Mechanisms of Cell Senescence and Apoptosis in Cyclophosphamide-Induced Premature Ovarian Failure in Rats

Mechanisms of Cell Senescence and Apoptosis in Cyclophosphamide-Induced Premature Ovarian Failure in Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanisms of Cell Senescence and Apoptosis in Cyclophosphamide-Induced Premature Ovarian Failure in Rats Jiaqi Wu, Yanmeng Wei, Qiangli Peng, Jing Zhu, Huacong Shi, Ting Zhao, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6277449/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jul, 2025 Read the published version in Journal of Ovarian Research → Version 1 posted 11 You are reading this latest preprint version Abstract Background Premature ovarian failure (POF) is a clinical condition characterized by a diminished ovarian reserve occurring before the age of 40, significantly affecting female reproductive health. However, its exact pathogenesis remains unclear. This research aimed to examine the mechanisms of cyclophosphamide (CTX)-induced senescence and apoptosis in the ovarian and cerebral cortex tissues of rats to provide insights into delaying aging and protecting female reproductive health. Methods A POF rat model was established via intraperitoneal injection of CTX, with the modeling effect confirmed by measuring ovarian volume and weight. Serum changes were detected using enzyme-linked immunosorbent assay (ELISA). Senescence-associated β-galactosidase (SA-β-gal) and terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining were performed to assess brain cortex and ovarian tissues. Western blotting and quantitative polymerase chain reaction (RT-qPCR) were used to detect the expression levels of proteins and genes related to cellular senescence and apoptosis, validating the correlation between POF, cellular senescence, and apoptosis. Results High-dose CTX induced POF. In rats with POF, the levels of anti-Müllerian hormone (AMH), estradiol (E2), and vitamin D (VD) significantly decreased ( P < 0.0001 ), whereas the levels of testosterone (T) and insulin (INS) significantly increased ( P < 0.0001 ). The number of senescent and apoptotic-positive cells in the ovarian and cerebral cortex tissues of rats with POF was substantially augmented ( P < 0.05; P < 0.01 ). Additionally, the expression of senescence-related proteins cyclin-dependent kinase inhibitor 1A (CDKN1A), cyclin-dependent kinase inhibitor 2A (CDKN2A), tumor protein p53 (P53), apoptosis-related protein BCL2-Associated X Protein (Bax), and cysteine-aspartic acid protease 3 (caspase 3) was upregulated. In contrast, the expression of the anti-apoptotic protein BCL-2 was downregulated. These findings demonstrated that high-dose CTX injection leads to cellular senescence and apoptosis, resulting in ovarian pathology. Conclusion High-dose CTX induced POF in rats, resulting in aging and apoptosis in the cerebral cortex and ovarian tissues. Therefore, inhibiting cellular senescence and apoptosis may be a potential approach for restoring ovarian reserve function in POF. Premature Ovarian Failure Cyclophosphamide Apoptosis Cellular Senescence Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Premature ovarian failure (POF) refers to a decline in ovarian reserve occurring before the age of 40, significantly affecting female reproductive health. The global incidence rate of POF is 1%. Clinically, POF manifests as amenorrhea, decreased estrogen levels, and elevated gonadotropin and follicle-stimulating hormone [ 1 ] . POF has multifactorial and poorly understood causes, and its pathogenesis remains unclear. Common causes of POF include autoimmune disorders, genetic factors, environmental factors, and medical interventions (surgery, radiotherapy, and chemotherapy) [ 2 ] . Therefore, investigating the pathogenesis of POF is crucial for developing strategies to delay aging and protect female reproductive health. The incidence of chemotherapy-induced POF ranges from 70 to 100% [ 3 ] . Cyclophosphamide (CTX), a chemotherapeutic agent, remains one of the most successful and widely used antitumor agents [ 4 ] . As an alkylating agent, CTX induces non-cyclical toxic effects on cells. Its anticancer efficacy stems from the binding of its active metabolite to DNA, causing double-strand breaks, inhibiting DNA replication and protein synthesis, disrupting the balance between pro-apoptotic and anti-apoptotic genes. This leads to impaired ovarian function and severe reproductive toxicity [ 5 ] . Even after the effective control of tumor tissues, this damage persists. CTX exhibits gonadotoxic effects, causing direct ovarian injury and indirectly promoting the depletion of reserve follicles by stimulating the excessive activation of primordial follicles [ 6 ] . This destruction leads to germ cell death and follicular atresia [ 5 ] , ultimately resulting in ovarian dysfunction and POF [ 7 ] . Therefore, CTX is widely used to induce POF in animal models [ 8 ] . Senescence is characterized by degenerative alterations in the structure and function of human cells and tissues. It represents an inevitable biological process [ 9 ] that has become a focal point for research [ 10 ] . The pathogenesis of POF is attributed to accelerated primordial follicle atresia or altered maturation/recruitment, leading to premature follicle depletion and insufficient folliculogenesis [ 11 ] . P53, a crucial tumor suppressor gene, acts as a major determinant in cell cycle regulation, DNA repair, and apoptosis. Cyclin-dependent kinase inhibitor 1A (CDKN1A) and cyclin-dependent kinase inhibitor 2A (CDKN2A) are important cell cycle regulatory genes. Therefore, we aim to investigate the mechanisms of senescence and apoptosis involving P53, CDKN1A, and CDKN2A in the ovarian and brain tissues of POF rats. We also measured the relevant hormone levels in these rats. This study established a rat senescence model using CTX to investigate its pathological effects on ovarian and brain tissues. We measured and analyzed ovarian weight, senescence-related hormone levels, and the expression of senescence pathways and apoptosis markers in ovarian and brain tissues. This study systematically explores the mechanisms underlying CTX-induced ovarian damage and offers fresh insights into the protection of ovarian function in patients undergoing chemotherapy. Materials and methods Experimental Animals Twelve female Sprague-Dawley (SD) rats, aged 6–8-week, were purchased from Beijing SPF Biotechnology Co., Ltd. The rats were housed in an animal room set to a controlled temperature of 22 ± 2°C, with a relative humidity of 50 − 70%, and a 12-hour light/dark cycle. They were given standard laboratory feed and autoclaved water ad libitum . After a 3-day acclimatization period, the SD rats were randomly assigned to either the control ( n = 6 ) or the experimental (POF, n = 6 ) groups. A sample size of six animals per group was determined based on statistical analysis to ensure the detection of the expected experimental effects. The experimental group received CTX intraperitoneally at 50 mg/kg on the first day, followed by 1 mg/kg daily for the next 14 days. The control group received an equivalent volume of saline. Body weights were recorded every other day in both groups. After 24 h, the rats were euthanized by cervical dislocation, and blood samples were collected. Ovarian and brain tissues were harvested aseptically for subsequent experiments. Enzyme-linked Immunosorbent Assay Blood samples were collected from the orbital veins post-modelling. The blood was allowed to clot at 20–26°C for 20 min, followed by centrifugation at 3000 rpm and 4°C for 15 min to obtain the serum. Serum levels of anti-Müllerian hormone (AMH), estradiol (E2), vitamin D (VD), testosterone (T), insulin (INS), high-density lipoprotein (HDL), cholesterol (CHO), triglycerides (TG), and low-density lipoprotein (LDL) were measured using enzyme-linked immunosorbent assay (ELISA) kits, following the manufacturer’s instructions. Absorbance at specific wavelengths was measured using an E1800 microplate reader (manufacturer: EIx800), equipped with a computer. Quantitative Polymerase Chain Reaction (RT-qPCR) Total RNA was extracted from ovarian and brain tissues using TRIzol Reagent (Ambion, Inc., Austin, TX, USA). The extracted RNA was reverse-transcribed into cDNA using a SureScript First-strand cDNA synthesis kit (Wuhan Servicebio Technology Co., Ltd., Wuhan, China). The transcribed cDNA was then diluted 5 − 20 times with 0.08 ml of RNase/DNase-free ddH 2 O. For qPCR, gene-specific primer-probe fluorescence exonuclease assays were performed by mixing SYBR Green (Wuhan Servicebio Technology Co., Ltd., Wuhan, China) with primers (Table 1 ) and the template DNA. The reaction was carried out for 40 cycles under the following conditions on a CFX96 Real-Time Quantitative Fluorescence PCR instrument (Bio-Rad): pre-denaturation at 95°C for 1 min; denaturation at 95°C for 20 sec; annealing at 55°C for 20 sec; and extension at 72°C for 30 sec. Fluorescence was recorded, and amplification and melting curves were generated to determine the Ct values. R-GAPDH was used as the internal reference gene. The primer sequences used for PCR amplification of specific gene fragments are listed in the table below. For each gene, relative quantification of mRNA was determined using the 2-ΔΔCt method. Statistical analysis of the qPCR data was performed using GraphPad Prism 6. Table 1 Genes and primers used in the RT-qPCR Gene Primer Sequence (5’–3’) R-GAPDH Forward GACCCCTTCATTGACCTCAAC Reverse GCCATCACGCCACAGCTTTCC APP Forward TGACAAGAAGGCCGTTATCC Reverse GGCCATGTGTGTCTCTACAA APOE Forward TTGTTTCGGAAGGAGCTGACTGG Reverse CTGGACCTGGTCAGAAAGCG p53 Forward GGAGGATTCACAGTCGGATATG Reverse CTGTGGTGGGCAGAATATCA CDKN2A Forward TCTCCGAGAGGAAGGCGAAC Reverse TCACCTGTATCGGGGTACGA CDKN1A Forward TGTGATATGTACCAGCCACAGG Reverse GGCTCAGGTAGATCTTGGGC Terminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling Assay Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining was performed to detect apoptosis in ovarian and brain cells. First, the extracted ovarian and brain tissues were immediately preserved in 4% paraformaldehyde and fixed at 4°C for 24 − 48 h. Tissues were then dehydrated using increasing concentrations of ethanol, immersed in xylene thrice, and embedded in paraffin. The embedded tissues were sectioned into 3 µm slices, floated in 20% alcohol, and then placed in a 47°C water bath for flattening before mounting and baking. Paraffin sections were deparaffinized, rehydrated, subjected to antigen retrieval and permeabilization, and equilibrated at 20–26°C. Subsequently, sections were treated with DNase-free proteinase K (Beyotime, ST532/ST533) and washed with phosphate-buffered saline (PBS). The TUNEL reaction mixture (containing TdT enzyme and biotin-labeled dUTP) was prepared following the TUNEL kit’s instructions. The mixture was applied to the sections and incubated at 37°C in the dark for 1 h. After washing thrice with PBS, the sections were treated with a streptavidin-HRP complex and developed using a DAB chromogen solution. Distinct brown-yellow staining was observed, and the reaction was terminated by rinsing with tap water. The sections were then mounted and observed. Western Blotting The extracted ovarian and brain tissues were lysed in RIPA lysis buffer (Servicebio, G2002-30ML/100ML), and proteins were extracted by low-temperature centrifugation (4°C, 16,000 × g , 15 min, supernatant collected). The protein concentration in each group was measured by western blotting using a BCA protein quantification kit (Beyotime, P0009, 5000 tests) to ensure equal protein loading, thereby enhancing the reliability of the experimental data. Proteins from each group were separated by SDS-PAGE (electrophoresis system: BIO-RAD BEP-600, 164–5050) and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, K2MA8350E, 0.45 µm, 26.5 × 3.75 m) using the wet transfer method. The PVDF membranes were rinsed once with tris-buffered saline with tween (TBST; Servicebio, G0004-500M) and blocked with 5% bovine serum albumin (Solarbio, CR2302110) at 4°C for 12–16 h. The membranes were then incubated with the corresponding primary antibodies (see Table 3) at 4°C overnight. After washing with TBST the following day, the membranes were incubated with secondary antibodies (diluted 1:5000 in 5% skim milk; BIO FROXX, EZ7890B383) at room temperature for 60 min. Enhanced chemiluminescence (ECL) was used for chemiluminescent imaging using a gel imaging system. Finally, the grayscale values of the target protein bands were analyzed using ImageJ software, with β-actin as the internal reference. The grayscale values represented the relative expression levels of the proteins, and statistical bar graphs were generated using GraphPad Prism software. Senescence-Associated β-Galactosidase Staining Senescence-associated β-galactosidase (SA-β-gal) staining was performed following the instructions of the SA-β-gal staining kit (Solarbio, G1580) to measure cellular senescence activity in ovarian and brain tissues. The tissues were embedded in an optimal cutting temperature compound and sectioned (6–10 µm thickness, stored at -20°C). Next, 50 µL of β-Gal fixation solution was added (fixed at room temperature for over 15 min) and washed with PBS three times. The staining working solution was then added, and the sections were incubated at 37°C for 12–16 h. Under an optical microscope (Nikon TS2), the senescent cells appeared blue-green, and the degree of senescence was proportional to the number of blue-green cells. Statistical Analysis Each test was performed with at least three replicates. All experimental data were analyzed using SPSS version 25.0. The results were expressed as mean ± SEM, and the data were imported into GraphPad Prism 6.0.0 for analysis. Differences between and within experimental groups were determined using the Student’s t-test or one-way ANOVA to establish the significance level of the experimental results. Statistical significance was set at *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; NS indicates not significant. Results Successful Construction of a Rat Model of POF We established the POF rat model following the method described in Section 2.1. Results showed that the body weights of rats in both groups increased; however, the weight gain in the POF group was slower than in the control group, confirming the successful establishment of the POF model. After 14 days, the rats were euthanized by cervical dislocation, and the ovaries were collected. Macroscopic observations and size measurements revealed no significant differences between the two groups(Fig. 1 A). After removing the fat and membranes from the collected ovaries, their weights were measured. The results suggested ovarian weight in the POF group was significantly higher than in the control group (P < 0.001 )༈Fig. 1 B-C༉. Detection of Serum Changes in Rats With POF Using ELISA Serum evaluation of changes in ovarian endocrine function in terms of hormonal secretion levels revealed that the POF group exhibited significantly decreased levels of AMH and E2 and increased levels of T compared to the control group ( P < 0.0001 ) (Fig. 2 A-C). In terms of metabolic level changes, the POF group showed a decrease in HDL ( P < 0.001 ) and VD ( P < 0.0001 ) levels and an increase in INS ( P < 0.0001 ), CHO ( P < 0.01 ), TG, and LDL ( P < 0.05 ) levels compared to the control group (Fig. 2 D-I). These results indicate that CTX-induced POF in rats leads to ovarian endocrine dysfunction. β-Galactosidase Staining to Detect Senescence in the Cerebral Cortex and Ovarian Tissue A complex interplay exists between cell proliferation and senescence. Results showed that the nuclei appeared red in the tissue sections stained with β-galactosidase, while the senescent cells were stained dark blue (Fig. 3 A-C). In the ovarian tissue, the number of senescent cells was significantly higher than in the normal group ( P < 0.05 ) (Fig. 3 D). In the cerebral cortex tissue, senescent cells were significantly increased in the cerebral cortex, hippocampal region, and white matter region ( P < 0.05 ), with the differences being statistically significant (Fig. 3 E-F). TUNEL Staining for Detection of Apoptosis in Ovarian and Cerebral Cortex Tissues Establishing a rat animal model revealed that after TUNEL staining of ovarian sections, the cell nuclei stained blue, and the positive staining for apoptosis was brownish yellow (Fig. 4 A-B). Compared to the normal group, the number of apoptosis-positive ovarian granulosa cells in the POF group increased ( P < 0.01 ) (Fig. 4 C). In cerebral cortical tissue, the results aligned with those observed in ovarian tissue (Fig. 4 D), confirming the increase in apoptosis of ovarian granulosa cells in the POF rat model. RT-qPCR to Detect Expression Levels of APP, APOE, p53, CDKN2A, and CDKN1A Genes in Ovarian and Cerebral Cortical Tissue RT-qPCR results showed that the expression of apolipoprotein E (APOE) in the POF group was significantly decreased in the ovarian tissue compared with the normal group ( P < 0.05 ) (Fig. 5 E). The expression levels of amyloid precursor protein (APP), p53, CDKN2A, and CDKN1A increased significantly ( P < 0.05 ) (Fig. 5 A-D). In the cerebral cortical tissue, APOE expression was significantly decreased ( P < 0.05 ) (Fig. 5 J). There was a significant increase in the expression of APP ( P < 0.01 ) (Fig. 5 I), p53 ( P < 0.001 ), and CDKN2A ( P 0.05 ) (Fig. 5 H); however, the difference was not statistically significant. These results indicate that senescent cells accumulate in the ovarian and cerebral tissues of rats with POF. Western Blot Analysis of Apoptosis and Senescence-related Protein Expression in Ovarian and Cerebral Cortical Tissue Western blot analysis revealed a significant increase in the expression of CDKN2A ( P < 0.05 ) (Fig. 6 F), CDKN1A ( P < 0.001 ) (Fig. 6 G), and p53 ( P < 0.01 ) (Fig. 6 E)in the ovarian tissue of rats in the POF group compared to those in the control group. In the POF group, the expression of BCL-2 was decreased (Fig. 6 C), whereas that of BCL2-Associated X Protein (Bax) and cysteine-aspartic acid protease 3 (caspase 3) increased ( P < 0.001 ) (Fig. 6 A-B). The cerebral cortical tissue results aligned with those in the ovarian tissue (Fig. 6 D、6H). Therefore, our findings indicate that CTX possesses cytotoxic effects on proliferating cells, leading to the accumulation of apoptotic and senescent cells in rat ovaries, thereby causing severe damage to the ovarian tissues. Discussion Ovarian aging is a complex biological process [ 12 ] . POF is characterized by low estrogen and high gonadotropin levels, which align with the hormonal changes observed in the rat model used in this study. E2 levels in rats with POF were significantly lower than those in the control group. An active ovary is the primary source of female steroid hormones [ 13 ] . AMH is crucial in evaluating ovarian function and is also an effective biomarker of ovarian reserve [ 14 ] . AMH belongs to the transforming growth factor-β superfamily and is a glycoprotein hormone secreted by the granulosa cells of small antral follicles in the ovary. In this study, AMH levels in rats with POF were lower than those in the control group, further demonstrating the success of the model. A reduction in AMH levels is considered one of the earliest signs of ovarian damage after chemotherapy [ 15 ] . Monitoring AMH levels is crucial for the production of E2. Therefore, monitoring serum E2 and AMH levels is suitable for evaluating the degree of POF. Previous studies have found that CTX reduces serum AMH and E2 levels [16, 17] . They influence each other via intricate regulatory mechanisms that maintain tissue homeostasis and function [ 1 ] Cellular senescence is defined as a stable cell cycle arrest that occurs in response to environmental stress or internal damage. This response triggers several intracellular phenotypic changes that affect normal cell function and viability [19] . Among them, SA-β-gal staining is commonly used to detect cellular senescence. During cellular senescence, the activity of the related SA-β-gal staining increases. p53, p16INK4A (encoded by CDKN2A), and p21CIP1 (encoded by CDKN1A) primarily drive cell cycle arrest and are highly expressed in senescent cells, making them the most common biomarkers of senescence [20] . Our study results verified this by detecting p53, p16INK4A (encoded by CDKN2A), and p21CIP1 (encoded by CDKN1A) through SA-β-gal staining. In addition, we detected an increase in the protein expression of P53, p16, and p21 in ovarian and cerebral cortical tissues using western blotting. Therefore, by studying the changes in the above biomarkers, we demonstrated that the number of senescent cells in the ovarian and cerebral cortical tissues increased in rats with CTX-induced POF. Apoptosis is a form of programmed cell death often accompanied by typical morphological and biochemical changes in cells. Changes in the cell nucleus occur during the later stages of apoptosis [21] . We observed changes in ovarian cell nuclei through TUNEL staining and found that the positive rate of apoptosis increased in the POF group. The BCL-2 protein and caspase 3 families are important in the regulation of apoptosis, including anti-apoptotic and pro-apoptotic proteins. In normal cells, anti-apoptotic proteins form complexes with pro-apoptotic proteins to inhibit apoptosis. This balance is disrupted when cells are stimulated by apoptotic signals. Pro-apoptotic proteins (such as Bax and caspase 3) increase or anti-apoptotic proteins (such as BCL-2) decrease, leading to the transmission of pro-apoptotic signals and the execution of cell apoptosis [22] . Therefore, western blotting was used to detect the expression of the anti-apoptotic protein (BCL-2) and the pro-apoptotic proteins (Bax and caspase 3). The results showed that the expression of pro-apoptotic proteins (Bax and caspase 3) increased, whereas that of the anti-apoptotic protein (BCL-2) decreased. Therefore, the pathogenesis of POF may be related to apoptosis in the ovarian tissue, and reducing apoptotic cells may preserve ovarian function. POF causes amenorrhea, infertility, and premature aging in female patients. It also increases the risk of age-related diseases such as cardiovascular disease, atherosclerosis, hyperlipidemia, and osteoporosis [23] . Lipid is the general term for CHO, TG, and lipoids (phospholipids, glycolipids, sterols, and steroids) in the serum. The most common lipids in clinical practice include CHO and TG. Clinically, the levels of plasma lipoproteins, such as HDL and LDL, are often measured to assess the risk of developing cardiovascular diseases, such as coronary heart disease and atherosclerosis [24] . In this study, by detecting the levels of plasma lipoproteins in the serum, we proved that lipid metabolism is affected in patients with POF. Apolipoproteins are protein components in plasma lipoproteins that can bind and transport lipids to various tissues in the body for metabolism and utilization. They are commonly classified into five categories: A, B, C, D, and E [25] . APOE is an important apolipoprotein rich in arginine with a molecular weight of 34 kDa. It is present in chylomicron (CM), VLDL, intermediate-density lipoprotein (IDL), and HDL, playing a crucial role in regulating lipid metabolism [26] . Individual lipid levels in patients with POF are altered accordingly. This can result in the long-term occurrence of cardiovascular diseases, hyperlipidemia, atherosclerosis, and other diseases in these patients. In the aforementioned study, it was shown that the protein levels of APP and APOE increased, indicating that APP and APOE may become long-term clinical detection indicators for patients with POF. This was confirmed by detecting the expression levels of APP and APOE genes in the cerebral cortical and ovarian tissues using qPCR. APOE is an important arginine-rich apolipoprotein with a molecular weight of 34 kDa. It is present in CM, VLDL, IDL, and HDL, playing a crucial role in regulating blood lipid metabolism [26] . The individual blood lipid levels of patients with POF are altered accordingly. Therefore, it is closely related to cardiovascular diseases, hyperlipidemia, atherosclerosis, and other diseases in patients with long-term POF. In our previous study, qPCR was used to detect the expression of APP and APOE genes in the cerebral cortex and ovarian tissues. The levels of APP and APOE proteins were increased, indicating that APP and APOE may become long-term clinical indicators for patients with POF. APP is a single-pass transmembrane protein widely present in tissue cells throughout the body. It is highly enriched in the brain and is mainly involved in cholesterol binding [27] . APP is also widely expressed in osteoblasts [28] . In patients with POF, the ovarian reserve function declines and estrogen levels decrease, leading to premature menopause, thereby significantly accelerating bone loss [29] . VD is a fat-soluble vitamin and also a type of steroid hormone. It mainly regulates the balance between calcium and phosphorus metabolism, and bone mineral reserves. VD deficiency can lead to diseases such as osteoporosis [30] . Therefore, we aimed to verify whether patients with POF experience severe bone loss during the aging process by detecting the changes in serum lipid and VD levels. Therefore, early detection and treatment of POF is necessary to prevent complications. However, our study only focused on key apoptosis and senescence biomarkers, while other potential biomarkers may require further validation. Our findings establish a strong association between POF pathogenesis and either apoptosis or cellular senescence. However, additional investigations are required to explore other underlying mechanisms to provide a foundation for future clinical applications. Conclusions This study used a CTX-induced POF rat model to investigate serum biomarkers, apoptosis, and senescence in ovarian and cerebral cortical tissues. The results revealed that early endocrine dysfunction occurred in the POF rat model and was accompanied by increased apoptotic and senescent cell counts. The elimination of senescent and apoptotic cells improves ovarian function. These findings highlight the importance of early prevention and intervention for long-term complications associated with POF. Abbreviations AMH anti-Müllerian hormone APOE apolipoprotein E Bax BCL2-Associated X Protein CHO cholesterol CM chylomicron CDKN1A cyclin-dependent kinase inhibitor 1A CDKN2A cyclin-dependent kinase inhibitor 2A CTX cyclophosphamide Caspase 3 cysteine-aspartic acid protease 3 E2 estradiol ECL enhanced chemiluminescence HDL high-density lipoprotein INS insulin IDL intermediate-density lipoprotein LDL low-density lipoprotein P53 tumor protein p53 PVDF polyvinylidene fluoride POF premature ovarian failure SA-β-gal senescence-associated β-galactosidase SD Sprague-Dawley TUNEL terminal deoxynucleotidyl transferase dUTP nick-end labeling T testosterone TG triglycerides TBST tris-buffered saline with tween VD vitamin D Declarations Ethics approval and consent to participate Ethics approval was obtained from the Laboratory Animal Welfare Ethics Committee of Kunming University of Science and Technology. Consent to participate is not applicable for this study. Clinical trial number not applicable. Consent for publication Not applicable. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author ( [email protected] ， [email protected] ) on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work received financial support from the Xingdian Talent Support Program for Medical and Health Talents (XDYC-YLWS-2023-0073); Yunnan Provincial Center for Obstetrics and Gynecology Research (2022YJZX-FC08; 2023YJZX-FC05); Key Laboratory of Birth Defects and Genetic Diseases Research in Yunnan Province (2022ZDFKT002); Central Government Guidance Fund for Local Science and Technology Development (202407AB110013); and National Natural Science Foundation of China (82460299). Authors’ contributions JW, YW designed and performed most experiments, analyzed the data, and wrote the manuscript. .JZ helped design the animal experiments. HS conducted histological and histopathological analyses. TZ，QP helped edit the manuscript. TY supervised all experiments and edited the manuscript. All authors read and approved the final manuscript. Acknowledgements Not applicable Footnotes Jiaqi Wu，Yanmeng Wei are joint first authors of this article. References Bao D, Gao L, Xin H, Wang L. lncRNA-FMR6 directly binds SAV1 to increase apoptosis of granulosa cells in premature ovarian failure. J Ovarian Res. 2023;16(1):65. Goswami D, Conway GS. Premature ovarian failure. Hum Reprod Update. 2005;11(4):391-410 Yang X, Wang C, He X, Wei J, Wang Y, Li X, Xu LP. Hormone therapy for premature ovarian insufficiency patients with malignant hematologic diseases. Climacteric. 2017;20(3):268-73. Park KR, Nam D, Yun HM, Lee SG, Jang HJ, Sethi G, et al. β-Caryophyllene oxide inhibits growth and induces apoptosis through the suppression of PI3K/AKT/mTOR/S6K1 pathways and ROS-mediated MAPKs activation. Cancer Lett. 2011;312(2):178-88 Yao Y, Wang B, Yu K, Song J, Wang L, Yang X, Zhang X, Li Y, Ma X. Nur77 ameliorates cyclophosphamide-induced ovarian insufficiency in mice by inhibiting oxidative damage and cell senescence. J Ovarian Res. 2024;17(1):203. Yao Y, Wang B, Yu K, Song J, Wang L, Yang X, Zhang X, Li Y, Ma X. Nur77 ameliorates cyclophosphamide-induced ovarian insufficiency in mice by inhibiting oxidative damage and cell senescence. J Ovarian Res. 2024;17(1):203. Trujillo M, Odle AK, Aykin-Burns N, Allen AR. Chemotherapy induced oxidative stress in the ovary: drug-dependent mechanisms and potential interventions†. Biol Reprodr. 2023;108(4):522–37. Feng Y, Zhang W, Xu X, Wang W, Xu Y, Wang M, et al. Protective effect of Luffa cylindrica fermentation liquid on cyclophosphamide-induced premature ovarian failure in female mice by attenuating oxidative stress, inflammation and apoptosis. J Ovarian Res. 2024;17(1):24. da Costa JP, Vitorino R, Silva GM, Vogel C, Duarte AC, Rocha-Santos T. A synopsis on aging-theories, mechanisms and future prospects. Ageing Res Rev. 2016;29:90-112. Sun C, Fan S, Wang X, Lu J, Zhang Z, Wu D, et al. Purple sweet potato color inhibits endothelial premature senescence by blocking the NLRP3 inflammasome. J Nutr Biochem. 2015;26(10):1029-40. Qin X, Zhao Y, Zhang T, Yin C, Qiao J, Guo W, et al. TrkB agonist antibody ameliorates fertility deficits in aged and cyclophosphamide-induced premature ovarian failure model mice. Nat Commun. 2022;13(1):914. Kinnear HM, Tomaszewski CE, Chang FL, Moravek MB, Xu M, Padmanabhan V, et al. The ovarian stroma as a new frontier. Reproduction 2020;160:R25. Baird DT. The endocrinology of ovarian steroid secretion. Eur J Obstet Gynecol Reprod Biol. 1974;4(1):31-9. doi:10.1016/0028-2243(74)90006-9. PMID: 4607188. Dewailly D,Laven J. AMH as the primary marker for fertility. Eur J Endocrinol. 2019;181(6):D45–1. Rosendahl M, Andersen CY, la Cour Freiesleben N, Juul A, Løssl K, Andersen AN. Dynamics and mechanisms of chemotherapy-induced ovarian follicular depletion in women of fertile age. Fertil Steril. 2010;94(1):156–66. Detti L, Uhlmann RA, Zhang J, Diamond MP, Saed GM, Fletcher NM, et al. Goserelin fosters bone elongation but does not prevent ovarian damage in cyclophosphamide-treated prepubertal mice. Fertil Steril. 2014;101(4):1157–64.e1151. Yang M, Lin L, Sha C, Li T, Zhao D, Wei H, et al. Bone marrow mesenchymal stem cell-derived exosomal miR-144-5p improves rat ovarian function after chemotherapy-induced ovarian failure by targeting PTEN. Lab Investig. 2020;100(3):342–52 Wang J, Liu W, Yu D, Yang Z, Li S, et al. Research progress on the treatment of premature ovarian failure using mesenchymal stem cells: A literature review. Front Cell Dev Biol. 2021;9:749822. Schafer MJ, White TA, Iijima K, Haak AJ, Ligresti G, Atkinson EJ, et al. Cellular senescence mediates fibrotic pulmonary disease. Nat Commun. 2017;8:14532. Hernandez-Seguar A, Nehme J, Demaria M. Hallmarks of cellular senescence. Trends Cell Biol. 2018;28(6):436-53. Bertheloot D, Latz E, Franklin BS. Necroptosis, pyroptosis and apoptosis: An intricate game of cell death. Cell Mol Immunol. 2021 ;18(5):1106-21. Zhao S, Zhang Y, Lu X, Ding H, Han B, Song X, et al. CDC20 regulates the cell proliferation and radiosensitivity of P53 mutant HCC cells through the Bcl-2/Bax pathway. Int J Biol Sci. 2021;17(13):3608-21. ESHRE Guideline Group on POI, Webber L, Davies M, Anderson R, Bartlett D, Braat B, et al. ESHRE Guideline: management of women with premature ovarian insufficiency. Hum Reprod. 2016;31(5):926-37. Ference BA, Graham I, Tokgozoglu L, Catapano AL. Impact of lipids on cardiovascular health: JACC Health Promotion Series. J Am Coll Cardiol. 2018;72(10):1141-56. Teter B, Ladu MJ, Sullivan PM, Frautschy SA, Cole GM, et al. Apolipoprotein E isotype-dependent modulation of microRNA-146a in plasma and brain. Neuroreport 2016;27(11):791-5. Huang Y, Mahley RW. Apolipoprotein E: Structure and function in lipid metabolism, neurobiology, and Alzheimer's diseases. Neurobiol Dis. 2014;72 Pt A:3-12. Pfundstein G, Nikonenko AG, Sytnyk V. Amyloid precursor protein (APP) and amyloid β (Aβ) interact with cell adhesion molecules: Implications in Alzheimer's disease and normal physiology. Front Cell Dev Biol. 2022;10:969547. Hefter D, Ludewig S, Draguhn A, Korte M. Amyloid, APP, and electrical activity of the brain. Neuroscientist, 2020;26(3):231-51. Akkawi I, Zmerly H. Osteoporosis: Current concepts. Joints. 2018;6(2):122-27. Romano F, Serpico D, Cantelli M, Di Sarno A, Dalia C, Arianna R, et al. Osteoporosis and dermatoporosis: A review on the role of vitamin D. Front Endocrinol. 2023;14:1231580. Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.zip Cite Share Download PDF Status: Published Journal Publication published 31 Jul, 2025 Read the published version in Journal of Ovarian Research → Version 1 posted Editorial decision: Revision requested 09 May, 2025 Reviews received at journal 07 May, 2025 Reviews received at journal 06 May, 2025 Reviewers agreed at journal 15 Apr, 2025 Reviewers agreed at journal 14 Apr, 2025 Reviews received at journal 08 Apr, 2025 Reviewers agreed at journal 28 Mar, 2025 Reviewers invited by journal 26 Mar, 2025 Editor assigned by journal 25 Mar, 2025 Submission checks completed at journal 25 Mar, 2025 First submitted to journal 21 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6277449","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":439908740,"identity":"6245fd56-d65d-4996-9618-65517accbf51","order_by":0,"name":"Jiaqi Wu","email":"","orcid":"","institution":"The First People’s Hospital of Yunnan Province","correspondingAuthor":false,"prefix":"","firstName":"Jiaqi","middleName":"","lastName":"Wu","suffix":""},{"id":439908741,"identity":"ef00a060-3191-4584-af8f-670eb55bbfb1","order_by":1,"name":"Yanmeng Wei","email":"","orcid":"","institution":"The First People’s Hospital of Yunnan Province","correspondingAuthor":false,"prefix":"","firstName":"Yanmeng","middleName":"","lastName":"Wei","suffix":""},{"id":439908742,"identity":"25474843-56fd-40fe-a319-3a4bae03c67b","order_by":2,"name":"Qiangli Peng","email":"","orcid":"","institution":"Yunnan Provincial Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qiangli","middleName":"","lastName":"Peng","suffix":""},{"id":439908745,"identity":"0377a7fe-37d5-47ef-a942-da4f154f4416","order_by":3,"name":"Jing Zhu","email":"","orcid":"","institution":"The First People’s Hospital of Yunnan Province","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Zhu","suffix":""},{"id":439908746,"identity":"00787769-933a-408c-94ef-5f2e783e55ab","order_by":4,"name":"Huacong Shi","email":"","orcid":"","institution":"The First People’s Hospital of Yunnan Province","correspondingAuthor":false,"prefix":"","firstName":"Huacong","middleName":"","lastName":"Shi","suffix":""},{"id":439908748,"identity":"c2fe1042-f7ea-4e08-9cba-dcacd834e10d","order_by":5,"name":"Ting Zhao","email":"","orcid":"","institution":"The First People’s Hospital of Yunnan Province","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Zhao","suffix":""},{"id":439908752,"identity":"14291d0d-a02c-4bc9-9afb-823864d8dd65","order_by":6,"name":"Tao Yuan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYBACCQYGNiRuhYScPAlamIH4jIWxYQNJWhjbKhIZDhDQIjkj99hjnprDif2z+w9++DhPIoGxgfnhoxt4tEhL5KUb8xw7nDjjzmFmyZnbJPLYGdiMjXPwaJGTyDGT5mE7nNhwI5lBmnebRDFjAw+bNGEt/w4nzr+RzPybd45EYsMBAlqkQVp42w4nbriRzCbN20CEFsmeN2aSc/vSjTfeSDaznHFMwtiwmYBfJI7nmEm8+WYtO+9G4uMbH2rq5OTZmx8+xqcFCpqR2MyElYNAHXHKRsEoGAWjYGQCAPBER91yXW7oAAAAAElFTkSuQmCC","orcid":"","institution":"The First People’s Hospital of Yunnan Province","correspondingAuthor":true,"prefix":"","firstName":"Tao","middleName":"","lastName":"Yuan","suffix":""}],"badges":[],"createdAt":"2025-03-21 12:08:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6277449/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6277449/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13048-025-01759-3","type":"published","date":"2025-07-31T16:13:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80539855,"identity":"819e3485-37d9-45e8-9624-8364bf7e7048","added_by":"auto","created_at":"2025-04-14 12:41:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":55856,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in body and ovarian weights in rats with cyclophosphamide (CTX)-induced premature ovarian failure (POF). (A) Gross images of ovaries in the specified groups (Control group, POF group). (B) Changes in body weight of rats in the specified groups (Control group, POF group). (C) Changes in ovarian weight of rats in the specified groups (Control group, POF group). All data are presented as mean ± SEM\u003cem\u003e (n = 6). *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001; NS, not significant.\u003c/em\u003e POF, premature ovarian failure.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/76a489b1d317bf4ac6f88c72.png"},{"id":80539856,"identity":"af37ac1c-58b9-4d7a-977b-befb7ff006a6","added_by":"auto","created_at":"2025-04-14 12:41:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":124444,"visible":true,"origin":"","legend":"\u003cp\u003eCyclophosphamide-induced ovarian dysfunction in rats with premature ovarian failure. Serum levels of AMH (A), E2 (B), T (C), INS (D), VD (E), HDL (F), CHO (G), TG (H), and LDL (I) were measured 15 days after cyclophosphamide modeling. All data are presented as mean ± SEM (\u003cem\u003en = 6\u003c/em\u003e). \u003cem\u003e*P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001; NS, not significant\u003c/em\u003e. AMH, anti-Müllerian hormone; E2, estradiol; VD, Vitamin D; T, testosterone; INS, insulin; HDL, high-density lipoprotein; CHO, cholesterol; TG, triglycerides; LDL, low-density lipoprotein.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/b01de0a09fd31921ddbb128c.png"},{"id":80539858,"identity":"d220b0a9-763d-4834-b8cc-6268ae9d7459","added_by":"auto","created_at":"2025-04-14 12:41:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":521643,"visible":true,"origin":"","legend":"\u003cp\u003eApoptosis in rat ovarian tissue and cerebral cortical tissue was determined by β-galactosidase staining. (A) β-galactosidase staining revealed aging variations in the white matter region of the brain tissue in the premature ovarian failure (POF)group compared to the control group rats. (B) β-galactosidase staining revealed variations in the hippocampal region of the brain tissue in the POFgroup compared to the control group rats. (C) β-galactosidase staining revealed variations in the cerebral cortical region of the brain tissue in the POF group compared to the control group rats; magnification is a full field of view, 200X, 400X, with cell nuclei stained red and apoptotic cells stained dark blue. (D, E, F) Analysis was performed using ImageJ-Pro-Plus software, and bar charts were generated using GraphPad Prism to show the changes in apoptosis in the brain tissue of the ovarian and the control group.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/1c1a00bca3478e57653ad657.png"},{"id":80539860,"identity":"c7549491-1e67-4013-9898-d123bc664a87","added_by":"auto","created_at":"2025-04-14 12:41:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":822310,"visible":true,"origin":"","legend":"\u003cp\u003eApoptosis in rat ovarian and cerebral cortical tissue was determined by TUNEL staining. (A) TUNEL staining revealed histological variations in the ovaries of the POF group compared to the control group. (B) TUNEL staining revealed histological variations in the cerebral cortex of rats in the POF group compared to the control group. Magnification is a full field of view, 200X, 400X, with cell nuclei stained blue and apoptotic cells stained brownish yellow. (C, D) Analysis was performed using ImageJ-Pro-Plus software, and bar charts were generated using Prism to show the changes in apoptosis in ovarian and cerebral cortical tissue.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/555695de54367e978b7b6b7c.png"},{"id":80539859,"identity":"d0bdf1c9-fb9c-4750-a736-18a0a6c899c0","added_by":"auto","created_at":"2025-04-14 12:41:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":164337,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of aging and lipid metabolism genes in ovarian and cerebral cortical tissues; A, B, and C represent the relative expression levels of aging genes P53, CDKN2A, and CDKN1A in ovarian tissue detected by quantitative polymerase chain reaction (RT-qPCR; \u003cem\u003en = 6\u003c/em\u003e). D and E represent the lipid metabolism levels (APP, APOE) in ovarian tissue detected by RT-qPCR; F, G, and H represent the relative expression levels of aging genes P53, CDKN2A, and CDKN1A in cerebral cortical tissue detected by RT-qPCR (\u003cem\u003en = 6\u003c/em\u003e). I and J represent the changes in lipid metabolism levels (APP, APOE) in cerebral cortical tissue detected by RT-qPCR.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/122770cce9fadc8403cc5c2b.png"},{"id":80539869,"identity":"9dbe8f29-ea64-404c-93d0-5d6a24c8e53a","added_by":"auto","created_at":"2025-04-14 12:41:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":279849,"visible":true,"origin":"","legend":"\u003cp\u003eIncreased expression of apoptosis and senescence proteins in ovarian and cerebral cortical tissues. A, B, C, and D represent the relative levels of apoptotic proteins caspase 3, BAX, and BCL-2 in ovarian and cerebral cortical tissues detected by western blotting (\u003cem\u003en = 6\u003c/em\u003e). E, F, G, and H represent the relative levels of senescent proteins P53, CDKN2A, and CDKN1A, respectively, in ovarian and cerebral cortical tissues detected by western blotting (\u003cem\u003en = 6\u003c/em\u003e). β-Actin was used to normalize the band density values.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/7508de27267617fa8b172e4a.png"},{"id":88268212,"identity":"cf85e6cc-c214-4b53-b0db-dc2febd489f7","added_by":"auto","created_at":"2025-08-04 16:50:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3324225,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/ef01eebe-37bb-4761-bd79-2c502055504b.pdf"},{"id":80539866,"identity":"6d3a5c62-5ddc-4db9-971d-c857429d5805","added_by":"auto","created_at":"2025-04-14 12:41:55","extension":"zip","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":4259390,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.zip","url":"https://assets-eu.researchsquare.com/files/rs-6277449/v1/214bff057ebbe03211f4f2d2.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanisms of Cell Senescence and Apoptosis in Cyclophosphamide-Induced Premature Ovarian Failure in Rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePremature ovarian failure (POF) refers to a decline in ovarian reserve occurring before the age of 40, significantly affecting female reproductive health. The global incidence rate of POF is 1%. Clinically, POF manifests as amenorrhea, decreased estrogen levels, and elevated gonadotropin and follicle-stimulating hormone \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. POF has multifactorial and poorly understood causes, and its pathogenesis remains unclear. Common causes of POF include autoimmune disorders, genetic factors, environmental factors, and medical interventions (surgery, radiotherapy, and chemotherapy) \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Therefore, investigating the pathogenesis of POF is crucial for developing strategies to delay aging and protect female reproductive health.\u003c/p\u003e \u003cp\u003eThe incidence of chemotherapy-induced POF ranges from 70 to 100% \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Cyclophosphamide (CTX), a chemotherapeutic agent, remains one of the most successful and widely used antitumor agents \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. As an alkylating agent, CTX induces non-cyclical toxic effects on cells. Its anticancer efficacy stems from the binding of its active metabolite to DNA, causing double-strand breaks, inhibiting DNA replication and protein synthesis, disrupting the balance between pro-apoptotic and anti-apoptotic genes. This leads to impaired ovarian function and severe reproductive toxicity \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Even after the effective control of tumor tissues, this damage persists. CTX exhibits gonadotoxic effects, causing direct ovarian injury and indirectly promoting the depletion of reserve follicles by stimulating the excessive activation of primordial follicles \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. This destruction leads to germ cell death and follicular atresia \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, ultimately resulting in ovarian dysfunction and POF \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Therefore, CTX is widely used to induce POF in animal models \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eSenescence is characterized by degenerative alterations in the structure and function of human cells and tissues. It represents an inevitable biological process \u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e that has become a focal point for research \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. The pathogenesis of POF is attributed to accelerated primordial follicle atresia or altered maturation/recruitment, leading to premature follicle depletion and insufficient folliculogenesis \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. P53, a crucial tumor suppressor gene, acts as a major determinant in cell cycle regulation, DNA repair, and apoptosis. Cyclin-dependent kinase inhibitor 1A (CDKN1A) and cyclin-dependent kinase inhibitor 2A (CDKN2A) are important cell cycle regulatory genes. Therefore, we aim to investigate the mechanisms of senescence and apoptosis involving P53, CDKN1A, and CDKN2A in the ovarian and brain tissues of POF rats. We also measured the relevant hormone levels in these rats.\u003c/p\u003e \u003cp\u003eThis study established a rat senescence model using CTX to investigate its pathological effects on ovarian and brain tissues. We measured and analyzed ovarian weight, senescence-related hormone levels, and the expression of senescence pathways and apoptosis markers in ovarian and brain tissues. This study systematically explores the mechanisms underlying CTX-induced ovarian damage and offers fresh insights into the protection of ovarian function in patients undergoing chemotherapy.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental Animals\u003c/h2\u003e \u003cp\u003eTwelve female Sprague-Dawley (SD) rats, aged 6\u0026ndash;8-week, were purchased from Beijing SPF Biotechnology Co., Ltd. The rats were housed in an animal room set to a controlled temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, with a relative humidity of 50\u0026thinsp;\u0026minus;\u0026thinsp;70%, and a 12-hour light/dark cycle. They were given standard laboratory feed and autoclaved water \u003cem\u003ead libitum\u003c/em\u003e. After a 3-day acclimatization period, the SD rats were randomly assigned to either the control (\u003cem\u003en\u0026thinsp;=\u0026thinsp;6\u003c/em\u003e) or the experimental (POF, \u003cem\u003en\u0026thinsp;=\u0026thinsp;6\u003c/em\u003e) groups. A sample size of six animals per group was determined based on statistical analysis to ensure the detection of the expected experimental effects. The experimental group received CTX intraperitoneally at 50 mg/kg on the first day, followed by 1 mg/kg daily for the next 14 days. The control group received an equivalent volume of saline. Body weights were recorded every other day in both groups. After 24 h, the rats were euthanized by cervical dislocation, and blood samples were collected. Ovarian and brain tissues were harvested aseptically for subsequent experiments.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEnzyme-linked Immunosorbent Assay\u003c/h3\u003e\n\u003cp\u003eBlood samples were collected from the orbital veins post-modelling. The blood was allowed to clot at 20\u0026ndash;26\u0026deg;C for 20 min, followed by centrifugation at 3000 rpm and 4\u0026deg;C for 15 min to obtain the serum. Serum levels of anti-M\u0026uuml;llerian hormone (AMH), estradiol (E2), vitamin D (VD), testosterone (T), insulin (INS), high-density lipoprotein (HDL), cholesterol (CHO), triglycerides (TG), and low-density lipoprotein (LDL) were measured using enzyme-linked immunosorbent assay (ELISA) kits, following the manufacturer\u0026rsquo;s instructions. Absorbance at specific wavelengths was measured using an E1800 microplate reader (manufacturer: EIx800), equipped with a computer.\u003c/p\u003e\n\u003ch3\u003eQuantitative Polymerase Chain Reaction (RT-qPCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from ovarian and brain tissues using TRIzol Reagent (Ambion, Inc., Austin, TX, USA). The extracted RNA was reverse-transcribed into cDNA using a SureScript First-strand cDNA synthesis kit (Wuhan Servicebio Technology Co., Ltd., Wuhan, China). The transcribed cDNA was then diluted 5\u0026thinsp;\u0026minus;\u0026thinsp;20 times with 0.08 ml of RNase/DNase-free ddH\u003csub\u003e2\u003c/sub\u003eO. For qPCR, gene-specific primer-probe fluorescence exonuclease assays were performed by mixing SYBR Green (Wuhan Servicebio Technology Co., Ltd., Wuhan, China) with primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and the template DNA. The reaction was carried out for 40 cycles under the following conditions on a CFX96 Real-Time Quantitative Fluorescence PCR instrument (Bio-Rad): pre-denaturation at 95\u0026deg;C for 1 min; denaturation at 95\u0026deg;C for 20 sec; annealing at 55\u0026deg;C for 20 sec; and extension at 72\u0026deg;C for 30 sec. Fluorescence was recorded, and amplification and melting curves were generated to determine the Ct values. R-GAPDH was used as the internal reference gene. The primer sequences used for PCR amplification of specific gene fragments are listed in the table below. For each gene, relative quantification of mRNA was determined using the 2-ΔΔCt method. Statistical analysis of the qPCR data was performed using GraphPad Prism 6.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenes and primers used in the RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR-GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACCCCTTCATTGACCTCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCATCACGCCACAGCTTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAPP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACAAGAAGGCCGTTATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCATGTGTGTCTCTACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAPOE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGTTTCGGAAGGAGCTGACTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGACCTGGTCAGAAAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGATTCACAGTCGGATATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTGGTGGGCAGAATATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDKN2A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCCGAGAGGAAGGCGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCACCTGTATCGGGGTACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDKN1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGATATGTACCAGCCACAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTCAGGTAGATCTTGGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eTerminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling Assay\u003c/h3\u003e\n\u003cp\u003eTerminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining was performed to detect apoptosis in ovarian and brain cells. First, the extracted ovarian and brain tissues were immediately preserved in 4% paraformaldehyde and fixed at 4\u0026deg;C for 24\u0026thinsp;\u0026minus;\u0026thinsp;48 h. Tissues were then dehydrated using increasing concentrations of ethanol, immersed in xylene thrice, and embedded in paraffin. The embedded tissues were sectioned into 3 \u0026micro;m slices, floated in 20% alcohol, and then placed in a 47\u0026deg;C water bath for flattening before mounting and baking. Paraffin sections were deparaffinized, rehydrated, subjected to antigen retrieval and permeabilization, and equilibrated at 20\u0026ndash;26\u0026deg;C. Subsequently, sections were treated with DNase-free proteinase K (Beyotime, ST532/ST533) and washed with phosphate-buffered saline (PBS). The TUNEL reaction mixture (containing TdT enzyme and biotin-labeled dUTP) was prepared following the TUNEL kit\u0026rsquo;s instructions. The mixture was applied to the sections and incubated at 37\u0026deg;C in the dark for 1 h. After washing thrice with PBS, the sections were treated with a streptavidin-HRP complex and developed using a DAB chromogen solution. Distinct brown-yellow staining was observed, and the reaction was terminated by rinsing with tap water. The sections were then mounted and observed.\u003c/p\u003e\n\u003ch3\u003eWestern Blotting\u003c/h3\u003e\n\u003cp\u003eThe extracted ovarian and brain tissues were lysed in RIPA lysis buffer (Servicebio, G2002-30ML/100ML), and proteins were extracted by low-temperature centrifugation (4\u0026deg;C, 16,000 \u0026times; \u003cem\u003eg\u003c/em\u003e, 15 min, supernatant collected). The protein concentration in each group was measured by western blotting using a BCA protein quantification kit (Beyotime, P0009, 5000 tests) to ensure equal protein loading, thereby enhancing the reliability of the experimental data. Proteins from each group were separated by SDS-PAGE (electrophoresis system: BIO-RAD BEP-600, 164\u0026ndash;5050) and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, K2MA8350E, 0.45 \u0026micro;m, 26.5 \u0026times; 3.75 m) using the wet transfer method. The PVDF membranes were rinsed once with tris-buffered saline with tween (TBST; Servicebio, G0004-500M) and blocked with 5% bovine serum albumin (Solarbio, CR2302110) at 4\u0026deg;C for 12\u0026ndash;16 h. The membranes were then incubated with the corresponding primary antibodies (see Table\u0026nbsp;3) at 4\u0026deg;C overnight. After washing with TBST the following day, the membranes were incubated with secondary antibodies (diluted 1:5000 in 5% skim milk; BIO FROXX, EZ7890B383) at room temperature for 60 min. Enhanced chemiluminescence (ECL) was used for chemiluminescent imaging using a gel imaging system. Finally, the grayscale values of the target protein bands were analyzed using ImageJ software, with β-actin as the internal reference. The grayscale values represented the relative expression levels of the proteins, and statistical bar graphs were generated using GraphPad Prism software.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSenescence-Associated β-Galactosidase Staining\u003c/h2\u003e \u003cp\u003eSenescence-associated β-galactosidase (SA-β-gal) staining was performed following the instructions of the SA-β-gal staining kit (Solarbio, G1580) to measure cellular senescence activity in ovarian and brain tissues. The tissues were embedded in an optimal cutting temperature compound and sectioned (6\u0026ndash;10 \u0026micro;m thickness, stored at -20\u0026deg;C). Next, 50 \u0026micro;L of β-Gal fixation solution was added (fixed at room temperature for over 15 min) and washed with PBS three times. The staining working solution was then added, and the sections were incubated at 37\u0026deg;C for 12\u0026ndash;16 h. Under an optical microscope (Nikon TS2), the senescent cells appeared blue-green, and the degree of senescence was proportional to the number of blue-green cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eEach test was performed with at least three replicates. All experimental data were analyzed using SPSS version 25.0. The results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM, and the data were imported into GraphPad Prism 6.0.0 for analysis. Differences between and within experimental groups were determined using the Student\u0026rsquo;s t-test or one-way ANOVA to establish the significance level of the experimental results. Statistical significance was set at \u003cem\u003e*P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; NS indicates not significant.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSuccessful Construction of a Rat Model of POF\u003c/h2\u003e \u003cp\u003eWe established the POF rat model following the method described in Section 2.1. Results showed that the body weights of rats in both groups increased; however, the weight gain in the POF group was slower than in the control group, confirming the successful establishment of the POF model. After 14 days, the rats were euthanized by cervical dislocation, and the ovaries were collected. Macroscopic observations and size measurements revealed no significant differences between the two groups(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). After removing the fat and membranes from the collected ovaries, their weights were measured. The results suggested ovarian weight in the POF group was significantly higher than in the control group \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e)༈Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C༉.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDetection of Serum Changes in Rats With POF Using ELISA\u003c/h2\u003e \u003cp\u003eSerum evaluation of changes in ovarian endocrine function in terms of hormonal secretion levels revealed that the POF group exhibited significantly decreased levels of AMH and E2 and increased levels of T compared to the control group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C). In terms of metabolic level changes, the POF group showed a decrease in HDL (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) and VD (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e) levels and an increase in INS (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e), CHO (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e), TG, and LDL (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) levels compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-I). These results indicate that CTX-induced POF in rats leads to ovarian endocrine dysfunction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eβ-Galactosidase Staining to Detect Senescence in the Cerebral Cortex and Ovarian Tissue\u003c/h2\u003e \u003cp\u003eA complex interplay exists between cell proliferation and senescence. Results showed that the nuclei appeared red in the tissue sections stained with β-galactosidase, while the senescent cells were stained dark blue (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). In the ovarian tissue, the number of senescent cells was significantly higher than in the normal group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In the cerebral cortex tissue, senescent cells were significantly increased in the cerebral cortex, hippocampal region, and white matter region (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), with the differences being statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTUNEL Staining for Detection of Apoptosis in Ovarian and Cerebral Cortex Tissues\u003c/h2\u003e \u003cp\u003eEstablishing a rat animal model revealed that after TUNEL staining of ovarian sections, the cell nuclei stained blue, and the positive staining for apoptosis was brownish yellow (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Compared to the normal group, the number of apoptosis-positive ovarian granulosa cells in the POF group increased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In cerebral cortical tissue, the results aligned with those observed in ovarian tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), confirming the increase in apoptosis of ovarian granulosa cells in the POF rat model.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRT-qPCR to Detect Expression Levels of APP, APOE, p53, CDKN2A, and CDKN1A Genes in Ovarian and Cerebral Cortical Tissue\u003c/b\u003e \u003c/p\u003e \u003cp\u003eRT-qPCR results showed that the expression of apolipoprotein E (APOE) in the POF group was significantly decreased in the ovarian tissue compared with the normal group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). The expression levels of amyloid precursor protein (APP), p53, CDKN2A, and CDKN1A increased significantly (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-D). In the cerebral cortical tissue, APOE expression was significantly decreased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ). There was a significant increase in the expression of APP (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI), p53 (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), and CDKN2A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF-G). CDKN1A expression increased (\u003cem\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH); however, the difference was not statistically significant. These results indicate that senescent cells accumulate in the ovarian and cerebral tissues of rats with POF.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot Analysis of Apoptosis and Senescence-related Protein Expression in Ovarian and Cerebral Cortical Tissue\u003c/h2\u003e \u003cp\u003eWestern blot analysis revealed a significant increase in the expression of CDKN2A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), CDKN1A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), and p53 (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE)in the ovarian tissue of rats in the POF group compared to those in the control group. In the POF group, the expression of BCL-2 was decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), whereas that of BCL2-Associated X Protein (Bax) and cysteine-aspartic acid protease 3 (caspase 3) increased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B). The cerebral cortical tissue results aligned with those in the ovarian tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD、6H). Therefore, our findings indicate that CTX possesses cytotoxic effects on proliferating cells, leading to the accumulation of apoptotic and senescent cells in rat ovaries, thereby causing severe damage to the ovarian tissues.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOvarian aging is a complex biological process \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. POF is characterized by low estrogen and high gonadotropin levels, which align with the hormonal changes observed in the rat model used in this study. E2 levels in rats with POF were significantly lower than those in the control group. An active ovary is the primary source of female steroid hormones \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. AMH is crucial in evaluating ovarian function and is also an effective biomarker of ovarian reserve \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. AMH belongs to the transforming growth factor-β superfamily and is a glycoprotein hormone secreted by the granulosa cells of small antral follicles in the ovary. In this study, AMH levels in rats with POF were lower than those in the control group, further demonstrating the success of the model. A reduction in AMH levels is considered one of the earliest signs of ovarian damage after chemotherapy \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Monitoring AMH levels is crucial for the production of E2. Therefore, monitoring serum E2 and AMH levels is suitable for evaluating the degree of POF. Previous studies have found that CTX reduces serum AMH and E2 levels \u003csup\u003e[16, 17]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThey influence each other via intricate regulatory mechanisms that maintain tissue homeostasis and function \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003eCellular senescence is defined as a stable cell cycle arrest that occurs in response to environmental stress or internal damage. This response triggers several intracellular phenotypic changes that affect normal cell function and viability \u003csup\u003e[19]\u003c/sup\u003e. Among them, SA-β-gal staining is commonly used to detect cellular senescence. During cellular senescence, the activity of the related SA-β-gal staining increases. p53, p16INK4A (encoded by CDKN2A), and p21CIP1 (encoded by CDKN1A) primarily drive cell cycle arrest and are highly expressed in senescent cells, making them the most common biomarkers of senescence \u003csup\u003e[20]\u003c/sup\u003e. Our study results verified this by detecting p53, p16INK4A (encoded by CDKN2A), and p21CIP1 (encoded by CDKN1A) through SA-β-gal staining. In addition, we detected an increase in the protein expression of P53, p16, and p21 in ovarian and cerebral cortical tissues using western blotting. Therefore, by studying the changes in the above biomarkers, we demonstrated that the number of senescent cells in the ovarian and cerebral cortical tissues increased in rats with CTX-induced POF.\u003c/p\u003e \u003cp\u003eApoptosis is a form of programmed cell death often accompanied by typical morphological and biochemical changes in cells. Changes in the cell nucleus occur during the later stages of apoptosis \u003csup\u003e[21]\u003c/sup\u003e. We observed changes in ovarian cell nuclei through TUNEL staining and found that the positive rate of apoptosis increased in the POF group. The BCL-2 protein and caspase 3 families are important in the regulation of apoptosis, including anti-apoptotic and pro-apoptotic proteins. In normal cells, anti-apoptotic proteins form complexes with pro-apoptotic proteins to inhibit apoptosis. This balance is disrupted when cells are stimulated by apoptotic signals. Pro-apoptotic proteins (such as Bax and caspase 3) increase or anti-apoptotic proteins (such as BCL-2) decrease, leading to the transmission of pro-apoptotic signals and the execution of cell apoptosis \u003csup\u003e[22]\u003c/sup\u003e. Therefore, western blotting was used to detect the expression of the anti-apoptotic protein (BCL-2) and the pro-apoptotic proteins (Bax and caspase 3). The results showed that the expression of pro-apoptotic proteins (Bax and caspase 3) increased, whereas that of the anti-apoptotic protein (BCL-2) decreased. Therefore, the pathogenesis of POF may be related to apoptosis in the ovarian tissue, and reducing apoptotic cells may preserve ovarian function.\u003c/p\u003e \u003cp\u003ePOF causes amenorrhea, infertility, and premature aging in female patients. It also increases the risk of age-related diseases such as cardiovascular disease, atherosclerosis, hyperlipidemia, and osteoporosis \u003csup\u003e[23]\u003c/sup\u003e. Lipid is the general term for CHO, TG, and lipoids (phospholipids, glycolipids, sterols, and steroids) in the serum. The most common lipids in clinical practice include CHO and TG. Clinically, the levels of plasma lipoproteins, such as HDL and LDL, are often measured to assess the risk of developing cardiovascular diseases, such as coronary heart disease and atherosclerosis \u003csup\u003e[24]\u003c/sup\u003e. In this study, by detecting the levels of plasma lipoproteins in the serum, we proved that lipid metabolism is affected in patients with POF. Apolipoproteins are protein components in plasma lipoproteins that can bind and transport lipids to various tissues in the body for metabolism and utilization. They are commonly classified into five categories: A, B, C, D, and E \u003csup\u003e[25]\u003c/sup\u003e. APOE is an important apolipoprotein rich in arginine with a molecular weight of 34 kDa. It is present in chylomicron (CM), VLDL, intermediate-density lipoprotein (IDL), and HDL, playing a crucial role in regulating lipid metabolism \u003csup\u003e[26]\u003c/sup\u003e. Individual lipid levels in patients with POF are altered accordingly. This can result in the long-term occurrence of cardiovascular diseases, hyperlipidemia, atherosclerosis, and other diseases in these patients. In the aforementioned study, it was shown that the protein levels of APP and APOE increased, indicating that APP and APOE may become long-term clinical detection indicators for patients with POF. This was confirmed by detecting the expression levels of APP and APOE genes in the cerebral cortical and ovarian tissues using qPCR. APOE is an important arginine-rich apolipoprotein with a molecular weight of 34 kDa. It is present in CM, VLDL, IDL, and HDL, playing a crucial role in regulating blood lipid metabolism \u003csup\u003e[26]\u003c/sup\u003e. The individual blood lipid levels of patients with POF are altered accordingly. Therefore, it is closely related to cardiovascular diseases, hyperlipidemia, atherosclerosis, and other diseases in patients with long-term POF. In our previous study, qPCR was used to detect the expression of APP and APOE genes in the cerebral cortex and ovarian tissues. The levels of APP and APOE proteins were increased, indicating that APP and APOE may become long-term clinical indicators for patients with POF.\u003c/p\u003e \u003cp\u003eAPP is a single-pass transmembrane protein widely present in tissue cells throughout the body. It is highly enriched in the brain and is mainly involved in cholesterol binding \u003csup\u003e[27]\u003c/sup\u003e. APP is also widely expressed in osteoblasts \u003csup\u003e[28]\u003c/sup\u003e. In patients with POF, the ovarian reserve function declines and estrogen levels decrease, leading to premature menopause, thereby significantly accelerating bone loss \u003csup\u003e[29]\u003c/sup\u003e. VD is a fat-soluble vitamin and also a type of steroid hormone. It mainly regulates the balance between calcium and phosphorus metabolism, and bone mineral reserves. VD deficiency can lead to diseases such as osteoporosis \u003csup\u003e[30]\u003c/sup\u003e. Therefore, we aimed to verify whether patients with POF experience severe bone loss during the aging process by detecting the changes in serum lipid and VD levels. Therefore, early detection and treatment of POF is necessary to prevent complications. However, our study only focused on key apoptosis and senescence biomarkers, while other potential biomarkers may require further validation. Our findings establish a strong association between POF pathogenesis and either apoptosis or cellular senescence. However, additional investigations are required to explore other underlying mechanisms to provide a foundation for future clinical applications.\u003c/p\u003e "},{"header":"Conclusions","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003cp\u003eThis study used a CTX-induced POF rat model to investigate serum biomarkers, apoptosis, and senescence in ovarian and cerebral cortical tissues. The results revealed that early endocrine dysfunction occurred in the POF rat model and was accompanied by increased apoptotic and senescent cell counts. The elimination of senescent and apoptotic cells improves ovarian function. These findings highlight the importance of early prevention and intervention for long-term complications associated with POF.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAMH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eanti-M\u0026uuml;llerian hormone\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAPOE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eapolipoprotein E\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBax\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBCL2-Associated X Protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCHO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003echolesterol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003echylomicron\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCDKN1A\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecyclin-dependent kinase inhibitor 1A\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCDKN2A\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecyclin-dependent kinase inhibitor 2A\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCTX\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecyclophosphamide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCaspase 3\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecysteine-aspartic acid protease 3\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eE2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eestradiol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eECL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eenhanced chemiluminescence\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehigh-density lipoprotein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eINS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einsulin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eintermediate-density lipoprotein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elow-density lipoprotein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eP53\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etumor protein p53\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePVDF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epolyvinylidene fluoride\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePOF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epremature ovarian failure\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSA-β-gal\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esenescence-associated β-galactosidase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSprague-Dawley\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTUNEL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eterminal deoxynucleotidyl transferase dUTP nick-end labeling\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etestosterone\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etriglycerides\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTBST\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etris-buffered saline with tween\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evitamin D\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthics approval was obtained from the Laboratory Animal Welfare Ethics Committee of Kunming University of Science and Technology. Consent to participate is not applicable for this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author ([email protected] ，[email protected]) on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work received financial support from the Xingdian Talent Support Program for Medical and Health Talents (XDYC-YLWS-2023-0073); Yunnan Provincial Center for Obstetrics and Gynecology Research (2022YJZX-FC08; 2023YJZX-FC05); Key Laboratory of Birth Defects and Genetic Diseases Research in Yunnan Province (2022ZDFKT002); Central Government Guidance Fund for Local Science and Technology Development (202407AB110013); and National Natural Science Foundation of China (82460299).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJW, YW designed and performed most experiments, analyzed the data, and wrote the manuscript. .JZ helped design the animal experiments. HS conducted histological and histopathological analyses. TZ，QP helped edit the manuscript. TY supervised all experiments and edited the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cb\u003eFootnotes\u003c/b\u003e\u003c/p\u003e\n\u003cp\u003eJiaqi Wu，Yanmeng Wei are joint first authors of this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBao D, Gao L, Xin H, Wang L. lncRNA-FMR6 directly binds SAV1 to increase apoptosis of granulosa cells in premature ovarian failure. J Ovarian Res. 2023;16(1):65. \u003c/li\u003e\n\u003cli\u003eGoswami D, Conway GS. Premature ovarian failure. Hum Reprod Update. 2005;11(4):391-410\u003c/li\u003e\n\u003cli\u003eYang X, Wang C, He X, Wei J, Wang Y, Li X, Xu LP. Hormone therapy for premature ovarian insufficiency patients with malignant hematologic diseases. Climacteric. 2017;20(3):268-73. \u003c/li\u003e\n\u003cli\u003ePark KR, Nam D, Yun HM, Lee SG, Jang HJ, Sethi G, et al. \u0026beta;-Caryophyllene oxide inhibits growth and induces apoptosis through the suppression of PI3K/AKT/mTOR/S6K1 pathways and ROS-mediated MAPKs activation. Cancer Lett. 2011;312(2):178-88\u003c/li\u003e\n\u003cli\u003eYao Y, Wang B, Yu K, Song J, Wang L, Yang X, Zhang X, Li Y, Ma X. Nur77 ameliorates cyclophosphamide-induced ovarian insufficiency in mice by inhibiting oxidative damage and cell senescence. J Ovarian Res. 2024;17(1):203. \u003c/li\u003e\n\u003cli\u003eYao Y, Wang B, Yu K, Song J, Wang L, Yang X, Zhang X, Li Y, Ma X. Nur77 ameliorates cyclophosphamide-induced ovarian insufficiency in mice by inhibiting oxidative damage and cell senescence. J Ovarian Res. 2024;17(1):203. \u003c/li\u003e\n\u003cli\u003eTrujillo M, Odle AK, Aykin-Burns N, Allen AR. Chemotherapy induced oxidative stress in the ovary: drug-dependent mechanisms and potential interventions\u0026dagger;. Biol Reprodr. 2023;108(4):522\u0026ndash;37.\u003c/li\u003e\n\u003cli\u003eFeng Y, Zhang W, Xu X, Wang W, Xu Y, Wang M, et al. Protective effect of Luffa cylindrica fermentation liquid on cyclophosphamide-induced premature ovarian failure in female mice by attenuating oxidative stress, inflammation and apoptosis. J Ovarian Res. 2024;17(1):24. \u003c/li\u003e\n\u003cli\u003eda Costa JP, Vitorino R, Silva GM, Vogel C, Duarte AC, Rocha-Santos T. A synopsis on aging-theories, mechanisms and future prospects. Ageing Res Rev. 2016;29:90-112. \u003c/li\u003e\n\u003cli\u003eSun C, Fan S, Wang X, Lu J, Zhang Z, Wu D, et al. Purple sweet potato color inhibits endothelial premature senescence by blocking the NLRP3 inflammasome. J Nutr Biochem. 2015;26(10):1029-40. \u003c/li\u003e\n\u003cli\u003eQin X, Zhao Y, Zhang T, Yin C, Qiao J, Guo W, et al. TrkB agonist antibody ameliorates fertility deficits in aged and cyclophosphamide-induced premature ovarian failure model mice. Nat Commun. 2022;13(1):914. \u003c/li\u003e\n\u003cli\u003eKinnear HM, Tomaszewski CE, Chang FL, Moravek MB, Xu M, Padmanabhan V, et al. The ovarian stroma as a new frontier. Reproduction 2020;160:R25.\u003c/li\u003e\n\u003cli\u003eBaird DT. The endocrinology of ovarian steroid secretion. Eur J Obstet Gynecol Reprod Biol. 1974;4(1):31-9. doi:10.1016/0028-2243(74)90006-9. PMID: 4607188.\u003c/li\u003e\n\u003cli\u003eDewailly D,Laven J. AMH as the primary marker for fertility. Eur J Endocrinol. 2019;181(6):D45\u0026ndash;1.\u003c/li\u003e\n\u003cli\u003eRosendahl M, Andersen CY, la Cour Freiesleben N, Juul A, L\u0026oslash;ssl K, Andersen AN. Dynamics and mechanisms of chemotherapy-induced ovarian follicular depletion in women of fertile age. Fertil Steril. 2010;94(1):156\u0026ndash;66.\u003c/li\u003e\n\u003cli\u003eDetti L, Uhlmann RA, Zhang J, Diamond MP, Saed GM, Fletcher NM, et al. Goserelin fosters bone elongation but does not prevent ovarian damage in cyclophosphamide-treated prepubertal mice. Fertil Steril. 2014;101(4):1157\u0026ndash;64.e1151.\u003c/li\u003e\n\u003cli\u003eYang M, Lin L, Sha C, Li T, Zhao D, Wei H, et al. Bone marrow mesenchymal stem cell-derived exosomal miR-144-5p improves rat ovarian function after chemotherapy-induced ovarian failure by targeting PTEN. Lab Investig. 2020;100(3):342\u0026ndash;52\u003c/li\u003e\n\u003cli\u003eWang J, Liu W, Yu D, Yang Z, Li S, et al. Research progress on the treatment of premature ovarian failure using mesenchymal stem cells: A literature review. Front Cell Dev Biol. 2021;9:749822.\u003c/li\u003e\n\u003cli\u003eSchafer MJ, White TA, Iijima K, Haak AJ, Ligresti G, Atkinson EJ, et al. Cellular senescence mediates fibrotic pulmonary disease. Nat Commun. 2017;8:14532.\u003c/li\u003e\n\u003cli\u003eHernandez-Seguar A, Nehme J, Demaria M. Hallmarks of cellular senescence. Trends Cell Biol. 2018;28(6):436-53.\u003c/li\u003e\n\u003cli\u003eBertheloot D, Latz E, Franklin BS. Necroptosis, pyroptosis and apoptosis: An intricate game of cell death. Cell Mol Immunol. 2021 ;18(5):1106-21.\u003c/li\u003e\n\u003cli\u003eZhao S, Zhang Y, Lu X, Ding H, Han B, Song X, et al. CDC20 regulates the cell proliferation and radiosensitivity of P53 mutant HCC cells through the Bcl-2/Bax pathway. Int J Biol Sci. 2021;17(13):3608-21.\u003c/li\u003e\n\u003cli\u003eESHRE Guideline Group on POI, Webber L, Davies M, Anderson R, Bartlett D, Braat B, et al. ESHRE Guideline: management of women with premature ovarian insufficiency. Hum Reprod. 2016;31(5):926-37.\u003c/li\u003e\n\u003cli\u003eFerence BA, Graham I, Tokgozoglu L, Catapano AL. Impact of lipids on cardiovascular health: JACC Health Promotion Series. J Am Coll Cardiol. 2018;72(10):1141-56.\u003c/li\u003e\n\u003cli\u003eTeter B, Ladu MJ, Sullivan PM, Frautschy SA, Cole GM, et al. Apolipoprotein E isotype-dependent modulation of microRNA-146a in plasma and brain. Neuroreport 2016;27(11):791-5.\u003c/li\u003e\n\u003cli\u003eHuang Y, Mahley RW. Apolipoprotein E: Structure and function in lipid metabolism, neurobiology, and Alzheimer\u0026apos;s diseases. Neurobiol Dis. 2014;72 Pt A:3-12.\u003c/li\u003e\n\u003cli\u003ePfundstein G, Nikonenko AG, Sytnyk V. Amyloid precursor protein (APP) and amyloid \u0026beta; (A\u0026beta;) interact with cell adhesion molecules: Implications in Alzheimer\u0026apos;s disease and normal physiology. Front Cell Dev Biol. 2022;10:969547.\u003c/li\u003e\n\u003cli\u003eHefter D, Ludewig S, Draguhn A, Korte M. Amyloid, APP, and electrical activity of the brain. Neuroscientist, 2020;26(3):231-51.\u003c/li\u003e\n\u003cli\u003eAkkawi I, Zmerly H. Osteoporosis: Current concepts. Joints. 2018;6(2):122-27.\u003c/li\u003e\n\u003cli\u003eRomano F, Serpico D, Cantelli M, Di Sarno A, Dalia C, Arianna R, et al. Osteoporosis and dermatoporosis: A review on the role of vitamin D. Front Endocrinol. 2023;14:1231580.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-ovarian-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jovr","sideBox":"Learn more about [Journal of Ovarian Research](http://ovarianresearch.biomedcentral.com)","snPcode":"13048","submissionUrl":"https://submission.nature.com/new-submission/13048/3","title":"Journal of Ovarian Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Premature Ovarian Failure, Cyclophosphamide, Apoptosis, Cellular Senescence","lastPublishedDoi":"10.21203/rs.3.rs-6277449/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6277449/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003ePremature ovarian failure (POF) is a clinical condition characterized by a diminished ovarian reserve occurring before the age of 40, significantly affecting female reproductive health. However, its exact pathogenesis remains unclear. This research aimed to examine the mechanisms of cyclophosphamide (CTX)-induced senescence and apoptosis in the ovarian and cerebral cortex tissues of rats to provide insights into delaying aging and protecting female reproductive health.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA POF rat model was established via intraperitoneal injection of CTX, with the modeling effect confirmed by measuring ovarian volume and weight. Serum changes were detected using enzyme-linked immunosorbent assay (ELISA). Senescence-associated β-galactosidase (SA-β-gal) and terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining were performed to assess brain cortex and ovarian tissues. Western blotting and quantitative polymerase chain reaction (RT-qPCR) were used to detect the expression levels of proteins and genes related to cellular senescence and apoptosis, validating the correlation between POF, cellular senescence, and apoptosis.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eHigh-dose CTX induced POF. In rats with POF, the levels of anti-M\u0026uuml;llerian hormone (AMH), estradiol (E2), and vitamin D (VD) significantly decreased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e), whereas the levels of testosterone (T) and insulin (INS) significantly increased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e). The number of senescent and apoptotic-positive cells in the ovarian and cerebral cortex tissues of rats with POF was substantially augmented (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05; P\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e). Additionally, the expression of senescence-related proteins cyclin-dependent kinase inhibitor 1A (CDKN1A), cyclin-dependent kinase inhibitor 2A (CDKN2A), tumor protein p53 (P53), apoptosis-related protein BCL2-Associated X Protein (Bax), and cysteine-aspartic acid protease 3 (caspase 3) was upregulated. In contrast, the expression of the anti-apoptotic protein BCL-2 was downregulated. These findings demonstrated that high-dose CTX injection leads to cellular senescence and apoptosis, resulting in ovarian pathology.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eHigh-dose CTX induced POF in rats, resulting in aging and apoptosis in the cerebral cortex and ovarian tissues. Therefore, inhibiting cellular senescence and apoptosis may be a potential approach for restoring ovarian reserve function in POF.\u003c/p\u003e","manuscriptTitle":"Mechanisms of Cell Senescence and Apoptosis in Cyclophosphamide-Induced Premature Ovarian Failure in Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-14 12:41:50","doi":"10.21203/rs.3.rs-6277449/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-09T15:26:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-07T06:38:56+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-06T08:33:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33300507652292652466622823351113014723","date":"2025-04-15T11:34:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"19618758483027250419505162226439238673","date":"2025-04-15T02:36:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-08T06:39:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"28805974984559559093668597541693191776","date":"2025-03-28T17:35:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-26T17:31:44+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-26T03:51:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-26T03:16:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Ovarian Research","date":"2025-03-21T11:57:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-ovarian-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jovr","sideBox":"Learn more about [Journal of Ovarian Research](http://ovarianresearch.biomedcentral.com)","snPcode":"13048","submissionUrl":"https://submission.nature.com/new-submission/13048/3","title":"Journal of Ovarian Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5315ff37-3ec3-404a-889c-e86b30c08d5e","owner":[],"postedDate":"April 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-04T16:42:05+00:00","versionOfRecord":{"articleIdentity":"rs-6277449","link":"https://doi.org/10.1186/s13048-025-01759-3","journal":{"identity":"journal-of-ovarian-research","isVorOnly":false,"title":"Journal of Ovarian Research"},"publishedOn":"2025-07-31 16:13:12","publishedOnDateReadable":"July 31st, 2025"},"versionCreatedAt":"2025-04-14 12:41:50","video":"","vorDoi":"10.1186/s13048-025-01759-3","vorDoiUrl":"https://doi.org/10.1186/s13048-025-01759-3","workflowStages":[]},"version":"v1","identity":"rs-6277449","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6277449","identity":"rs-6277449","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}