b922b85c08628f3.png"},{"id":66950438,"identity":"7c4dbd44-db27-4fb3-9d3c-16d927f992cc","added_by":"auto","created_at":"2024-10-18 10:13:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":139562,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of LncMALAT1 on the phenotype of non-small cell lung cancer cells. A, qPCR analysis of lncRNA MALAT1 expression in NSCLC cells transfected with siRNA targeting MALAT1 (n=3). B, Electrophoresis of reverse transcription products after MALAT1 silencing. C, Quantitative analysis of the data in A. D, Immunofluorescence analysis of the proliferation ability of NSCLC cells transfected with siRNA targeting MALAT1 (n=3). E, Transwell migration assays were used to evaluate the migration ability of cells. F, Cell cycle analysis by flow cytometry. G,Quantitative analysis of the data in F. H, Flow cytometry was used to analyze apoptosis. I, Quantitative analysis of the data in H. J, The colony-forming ability of cells was evaluated through colony formation assays. K, Quantitative analysis of the data in J.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/6e5625cf1f620fb01f29931d.png"},{"id":66946926,"identity":"d4d9ff13-c9af-4301-8221-e7ff64b05244","added_by":"auto","created_at":"2024-10-18 09:49:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":82886,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of the lncRNA MALAT1 on the expression of METTL3, INPP5B, and LRIG2. A, qPCR analysis of lncRNA MALAT1 expression in NSCLC cells transfected with siRNA targeting MALAT1 (n=3). B, Immunofluorescence analysis of METTL3 protein expression. C, Differential gene expression analysis of NSCLC cells with MALAT1 silencing. D, WB analysis of INPP5B and LRIG2 expression in NSCLC cells with MALAT1 silencing (n=3). E, Quantitative analysis of INPP5B expression in D. F, Quantitative analysis of LRIG2 expression in D. G, Quantitative analysis of m\u003csup\u003e6\u003c/sup\u003eA RNA modification in NSCLC cells with MALAT1 silencing (n=9). H, Electrophoretic map of m\u003csup\u003e6\u003c/sup\u003eA RNA modification.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/163e3b7ad0c7b28f0ab26d95.png"},{"id":66946924,"identity":"653241e6-e74e-4329-8cbe-41b9157bb29c","added_by":"auto","created_at":"2024-10-18 09:49:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":58222,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of METTL3 overexpression on non-small cell lung cancer cells with MALAT1 silencing. A, Construction of the METTL3 overexpression plasmid. B, Quantitative analysis of METTL3 mRNA expression. C, WB analysis of METTL3 expression (n=3). D, Quantitative analysis of the data in C. E, WB analysis of INPP5B and LRIG2 expression (n = 3). F, Quantitative analysis of INPP5B expression in E. G, Quantitative analysis of LRIG2 expression in E.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/804f71a51cc75924d9108b92.png"},{"id":66949444,"identity":"d1ffb796-009b-40f7-975e-f801ea725bee","added_by":"auto","created_at":"2024-10-18 10:05:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":138586,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of METTL3 overexpression on the phenotype of non-small cell lung cancer cells with MALAT1 silencing. A, Effect on cell proliferation. B, Effect on cell migration ability. C, Quantitative analysis of the data in B. D, Effect on apoptosis. E, Quantitative analysis of the data in D. F, Effect on the cell cycle. G, Quantitative analysis of the data in F.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/3856df65d248ac4feb0bb103.png"},{"id":66948692,"identity":"5d8f3fab-a89e-4660-ad3d-1a10fa6f4a03","added_by":"auto","created_at":"2024-10-18 09:57:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":253642,"visible":true,"origin":"","legend":"\u003cp\u003eMALAT1 regulates the effect of METTL3 on the immune microenvironment of NSCLC tumors. A, Immunofluorescence staining of dendritic cells in the control group. B, Immunofluorescence staining of CD8+ T cells in the control group. C, Immunofluorescence staining of dendritic cells in the MALAT1 interference group. D, Immunofluorescence staining of CD8+ T cells in the MALAT1 interference group. E, Immunofluorescence staining of dendritic cells overexpressing METTL3 after interference with MALAT1 expression. F, Immunofluorescence staining of CD8+ T cells overexpressing METTL3 after interference with MALAT1 expression. G, Quantitative analysis of the data in A, C and E. H, Quantitative analysis of the data in B, D and F. H, Photographs of the tumors. J, Growth curve of the tumors.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/140f0ff0500da296694f6672.png"},{"id":66946923,"identity":"d8f2b0ce-4783-4cbc-91ff-56fd9557c482","added_by":"auto","created_at":"2024-10-18 09:49:21","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":273537,"visible":true,"origin":"","legend":"\u003cp\u003eCellular localization of METTL3 in clinical samples of non-small cell lung cancer and correlation analysis of METTL3 expression with INPP5B and LRIG2 expression. A, Cellular localization of 18S, which is a cytoplasmic marker. B, Cellular localization of U6, which is a nuclear marker. C, Cellular localization of METTL3. D, Immunohistochemical staining showing low METTL3 expression. E, Immunohistochemical staining showing high INPP5B expression. F, Immunohistochemical staining showing low LRIG2 expression. G, Immunohistochemical staining showing high METTL3 expression. H, Immunohistochemical staining showing low INPP5B expression. I, Immunohistochemical staining showing high LRIG2 expression. J, Quantitative analysis of immunohistochemical data (means and standard deviations). K, Quantitative analysis of immunohistochemical data (all data).\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/e5fd93cff29735958965a674.png"},{"id":66946927,"identity":"0cfb4cf0-944e-4501-ae1e-99f44acaa323","added_by":"auto","created_at":"2024-10-18 09:49:23","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":66255,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the regulatory landscape in which the lncRNA MALAT1/METTL3/INPP5B/LRIG2 signaling axis influences tumor progression in NSCLC.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/470d65f39de6c024dbf67c7b.png"},{"id":67022020,"identity":"e586e95f-10b1-4f19-8b17-9fbb92bf48d9","added_by":"auto","created_at":"2024-10-19 14:46:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1572278,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5243760/v1/47576538-75e5-4ec8-a849-e59432a1a1a1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncRNA MALAT1 promotes METTL3-mediated m6A modification to promote progression in non-small cell lung cancer","fulltext":[{"header":"1 | INTRODUCTION","content":"\u003cp\u003eStatistical data indicate that 2.2 million new lung cancer cases are diagnosed and 1.8 million lung cancer-related deaths occur annually worldwide. Non-small cell lung cancer (NSCLC) accounts for approximately 85% of lung cancer cases.\u003csup\u003e1\u003c/sup\u003e In China, lung cancer is still considered one of the most malignant tumors and has high incidence and mortality rates. Every year in China, approximately 828000 new cases, accounting for 24.6% of all new cancer cases, are diagnosed, and approximately 657000 deaths, accounting for 29.71% of all cancer deaths, occur.\u003csup\u003e2,3\u003c/sup\u003e Thus, NSCLC imposes a substantial burden on society as a whole and on families and individuals.\u003c/p\u003e\n\u003cp\u003em\u003csup\u003e6\u003c/sup\u003eA RNA methylation is the most prominent and abundant internal modification that is widely present in mRNAs, long noncoding RNAs (lncRNAs), and microRNAs (miRNAs) in eukaryotic cells.\u003csup\u003e4,5\u003c/sup\u003e m\u003csup\u003e6\u003c/sup\u003eA is installed by methyltransferases (writers), removed by demethylases (erasers), and recognized by binding proteins (readers).\u003csup\u003e6\u003c/sup\u003e m\u003csup\u003e6\u003c/sup\u003eA modification plays an important role in tumor initiation, proliferation, and metastasis.\u003csup\u003e7,8\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003eLncRNAs have two main mechanisms of action, namely, transcriptional regulation and posttranscriptional regulation. Previous studies have shown that m\u003csup\u003e6\u003c/sup\u003eA modification commonly occurs on lncRNAs.\u003csup\u003e9\u003c/sup\u003e Previous studies have focused mainly on the impact of m\u003csup\u003e6\u003c/sup\u003eA modification-related proteins on mRNA stability and translation. However, there is little research on whether lncRNAs are involved in regulating the function of m\u003csup\u003e6\u003c/sup\u003eA modification-related proteins during tumor development. Research has shown that LNC942, which is highly expressed in breast cancer (BRCA), promotes the progression of BRCA by increasing the mRNA stability of the m\u003csup\u003e6\u003c/sup\u003eA methyltransferase METTL14, increasing METTL14 mRNA and protein expression, and subsequently upregulating the expression of the downstream target genes CXCR4 and CYP1B1.\u003csup\u003e10\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003em\u003csup\u003e6\u003c/sup\u003eA modification affects the functions of lncRNAs through various regulatory mechanisms.\u003csup\u003e11,12\u003c/sup\u003e On the one hand, m\u003csup\u003e6\u003c/sup\u003eA modification acts on DNA:RNA triple helix structures, regulating the relationship between lncRNAs and specific sites in DNA. On the other hand, m\u003csup\u003e6\u003c/sup\u003eA modification can provide binding sites for proteins that recognize methylation modifications (readers) or regulate the local structure of RNA, thereby inducing the binding of RNA binding proteins (RBPs) and regulating the function of lncRNAs. Research has shown that the m\u003csup\u003e6\u003c/sup\u003eA methyltransferase METTL3 regulates YAP expression and activity through the lncRNA MALAT1 (LncMALAT1), promoting the molecular mechanism underlying chemoresistance in NSCLC.\u003csup\u003e13\u003c/sup\u003e On the one hand, METTL3 can directly promote YAP protein translation and thus upregulate YAP protein expression; on the other hand, METTL3 increases the stability of MALAT1 by increasing its m\u003csup\u003e6\u003c/sup\u003eA modification level. MALAT1 acts as a competing endogenous RNA (ceRNA) by binding miR-1914-3p to further regulate the protein expression of YAP.\u003csup\u003e13,14\u003c/sup\u003e However, whether the lncRNA MALAT1 affects the progression of NSCLC through targeted regulation of METTL3 remains unclear, and the molecular mechanism involved remains unidentified.\u003c/p\u003e\n\u003cp\u003eIn this study, we confirmed that the lncRNA MALAT1 is localized in the nucleus and interacts with the METTL3 protein. After interference with MALAT1 expression, the proliferation, migration, and colony formation abilities of cells were significantly decreased, apoptosis was increased, and G0/G1 arrest was induced. Moreover, METTL3 expression was downregulated, the expression of the oncoprotein LRIG2 was downregulated, the expression of the tumor suppressor protein INPP5B was upregulated, and the m\u003csup\u003e6\u003c/sup\u003eA level was decreased. Furthermore, the infiltration of dendritic cells (DCs) and CD8+ T cells in the tumor microenvironment was increased. In summary, the lncRNA MALAT1 targets METTL3 and regulates its expression, in turn regulating the expression of the INPP5B and LRIG2 genes, modulating the tumor immune microenvironment, and affecting the progression of NSCLC.\u003c/p\u003e"},{"header":"2 | MATERIALS AND METHODS","content":"\u003cp\u003e2.1 | Bioinformatics analysis\u003c/p\u003e\n\u003cp\u003eThe clinical data of non-small cell lung cancer patients were downloaded from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/). The R original was used for m\u003csup\u003e6\u003c/sup\u003eA RNA methylation analysis, tumor classification, PCA analysis, survival analysis, and Cox regression analysis. ENCORI website was used to predict the targeted binding of lncRNA MALAT1 and METTL3.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.2 | Cell culture\u003c/p\u003e\n\u003cp\u003eNCI-H226 cells (BNCC100405, BeNa Bio) were cultured in RPMI-1640 medium (KGM31800S, KeyGEN BioTECH) in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator at 37\u0026deg;C. When the cell confluence reached 70%, the cells were considered ready for transfection. The culture medium was changed to serum-free RPMI-1640 medium (1 mL). Then, 125 \u0026mu;L of Opti-MEM was added to each of two sterilized Eppendorf (EP) tubes, 5 \u0026mu;L of Lipofectamine 3000 was added to one tube, and 5 \u0026mu;L of P3000 and 2.5 \u0026mu;g of the overexpression plasmid were added to the other tube. Each tube was mixed separately and incubated at room temperature for 5 min. Then, the contents of the each of the two EP tubes were mixed together, the mixture was incubated at room temperature for 15 min and added to the corresponding six-well plates, and the plates were returned to the incubator for culture. Four hours after transfection, 1 mL of RPMI-1640 medium supplemented with 20% serum was added to the wells of the six-well plate, and subsequent experiments were performed after culture for 48 h.\u003c/p\u003e\n\u003cp\u003e2.3 |\u0026nbsp;Mouse models\u003c/p\u003e\n\u003cp\u003eAll experimental procedures on animals were approved the by the Animal Ethics Committee of the research center for drug safety evaluation of Hainan, Hainan Medical University. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; (protocol code 2022004DE, approval date April 1, 2022). All testing method were reported according to the ARRIVE guidelines34. Twenty male huHSC-NCG humanized mice (6 weeks old, 18 g\u0026ndash;22\u0026nbsp;g) were ordered from ji Cui Yao Kang (Jiangsu, China) and housed under SPF animal lab condition(temperature 20\u0026ndash;26℃, humidity 50\u0026ndash;70%), all mice have free accessible to water and chow. NCI-H226 cells with a concentration of 1\u0026nbsp;\u0026times;\u0026nbsp;10\u003csup\u003e6\u003c/sup\u003e cells were injected subcutaneously into the axilla of the right forelimb of the animals after 7 days of quarantine.Tumor volumes were subsequently assessed at three-day intervals through caliper measurements and computed utilizing the formula: (length\u0026nbsp;\u0026times;\u0026nbsp;height\u0026nbsp;\u0026times;\u0026nbsp;width)/2. \u0026nbsp; \u0026nbsp;On the 26th day of the experiment, all mice were euthanized by small animal anesthesia system (Matrx, 5% isoflurane).\u003c/p\u003e\n\u003cp\u003e2.4 | Human samples\u003c/p\u003e\n\u003cp\u003eNSCLC tissue and adjacent noncancer tissue were obtained from patients who underwent surgery at the Second Affiliated Hospital of Hainan Medical University (Haikou, China). \u0026nbsp; \u0026nbsp;This study was approved by the Ethics Committee of Hainan Medical University. All study methods conformed to the principles set by the Declaration of Helsinki. Each patient was required to sign an informed consent form before sample collection. During surgery, the excised tissue sample was quickly placed in liquid nitrogen.\u003c/p\u003e\n\u003cp\u003e2.5 | Immunofluorescence assay\u003c/p\u003e\n\u003cp\u003eCells were fixed with paraformaldehyde (4%) and were then washed 3 times by immersion with PBS in Petri dishes. Then, 5% bovine serum albumin (BSA) was added dropwise to each dish, and the dishes were incubated at 37\u0026deg;C for 30 min. A sufficient amount of the diluted primary antibody, namely, the anti-METTL3 (DF12020, Affinity; 1/200) antibody, was added to each Petri dish, and the dishes were stored at 4\u0026deg;C overnight. Then, the diluted Cy3-conjugated fluorescent secondary antibody (Goat Anti-Rabbit IgGA, H+L, S007, ABclonal; 1/100) was added, and the dishes were incubated at 37\u0026deg;C for 30 min and washed thoroughly with PBS. 4\u0026rsquo;,6-Diamidino-2-phenylindole (DAPI) was added, and the dishes were incubated for 3 min in the dark. After this nuclear staining step, the culture dishes were observed under a fluorescence microscope (CKX53, Olympus), and images were acquired.\u003c/p\u003e\n\u003cp\u003e2.6 | Cell migration assay\u003c/p\u003e\n\u003cp\u003eCultured cells were resuspended in serum-free medium and seeded into the upper compartment of a Transwell chamber, and medium containing FBS was added to the lower compartment. After 24 h of culture in a CO\u003csub\u003e2\u003c/sub\u003e incubator at 37\u0026deg;C, the plates were removed, the medium was discarded, and the migrated cells were stained with 0.1% crystal violet for 1 h. The cells remaining in the chamber were wiped with a cotton swab and observed under a microscope. After imaging, the staining solution was removed, 33% acetic acid was added, and the absorbance of each well was measured with a microplate reader at a wavelength of 562 nm.\u003c/p\u003e\n\u003cp\u003e2.7 | Flow cytometric analyses of the cell cycle and apoptosis\u003c/p\u003e\n\u003cp\u003eA total of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells were collected, washed twice with PBS, and centrifuged for 3 min (1500 rpm). The cells were resuspended with 300 \u0026micro;L of precooled 1\u0026times; Annexin V-FITC binding solution; then, 5 \u0026mu;L of Annexin V-FITC and 10 \u0026mu;L of propidium iodide (PI) were added to each well, and the plate was mixed gently and incubated at room temperature for 10 min in the dark. The cell cycle and apoptosis were then analyzed by flow cytometry.\u003c/p\u003e\n\u003cp\u003e2.8 | Evaluation of cell proliferation by a 5-ethynyl-2-deoxyuridine (EdU) incorporation assay\u003c/p\u003e\n\u003cp\u003eA volume of EdU working solution (20 \u0026mu;M) equal to the volume of culture medium was preheated to 37\u0026deg;C and added to each well of a 6-well plate, the plate was incubated for 18 h, the medium was removed, and the cells were washed twice with 1 mL of washing solution per well for 3 min each. Click reaction solution (0.5 mL) was then added to each well, and the plate was incubated for 30 min. The click reaction solution was removed by centrifugation, and the cells were washed with washing solution 3 times for 3 min each and then resuspended in 500 \u0026micro;L of PBS for analysis.\u003c/p\u003e\n\u003cp\u003e2.9 | m\u003csup\u003e6\u003c/sup\u003eA RNA methylation assay\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cells, and\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA levels were measured using an EpiQuik\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA Methylation Quantification Kit (Colorimetric, Base Catalog # P-9005).\u003c/p\u003e\n\u003cp\u003e2.10 | Fluorescence in situ hybridization (FISH)\u003c/p\u003e\n\u003cp\u003eThe localization of the lncRNAs MALAT1 and METTL3 in cells was detected by FISH. Paraffin sections were dewaxed with xylene and rehydrated. The sections were treated with pepsin diluted with citric acid (3%). ISH was performed with a MALAT1 in situ hybridization kit (CY3, MK3969-h) and a METTL3 in situ hybridization kit (Boster), fluorescence staining was performed with a Cy3-conjugated fluorescent secondary antibody (Boster), and nuclear staining was performed with DAPI.\u003c/p\u003e\n\u003cp\u003e2.11 | RNA immunoprecipitation (RIP) assay\u003c/p\u003e\n\u003cp\u003eCells were lysed, and the lysates were then pretreated with magnetic beads for 30 min. An anti-METTL3 antibody (15073-1-AP, Proteintech), a negative control antibody (rabbit IgG, GB111738, Servicebio), and a positive reference antibody (U1 snRNP 70, sc-390899, Santa Cruz) were added, and the mixture was incubated with magnetic beads for 3 h. A precipitation kit (Cat. No. P0102, GENESEED) was used for IP (antigen capture) for 2 h. The magnetic bead mixture was washed, RNA was purified and extracted, and the quantitative PCR (qPCR) samples were placed in the thermal cycler for analysis.\u003c/p\u003e\n\u003cp\u003e2.12 | RNA isolation and reverse transcription\u0026ndash;quantitative PCR (RT‒qPCR)\u003c/p\u003e\n\u003cp\u003eTRIzol reagent was used to extract total RNA from cells, mRNA/lncRNA was extracted with an RNA ultrapure extraction kit, RNA concentration and purity (OD260/OD280) were measured with a UV‒visible spectrophotometer, cDNA was synthesized with an RNA RT kit, and fluorescence qPCR was performed with a fluorescence PCR system. The reaction steps were as follows: 40 cycles of predenaturation at 95\u0026deg;C for 10 min; denaturation at 95\u0026deg;C for 10 s; annealing at 58\u0026deg;C for 30 s; and extension at 72\u0026deg;C for 30 s. With \u0026beta;-actin as the internal reference, relative gene expression was calculated by the 2\u003csup\u003e- △△Ct\u003c/sup\u003e method. The sequences of the primers used for target gene amplification were as follows:\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;TGGCACCCAGCACAATGAA3\u0026rsquo; (\u0026beta;-actin F)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;CTAAGTCATAGTCCGCCTAGAAGCA3\u0026rsquo;(\u0026beta;-actin R)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;TGGAGTTGGGGAGAGAATGTCTA3\u0026rsquo; (METTL3 F)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;TTTCCTTTGACACCAACCAAGC3\u0026rsquo;(METTL3 R)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;ACACAGCAAGCAAACAGGTCAT3\u0026rsquo; (INPP5B F)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;GCCATCAAGTAGTGGAAGACATTT3\u0026rsquo;(INPP5B R)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;GGGAGATACCATGATCACGAAGGT3\u0026rsquo; (RIP Positive primer-U1-F)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;CCACAAATTATGCAGTCGAGTTTCCC3\u0026rsquo; (RIP Positive primer-U1-R)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;AAATCCGTGAGGTCGGCAAT3\u0026rsquo; (LncRNA MALAT1 F)\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;TCTCCAGGACTTGGCAGTCT3\u0026rsquo; (LncRNA MALAT1 R)\u003c/p\u003e\n\u003cp\u003e2.13 | Protein extraction and western blot (WB) analysis\u003c/p\u003e\n\u003cp\u003eWestern blotting was performed to measure target protein levels, which were normalized to \u0026beta;-actin levels. The cell samples were harvested for lysis, placed on ice for 15 min, and centrifuged for 10 min at 12000 r/min. The supernatant was added to buffer solution, and the mixture was boiled for 5 min and stored at -20\u0026deg;C. The protein concentration in the cell supernatant was measured with a quantitative bicinchoninic acid (BCA) kit. A 10% sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis (SDS‒PAGE) resolving gel and 5% stacking gel were prepared, and protein samples and a marker were then loaded into the wells for separation by electrophoresis. The gel was then cut and placed in a transfer system for membrane transfer at a constant current of 300 mA for 90 min, and the membrane was blocked with 3% skim milk at room temperature for 1 h. The polyvinylidene fluoride (PVDF) membrane was incubated with a mouse anti-beta-Actin antibody (HC201, TransGen Biotech; 1/2000) overnight. After washing, the PVDF membrane was incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (GB23303, Servicebio; 1/2000) for 2 h. After the PVDF membrane was washed, it was immersed in chemiluminescence solution and then placed in the sample placement area of an ultrasensitive chemiluminescence imaging system to run the imaging program.\u003c/p\u003e\n\u003cp\u003e2.14 | Statistical analysis\u003c/p\u003e\n\u003cp\u003eAll the data were statistically analyzed using IBM SPSS Statistics 26.0 software. The significance of differences in quantitative values between two groups was determined via the independent samples t test, and the significance of differences in quantitative values between multiple groups was determined via one-way analysis of variance, with the least significant difference (LSD) and the Student\u0026ndash;Newman\u0026ndash;Keuls (S-N-K) tests used for pairwise comparisons. The significance level was set at \u0026alpha;=0.05. Differences were considered significant if P \u0026lt; 0.05 (*P \u0026lt; 0.05; **P \u0026lt; 0.01; and ***P \u0026lt; 0.001).\u003c/p\u003e"},{"header":"3 │ RESULTS","content":"\u003cp\u003e\u003cstrong\u003e3.1 │ Clinical significance of the m6A RNA methyltransferase gene METTL3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData for NSCLC tumor and paracancerous tissues were downloaded from the TCGA database for bioinformatics analysis. The expression of\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase genes in tumor tissues was significantly greater than that in paracancerous tissues (Figure 1A). According to the expression levels of the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase genes, the tumor samples were divided into 2 groups: group 1, with low expression; and group 2, with high expression (Figure 1B). Principal component analysis (PCA) was subsequently performed (Figure 1C). Survival analysis was conducted according to the expression levels of the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase genes and the survival times of the patients in group 1 and group 2. The lower the expression level of an\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene was, the longer the survival time of patients (Figure 1D). Cox regression analysis revealed that the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene METTL3 had the greatest impact on the prognosis of NSCLC patients (Figure 1E). Survival analysis was then conducted according to the METTL3 gene expression level, and the results showed that the METTL3 gene expression level was significantly correlated with patient survival. The lower the METTL3 gene expression level was, the longer the patient survival time (Figure 1F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 │MALAT1 interacts with METTL3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur previous study revealed that the expression level of METTL3 was closely related to that of the lncRNA MALAT1. The possibility of targeted binding between the lncRNA MALAT1 and METTL3 was predicted via the ENCORI website (Figure 1G). The RIP assay showed that the lncRNA MALAT1 targeted METTL3 for binding (Figure 1H,I). These results suggest that in NSCLC, METTL3 gene expression is closely related to the survival and prognosis of patients and may be related to the targeted binding of the lncRNA MALAT1.\u003c/p\u003e\n\u003cp\u003eNext, we studied the colocalization of the lncRNA MALAT1 and METTL3 in NSCLC cells with interference with MALAT1 expression and METTL3 overexpression through FISH. The results showed that MALAT1 and METTL3 exhibited nuclear colocalization. The lncRNA MALAT1 is expressed mainly in the nucleus, and METTL3 mRNA is also located mainly in the nucleus when its expression is low. However, after METTL3 was overexpressed, a portion of the METTL3 mRNA overflowed into the cytoplasm (Figure 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 │ Effect of MALAT1 on the phenotype of NSCLC cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo verify the effect of LncMALAT1 on NSCLC, we designed three targeted interference sequences according to the human lncRNA MALAT1 sequence in GenBank (NR_002819.4, Gene ID: 378938): Si-1, Si-889, and Si-1808. The silencing efficiency of the Si-1 interference sequence was the highest (Figure 3A). The RNA electrophoresis results clearly revealed the bands for 18S RNA and 28S RNA separated by electrophoresis, the intensity ratio of the 28S to the 18S band was 2:1, and the RNA integrity was good (Figure 3B). In addition, the DNA electrophoresis results showed that the β-actin and MALAT1 bands had the expected intensities and the correct locations and corresponded to the target products (Figure 3C). Therefore, Si-1 was selected for subsequent generation of si-MALAT1 cells.\u003c/p\u003e\n\u003cp\u003eAfter silencing of lncRNA MALAT1 in the NSCLC cell line NCI-h226, the proliferation ability of the cells was evaluated by an immunofluorescence assay, the migration ability of the cells was evaluated by a Transwell migration assay, the cell cycle distribution and apoptosis were analyzed by flow cytometry, and the colony formation ability of the cells was evaluated by a colony formation assay. After lncRNA MALAT1 silencing, cell proliferation was significantly decreased (Figure 3D), cell migration was significantly decreased (Figure 3E), apoptosis was increased (Figure 3F,G), G0/G1 arrest was induced (Figure 3H,I), and colony formation was significantly decreased (Figure 3J,K). These results suggest that inhibition of the lncRNA MALAT1 has an inhibitory effect on the progression of NSCLC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 │ Effect of MALAT1 on METTL3, INPP5B and LRIG2 expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, we confirmed the effect of LncMALAT1 on the expression of the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase METTL3 in NSCLC cells. After interference with LncMALAT1 expression, the qPCR results showed a significant decrease in the mRNA transcript level of MALAT1 (Figure 4A), and the immunofluorescence staining results showed a significant decrease in the protein expression of METTL3 (Figure 4B). Next, we studied the effects of LncMALAT1 interference on the expression of the tumor suppressor INPP5B and the tumor promoter LRIG2 by transcriptome sequencing. The WB results showed that after MALAT1 silencing, INPP5B protein expression was significantly upregulated, and LRIG2 protein expression was significantly downregulated (Figure 4C, D, E). In addition, after interference with MALAT1 expression, the cellular\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA levels were significantly decreased (Figure 4F, G). These results indicate that the lncRNA MALAT1 can regulate the expression of the tumor suppressor gene INPP5B and the oncoprotein LRIG2 in NSCLC cells and affect the overall level of\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methylation in the cells.\u003c/p\u003e\n\u003cp\u003eTo further confirm that LncMALAT1 may affect the progression of NSCLC through targeted binding to the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene METTL3, we constructed a METTL3 overexpression plasmid (Figure 5A) and transfected it into NSCLC cells with MALAT1 silencing. We then measured the mRNA and protein expression levels of METTL3 as well as the protein expression levels of INPP5B and LRIG2. The mRNA expression of METTL3 in the cells was significantly upregulated (Figure 5 B), and the WB results showed that the protein expression of METTL3 was also significantly upregulated (Figure 5 C, D). In addition, the expression of the INPP5B protein was significantly downregulated (Figure 5E, F), and the expression of the LRIG2 protein was significantly upregulated (Figure 5E, G). These results indicate that LncMALAT1 regulates the expression of INPP5B and LRIG2 in NSCLC cells through targeted binding to METTL3 and further confirm that the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene METTL3 can promote the progression of NSCLC.\u003c/p\u003e\n\u003cp\u003eNext, we further verified the effects of METTL3 overexpression on the proliferation, migration, cell cycle and apoptosis of NSCLC cells. The cell proliferation capacity was significantly increased (Figure 6A), as was the cell migration capacity (Figure 6B, C). Apoptosis was significantly reduced (Figure 6D, E), and the cells exhibited S-phase arrest(Figure 6F, G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 │ MALAT1 regulates the effect of METTL3 on the immune microenvironment of NSCLC tumors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm that MALAT1 affects the NSCLC tumor immune microenvironment by regulating METTL3, we constructed a BALB/c nude mouse subcutaneous xenograft model using NSCLC cells with MALAT1 silencing with and without METTL3 overexpression. The results of immunofluorescence staining showed that, compared with that in the control group, the infiltration of CD8+ T cells into NSCLC tumors with MALAT1 silencing was significantly increased (Figure 7A, B, D). NSCLC tumors with both METTL3 overexpression an MALAT1 silencing showed significantly reduced infiltration of dendritic cells and CD8+ T cells (Figure 7A, C, D). NSCLC tumor growth was inhibited by interference with MALAT1 expression, and overexpression of METTL3 promoted tumor growth (Figure 7 E, F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 │ Correlation analysis of INPP5B, LRIG2 and METTL3 expression in clinical samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the previous in vitro experiments, we investigated the regulatory effects of METTL3 on NSCLC and the mechanisms involved. Next, we further analyzed the cellular localization of METTL3 and the correlation between the expression of METTL3 and that of INPP5B and LRIG2 in clinical samples of NSCLC. The FISH results showed that METTL3 was localized in the nucleus (Figure 8A-C). Immunohistochemical analysis revealed that INPP5B protein expression was downregulated and LRIG2 protein expression was upregulated in clinical samples with high METTL3 expression (Figure 8D-K). These results further confirmed that the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA RNA methyltransferase gene METTL3 promotes the progression of NSCLC by inhibiting the expression of the tumor suppressor INPP5B and upregulating the expression of the oncoprotein LRIG2.\u003c/p\u003e"},{"header":"4 | DISCUSSION","content":"\u003cp\u003em\u003csup\u003e6\u003c/sup\u003eA modification is actively involved in the maintenance of tumor cell function and characteristics during tumorigenesis and development.\u003csup\u003e15,16\u003c/sup\u003e As a core component of the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA methyltransferase complex, METTL3 has methyltransferase activity and is a catalytic subunit of the complex, which is associated with mitogen-activated protein kinase cascades, ubiquitin-dependent degradation, RNA splicing and cellular regulatory processes.\u003csup\u003e17,18\u003c/sup\u003e High METTL3 expression is positively correlated with poor tumor differentiation, high tumor stage and tumor metastasis, and METTL3 expression is significantly greater in NSCLC tissues than in normal paracancerous tissues.\u003csup\u003e19-21\u003c/sup\u003e In addition, studies have shown that after endogenous METTL3 is knocked out, the abundance and profile of\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA in mRNAs are also changed, which was found to directly affect the colony formation of H1299 cells (a NSCLC cell line) in soft agar and the growth of xenograft tumors.\u003csup\u003e22\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003eThe mechanisms of action of lncRNAs are transcriptional regulation and posttranscriptional regulation. Studies have shown that\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA modification is prevalent in lncRNAs in tumor cells.\u003csup\u003e23,24\u003c/sup\u003e In NSCLC, previous studies have focused mainly on the effect of the\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA methyltransferase METTL3 on mRNA stability and translation.\u003csup\u003e25-27\u003c/sup\u003e However, there are few studies on whether lncRNAs are involved in the regulation of METTL3 and affect METTL3 target gene expression and the tumor immune microenvironment during tumor development, thus affecting tumor progression. In this study, we found that the lncRNA MALAT1 can target METTL3 to regulate its expression and affect the progression of NSCLC. After interference MALAT1 lncRNA expression, the expression of METTL3 was downregulated, and the growth of NSCLC cells was inhibited.\u003c/p\u003e\n\u003cp\u003eLRIG2 is highly expressed in osteosarcoma (OS) tissues and cell lines, and downregulation of LRIG2 expression significantly inhibits the proliferation and migration of OS cells and increases apoptosis.\u003csup\u003e28\u003c/sup\u003e INPP5B is downregulated in a variety of solid tumors, especially lung adenocarcinoma (LUAD). Overexpression of INPP5B was found to significantly inhibit the proliferation and migration of LUAD cells and to block G2/M transition.\u003csup\u003e29\u003c/sup\u003e Our results showed that after interference with MALAT1 expression, METTL3 expression was downregulated, and the expression of the oncoprotein LRIG2 was significantly downregulated but that of the tumor suppressor protein INPP5B was significantly upregulated. After overexpression of METTL3, the expression of LRIG2 was significantly upregulated, and the expression of INPP5B was significantly downregulated. This result was also confirmed in NSCLC clinical samples. The expression levels of LRIG2 and INPP5B may thus be regulated by METTL3-mediated methylation.\u003c/p\u003e\n\u003cp\u003eTumor immunity is a specific immune response activated by the body to tumor cells. Studies have shown that\u0026nbsp;m\u003csup\u003e6\u003c/sup\u003eA modification mediated by the RNA methyltransferase METTL3 regulates the functional activation of dendritic cells by altering mRNA translation.\u003csup\u003e30\u003c/sup\u003e In 2018, Song Erwei et al. revealed a new mechanism by which lncRNAs change the balance of T-cell subsets in the tumor microenvironment by regulating the apoptotic sensitivity of T-cell subsets, resulting in tumor immune escape.\u003csup\u003e31\u003c/sup\u003e Our experimental results showed that the infiltration of dendritic cells and CD8+ T cells was significantly increased in NSCLC tumors with MALAT1 silencing and was significantly reduced after METTL3 overexpression. This finding suggests that the lncRNA MALAT1 may affect the NSCLC immune microenvironment by regulating METTL3 expression.\u003c/p\u003e\n\u003cp\u003eIn summary, our findings suggest that the lncRNA MALAT1 affects the tumor immune microenvironment by targeting METTL3 and plays a key role in promoting the progression of NSCLC (Figure 9). Our data also confirm the regulatory effect of METTL3 on the oncoprotein LRIG2 and the tumor suppressor protein INPP5B, but the specific mechanism of action needs to be further studied. In future studies, we will continue to evaluate how METTL3 affects the NSCLC immune microenvironment, providing new directions for the treatment of NSCLC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003em\u003csup\u003e6\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003eN6-methyladenosine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003elncRNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003eLong non-coding RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMALAT1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003emetastasis associated in lung denocarcinoma transcript 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNSCLC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003enon-small cell lung cancer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMETTL3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003emethyltransferase-like 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eINPP5B\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003einositol polyphosphate-5-phosphatase B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLRIG2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003eleucine-rich repeats and immunoglobulin-like domains 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSi+NO-NC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003eLncRNA MATTL1 interferes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSi+NO\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003eLncRNA MATTL1 interferes with + overexpression of METTL3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEdU\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003e5-ethynyl-2-deoxyuridine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.1413%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRIP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.8587%;\"\u003e\n \u003cp\u003eRNA Immunoprecipitation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Hainan Provincial Natural Science Foundation High level Talent Project(NO. 822RC843).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHainan Provincial Natural Science Foundation High level Talent Project(NO. 822RC843).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiment involving mice has been approved by the Animal Ethics Committee of the\u0026nbsp;research center for drug safety evaluation of Hainan, Hainan Medical University.\u0026nbsp;The collection of NSCLC tissues and adjacent non-cancer tissues was approved by the Ethics Committee of the Second Affiliated Hospital of Hainan Medical University.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- Approval of the research protocol by an Institutional Reviewer Board.\u003c/p\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003cp\u003e- Informed Consent.\u003c/p\u003e\n\u003cp\u003eAll informed consent was obtained from the subject(s) and/or guardian(s).\u003c/p\u003e\n\u003cp\u003e- Registry and the Registration No. of the study/trial.\u003c/p\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003cp\u003e- Animal Studies.\u003c/p\u003e\n\u003cp\u003eWild-type Balb/c mice were obtained from the Guangdong Medical Laboratory Animal Center (Foshan, China). The humanized peripheral-blood-mononuclear- cell-engrafted (hu-PBMC) mice were sourced from Gempharmatech Co., Ltd. (Nanjing, China). The\u0026nbsp;research center for drug safety evaluation of Hainan\u0026nbsp;approved the animal protocols used in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eS. T. and F. L. performed the experiments, analyzed the data, drafted the figures, and co-wrote the manuscript. D. F. and Q. W. analyzed and discussed the data. S. T. \u0026nbsp;assisted with the animal experiments. F. L. and B.L. conceived the study, supervised the experiments, analyzed the data, and co-wrote the manuscripts.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWang R, Yamada T, Kita K, et al. Transient IGF-1R inhibition combined with osimertinib eradicates AXL-low expressing EGFR mutated lung cancer[J]. Nat Commun. 2020, 11(1):4607.\u003c/li\u003e\n\u003cli\u003eBray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin. 2021,1:41. \u003c/li\u003e\n\u003cli\u003eCastellano JJ, Marrades RM, Molins L, et al. Extracellular vesicle lincRNA-p21 expression in tumor-draining pulmonary vein defines prognosis in NSCLC and modulates endothelial cell behavior[J]. Cancers (Basel). 2020,2(3):734.\u003c/li\u003e\n\u003cli\u003eWilson C, Chen PJ, Miao Z, et al. Programmable m\u003csup\u003e6\u003c/sup\u003eA modification of cellular RNAs with a Cas13-directed methyltransferase[J]. Nat Biotechnol. 2020, 38(12):1431- 1440. \u003c/li\u003e\n\u003cli\u003eYang Y, Hsu PJ, Chen YS, et al. Dynamic transcriptomic m\u003csup\u003e6\u003c/sup\u003eA decoration: writers, erasers, readers and functions in RNA metabolism[J]. Cell Res. 2018, 28(6):616-624.\u003c/li\u003e\n\u003cli\u003eJi L, Chen S, Gu L, et al. Exploration of Potential Roles of m\u003csup\u003e6\u003c/sup\u003eA Regulatorsin Colorectal Cancer Prognosis[J]. Front Oncol. 2020, 10:768.\u003c/li\u003e\n\u003cli\u003eLiu T, Wei Q, Jin J, et al. The m\u003csup\u003e6\u003c/sup\u003eA reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation[J]. Nucleic Acids Res. 2020, 48(7):3816-3831. \u003c/li\u003e\n\u003cli\u003eWang Y, He Y, Su C, et al. Nuclear Localized O-Fucosyl- transferase SPY Facilitates PRR5 Proteolysis to Fine-Tune the Pace of Arabidopsis Circadian Clock[J]. Mol Plant. 2020, 13(3):446-458.\u003c/li\u003e\n\u003cli\u003eZhang M, Han Y, Zheng Y, et al. ZEB1-activated LINC01123 accelerates the malignancy in lung adenocarcinoma through NOTCH signaling pathway[J]. Cell Death Dis. 2020, 11(11):981.\u003c/li\u003e\n\u003cli\u003eSun T, Wu Z, Wang X, et al. LNC942 promoting METTL14- mediated m\u0026lt;sup\u0026gt;6\u0026lt;/sup\u0026gt;A methylation in breast cancer cell proliferation and progression[J]. Oncogene. 2020, 39(31):5358-5372.\u003c/li\u003e\n\u003cli\u003eHan M, Wang S, Fritah S, et al. Interfering with long non-coding RNA MIR22HG processing inhibits glioblastoma progression through suppression of Wnt/ \u0026beta;-catenin signalling[J]. Brain. 2020, 143(2):512-530. \u003c/li\u003e\n\u003cli\u003eJia R, Chai P, Wang S, et al. m\u003csup\u003e6\u003c/sup\u003eA modification suppresses ocular melanoma through modulating HINT2 mRNA translation[J]. Mol Cancer. 2019, 18(1):161.\u003c/li\u003e\n\u003cli\u003eJin D, Guo J, Wu Y, et al. Correction to: m\u003csup\u003e6\u003c/sup\u003eA mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis[J]. J Hematol Oncol. 2020, 13(1):106.\u003c/li\u003e\n\u003cli\u003eJin D, Guo J, Wu Y, et al. m\u003csup\u003e6\u003c/sup\u003eA mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis[J]. J Hematol Oncol. 2021, 14(1):32.\u003c/li\u003e\n\u003cli\u003eLiu L, Li H, Hu D, et al. Insights into N6-methyladenosine and rogrammed cell death in cancer. \u003cem\u003eMol Cancer\u003c/em\u003e. 2022;21(1):32.\u003c/li\u003e\n\u003cli\u003eCheng C, Wang P, Yang Y, et al. Smoking-Induced M2-TAMs, via ircEML4 in EVs, Promote the Progression of NSCLC through LKBH5-Regulated m\u003csup\u003e6\u003c/sup\u003eA Modification of SOCS2 in NSCLC Cells. \u003cem\u003eAdv Sci (Weinh)\u003c/em\u003e. 2023;10(22):e2300953.\u003c/li\u003e\n\u003cli\u003eGuo YQ, Wang Q, Wang JG, et al. METTL3 modulates m\u003csup\u003e6\u003c/sup\u003eA odification of CDC25B and promotes head and neck squamous cell carcinoma malignant progression. \u003cem\u003eExp Hematol Oncol\u003c/em\u003e. 2022;11(1):14. \u003c/li\u003e\n\u003cli\u003eTang J, Wang X, Xiao D, Liu S, Tao Y. The chromatin-associated RNAs in gene regulation and cancer. \u003cem\u003eMol Cancer\u003c/em\u003e. 2023;22(1):27.\u003c/li\u003e\n\u003cli\u003eZhang K, Dong Y, Li M, et al. Clostridium butyricum inhibits epithelial-mesenchymal transition of intestinal carcinogenesis through downregulating METTL3. \u003cem\u003eCancer Sci\u003c/em\u003e. 2023;114(8):3114-3127.\u003c/li\u003e\n\u003cli\u003eJiang R, Dai Z, Wu J, Ji S, Sun Y, Yang W. METTL3 stabilizes HDAC5 mRNA in an m\u003csup\u003e6\u003c/sup\u003eA-dependent manner to facilitate malignant proliferation of osteosarcoma cells. \u003cem\u003eCell Death Discov\u003c/em\u003e. 2022;8(1):179.\u003c/li\u003e\n\u003cli\u003eZhang Y, Liu S, Zhao T, Dang C. METTL3‑mediated m\u003csup\u003e6\u003c/sup\u003eA modification of Bcl‑2 mRNA promotes non‑small cell lung cancer progression [published correction appears in Oncol Rep. 2023 Apr;49(4):]. \u003cem\u003eOncol Rep\u003c/em\u003e. 2021;46(2):163.\u003c/li\u003e\n\u003cli\u003eHAN Y, JIANG J J, SANG S L, et al. Research progress on mechanisms of m\u003csup\u003e6\u003c/sup\u003eA RNA methylated modification regulating non-small cell lung cancer[J]. Academic Journal of Shanghai University of Traditional Chinese Medicine, 2023, 37(4): 83-89. \u003c/li\u003e\n\u003cli\u003eLi B, Zhao R, Qiu W, et al. The N6-methyladenosine-mediated lncRNA WEE2-AS1 promotes glioblastoma progression by stabilizing RPN2. \u003cem\u003eTheranostics\u003c/em\u003e. 2022;12(14):6363-6379.\u003c/li\u003e\n\u003cli\u003eDeng LJ, Deng WQ, Fan SR, et al. m\u003csup\u003e6\u003c/sup\u003eA modification: recent advances, anticancer targeted drug discovery and beyond. \u003cem\u003eMol Cancer\u003c/em\u003e. 2022;21(1):52.\u003c/li\u003e\n\u003cli\u003eFeng Y, Wu F, Wu Y, Guo Z, Ji X. LncRNA DGUOK-AS1 facilitates non-small cell lung cancer growth and metastasis through increasing TRPM7 stability via m\u003csup\u003e6\u003c/sup\u003eA modification. Transl Oncol. 2023;32:101661.\u003c/li\u003e\n\u003cli\u003eZhang W, Zhang S, Dong C, et al. A bibliometric analysis of RNA methylation in diabetes mellitus and its complications from 2002 to 2022. Front Endocrinol (Lausanne). 2022;13:997034.\u003c/li\u003e\n\u003cli\u003eWu L, Cheng D, Yang X, et al. M2-TAMs promote immunoresistance in lung adenocarcinoma by enhancing \u003cem\u003eMETTL3\u003c/em\u003e-mediated m\u003csup\u003e6\u003c/sup\u003eA methylation. \u003cem\u003eAnn Transl Med\u003c/em\u003e. 2022;10(24):1380.\u003c/li\u003e\n\u003cli\u003eHu J, Dong F, He Y, et al. LRIG2 promotes glioblastoma progression by modulating innate antitumor immunity through macrophage infiltration and polarization. \u003cem\u003eJ Immunother Cancer\u003c/em\u003e. 2022;10(9):e004452. \u003c/li\u003e\n\u003cli\u003eDeng J, Lin X, Li Q, et al. Decreased INPP5B expression predicts poor prognosis in lung adenocarcinoma. \u003cem\u003eCancer Cell Int\u003c/em\u003e. 2022;22(1):189.\u003c/li\u003e\n\u003cli\u003eWang H, Hu X, Huang M, et al. Mettl3-mediated mRNA m\u003csup\u003e6\u003c/sup\u003eA methylation promotes dendritic cell activation[J]. Nat Commun. 2019, 10(1):1898. \u003c/li\u003e\n\u003cli\u003eHuang D, Chen J, Yang L, et al. NKILA lncRNA promotes tumor immune evasion by sensitizing T cells to activation-induced cell death[J]. Nat Immunol. 2018 , 19(10):1112-1125.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"NSCLC, lncRNA MALAT1, METTL3, targeted binding, tumor immune microenvironment","lastPublishedDoi":"10.21203/rs.3.rs-5243760/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5243760/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective: \u003c/strong\u003eThis study aims to examine whether lncRNA MALAT1 targets METTL3 and modulates its expression, subsequently influencing the expression of INPP5B and LRIG2 genes. Additionally, the research seeks to determine how these interactions regulate the tumor immune microenvironment and impact the progression of non-small cell lung cancer (NSCLC).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eNon-small cell lung cancer cells (NCI-H226) served as the experimental model in this study. The cells were transfected with si-MALAT1 and OE-METTL3 constructs. Fluorescence in situ hybridization (FISH) was employed to determine the subcellular localization of MALAT1. Apoptosis was quantified using flow cytometry, whereas cell proliferation was assessed through the 5-ethynyl-2'-deoxyuridine (EDU) incorporation assay. The Transwell assay was utilized to evaluate cell migration capability and m6A methylation levels. Quantitative PCR (qPCR) and Western blot (WB) analyses were conducted to measure the expression levels of cancer-related genes. Furthermore, an RNA immunoprecipitation (RIP) assay was conducted to validate the interaction between MALAT1 and METTL3. To investigate the functional implications of this interaction, a BALB/c nude mouse subcutaneous xenograft model was utilized, wherein NSCLC cells with silenced MALAT1 expression were employed, both with and without the overexpression of METTL3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eThe MALAT1 is primarily localized within the nucleus. Under conditions of low expression, MALAT1 remains confined to the nucleus, whereas at elevated expression levels, it translocates to the cytoplasm. Following the application of siRNA targeting MALAT1 (si-MALAT1), a reduction in cell proliferation and migration capabilities was observed, although no significant change in cell colony formation ability was detected. Additionally, an increase in cell apoptosis was noted, with cells exhibiting arrest in the G0/G1 phase of the cell cycle. In parallel, the expression levels of MALAT1 and the oncogenic gene LRIG2 were both diminished, concomitant with a reduction in m6A methylation levels. Subsequent to the interference with MALAT1, transfection with a METTL3 overexpression vector led to a notable decrease in apoptosis, retention of cells in the S phase, and a significant downregulation of the tumor suppressor gene INPP5B. Results from the RIP assay indicated an interaction between MALAT1 and the MALAT1 protein. Furthermore, MALAT1 modulates the impact of METTL3 on the immune microenvironment of NSCLC tumors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThe long non-coding RNA MALAT1 facilitates the progression of NSCLC and holds potential as a novel prognostic biomarker and therapeutic target.\u003c/p\u003e","manuscriptTitle":"LncRNA MALAT1 promotes METTL3-mediated m6A modification to promote progression in non-small cell lung cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-18 09:49:13","doi":"10.21203/rs.3.rs-5243760/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9a6415d1-2601-40a4-a854-1e51a6d53f4a","owner":[],"postedDate":"October 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-20T02:53:31+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-18 09:49:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5243760","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5243760","identity":"rs-5243760","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.