Comparative transcriptomics uncovers apoptosis in brain impairment in newly pupated honeybee worker under cold stress

Comparative transcriptomics uncovers apoptosis in brain impairment in newly pupated honeybee worker under cold stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparative transcriptomics uncovers apoptosis in brain impairment in newly pupated honeybee worker under cold stress Xiangjie Zhu, Mingjie Cao, Hongzhi Xu, Yuanmingyue Tian, Chenyu Zhu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4137942/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Honeybees have a much narrower developmental temperature range compared to other insects, making it an ideal model species for studying temperature effect on insect metamorphosis. Cold exposure during pupal stage resulted in impaired learning, memory, and foraging ability in adults. So far, the understanding of molecular mechanisms and physiological processes underlying the impaired brain development of honeybee pupae under cold exposure is unclear. Result The transcriptome data used in this study were collected from the heads of white-eyed honeybee pupae between control group and cold-treated groups. A total of 736 significantly differentially expressed genes (DEGs) were found to be shared by the different durations of cold treatment, and three gene clusters with significant expression patterns were identified using gene expression trend analysis, and RT-qPCR verification was performed on six genes. Enrichment analyses of each cluster using GO and KEGG database showed that upregulated DEGs followed by a plateau were significantly enriched in apoptosis, axon regeneration and signalling pathways regulating pluripotency of stem cells genes, consistently upregulated DEGs were significantly enriched in MAPK signalling pathway, and the downregulated DEGs followed by a plateau were related to insect ecdysteroids synthesis ( phm and spookiest ), epigenetic regulation of genes associated with brain development ( LSD1 ), endoplasmic reticulum-associated protein degradation ( RNF5 and SVIP ) and regulation of endoplasmic reticulum stress-associated cell apoptosis ( FBXO32 , PET191 and UBL5 ). Conclusion Our study suggests that cold stress will inhibit the synthesis of ecdysteroids, disrupt gene epigenetic regulation, and intensify endoplasmic reticulum stress-associated brain cell apoptosis, thus hinder brain development in new pupal heads. Apis mellifera new pupae apoptosis trend analysis low temperature brain impairment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Apis mellifera have been widely used as pollinators since the application of pollination services began [1], they are the primarily managed species worldwide for both honey production and crop pollination, demonstrating their important value in both crop diversity and sustainable agriculture [2]. In recent years, there has been an increasing emphasis on the impact of global climate change on plant pollination [3–5], the alarming decline in honeybee populations [6–8] and their brood-rearing behaviour [9], raising concerns about their overall health. The central nervous system (CNS) of the honeybee is crucial in both forging and pollinating behaviours. Honeybees forage across wide expanses to collect nectar, pollen, and propolis to take back to the hive. This activity is essential for the sustainability of bee colonies, and pollination can be seen as a positive result of their efforts. By using sensory organs in the head, honeybees can detect the colour and odour of the flower [10, 11]. These signals are processed by the mushroom body, which is the centre of sensory integration [12]. The processed signals are then transmitted through the nervous system and serve as visual and olfactory cues for honeybee visitation [13]. This pattern of stimuli and rewards involves learning and memory behaviour, as the colony must adapt to the frequent changes in floral resources throughout their foraging lifetime (review in ref. [14]). As eusocial insects, honeybees communicate information to recruit additional foragers for food resources through dance behaviour (review in ref. [15]). Some research indicates that the central complex of the honeybee brain could be involved in the neurobiological process underlying this behaviour [16]. Central nervous system dysfunction in honeybees, caused by cold stress during the developmental stage, can hinder their foraging ability and have detrimental effects on the health of bee colonies. In comparison to many insects, honeybees have a much narrower developmental temperature range (32°C-36°C, the optimum temperature is 35℃). Deviation from the optimal temperature during development can result in abnormal development of honeybee broods, including abnormal external morphology of adult honeybee (proboscis, forewing, and hind leg) [17], and a shortened lifespan [18, 19]. Due to the various evidence available, it is clear that cold stress can hinder the development of honeybee brains [20]. This includes a decline in the number of mushroom body synaptic complexes [21], leading to impaired learning, memory, and foraging abilities in adult honeybees after they emerge [20]. Based on our team's preliminary research, it has been found that cold stress can impede brain development in the new puape stage of Apis mellifera and lead to a significant reduction in the learning and memory abilities when they emerge [20], however, the mechanism by which brain development is impeded remains unclear. In this study, we conducted in-depth comparative exploitation of previously collected high-quality transcriptome data, using the trend analysis method, we were able to select the set of genes that conformed to a certain expression pattern (e.g., the expression continued to increase or decrease) in honeybee pupae head under prolongation of cold treatment, to reduce the complexity of the data and the difficulty of the analysis and facilitate the discovery of key genes that responded to the cold stress during this certain developmental stage. Methods The sample preparation The samples used in this study were collected from healthy colonies during the spring season, with no signs of known brood diseases. Using the sampling method previously developed by our research group to obtain consistent honeybee eggs [19], each queen was confined in a mesh cage to lay eggs on a fresh comb for a period of 12 h. These eggs were then left in the colony until they were sealed by workers. The sections of comb containing broods that capped within 4 h were removed and placed in a chamber with consistent temperature and humidity (35°C ± 0.2°C, RH 75%) [THB-250, Allison Instruments and Equipment (Shanghai) Co., Ltd., precision ± 0.1°C] for 4 d, namely CK4, then transfer two groups of 4 d capped broods into another chamber and apply the cold treatment (20°C ± 0.2°C, RH 75%) for 24 h and 48 h, namely T5 and T6. Each group contain 10 capped broods, and once the treatment is complete, cut the head from honeybee pupae and store it at -80 ℃ for further use. Differential gene expression and trends analysis The transcriptome data collected from the heads of white-eyed honeybee pupae with no temperature treatment (control group, CK4) and with 20℃ cold treatments for 24 h and 48 h (cold treatment group, T5 and T6) were acquired from previously published data by our research group (NCBI SRA login number: SRR15710549-SRR15710554). Expression levels of transcripts were determined using the FPKM method and differentially expressed genes (DEGs) between the two samples were analyzed using the DEGseq R package [22]. DEGs were identified using a Poisson distribution with a false discovery rate (FDR) ≤ 0.05 and fold change ≥ 2 (log2 ratio ≥ 1, fold change = FPKM of the treatment group/ FPKM of the control group) through multiple hypothesis testing. Significant differential expressions were determined based on this threshold. The three time-point DEGs were then clustered using STEM[23] through the OmicShare online platform for data analysis (https://www.omicshare.com/tools/Home/Soft/getsoft). Functional classification of DEGs Use both GO and KEGG databases to annotate the DEGs clusters with significant expression trends identified in 2.2 and perform hypothesis testing to obtain P-values. Then, adjust the P-values to Q-values to evaluate if the GO terms and KEGG signalling pathways in the DEGs clusters are significantly enriched, with a threshold of Q ≤ 0.05. This analysis will be carried out using OmicShare online platform tools (https://www.omicshare.com/tools/Home/Soft/getsoft). RT-qPCR validation The primers for this study were designed using NCBI Primer Blast and are listed in Table 1. Each sample underwent three biological replicates and three technical replicates for the target gene. Total RNA was extracted from the samples gathered in the section “The sample preparation” using the Transzol ® Up Plus RNA Kit, and cDNA was synthesized through reverse transcription using TransScript ® Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR. The resulting cDNA was then used as a template for quantitative PCR (qPCR), with a reaction system of 10 μL following the PerfectStart ® Green qPCR SuperMix instructions. the 2 − △△ Ct method has been used to calculate the relative expression level of studied genes, with Actin used as a reference. At last, the expression level will be logarithmically transformed using a base of 2, and the result will be determined by taking the average value. The difference in gene expression between the treatment group and the control group was analyzed using an unpaired t-test to determine statistical significance. Table 1. Primers for RT-qPCR of DEGs. Gene Gene ID Primer sequence ACTIN LOC413144 F: TGCCAACACTGTCCTTTCTG R: AGAATTGACCCACCAATCCA RNF5 LOC408751 F:ACAAGGGAACAAGCTGGACC R: TTGCCTTGTTGGAGTGTCT PET191 LOC725170 F:TGTGCTCATTTACGTGCAAGC R: AGGTCCTCTAAATCTTCGCCT SVIP LOC102655388 F:TGTTGCAAACAATCATCTTCATGTG R: TTCCTCGGTTTTGTTGTTCAGC UBL5 LOC724489 F:TAACATGCAATGATCGTCTTGG R: ATGAGTTCCAGTTTGAGCTGC MAP3K9 LOC411566 F:TTCATGGATTGCGCATGAAGG R: TGTCGTTGCTGAACTTGTGC NUMR1 LOC726755 F:AATCGATGCACACAGCAACC R: TTCGCCAAACACATACGGGA Results Morphology of pupae developing under cold stress Honeybee new pupae were photographed every 24 hours under white light to observe their external morphological changes. In pupae developing at normal temperatures, the compound eyes undergo noticeable colour changes. After 4 days of being sealed, the honeybee larvae complete their moulting and pupation process, resulting in white compound eyes. By day 5, the eyes turn pink, and by day 6, they become dark red (Figure 1A). In contrast, pupae subjected to cold treatment have no notable colour changes in their compound eyes during the same timeframe (Figure 1B). Identification of gene expression trends in different cold treatment duration The differentially expressed genes (DEGs) between the cold treatment groups (T5, T6) and the control group (CK4) were determined using multiple hypotheses testing based on the Poisson distribution. The threshold for identification included a false discovery rate (FDR) of less than 0.05 and a fold change of ≥2 (log2 ratio ≥1). At three time points, a total of 1707 DEGs were identified when compared to the control group, with 1269 DEGs in T5 vs CK4 and 1174 DEGs in T6 vs CK4, the intersection of the two comparison groups results in a total of 736 shared DEGs (Figure 2A). These DEGs are likely associated with the regulation of honeybee pupae brain development under cold stress conditions. As the duration of cold stress increased, we noted that a decrease in the number of DEGs was observed in the pupae head, indicating possible gene expression inhibition. To further investigate the expression patterns and functions of DEGs contained in three time points, the DEGs were clustered by STEM. The total 736 DEGs shared between two comparison groups were divided into 8 profiles. Most of these DEGs were clustered into three profiles with significant trends (P-value < 0.05) (Figure 1B), which included a downregulated trend for profile 1 (289) and two upregulated trends for profile 6 (329) and profile 7 (97) (Figure 2B). GO enrichment analysis of gene clusters The GO enrichment analysis findings revealed that post cold stress, the new pupae head DEGs exhibited the highest number of genes classified under biological processes. DEGs on Profile 1 showed enrichment in 27 level 2 GO terms, whereas DEGs on Profile 6 and Profile 7 displayed enrichment in 32 and 24 GO level 2 GO terms, respectively (Figure 3). KEGG enrichment analysis of gene clusters The DEGs were found to be enriched in 29 signalling pathways in Profile 1 according to the results of the KEGG pathway enrichment analysis. The KEGG pathway with the most enriched genes are Spliceosome(3), Ribosome(3), Insect hormone biosynthesis(2), Thermogenesis(2), Protein processing in endoplasmic reticulum(2), Amyotrophic lateral sclerosis(2), Metabolic pathways(2)。The DNAL4 gene is enriched in two pathways that are both associated with neurological disorders, including Pathways of neurodegeneration - multiple diseases and Huntington disease (Figure 4). The DEGs in Profile 6 were found to be enriched in 38 signalling pathways, as revealed by the KEGG pathway enrichment analysis. Among these pathways, the most enriched genes were found in Metabolic pathways (4), Apoptosis - fly (3), Axon regeneration (3), Signaling pathways regulating pluripotency of stem cells (3), mRNA surveillance pathway (3), Spliceosome (3), and Amyotrophic lateral sclerosis (3). Moreover, Apoptosis – fly, Axon regeneration, and Signaling pathways regulating the pluripotency of stem cells showed significant enrichment with a Q-value of less than 0.05 (Figure 4). In Profile 7, the DEGs were enriched in 6 signalling pathways: MAPK signalling pathway – fly (2), Axon regeneration (1), Synaptic vesicle cycle (1), Transcriptional misregulation in cancer (1), Aminoacyl-tRNA biosynthesis (1), and Spliceosome (1). DEGs show significant enrichment in the MAPK signalling pathway - fly (Q-value < 0.05) (Figure 4). Verification of expression patterns through qPCR analysis To validate the transcriptome data, RT-qPCR analysis was performed on six genes (RNF5, PET191, SVIP, UBL5, MAP3K9 and NUMR1) in three gene clusters. The results showed that the expression patterns of most genes were consistent with the transcriptome data, indicating its reliability (Figure 5). Discussion 35℃ is considered the optimal temperature for honeybee development, and our previous studies have shown through tissue sections that brain development of new pupae stagnates after exposure to cold stress, and learning and memory are impaired in adults [20]. However, the physiological processes and molecular mechanisms behind this phenomenon of cold-stress effect have not been thoroughly investigated. With this aim in mind, we analyzed the trends of DEGs in the pupae heads of white-eyed pupae with or without cold treatment, suggesting that ER stress-associated cell apoptosis may be the key factor contributing to brain developmental defects during cold exposure. At the same time, we found that cold stress may inhibit the synthesis of ecdysteroids in the pupae head and interfere with epigenetic regulation associated with brain development, which are also possible factors for the inhibition of pupae brain development. We also found that DEGs associated with neuronal differentiation and neuronal damage repair showed an up-regulation trend during cold stress, suggesting a potential repair mechanism for pupae in response to cold stress. This study also lays the groundwork for the subsequent functional validation of genes related to brain development. Accumulation of misfolded proteins exacerbates endoplasmic reticulum (ER) stress-induced cell apoptosis RNF5 and SVIP , which were identified in Profile 1 and annotated in protein processing in endoplasmic reticulum pathways, are involved in endoplasmic reticulum-associated protein degradation (ERAD). The ubiquitin/protease system is responsible for clearing misfolded proteins during protein synthesis through various physiological steps catalyzed by E3 ubiquitin ligase[24]. RNF5 encodes E3 ubiquitin-protein ligase RNF5 and is involved in degrading misfolded proteins within the endoplasmic reticulum [25, 26]. SVIP , on the other hand, encodes the Small VCP/p97 interacting protein (SVIP) in Drosophila, serving as an interaction cofactor that regulates protein quality control and responds to cellular stress [27]. The highly conserved VCP/p97 in eukaryotic cells binds to SVIP , recognizing ubiquitinated proteins and transferring them from the endoplasmic reticulum to the cytosol for degradation [28–30]. The expression levels of RNF5 and SVIP downregulated in response to cold stress, indicating that the degradation of misfolded proteins in the endoplasmic reticulum of head tissue cells was inhibited, leading to the accumulation of misfolded proteins (Figure 6). The downregulation of FBXO32 in Profile 1 could play a crucial role in regulating cell apoptosis induced by endoplasmic reticulum stress (ER stress). The build-up of misfolded proteins in the endoplasmic reticulum results in endoplasmic reticulum stress, which triggers unfolded protein responses (UPR) [31, 32]. Adverse environmental stress can induce endoplasmic reticulum stress, which triggers unfolded protein responses (UPR) [33]. This activation of the IRE1 pathway in Apis mellifera worker cells leads to the splicing of XBP1u mRNA, turning it into XBP1s mRNA. As a result, XBP1s are produced and enter the cell nucleus to facilitate the generation of chaperones and other folding-promoting factors [34]. If the stress intensity exceeds a certain threshold or persists for an extended period, ER stress will ultimately result in cell apoptosis [35]. Additionally, XBP1s has been shown to enhance the synthesis of the CHOP transcription factor [36–38], thereby exacerbating honeybee cell apoptosis [39]. FBXO32 encodes a ubiquitin-E3 ligase that plays a role in regulating cellular autophagy and maintaining endoplasmic reticulum homeostasis [40]. Mutations in FBXO32 result in increased CHOP expression and worsen cell apoptosis induced by ER stress [41]. In this study, FBXO32 were downregulated in Profile 1, annotated in the FoxO signalling pathway. It is hypothesized that cold exposure will induce ER stress in the brain cells of new pupae, resulting in elevated apoptosis and hindrance to normal pupal brain development (Figure 6). The downregulation of the UBL5, annotated in the thermogenesis pathway, could be another factor that intensifies ER-stress-associated brain cell apoptosis. UBL5 is known to play a crucial role in the organisms’ stress response [42]. UBL5 encode Ubiquitin-like protein 5 (UBL5) is not only involved in the response to unfolded protein reactions in cell mitochondria [43] but it has also been implicated in ER stress-induced cell apoptosis. The PERK pathway plays a role in the cellular response to unfolded protein responses, as demonstrated in a series of studies [44–46]. Additionally, this pathway is a crucial UPR regulatory pathway present in insects [47, 48]. When unfolded protein reactions take place in the endoplasmic reticulum, the cellular PERK pathway plays a crucial role in degrading the UBL5 protein, ultimately resulting in heightened cell apoptosis [49]. The study indicated a downward trend in the expression of UBL5 , indicating that, alongside the IRE1 pathway, cold stress can also trigger the activation of the PERK pathway, leading to increased apoptosis in brain cells of honeybee pupae, and may potentially inhibit brain development (Figure 6). PET191 encodes a protein that plays a role in the assembly of cytochrome oxidase [50, 51], an enzyme involved in the mitochondrial electron transport chain. Cytochrome oxidase is important for neuronal metabolic activity and is considered a marker of neuronal function and size [52]. Inhibition of cytochrome oxidase activity in neuronal mitochondria can exacerbate endoplasmic reticulum stress-induced neuronal apoptosis [53]. PET191 were downregulated in Profile 1, annotated in the thermogenesis pathway, suggesting that it could be a crucial factor in the regulation of apoptosis in honeybee pupae brain cells (Figure 6). Inhibition of ecdysteroids synthesis in pupae head Multiple members of the cytochrome P450 gene family play a role in regulating ecdysteroid production, and their presence in Profile 1 implies that cold stress could potentially impede the synthesis of ecdysteroids. Ecdysone and 20-hydroxyecdysone are important hormones in insect moulting, collectively known as ecdysteroids. The brain is the main site for ecdysone synthesis in honeybee workers, with the conversion to 20-hydroxyecdysone occurring mainly in the brain and fat body tissue [54]. The CYP306A1 enzyme is crucial for ecdysone biosynthesis, as it catalyzes the conversion of ketodiol to ketotriol [55]. Insects' development process is hindered by the reduction in CYP306A1 expression level. Silencing the CYP306A1 gene expression in third instar larvae of Chilo suppressalis resulted in a significant decrease in pupation rate and pupal weight [56]. The CYP307B1 enzyme is also important for ecdysone biosynthesis [57, 58], catalyzing the conversion of 2-deoxydecanone to 3-deoxydecanone [59]. In this study, the downregulated genes CYP306A1 ( phm) and CYP307B1 ( spookiest ) were enriched in the KEGG signalling pathway of insect hormone biosynthesis (P = 0.027， Q = 0.484). It is suggested that cold stress reduces the activity of CYP306A1 and CYP307B1 enzymes, leading to inhibition of ecdysteroid synthesis in the honeybee pupal head. Epigenetic regulation in brain development The gene LSD1 , which is downregulated in Profile 1, is believed to play a crucial role in regulating the development of the worker pupal brain. LSD1 is involved in epigenetic regulation and acts as a lysine-specific demethylase targeting histones H3K4 and H3K9, as well as non-histone substrates, to either inhibit or activate transcription and regulate gene expression [60]. Studies have shown that LSD1 is important for various aspects of brain development [61] and that mutations in LSD1 can lead to paralysis in adult mice, extensive neuronal death in the hippocampus and cortex, and learning and memory disorders [62]. In this study, the expression of LSD1 decreased with prolonged exposure to cold stress. Our team plans to further investigate the role of LSD1 in honeybee pupal brain development by using RNAi methods to confirm the relationship between LSD1 downregulation and inhibition of brain development. Neurodevelopment & neuronal repair The DEGs identified in Profile 6 were found to be significantly enriched in three KEGG signalling pathways: apoptosis, axon regeneration, and signalling pathways regulating pluripotency of stem cells (Q < 0.05). The upregulated gene EIP93F , involved in cell apoptosis, has been shown to regulate the development of the Drosophila nervous system, promote autophagy of mushroom body neurocytes, and facilitate the remodelling process of the mushroom body during abnormal development [63]. Additionally, the upregulated gene EPHB1 , present in the axon regeneration pathway, enhances the expression of damaged motor neurons to initiate neuronal repair [64]. Previous research by our team revealed that 70% of bee individuals subjected to 48 h of cold treatment died before completing eclosion [20]. It is speculated that the head tissue development of honeybee worker bees continues to progress even under cold stress. There seems to be a mechanism in place for repairing neural tissue damage, which helps counteract the abnormal apoptosis of head tissue cells caused by the stress. Profile 6 cluster shows an upregulate trend initially, then followed by a plateau phase suggesting a limited ability for damage repair. This aligns with the observation that only 70% of pupae successfully emerge after undergoing 48 hours of cold treatment during the pupal stage. Conclusion In conclusion, cold exposure during the new pupae stage of Apis mellifera worker will lead to the inhibition of ecdysteroids synthesis in the pupae head, interferes with epigenetic regulation related to brain development, and leads to the accumulation of misfolded proteins on the endoplasmic reticulum, which exacerbates apoptosis caused by endoplasmic reticulum stress that may be an important reason for the inhibition of brain development under cold stress. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA database (accession number: SRR15710549–SRR15710554). Competing interests The authors declare that this study was conducted without any business or financial relationships that could be perceived as a potential conflict of interest. Funding This work was supported by the China Agriculture Research System of MOF and MARA (CARS-44-KXJ11), the Fujian Natural Science Foundation Project (2021j01079), and the innovation initiative for undergraduates of Fujian Agriculture and Forestry University (X202310389225, X202310389117). Authors' contributions Conceptualization, M.C., X.Z.; methodology, M.C., X.Z. and X.X.; software, M.C., C.Z.; validation, M.C., Y.T. and H.X.; formal analysis, M.C.; investigation, M.C., X.X., Y.T., M.Y. and Z.Z.; resources, X.Z., B.Z. and S.Z.; data curation, M.C., H.L.; original draft preparation, M.C.; review and editing, X.Z., X.X.; visualization, M.C.; supervision, X.X., S.Z. and B.Z.; project administration, M.C., X.Z.; funding acquisition, X.Z., X.X., S.Z., and B.Z.. All authors reviewed the manuscript. Acknowledgements. We thank Xianbing Su and Mingqi Wang for their laboratory assistance. We also thank the editor and anonymous referees for their helpful comments on this paper. References Valido A, Rodríguez-Rodríguez MC, Jordano P. Honeybees disrupt the structure and functionality of plant-pollinator networks. Sci Rep. 2019;9:4711. Shrestha JB. Honeybees: The Pollinator Sustaining Crop Diversity. J Agric & Environ. 2009;9:90–2. Schweiger O, Biesmeijer JC, Bommarco R, Hickler T, Hulme PE, Klotz S, et al. Multiple stressors on biotic interactions: how climate change and alien species interact to affect pollination. Biological Reviews. 2010;85:777–95. Settele J, Bishop J, Potts SG. Climate change impacts on pollination. Nature Plants. 2016;2:1–3. Giannini TC, Costa WF, Cordeiro GD, Imperatriz-Fonseca VL, Saraiva AM, Biesmeijer J, et al. Projected climate change threatens pollinators and crop production in Brazil. PLOS ONE. 2017;12:e0182274. Hristov P, Shumkova R, Palova N, Neov B. Honey bee colony losses: Why are honey bees disappearing? Sociobiology. 2021;68:e5851–e5851. Hristov P, Shumkova R, Palova N, Neov B. Factors Associated with Honey Bee Colony Losses: A Mini-Review. Veterinary Sciences. 2020;7:166. vanEngelsdorp D, Meixner MD. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. Journal of Invertebrate Pathology. 2010;103:S80–95. Villagomez GN, Nürnberger F, Requier F, Schiele S, Steffan-Dewenter I. Effects of temperature and photoperiod on the seasonal timing of Western honey bee colonies and an early spring flowering plant. Ecology and Evolution. 2021;11:7834–49. Hempel de Ibarra N, Vorobyev M, Menzel R. Mechanisms, functions and ecology of colour vision in the honeybee. J Comp Physiol A. 2014;200:411–33. Martin JP, Beyerlein A, Dacks AM, Reisenman CE, Riffell JA, Lei H, et al. The neurobiology of insect olfaction: Sensory processing in a comparative context. Progress in Neurobiology. 2011;95:427–47. Groh C, Rössler W. Analysis of Synaptic Microcircuits in the Mushroom Bodies of the Honeybee. Insects. 2020;11:43. Rachersberger M, Cordeiro GD, Schäffler I, Dötterl S. Honeybee Pollinators Use Visual and Floral Scent Cues to Find Apple (Malus domestica) Flowers. J Agric Food Chem. 2019;67:13221–7. Lemanski NJ, Cook CN, Smith BH, Pinter-Wollman N. A Multiscale Review of Behavioral Variation in Collective Foraging Behavior in Honey Bees. Insects. 2019;10:370. Von Frisch K, Lindauer M. The “Language” and Orientation of the Honey Bee. Annu Rev Entomol. 1956;1:45–58. Barron AB, Plath JA. The evolution of honey bee dance communication: a mechanistic perspective. Journal of Experimental Biology. 2017;220:4339–46. Xu X, Du X, Zhou S, Zhou B, Lai K, Wang Q, et al. Impacts of high temperature during early capped brood on pupal development and the size of appendages in adult workers Apis cerana . Front Ecol Evol. 2023;11:1144216. Medrzycki P, Sgolastra F, Bortolotti L, Bogo G, Tosi S, Padovani E, et al. Influence of brood rearing temperature on honey bee development and susceptibility to poisoning by pesticides. Journal of Apicultural Research. 2010;49:52–9. Wang Q, Xu X, Zhu X, Chen L, Zhou S, Huang ZY, et al. Low-Temperature Stress during Capped Brood Stage Increases Pupal Mortality, Misorientation and Adult Mortality in Honey Bees. PLoS ONE. 2016;11:e0154547. Zhu C, Li H, Xu X, Zhou S, Zhou B, Li X, et al. The mushroom body development and learning ability of adult honeybees are influenced by cold exposure during their early pupal stage. Front Physiol. 2023;14:1173808. Groh C, Tautz J, Rössler W. Synaptic organization in the adult honey bee brain is influenced by brood-temperature control during pupal development. Proc Natl Acad Sci USA. 2004;101:4268–73. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15:550. Ernst J, Bar-Joseph Z. STEM: a tool for the analysis of short time series gene expression data. BMC Bioinformatics. 2006;7:191. Willis MS, Townley-Tilson WHD, Kang EY, Homeister JW, Patterson C. Sent to Destroy: The Ubiquitin Proteasome System Regulates Cell Signaling and Protein Quality Control in Cardiovascular Development and Disease. Circulation Research. 2010;106:463–78. Tcherpakov M, Delaunay A, Toth J, Kadoya T, Petroski MD, Ronai ZA. Regulation of Endoplasmic Reticulum-associated Degradation by RNF5-dependent Ubiquitination of JNK-associated Membrane Protein (JAMP) *. Journal of Biological Chemistry. 2009;284:12099–109. Delaunay A, Bromberg KD, Hayashi Y, Mirabella M, Burch D, Kirkwood B, et al. The ER-Bound RING Finger Protein 5 (RNF5/RMA1) Causes Degenerative Myopathy in Transgenic Mice and Is Deregulated in Inclusion Body Myositis. PLOS ONE. 2008;3:e1609. Wójcik C, Yano M, DeMartino GN. RNA interference of valosin-containing protein (VCP/p97) reveals multiple cellular roles linked to ubiquitin/proteasome-dependent proteolysis. Journal of Cell Science. 2004;117:281–92. Beskow A, Grimberg KB, Bott LC, Salomons FA, Dantuma NP, Young P. A Conserved Unfoldase Activity for the p97 AAA-ATPase in Proteasomal Degradation. Journal of Molecular Biology. 2009;394:732–46. Huryn DM, Kornfilt DJP, Wipf P. p97: An Emerging Target for Cancer, Neurodegenerative Diseases, and Viral Infections. J Med Chem. 2020;63:1892–907. Ahlstedt BA, Ganji R, Raman M. The functional importance of VCP to maintaining cellular protein homeostasis. Biochem Soc Trans. 2022;50:1457–69. Bergmann TJ, Molinari M. Three branches to rule them all? UPR signalling in response to chemically versus misfolded proteins-induced ER stress. Biology of the Cell. 2018;110:197–204. Hetz C, Zhang K, Kaufman RJ. Mechanisms, regulation and functions of the unfolded protein response. Nat Rev Mol Cell Biol. 2020;21:421–38. Kitamura M. The unfolded protein response triggered by environmental factors. Semin Immunopathol. 2013;35:259–75. Johnston BA, Hooks KB, McKinstry M, Snow JW. Divergent forms of endoplasmic reticulum stress trigger a robust unfolded protein response in honey bees. Journal of Insect Physiology. 2016;86:1–10. Sano R, Reed JC. ER stress-induced cell death mechanisms. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 2013;1833:3460–70. Lee A-H, Iwakoshi NN, Glimcher LH. XBP-1 Regulates a Subset of Endoplasmic Reticulum Resident Chaperone Genes in the Unfolded Protein Response. Molecular and Cellular Biology. 2003;23:7448–59. Chan JY, Luzuriaga J, Maxwell EL, West PK, Bensellam M, Laybutt DR. The balance between adaptive and apoptotic unfolded protein responses regulates β-cell death under ER stress conditions through XBP1, CHOP and JNK. Molecular and Cellular Endocrinology. 2015;413:189–201. Hu H, Tian M, Ding C, Yu S. The C/EBP Homologous Protein (CHOP) Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced Apoptosis and Microbial Infection. Frontiers in Immunology. 2019;9. Kumar D, Banerjee D, Chakrabarti P, Sarkar S, Basu P. Oxidative stress and apoptosis in Asian honey bees ( A. cerana ) exposed to multiple pesticides in intensive agricultural landscape. Apidologie. 2022;53:25. Al-Yacoub N, Shaheen R, Awad SM, Kunhi M, Dzimiri N, Nguyen HC, et al. FBXO32 , encoding a member of the SCF complex, is mutated in dilated cardiomyopathy. Genome Biology. 2016;17:2. Al-Yacoub N, Colak D, Mahmoud SA, Hammonds M, Muhammed K, Al-Harazi O, et al. Mutation in FBXO32 causes dilated cardiomyopathy through up-regulation of ER-stress mediated apoptosis. Commun Biol. 2021;4:1–12. Chanarat S. UBL5/Hub1: An Atypical Ubiquitin-Like Protein with a Typical Role as a Stress-Responsive Regulator. International Journal of Molecular Sciences. 2021;22:9384. Haralambous C, Ntouma V. Islet Beta-Cell Specific Deletion of UBL5 Gene Associated with Mitochondrial Stress Leads to Diabetes in Mice and Beta-Cell Impairment/Death. Diabetes. 2018;67 Supplement_1:311-LB. Hughes D, Mallucci GR. The unfolded protein response in neurodegenerative disorders – therapeutic modulation of the PERK pathway. The FEBS Journal. 2019;286:342–55. Wang Y, Alam GN, Ning Y, Visioli F, Dong Z, Nör JE, et al. The Unfolded Protein Response Induces the Angiogenic Switch in Human Tumor Cells through the PERK/ATF4 Pathway. Cancer Research. 2012;72:5396–406. Schroder M, Kaufman RJ. Divergent Roles of IRE1α and PERK in the Unfolded Protein Response. Current Molecular Medicine. 2006;6:5–36. Ryoo HD. Drosophila as a model for unfolded protein response research. BMB Reports. 2015;48:445–53. Adames TR, Rondeau NC, Kabir MT, Johnston BA, Truong H, Snow JW. The IRE1 pathway regulates honey bee Unfolded Protein Response gene expression. Insect Biochemistry and Molecular Biology. 2020;121:103368. Wang W, Hawkridge AM, Ma Y, Zhang B, Mangrum JB, Hassan ZH, et al. Ubiquitin-like protein 5 is a novel player in the UPR–PERK arm and ER stress–induced cell death. Journal of Biological Chemistry. 2023;299:104915. McEwen JE, Hong KH, Park S, Preciado GT. Sequence and chromosomal localization of two PET genes required for cytochrome c oxidase assembly in Saccharomyces cerevisiae. Curr Genet. 1993;23:9–14. Khalimonchuk O, Rigby K, Bestwick M, Pierrel F, Cobine PA, Winge DR. Pet191 Is a Cytochrome c Oxidase Assembly Factor in Saccharomyces cerevisiae. Eukaryotic Cell. 2008;7:1427–31. Wong-Riley MTT. Cytochrome oxidase: an endogenous metabolic marker for neuronal activity. Trends in Neurosciences. 1989;12:94–101. Costa RO, Ferreiro E, Oliveira CR, Pereira CMF. Inhibition of mitochondrial cytochrome c oxidase potentiates Aβ-induced ER stress and cell death in cortical neurons. Molecular and Cellular Neuroscience. 2013;52:1–8. Yamanaka N, Rewitz KF, O’Connor MB. Ecdysone Control of Developmental Transitions: Lessons from Drosophila Research. Annu Rev Entomol. 2013;58:497–516. Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, et al. CYP306A1, a Cytochrome P450 Enzyme, Is Essential for Ecdysteroid Biosynthesis in the Prothoracic Glands of Bombyx and Drosophila *. Journal of Biological Chemistry. 2004;279:35942–9. Lu Y, Bai Q, Li Q, Zheng X, Tian J, Guo J, et al. Two P450 genes, CYP6SN3 and CYP306A1, involved in the growth and development of Chilo suppressalis and the lethal effect caused by vetiver grass. International Journal of Biological Macromolecules. 2022;223:860–9. Rewitz KF, Gilbert LI. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: Evolutionary implications. BMC Evolutionary Biology. 2008;8:60. Van Ekert E, Wang M, Miao Y-G, Brent CS, Hull JJ. RNA interference-mediated knockdown of the Halloween gene Spookiest (CYP307B1) impedes adult eclosion in the western tarnished plant bug, Lygus hesperus. Insect Molecular Biology. 2016;25:550–65. Shahzad MF, Idrees A, Afzal A, Iqbal J, Qadir ZA, Khan AA, et al. RNAi-Mediated Silencing of Putative Halloween Gene Phantom Affects the Performance of Rice Striped Stem Borer, Chilo suppressalis . Insects. 2022;13:731. Kim D, Kim KI, Baek SH. Roles of lysine-specific demethylase 1 ( LSD1 ) in homeostasis and diseases. J Biomed Sci. 2021;28:41. Zhang F, Xu D, Yuan L, Sun Y, Xu Z. Epigenetic regulation of Atrophin1 by lysine-specific demethylase 1 is required for cortical progenitor maintenance. Nat Commun. 2014;5:5815. Christopher MA, Myrick DA, Barwick BG, Engstrom AK, Porter-Stransky KA, Boss JM, et al. LSD1 protects against hippocampal and cortical neurodegeneration. Nat Commun. 2017;8:805. Siegrist SE. Termination of Drosophila mushroom body neurogenesis via autophagy and apoptosis. Autophagy. 2019;15:1481–2. Tyzack GE, Hall CE, Sibley CR, Cymes T, Forostyak S, Carlino G, et al. A neuroprotective astrocyte state is induced by neuronal signal EphB1 but fails in ALS models. Nat Commun. 2017;8:1164. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4137942","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":282185431,"identity":"2399bcd3-511c-4b39-902c-5006ffa685f3","order_by":0,"name":"Xiangjie Zhu","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Xiangjie","middleName":"","lastName":"Zhu","suffix":""},{"id":282185432,"identity":"abd1813c-7e9d-43b0-8aac-2e881b4892b9","order_by":1,"name":"Mingjie Cao","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Mingjie","middleName":"","lastName":"Cao","suffix":""},{"id":282185433,"identity":"a5fcac70-5473-4562-8492-fd6500996a30","order_by":2,"name":"Hongzhi Xu","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Hongzhi","middleName":"","lastName":"Xu","suffix":""},{"id":282185434,"identity":"c292ebac-94ce-4a54-a7d5-aa88bbb0cf95","order_by":3,"name":"Yuanmingyue Tian","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Yuanmingyue","middleName":"","lastName":"Tian","suffix":""},{"id":282185435,"identity":"59af64f0-871e-4397-b015-f68f6255b62a","order_by":4,"name":"Chenyu Zhu","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Chenyu","middleName":"","lastName":"Zhu","suffix":""},{"id":282185436,"identity":"b3d49c61-92a9-40a2-9284-16a3500dc5e9","order_by":5,"name":"Bingfeng Zhou","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Bingfeng","middleName":"","lastName":"Zhou","suffix":""},{"id":282185437,"identity":"5d7e4f49-edbc-4959-ba5e-42e29d8ef3c8","order_by":6,"name":"Han Li","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Li","suffix":""},{"id":282185438,"identity":"2e74d6ee-ca5f-4aa9-91e3-be35d0ef9b37","order_by":7,"name":"Meihong Yao","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Meihong","middleName":"","lastName":"Yao","suffix":""},{"id":282185439,"identity":"70c528ba-e9c0-4b47-879d-236f4efc316c","order_by":8,"name":"Zhining Zhang","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Zhining","middleName":"","lastName":"Zhang","suffix":""},{"id":282185440,"identity":"be40b8d3-4cbc-4dbf-818c-6798231cd705","order_by":9,"name":"Shujing Zhou","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Shujing","middleName":"","lastName":"Zhou","suffix":""},{"id":282185441,"identity":"6cc408a7-79f1-4122-8d67-f26fa95b3f89","order_by":10,"name":"Xinjian Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIiWNgGAWjYJCCAww8EgwMzMwHH3yokJDjJ14LO1uy4YwzFsaSDUTbxc9jJs3bVpG4gZAWgxs5hocLZCzkzZl5jA1450kwbmBgfvjoBh4tkjPSEg7P4JEw3NnMVvhAcpsEszkDm7FxDj7nSCQfOMzDAzT8MPNmA8NtEmyWDTxs0vi0sEkkNoC02G84zGAmkThHgsfgAAEtMFsSNxxmMZM42CAhQVCLZM+zBJCW5A2HgYHccEzCQLKZgF8MjucYf+btqbPdcP7wwcd/aurq+9mbHz7GpwUMGHuQecyElIPBD6JUjYJRMApGwUgFAClDRydOmkrRAAAAAElFTkSuQmCC","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":true,"prefix":"","firstName":"Xinjian","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2024-03-20 14:42:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4137942/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4137942/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53419105,"identity":"5064d4fb-8c2e-4e79-bb21-45f620384897","added_by":"auto","created_at":"2024-03-25 18:11:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":914010,"visible":true,"origin":"","legend":"\u003cp\u003eMorphology observation of white-eyed pupae under different durations of cold stress. (A) Newly pupated, white-eyed pupae develop under 20℃ cold stress for 24 h and 48 h. (B) Newly pupated, white-eyed pupae develop under 35℃ optimal temperature for 24 h and 48 h.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/32f774ed21ae8201c36704f8.png"},{"id":53419104,"identity":"ca26f290-9170-4aa4-8d52-d5eadaacab18","added_by":"auto","created_at":"2024-03-25 18:11:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":125225,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Venn analysis showed overlapping differentially expressed genes between T5 vs CK4 and T6 vs CK4; (B) The result of trend analysis of DEGs, the number in the box denoting the P-value.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/f0b95c5d86055993394594c2.png"},{"id":53419108,"identity":"07ec3cd9-b20b-48e9-ba19-e5959caea051","added_by":"auto","created_at":"2024-03-25 18:11:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":128764,"visible":true,"origin":"","legend":"\u003cp\u003eLevel-2 GO classification of Profile 1, Profile 6 and Profile 7.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/6899d66ba1500cc3bcc36795.png"},{"id":53419110,"identity":"d2e97d7a-48c0-45bf-9b38-19343f40db49","added_by":"auto","created_at":"2024-03-25 18:11:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":963463,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG pathway enrichment analysis of Profile 1, Profile 6 and Profile 7, “*” is used to indicate a significant enrichment of the pathway (Q-value \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/5a074586c571edf568818d52.png"},{"id":53419109,"identity":"59629b05-58f1-47d3-8cbb-d5ac176eeb81","added_by":"auto","created_at":"2024-03-25 18:11:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":147032,"visible":true,"origin":"","legend":"\u003cp\u003eVerification of transcriptome data collected from the heads of white-eyed honeybee pupae with no temperature treatment and with 20℃ cold treatments for 24 h and 48 h by RT-qPCR. Display relative expression levels of \u003cem\u003eRNF5\u003c/em\u003e, \u003cem\u003ePET191\u003c/em\u003e, \u003cem\u003eSVIP\u003c/em\u003e, \u003cem\u003eUBL5\u003c/em\u003e, \u003cem\u003eMAP3K9\u003c/em\u003e, and \u003cem\u003eNUMR1\u003c/em\u003e. Data in the figure are mean ± SD, and the “*” and above bars represent significant differences between the cold treatment group and the control group of the same gene in the relative expression level (**, P \u0026lt; 0. 01, ***, P \u0026lt; 0. 001, unpaired T-test).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/d3cbe607f5e95e426bdd3397.png"},{"id":53420031,"identity":"9d9fd922-5f1c-454a-a2be-35def5cc78fb","added_by":"auto","created_at":"2024-03-25 18:19:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":227584,"visible":true,"origin":"","legend":"\u003cp\u003eA hypothetical working model of cold-stress induced ER-stress-associated cell apoptosis in honeybee pupae brain at new pupae stage.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/9eecd64bc4ea131060932ed5.png"},{"id":54385940,"identity":"7963ff5c-6a1e-4859-b202-57fd78b043c4","added_by":"auto","created_at":"2024-04-09 17:35:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2465371,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4137942/v1/c9320438-b671-4200-8ca2-d8f013072e93.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comparative transcriptomics uncovers apoptosis in brain impairment in newly pupated honeybee worker under cold stress","fulltext":[{"header":"Background","content":"\u003cp\u003e\u003cem\u003eApis mellifera\u003c/em\u003e have been widely used as pollinators since the application of pollination services began\u0026nbsp;[1], they are the primarily managed species worldwide for both honey production and crop pollination, demonstrating their important value in both crop diversity and sustainable agriculture\u0026nbsp;[2]. In recent years, there has been an increasing emphasis on the impact of global climate change on plant pollination\u0026nbsp;[3\u0026ndash;5], the alarming decline in honeybee populations\u0026nbsp;[6\u0026ndash;8]\u0026nbsp;and their brood-rearing behaviour\u0026nbsp;[9], raising concerns about their overall health.\u003c/p\u003e\n\u003cp\u003eThe central nervous system (CNS) of the honeybee is crucial in both forging and pollinating behaviours. Honeybees forage across wide expanses to collect nectar, pollen, and propolis to take back to the hive. This activity is essential for the sustainability of bee colonies, and pollination can be seen as a positive result of their efforts. By using sensory organs in the head, honeybees can detect the colour and odour of the flower\u0026nbsp;[10, 11]. These signals are processed by the mushroom body, which is the centre of sensory integration\u0026nbsp;[12]. The processed signals are then transmitted through the nervous system and serve as visual and olfactory cues for honeybee visitation\u0026nbsp;[13]. This pattern of stimuli and rewards involves learning and memory behaviour, as the colony must adapt to the frequent changes in floral resources throughout their foraging lifetime (review in ref.\u0026nbsp;[14]). As eusocial insects, honeybees communicate information to recruit additional foragers for food resources through dance behaviour (review in ref.\u0026nbsp;[15]). Some research indicates that the central complex of the honeybee brain could be involved in the neurobiological process underlying this behaviour\u0026nbsp;[16].\u003c/p\u003e\n\u003cp\u003eCentral nervous system dysfunction in honeybees, caused by cold stress during the developmental stage, can hinder their foraging ability and have detrimental effects on the health of bee colonies. In comparison to many insects, honeybees have a much narrower developmental temperature range (32\u0026deg;C-36\u0026deg;C, the optimum temperature is 35℃). Deviation from the optimal temperature during development can result in abnormal development of honeybee broods, including abnormal external morphology of adult honeybee (proboscis, forewing, and hind leg)\u0026nbsp;[17], and a shortened lifespan\u0026nbsp;[18, 19]. Due to the various evidence available, it is clear that cold stress can hinder the development of honeybee brains\u0026nbsp;[20]. This includes a decline in the number of mushroom body synaptic complexes\u0026nbsp;[21], leading to impaired learning, memory, and foraging abilities in adult honeybees after they emerge\u0026nbsp;[20].\u003c/p\u003e\n\u003cp\u003eBased on our team\u0026apos;s preliminary research, it has been found that cold stress can impede brain development in the new puape stage of \u003cem\u003eApis mellifera\u003c/em\u003e and lead to a significant reduction in the learning and memory abilities when they emerge [20], however, the mechanism by which brain development is impeded remains unclear. In this study, we conducted in-depth comparative exploitation of previously collected high-quality transcriptome data, using the trend analysis method, we were able to select the set of genes that conformed to a certain expression pattern (e.g., the expression continued to increase or decrease) in honeybee pupae head under prolongation of cold treatment, to reduce the complexity of the data and the difficulty of the analysis and facilitate the discovery of key genes that responded to the cold stress during this certain developmental stage.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eThe sample preparation\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe samples used in this study were collected from healthy colonies during the spring season, with no signs of known brood diseases. Using the sampling method previously developed by our research group to obtain consistent honeybee eggs\u0026nbsp;[19], each queen was confined in a mesh cage to lay eggs on a fresh comb for a period of 12 h. These eggs were then left in the colony until they were sealed by workers. The sections of comb containing broods that capped within 4 h were removed and placed in a chamber with consistent temperature and humidity (35\u0026deg;C \u0026plusmn; 0.2\u0026deg;C, RH 75%) [THB-250, Allison Instruments and Equipment (Shanghai) Co., Ltd., precision \u0026plusmn; 0.1\u0026deg;C] for 4 d, namely CK4, then transfer two groups of 4 d capped broods into another chamber and apply the cold treatment (20\u0026deg;C \u0026plusmn; 0.2\u0026deg;C, RH 75%) for 24 h and 48 h, namely T5 and T6. Each group contain 10 capped broods, and once the treatment is complete, cut the head from honeybee pupae and store it at -80 ℃ for further use.\u003c/p\u003e\n\u003cp\u003eDifferential gene expression and trends analysis\u003c/p\u003e\n\u003cp\u003eThe transcriptome data collected from the heads of white-eyed honeybee pupae with no temperature treatment (control group, CK4) and with 20℃ cold treatments for 24 h and 48 h (cold treatment group, T5 and T6) were acquired from previously published data by our research group (NCBI SRA login number: SRR15710549-SRR15710554). Expression levels of transcripts were determined using the FPKM method and differentially expressed genes (DEGs) between the two samples were analyzed using the DEGseq R package\u0026nbsp;[22]. DEGs were identified using a Poisson distribution with a false discovery rate (FDR)\u0026thinsp;\u0026le;\u0026thinsp;0.05 and fold change\u0026thinsp;\u0026ge;\u0026thinsp;2 (log2 ratio\u0026thinsp;\u0026ge;\u0026thinsp;1, fold change = FPKM of the treatment group/ FPKM of the control group) through multiple hypothesis testing. Significant differential expressions were determined based on this threshold. The three time-point DEGs were then clustered using STEM[23]\u0026nbsp;through the OmicShare online platform for data analysis (https://www.omicshare.com/tools/Home/Soft/getsoft).\u003c/p\u003e\n\u003cp\u003eFunctional classification of DEGs\u003c/p\u003e\n\u003cp\u003eUse both GO and KEGG databases to annotate the DEGs clusters with significant expression trends identified in 2.2 and perform hypothesis testing to obtain P-values. Then, adjust the P-values to Q-values to evaluate if the GO terms and KEGG signalling pathways in the DEGs clusters are significantly enriched, with a threshold of Q \u0026le; 0.05. This analysis will be carried out using OmicShare online platform tools (https://www.omicshare.com/tools/Home/Soft/getsoft).\u003c/p\u003e\n\u003cp\u003eRT-qPCR validation\u003c/p\u003e\n\u003cp\u003eThe primers for this study were designed using NCBI Primer Blast and are listed in Table 1. Each sample underwent three biological replicates and three technical replicates for the target gene. Total RNA was extracted from the samples gathered in the section \u0026ldquo;The sample preparation\u0026rdquo; using the \u003cem\u003eTranszol\u003c/em\u003e\u0026reg; Up Plus RNA Kit, and cDNA was synthesized through reverse transcription using \u003cem\u003eTransScript\u003c/em\u003e\u0026reg; Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR. The resulting cDNA was then used as a template for quantitative PCR (qPCR), with a reaction system of 10 \u0026mu;L following the \u003cem\u003ePerfectStart\u003c/em\u003e\u0026reg; Green qPCR SuperMix instructions. the 2\u003csup\u003e\u0026minus;\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e method has been used to calculate the relative expression level of studied genes, with Actin used as a reference. At last, the expression level will be logarithmically transformed using a base of 2, and the result will be determined by taking the average value. The difference in gene expression between the treatment group and the control group was analyzed using an unpaired t-test to determine statistical significance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003ePrimers for RT-qPCR of DEGs.\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"525\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eGene ID\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003ePrimer sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003eACTIN\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC413144\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF: TGCCAACACTGTCCTTTCTG R: AGAATTGACCCACCAATCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003eRNF5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC408751\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF:ACAAGGGAACAAGCTGGACC R: TTGCCTTGTTGGAGTGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003ePET191\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC725170\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF:TGTGCTCATTTACGTGCAAGC R: AGGTCCTCTAAATCTTCGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003eSVIP\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC102655388\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF:TGTTGCAAACAATCATCTTCATGTG R: TTCCTCGGTTTTGTTGTTCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003eUBL5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC724489\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF:TAACATGCAATGATCGTCTTGG R: ATGAGTTCCAGTTTGAGCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003eMAP3K9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC411566\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF:TTCATGGATTGCGCATGAAGG R: TGTCGTTGCTGAACTTGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.428571428571429%\"\u003e\n \u003cp\u003e\u003cem\u003eNUMR1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.904761904761905%\"\u003e\n \u003cp\u003eLOC726755\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.66666666666667%\"\u003e\n \u003cp\u003eF:AATCGATGCACACAGCAACC R: TTCGCCAAACACATACGGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eMorphology of pupae developing under cold stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHoneybee new pupae\u0026nbsp;were photographed every 24 hours under white light to observe their external morphological changes. In pupae developing at normal temperatures, the compound eyes undergo noticeable colour changes. After 4 days of being sealed, the honeybee larvae complete their moulting and pupation process, resulting in white compound eyes. By day 5, the eyes turn pink, and by day 6, they become dark red\u0026nbsp;(Figure 1A). In contrast, pupae subjected to cold treatment have no notable colour changes in their compound eyes during the same timeframe\u0026nbsp;(Figure 1B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of gene expression trends in different cold treatment duration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe differentially expressed genes (DEGs) between the cold treatment groups (T5, T6) and the control group (CK4) were determined using multiple hypotheses testing based on the Poisson distribution. The threshold for identification included a false discovery rate (FDR) of less than 0.05 and a fold change of \u0026ge;2 (log2 ratio \u0026ge;1). At three time points, a total of 1707 DEGs were identified when compared to the control group, with 1269 DEGs in T5 vs CK4 and 1174 DEGs in T6 vs CK4, the intersection of the two comparison groups results in a total of 736 shared DEGs (Figure 2A). These DEGs are likely associated with the regulation of honeybee pupae brain development under cold stress conditions. As the duration of cold stress increased, we noted that a decrease in the number of DEGs was observed in the pupae head, indicating possible gene expression inhibition.\u003c/p\u003e\n\u003cp\u003eTo further investigate the expression patterns and functions of DEGs contained in three time points, the DEGs were clustered by STEM. The total 736 DEGs shared between two comparison groups were divided into 8 profiles. Most of these DEGs were clustered into three profiles with significant trends (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Figure 1B), which included a downregulated trend for profile 1 (289) and two upregulated trends for profile 6 (329) and profile 7 (97) (Figure 2B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGO enrichment analysis of gene clusters\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe GO enrichment analysis findings revealed that post cold stress, the new pupae head DEGs exhibited the highest number of genes classified under biological processes. DEGs on Profile 1 showed enrichment in 27 level 2 GO terms, whereas DEGs on Profile 6 and Profile 7 displayed enrichment in 32 and 24 GO level 2 GO terms, respectively (Figure 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKEGG enrichment analysis of gene clusters\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DEGs were found to be enriched in 29 signalling pathways in Profile 1 according to the results of the KEGG pathway enrichment analysis. The KEGG pathway with the most enriched genes are Spliceosome(3), Ribosome(3), Insect hormone biosynthesis(2), Thermogenesis(2), Protein processing in endoplasmic reticulum(2), Amyotrophic lateral sclerosis(2), Metabolic pathways(2)。The DNAL4 gene is enriched in two pathways that are both associated with neurological disorders, including Pathways of neurodegeneration - multiple diseases and Huntington disease (Figure 4).\u003c/p\u003e\n\u003cp\u003eThe DEGs in Profile 6 were found to be enriched in 38 signalling pathways, as revealed by the KEGG pathway enrichment analysis. Among these pathways, the most enriched genes were found in Metabolic pathways (4), Apoptosis - fly (3), Axon regeneration (3), Signaling pathways regulating pluripotency of stem cells (3), mRNA surveillance pathway (3), Spliceosome (3), and Amyotrophic lateral sclerosis (3). Moreover, Apoptosis \u0026ndash; fly, Axon regeneration, and Signaling pathways regulating the pluripotency of stem cells showed significant enrichment with a Q-value of less than 0.05 (Figure 4).\u003c/p\u003e\n\u003cp\u003eIn Profile 7, the DEGs were enriched in 6 signalling pathways: MAPK signalling pathway \u0026ndash; fly (2), Axon regeneration (1), Synaptic vesicle cycle (1), Transcriptional misregulation in cancer (1), Aminoacyl-tRNA biosynthesis (1), and Spliceosome (1). DEGs show significant enrichment in the MAPK signalling pathway - fly (Q-value \u0026lt; 0.05) (Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVerification of expression patterns through qPCR analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo validate the transcriptome data, RT-qPCR analysis was performed on six genes (RNF5, PET191, SVIP, UBL5, MAP3K9 and NUMR1) in three gene clusters. The results showed that the expression patterns of most genes were consistent with the transcriptome data, indicating its reliability (Figure 5).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e35℃ is considered the optimal temperature for honeybee development, and our previous studies have shown through tissue sections that brain development of new pupae stagnates after exposure to cold stress, and learning and memory are impaired in adults\u0026nbsp;[20]. However, the physiological processes and molecular mechanisms behind this phenomenon of cold-stress effect have not been thoroughly investigated. With this aim in mind, we analyzed the trends of DEGs in the pupae heads of white-eyed pupae with or without cold treatment, suggesting that ER stress-associated cell apoptosis may be the key factor contributing to brain developmental defects during cold exposure. At the same time, we found that cold stress may inhibit the synthesis of ecdysteroids in the pupae head and interfere with epigenetic regulation associated with brain development, which are also possible factors for the inhibition of pupae brain development. We also found that DEGs associated with neuronal differentiation and neuronal damage repair showed an up-regulation trend during cold stress, suggesting a potential repair mechanism for pupae in response to cold stress. This study also lays the groundwork for the subsequent functional validation of genes related to brain development.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAccumulation of misfolded proteins exacerbates endoplasmic reticulum (ER) stress-induced cell apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRNF5\u003c/em\u003e and \u003cem\u003eSVIP\u003c/em\u003e, which were identified in Profile 1 and annotated in protein processing in endoplasmic reticulum pathways, are involved in endoplasmic reticulum-associated protein degradation (ERAD). The ubiquitin/protease system is responsible for clearing misfolded proteins during protein synthesis through various physiological steps catalyzed by E3 ubiquitin ligase[24]. \u003cem\u003eRNF5\u003c/em\u003e encodes E3 ubiquitin-protein ligase RNF5 and is involved in degrading misfolded proteins within the endoplasmic reticulum [25, 26]. \u003cem\u003eSVIP\u003c/em\u003e, on the other hand, encodes the Small VCP/p97 interacting protein (SVIP) in Drosophila, serving as an interaction cofactor that regulates protein quality control and responds to cellular stress [27]. The highly conserved VCP/p97 in eukaryotic cells binds to \u003cem\u003eSVIP\u003c/em\u003e, recognizing ubiquitinated proteins and transferring them from the endoplasmic reticulum to the cytosol for degradation [28\u0026ndash;30]. The expression levels of \u003cem\u003eRNF5\u003c/em\u003e and \u003cem\u003eSVIP\u003c/em\u003e downregulated in response to cold stress, indicating that the degradation of misfolded proteins in the endoplasmic reticulum of head tissue cells was inhibited, leading to the accumulation of misfolded proteins (Figure 6).\u003c/p\u003e\n\u003cp\u003eThe downregulation of \u003cem\u003eFBXO32\u003c/em\u003e in Profile 1 could play a crucial role in regulating cell apoptosis induced by endoplasmic reticulum stress (ER stress). The build-up of misfolded proteins in the endoplasmic reticulum results in endoplasmic reticulum stress, which triggers unfolded protein responses (UPR) [31, 32]. Adverse environmental stress can induce endoplasmic reticulum stress, which triggers unfolded protein responses (UPR) [33]. This activation of the IRE1 pathway in \u003cem\u003eApis mellifera\u003c/em\u003e worker cells leads to the splicing of XBP1u mRNA, turning it into XBP1s mRNA. As a result, XBP1s are produced and enter the cell nucleus to facilitate the generation of chaperones and other folding-promoting factors [34]. If the stress intensity exceeds a certain threshold or persists for an extended period, ER stress will ultimately result in cell apoptosis [35]. Additionally, XBP1s has been shown to enhance the synthesis of the CHOP transcription factor [36\u0026ndash;38], thereby exacerbating honeybee cell apoptosis [39]. \u003cem\u003eFBXO32\u003c/em\u003e encodes a ubiquitin-E3 ligase that plays a role in regulating cellular autophagy and maintaining endoplasmic reticulum homeostasis [40]. Mutations in \u003cem\u003eFBXO32\u003c/em\u003e result in increased CHOP expression and worsen cell apoptosis induced by ER stress [41]. In this study, \u003cem\u003eFBXO32\u003c/em\u003e were downregulated in Profile 1, annotated in the \u003cem\u003eFoxO\u003c/em\u003e signalling pathway. It is hypothesized that cold exposure will induce ER stress in the brain cells of new pupae, resulting in elevated apoptosis and hindrance to normal pupal brain development (Figure 6).\u003c/p\u003e\n\u003cp\u003eThe downregulation of the \u003cem\u003eUBL5,\u0026nbsp;\u003c/em\u003eannotated in the thermogenesis pathway, could be another factor that intensifies ER-stress-associated brain cell apoptosis. \u003cem\u003eUBL5\u003c/em\u003e is known to play a crucial role in the organisms\u0026rsquo; stress response [42]. \u003cem\u003eUBL5\u003c/em\u003e encode\u003cem\u003e\u0026nbsp;\u003c/em\u003eUbiquitin-like protein 5 (UBL5) is not only involved in the response to unfolded protein reactions in cell mitochondria [43] but it has also been implicated in ER stress-induced cell apoptosis. The PERK pathway plays a role in the cellular response to unfolded protein responses, as demonstrated in a series of studies [44\u0026ndash;46]. Additionally, this pathway is a crucial UPR regulatory pathway present in insects [47, 48]. When unfolded protein reactions take place in the endoplasmic reticulum, the cellular PERK pathway plays a crucial role in degrading the UBL5 protein, ultimately resulting in heightened cell apoptosis [49]. The study indicated a downward trend in the expression of \u003cem\u003eUBL5\u003c/em\u003e, indicating that, alongside the IRE1 pathway, cold stress can also trigger the activation of the PERK pathway, leading to increased apoptosis in brain cells of honeybee pupae, and may potentially inhibit brain development (Figure 6).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePET191\u0026nbsp;\u003c/em\u003eencodes a protein that plays a role in the assembly of cytochrome oxidase [50, 51], an enzyme involved in the mitochondrial electron transport chain. Cytochrome oxidase is important for neuronal metabolic activity and is considered a marker of neuronal function and size [52]. Inhibition of cytochrome oxidase activity in neuronal mitochondria can exacerbate endoplasmic reticulum stress-induced neuronal apoptosis [53]. \u003cem\u003ePET191\u003c/em\u003e were downregulated in Profile 1, annotated in the thermogenesis pathway, suggesting that it could be a crucial factor in the regulation of apoptosis in honeybee pupae brain cells (Figure 6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of ecdysteroids synthesis in pupae head\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMultiple members of the cytochrome P450 gene family play a role in regulating ecdysteroid production, and their presence in Profile 1 implies that cold stress could potentially impede the synthesis of ecdysteroids. Ecdysone and 20-hydroxyecdysone are important hormones in insect moulting, collectively known as ecdysteroids. The brain is the main site for ecdysone synthesis in honeybee workers, with the conversion to 20-hydroxyecdysone occurring mainly in the brain and fat body tissue [54]. The CYP306A1 enzyme is crucial for ecdysone biosynthesis, as it catalyzes the conversion of ketodiol to ketotriol [55]. Insects\u0026apos; development process is hindered by the reduction in \u003cem\u003eCYP306A1\u003c/em\u003e expression level. Silencing the \u003cem\u003eCYP306A1\u003c/em\u003e gene expression in third instar larvae of \u003cem\u003eChilo suppressalis\u003c/em\u003e resulted in a significant decrease in pupation rate and pupal weight [56]. The CYP307B1 enzyme is also important for ecdysone biosynthesis [57, 58], catalyzing the conversion of 2-deoxydecanone to 3-deoxydecanone [59]. In this study, the downregulated genes \u003cem\u003eCYP306A1\u003c/em\u003e (\u003cem\u003ephm)\u003c/em\u003e and \u003cem\u003eCYP307B1\u003c/em\u003e (\u003cem\u003espookiest\u003c/em\u003e) were enriched in the KEGG signalling pathway of insect hormone biosynthesis (P = 0.027，\u0026nbsp;Q = 0.484). It is suggested that cold stress reduces the activity of CYP306A1 and CYP307B1 enzymes, leading to inhibition of ecdysteroid synthesis in the honeybee pupal head.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEpigenetic regulation in brain development\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe gene \u003cem\u003eLSD1\u003c/em\u003e, which is downregulated in Profile 1, is believed to play a crucial role in regulating the development of the worker pupal brain. \u003cem\u003eLSD1\u003c/em\u003e is involved in epigenetic regulation and acts as a lysine-specific demethylase targeting histones H3K4 and H3K9, as well as non-histone substrates, to either inhibit or activate transcription and regulate gene expression [60]. Studies have shown that \u003cem\u003eLSD1\u003c/em\u003e is important for various aspects of brain development [61] and that mutations in \u003cem\u003eLSD1\u003c/em\u003e can lead to paralysis in adult mice, extensive neuronal death in the hippocampus and cortex, and learning and memory disorders [62]. In this study, the expression of \u003cem\u003eLSD1\u003c/em\u003e decreased with prolonged exposure to cold stress. Our team plans to further investigate the role of \u003cem\u003eLSD1\u003c/em\u003e in honeybee pupal brain development by using RNAi methods to confirm the relationship between \u003cem\u003eLSD1\u003c/em\u003e downregulation and inhibition of brain development.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNeurodevelopment \u0026amp; neuronal repair\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DEGs identified in Profile 6 were found to be significantly enriched in three KEGG signalling pathways: apoptosis, axon regeneration, and signalling pathways regulating pluripotency of stem cells (Q \u0026lt; 0.05). The upregulated gene \u003cem\u003eEIP93F\u003c/em\u003e, involved in cell apoptosis, has been shown to regulate the development of the Drosophila nervous system, promote autophagy of mushroom body neurocytes, and facilitate the remodelling process of the mushroom body during abnormal development [63]. Additionally, the upregulated gene \u003cem\u003eEPHB1\u003c/em\u003e, present in the axon regeneration pathway, enhances the expression of damaged motor neurons to initiate neuronal repair [64]. Previous research by our team revealed that 70% of bee individuals subjected to 48 h of cold treatment died before completing eclosion [20]. It is speculated that the head tissue development of honeybee worker bees continues to progress even under cold stress. There seems to be a mechanism in place for repairing neural tissue damage, which helps counteract the abnormal apoptosis of head tissue cells caused by the stress. Profile 6 cluster shows an upregulate trend initially, then followed by a plateau phase suggesting a limited ability for damage repair. This aligns with the observation that only 70% of pupae successfully emerge after undergoing 48 hours of cold treatment during the pupal stage.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, cold exposure during the new pupae stage of \u003cem\u003eApis mellifera\u003c/em\u003e worker will lead to the inhibition of ecdysteroids synthesis in the pupae head, interferes with epigenetic regulation related to brain development, and leads to the accumulation of misfolded proteins on the endoplasmic reticulum, which exacerbates apoptosis caused by endoplasmic reticulum stress that may be an important reason for the inhibition of brain development under cold stress.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA database (accession number: SRR15710549\u0026ndash;SRR15710554).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that this study was conducted without any business or financial relationships that could be perceived as a potential conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the China Agriculture Research System of MOF and MARA (CARS-44-KXJ11), the Fujian Natural Science Foundation Project (2021j01079), and the innovation initiative for undergraduates of Fujian Agriculture and Forestry University (X202310389225, X202310389117).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, M.C., X.Z.; methodology, M.C., X.Z. and X.X.; software, M.C., C.Z.; validation, M.C., Y.T. and H.X.; formal analysis, M.C.; investigation, M.C., X.X., Y.T., M.Y. and Z.Z.; resources, X.Z., B.Z. and S.Z.; data curation, M.C., H.L.; original draft preparation, M.C.; review and editing, X.Z., X.X.; visualization, M.C.; supervision, X.X., S.Z. and B.Z.; project administration, M.C., X.Z.; funding acquisition, X.Z., X.X., S.Z., and B.Z.. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Xianbing Su and Mingqi Wang for their laboratory assistance. We also thank the editor and anonymous referees for their helpful comments on this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eValido A, Rodr\u0026iacute;guez-Rodr\u0026iacute;guez MC, Jordano P. Honeybees disrupt the structure and functionality of plant-pollinator networks. Sci Rep. 2019;9:4711.\u003c/li\u003e\n\u003cli\u003eShrestha JB. Honeybees: The Pollinator Sustaining Crop Diversity. J Agric \u0026amp; Environ. 2009;9:90\u0026ndash;2.\u003c/li\u003e\n\u003cli\u003eSchweiger O, Biesmeijer JC, Bommarco R, Hickler T, Hulme PE, Klotz S, et al. Multiple stressors on biotic interactions: how climate change and alien species interact to affect pollination. Biological Reviews. 2010;85:777\u0026ndash;95.\u003c/li\u003e\n\u003cli\u003eSettele J, Bishop J, Potts SG. Climate change impacts on pollination. Nature Plants. 2016;2:1\u0026ndash;3.\u003c/li\u003e\n\u003cli\u003eGiannini TC, Costa WF, Cordeiro GD, Imperatriz-Fonseca VL, Saraiva AM, Biesmeijer J, et al. Projected climate change threatens pollinators and crop production in Brazil. PLOS ONE. 2017;12:e0182274.\u003c/li\u003e\n\u003cli\u003eHristov P, Shumkova R, Palova N, Neov B. Honey bee colony losses: Why are honey bees disappearing? Sociobiology. 2021;68:e5851\u0026ndash;e5851.\u003c/li\u003e\n\u003cli\u003eHristov P, Shumkova R, Palova N, Neov B. Factors Associated with Honey Bee Colony Losses: A Mini-Review. Veterinary Sciences. 2020;7:166.\u003c/li\u003e\n\u003cli\u003evanEngelsdorp D, Meixner MD. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. Journal of Invertebrate Pathology. 2010;103:S80\u0026ndash;95.\u003c/li\u003e\n\u003cli\u003eVillagomez GN, N\u0026uuml;rnberger F, Requier F, Schiele S, Steffan-Dewenter I. Effects of temperature and photoperiod on the seasonal timing of Western honey bee colonies and an early spring flowering plant. Ecology and Evolution. 2021;11:7834\u0026ndash;49.\u003c/li\u003e\n\u003cli\u003eHempel de Ibarra N, Vorobyev M, Menzel R. Mechanisms, functions and ecology of colour vision in the honeybee. J Comp Physiol A. 2014;200:411\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eMartin JP, Beyerlein A, Dacks AM, Reisenman CE, Riffell JA, Lei H, et al. The neurobiology of insect olfaction: Sensory processing in a comparative context. Progress in Neurobiology. 2011;95:427\u0026ndash;47.\u003c/li\u003e\n\u003cli\u003eGroh C, R\u0026ouml;ssler W. Analysis of Synaptic Microcircuits in the Mushroom Bodies of the Honeybee. Insects. 2020;11:43.\u003c/li\u003e\n\u003cli\u003eRachersberger M, Cordeiro GD, Sch\u0026auml;ffler I, D\u0026ouml;tterl S. Honeybee Pollinators Use Visual and Floral Scent Cues to Find Apple (Malus domestica) Flowers. J Agric Food Chem. 2019;67:13221\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eLemanski NJ, Cook CN, Smith BH, Pinter-Wollman N. A Multiscale Review of Behavioral Variation in Collective Foraging Behavior in Honey Bees. Insects. 2019;10:370.\u003c/li\u003e\n\u003cli\u003eVon Frisch K, Lindauer M. The \u0026ldquo;Language\u0026rdquo; and Orientation of the Honey Bee. Annu Rev Entomol. 1956;1:45\u0026ndash;58.\u003c/li\u003e\n\u003cli\u003eBarron AB, Plath JA. The evolution of honey bee dance communication: a mechanistic perspective. Journal of Experimental Biology. 2017;220:4339\u0026ndash;46.\u003c/li\u003e\n\u003cli\u003eXu X, Du X, Zhou S, Zhou B, Lai K, Wang Q, et al. Impacts of high temperature during early capped brood on pupal development and the size of appendages in adult workers \u003cem\u003eApis cerana\u003c/em\u003e. Front Ecol Evol. 2023;11:1144216.\u003c/li\u003e\n\u003cli\u003eMedrzycki P, Sgolastra F, Bortolotti L, Bogo G, Tosi S, Padovani E, et al. Influence of brood rearing temperature on honey bee development and susceptibility to poisoning by pesticides. Journal of Apicultural Research. 2010;49:52\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eWang Q, Xu X, Zhu X, Chen L, Zhou S, Huang ZY, et al. Low-Temperature Stress during Capped Brood Stage Increases Pupal Mortality, Misorientation and Adult Mortality in Honey Bees. PLoS ONE. 2016;11:e0154547.\u003c/li\u003e\n\u003cli\u003eZhu C, Li H, Xu X, Zhou S, Zhou B, Li X, et al. The mushroom body development and learning ability of adult honeybees are influenced by cold exposure during their early pupal stage. Front Physiol. 2023;14:1173808.\u003c/li\u003e\n\u003cli\u003eGroh C, Tautz J, R\u0026ouml;ssler W. Synaptic organization in the adult honey bee brain is influenced by brood-temperature control during pupal development. Proc Natl Acad Sci USA. 2004;101:4268\u0026ndash;73.\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15:550.\u003c/li\u003e\n\u003cli\u003eErnst J, Bar-Joseph Z. STEM: a tool for the analysis of short time series gene expression data. BMC Bioinformatics. 2006;7:191.\u003c/li\u003e\n\u003cli\u003eWillis MS, Townley-Tilson WHD, Kang EY, Homeister JW, Patterson C. Sent to Destroy: The Ubiquitin Proteasome System Regulates Cell Signaling and Protein Quality Control in Cardiovascular Development and Disease. Circulation Research. 2010;106:463\u0026ndash;78.\u003c/li\u003e\n\u003cli\u003eTcherpakov M, Delaunay A, Toth J, Kadoya T, Petroski MD, Ronai ZA. Regulation of Endoplasmic Reticulum-associated Degradation by RNF5-dependent Ubiquitination of JNK-associated Membrane Protein (JAMP) *. Journal of Biological Chemistry. 2009;284:12099\u0026ndash;109.\u003c/li\u003e\n\u003cli\u003eDelaunay A, Bromberg KD, Hayashi Y, Mirabella M, Burch D, Kirkwood B, et al. The ER-Bound RING Finger Protein 5 (RNF5/RMA1) Causes Degenerative Myopathy in Transgenic Mice and Is Deregulated in Inclusion Body Myositis. PLOS ONE. 2008;3:e1609.\u003c/li\u003e\n\u003cli\u003eW\u0026oacute;jcik C, Yano M, DeMartino GN. RNA interference of valosin-containing protein (VCP/p97) reveals multiple cellular roles linked to ubiquitin/proteasome-dependent proteolysis. Journal of Cell Science. 2004;117:281\u0026ndash;92.\u003c/li\u003e\n\u003cli\u003eBeskow A, Grimberg KB, Bott LC, Salomons FA, Dantuma NP, Young P. A Conserved Unfoldase Activity for the p97 AAA-ATPase in Proteasomal Degradation. Journal of Molecular Biology. 2009;394:732\u0026ndash;46.\u003c/li\u003e\n\u003cli\u003eHuryn DM, Kornfilt DJP, Wipf P. p97: An Emerging Target for Cancer, Neurodegenerative Diseases, and Viral Infections. J Med Chem. 2020;63:1892\u0026ndash;907.\u003c/li\u003e\n\u003cli\u003eAhlstedt BA, Ganji R, Raman M. The functional importance of VCP to maintaining cellular protein homeostasis. Biochem Soc Trans. 2022;50:1457\u0026ndash;69.\u003c/li\u003e\n\u003cli\u003eBergmann TJ, Molinari M. Three branches to rule them all? UPR signalling in response to chemically versus misfolded proteins-induced ER stress. Biology of the Cell. 2018;110:197\u0026ndash;204.\u003c/li\u003e\n\u003cli\u003eHetz C, Zhang K, Kaufman RJ. Mechanisms, regulation and functions of the unfolded protein response. Nat Rev Mol Cell Biol. 2020;21:421\u0026ndash;38.\u003c/li\u003e\n\u003cli\u003eKitamura M. The unfolded protein response triggered by environmental factors. Semin Immunopathol. 2013;35:259\u0026ndash;75.\u003c/li\u003e\n\u003cli\u003eJohnston BA, Hooks KB, McKinstry M, Snow JW. Divergent forms of endoplasmic reticulum stress trigger a robust unfolded protein response in honey bees. Journal of Insect Physiology. 2016;86:1\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eSano R, Reed JC. ER stress-induced cell death mechanisms. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 2013;1833:3460\u0026ndash;70.\u003c/li\u003e\n\u003cli\u003eLee A-H, Iwakoshi NN, Glimcher LH. XBP-1 Regulates a Subset of Endoplasmic Reticulum Resident Chaperone Genes in the Unfolded Protein Response. Molecular and Cellular Biology. 2003;23:7448\u0026ndash;59.\u003c/li\u003e\n\u003cli\u003eChan JY, Luzuriaga J, Maxwell EL, West PK, Bensellam M, Laybutt DR. The balance between adaptive and apoptotic unfolded protein responses regulates \u0026beta;-cell death under ER stress conditions through XBP1, CHOP and JNK. Molecular and Cellular Endocrinology. 2015;413:189\u0026ndash;201.\u003c/li\u003e\n\u003cli\u003eHu H, Tian M, Ding C, Yu S. The C/EBP Homologous Protein (CHOP) Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced Apoptosis and Microbial Infection. Frontiers in Immunology. 2019;9.\u003c/li\u003e\n\u003cli\u003eKumar D, Banerjee D, Chakrabarti P, Sarkar S, Basu P. Oxidative stress and apoptosis in Asian honey bees (\u003cem\u003eA. cerana\u003c/em\u003e) exposed to multiple pesticides in intensive agricultural landscape. Apidologie. 2022;53:25.\u003c/li\u003e\n\u003cli\u003eAl-Yacoub N, Shaheen R, Awad SM, Kunhi M, Dzimiri N, Nguyen HC, et al. \u003cem\u003eFBXO32\u003c/em\u003e, encoding a member of the SCF complex, is mutated in dilated cardiomyopathy. Genome Biology. 2016;17:2.\u003c/li\u003e\n\u003cli\u003eAl-Yacoub N, Colak D, Mahmoud SA, Hammonds M, Muhammed K, Al-Harazi O, et al. Mutation in \u003cem\u003eFBXO32\u003c/em\u003e causes dilated cardiomyopathy through up-regulation of ER-stress mediated apoptosis. Commun Biol. 2021;4:1\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eChanarat S. UBL5/Hub1: An Atypical Ubiquitin-Like Protein with a Typical Role as a Stress-Responsive Regulator. International Journal of Molecular Sciences. 2021;22:9384.\u003c/li\u003e\n\u003cli\u003eHaralambous C, Ntouma V. Islet Beta-Cell Specific Deletion of UBL5 Gene Associated with Mitochondrial Stress Leads to Diabetes in Mice and Beta-Cell Impairment/Death. Diabetes. 2018;67 Supplement_1:311-LB.\u003c/li\u003e\n\u003cli\u003eHughes D, Mallucci GR. The unfolded protein response in neurodegenerative disorders \u0026ndash; therapeutic modulation of the PERK pathway. The FEBS Journal. 2019;286:342\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003eWang Y, Alam GN, Ning Y, Visioli F, Dong Z, N\u0026ouml;r JE, et al. The Unfolded Protein Response Induces the Angiogenic Switch in Human Tumor Cells through the PERK/ATF4 Pathway. Cancer Research. 2012;72:5396\u0026ndash;406.\u003c/li\u003e\n\u003cli\u003eSchroder M, Kaufman RJ. Divergent Roles of IRE1\u0026alpha; and PERK in the Unfolded Protein Response. Current Molecular Medicine. 2006;6:5\u0026ndash;36.\u003c/li\u003e\n\u003cli\u003eRyoo HD. \u003cem\u003eDrosophila\u003c/em\u003e as a model for unfolded protein response research. BMB Reports. 2015;48:445\u0026ndash;53.\u003c/li\u003e\n\u003cli\u003eAdames TR, Rondeau NC, Kabir MT, Johnston BA, Truong H, Snow JW. The IRE1 pathway regulates honey bee Unfolded Protein Response gene expression. Insect Biochemistry and Molecular Biology. 2020;121:103368.\u003c/li\u003e\n\u003cli\u003eWang W, Hawkridge AM, Ma Y, Zhang B, Mangrum JB, Hassan ZH, et al. Ubiquitin-like protein 5 is a novel player in the UPR\u0026ndash;PERK arm and ER stress\u0026ndash;induced cell death. Journal of Biological Chemistry. 2023;299:104915.\u003c/li\u003e\n\u003cli\u003eMcEwen JE, Hong KH, Park S, Preciado GT. Sequence and chromosomal localization of two PET genes required for cytochrome c oxidase assembly in Saccharomyces cerevisiae. Curr Genet. 1993;23:9\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eKhalimonchuk O, Rigby K, Bestwick M, Pierrel F, Cobine PA, Winge DR. \u003cem\u003ePet191\u003c/em\u003e Is a Cytochrome c Oxidase Assembly Factor in Saccharomyces cerevisiae. Eukaryotic Cell. 2008;7:1427\u0026ndash;31.\u003c/li\u003e\n\u003cli\u003eWong-Riley MTT. Cytochrome oxidase: an endogenous metabolic marker for neuronal activity. Trends in Neurosciences. 1989;12:94\u0026ndash;101.\u003c/li\u003e\n\u003cli\u003eCosta RO, Ferreiro E, Oliveira CR, Pereira CMF. Inhibition of mitochondrial cytochrome c oxidase potentiates A\u0026beta;-induced ER stress and cell death in cortical neurons. Molecular and Cellular Neuroscience. 2013;52:1\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eYamanaka N, Rewitz KF, O\u0026rsquo;Connor MB. Ecdysone Control of Developmental Transitions: Lessons from \u003cem\u003eDrosophila\u003c/em\u003e Research. Annu Rev Entomol. 2013;58:497\u0026ndash;516.\u003c/li\u003e\n\u003cli\u003eNiwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, et al. CYP306A1, a Cytochrome P450 Enzyme, Is Essential for Ecdysteroid Biosynthesis in the Prothoracic Glands of \u003cem\u003eBombyx\u003c/em\u003e and \u003cem\u003eDrosophila\u003c/em\u003e*. Journal of Biological Chemistry. 2004;279:35942\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eLu Y, Bai Q, Li Q, Zheng X, Tian J, Guo J, et al. Two P450 genes, CYP6SN3 and CYP306A1, involved in the growth and development of \u003cem\u003eChilo suppressalis\u003c/em\u003e and the lethal effect caused by vetiver grass. International Journal of Biological Macromolecules. 2022;223:860\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eRewitz KF, Gilbert LI.\u003cem\u003e Daphnia\u003c/em\u003e Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: Evolutionary implications. BMC Evolutionary Biology. 2008;8:60.\u003c/li\u003e\n\u003cli\u003eVan Ekert E, Wang M, Miao Y-G, Brent CS, Hull JJ. RNA interference-mediated knockdown of the Halloween gene \u003cem\u003eSpookiest\u003c/em\u003e (CYP307B1) impedes adult eclosion in the western tarnished plant bug, Lygus hesperus. Insect Molecular Biology. 2016;25:550\u0026ndash;65.\u003c/li\u003e\n\u003cli\u003eShahzad MF, Idrees A, Afzal A, Iqbal J, Qadir ZA, Khan AA, et al. RNAi-Mediated Silencing of Putative Halloween Gene Phantom Affects the Performance of Rice Striped Stem Borer, \u003cem\u003eChilo suppressalis\u003c/em\u003e. Insects. 2022;13:731.\u003c/li\u003e\n\u003cli\u003eKim D, Kim KI, Baek SH. Roles of lysine-specific demethylase 1 (\u003cem\u003eLSD1\u003c/em\u003e) in homeostasis and diseases. J Biomed Sci. 2021;28:41.\u003c/li\u003e\n\u003cli\u003eZhang F, Xu D, Yuan L, Sun Y, Xu Z. Epigenetic regulation of Atrophin1 by lysine-specific demethylase 1 is required for cortical progenitor maintenance. Nat Commun. 2014;5:5815.\u003c/li\u003e\n\u003cli\u003eChristopher MA, Myrick DA, Barwick BG, Engstrom AK, Porter-Stransky KA, Boss JM, et al. \u003cem\u003eLSD1\u003c/em\u003e protects against hippocampal and cortical neurodegeneration. Nat Commun. 2017;8:805.\u003c/li\u003e\n\u003cli\u003eSiegrist SE. Termination of \u003cem\u003eDrosophila\u003c/em\u003e mushroom body neurogenesis via autophagy and apoptosis. Autophagy. 2019;15:1481\u0026ndash;2.\u003c/li\u003e\n\u003cli\u003eTyzack GE, Hall CE, Sibley CR, Cymes T, Forostyak S, Carlino G, et al. A neuroprotective astrocyte state is induced by neuronal signal \u003cem\u003eEphB1\u003c/em\u003e but fails in ALS models. Nat Commun. 2017;8:1164.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Apis mellifera, new pupae, apoptosis, trend analysis, low temperature, brain impairment ","lastPublishedDoi":"10.21203/rs.3.rs-4137942/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4137942/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHoneybees have a much narrower developmental temperature range compared to other insects, making it an ideal model species for studying temperature effect on insect metamorphosis. Cold exposure during pupal stage resulted in impaired learning, memory, and foraging ability in adults. So far, the understanding of molecular mechanisms and physiological processes underlying the impaired brain development of honeybee pupae under cold exposure is unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResult\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe transcriptome data used in this study were collected from the heads of white-eyed honeybee pupae between control group and cold-treated groups. A total of 736 significantly differentially expressed genes (DEGs) were found to be shared by the different durations of cold treatment, and three gene clusters with significant expression patterns were identified using gene expression trend analysis, and RT-qPCR verification was performed on six genes. Enrichment analyses of each cluster using GO and KEGG database showed that upregulated DEGs followed by a plateau were significantly enriched in apoptosis, axon regeneration and signalling pathways regulating pluripotency of stem cells genes, consistently upregulated DEGs were significantly enriched in MAPK signalling pathway, and the downregulated DEGs followed by a plateau were related to insect ecdysteroids synthesis (\u003cem\u003ephm\u003c/em\u003e and \u003cem\u003espookiest\u003c/em\u003e), epigenetic regulation of genes associated with brain development (\u003cem\u003eLSD1\u003c/em\u003e), endoplasmic reticulum-associated protein degradation (\u003cem\u003eRNF5\u003c/em\u003e and \u003cem\u003eSVIP\u003c/em\u003e) and regulation of endoplasmic reticulum stress-associated cell apoptosis (\u003cem\u003eFBXO32\u003c/em\u003e, \u003cem\u003ePET191\u003c/em\u003e and \u003cem\u003eUBL5\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur study suggests that cold stress will inhibit the synthesis of ecdysteroids, disrupt gene epigenetic regulation, and intensify endoplasmic reticulum stress-associated brain cell apoptosis, thus hinder brain development in new pupal heads.\u003c/p\u003e","manuscriptTitle":"Comparative transcriptomics uncovers apoptosis in brain impairment in newly pupated honeybee worker under cold stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-25 18:11:05","doi":"10.21203/rs.3.rs-4137942/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cb250a43-0056-488b-a42c-c64a9cbd5c15","owner":[],"postedDate":"March 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-09T17:27:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-25 18:11:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4137942","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4137942","identity":"rs-4137942","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}