Consequences of insecticide overuse in Hungary: assessment of pyrethroid resistance in Culex pipiens and Aedes albopictus mosquitoes

Consequences of insecticide overuse in Hungary: assessment of pyrethroid resistance in Culex pipiens and Aedes albopictus mosquitoes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Consequences of insecticide overuse in Hungary: assessment of pyrethroid resistance in Culex pipiens and Aedes albopictus mosquitoes Rebeka Csiba, Zsaklin Varga, Dorina Pásztor, Bianka Süle, Zoltán Soltész, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5062656/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Jan, 2025 Read the published version in Parasites & Vectors → Version 1 posted 9 You are reading this latest preprint version Abstract Background Mosquitoes, as vectors of various pathogens, have been a public health risk for centuries. Human activities such as international travel and trade, along with climate change, have facilitated the spread of invasive mosquitoes and novel pathogens across Europe, increasing the risk of mosquito-borne disease introduction and spread. Despite this threat, mosquito control in Hungary still relies predominantly on chemical treatments, which poses the risk of developing insecticide resistance in local populations. While pyrethroid resistance has been documented in several countries, there is no information on this issue from Hungary. This study aims to investigate the presence of resistance in Hungarian mosquito populations by analysing a native, already-known disease vector and a recently established invasive species with public health significance. Methods We assessed the presence of kdr mutations L1014F and V1016G in Culex pipiens and Aedes albopictus mosquitoes, respectively, responsible for pyrethroid resistance. Mosquito specimens were investigated retrospectively, i.e. collected from previous years within the framework of local monitoring programs run in urban areas representing five regions of Hungary. The mutations in mosquitoes were detected individually by allele-specific PCR and gel electrophoresis, following generally used protocols. Results In Cx. pipiens , the kdr mutation was detected across all five collection sites, with resistance allele frequencies ranging from 18.1–36.3%. Resistance alleles were identified in homozygosity and in heterozygosity with the susceptible allele as well, resulting in 53% of the investigated mosquitoes showing resistance to pyrethroids in the Hungarian populations. In contrast, for Ae. albopictus , all the analysed individuals were found to carry only the susceptible alleles, indicating a homozygous susceptible genotype across all the investigated populations. Conclusion Our work highlights the consequences of the unilateral and long-term use of chemical treatments on mosquitoes. This indicates an urgent need for a change of concept in mosquito control strategy in Hungary, as well as in countries where mosquito control still relies dominantly on insecticides. The restricted use of chemical treatment is highly recommended to prevent the development of pyrethroid resistance in recently established populations of the invasive Ae. albopictus , and to decrease the public health risk of vector-borne diseases. Asian tiger mosquito common house mosquito AIM IVM deltamethrin West Nile virus Dengue genotyping Figures Figure 1 Figure 2 Background For centuries, mosquitoes as vectors of various pathogens have presented a significant global health challenge, promoting numerous efforts to control their populations. In our increasingly globalised world, human activities such as international travel and trade facilitate the nearly limitless spread of non-native invasive mosquito species and novel pathogens across continents and countries. Climate change further facilitates the establishment of invasive mosquitoes and enables pathogens to survive in new territories, ultimately increasing the risk of mosquito-borne diseases [ 1 ]. A holistic research approach to investigate the problem is essential to mitigate the related public health risk and apply appropriate techniques to control the vector population [ 2 ]. As a leading example of such an effort, the concept of Integrated Vector Management (IVM) considers surveillance data, emphasises communication between stakeholders, and encompasses a variety of treatment methods for different purposes, including physical, biological, and chemical strategies [ 3 , 4 ]. While physical control focuses on eliminating or modifying artificial mosquito breeding sites and incorporates personal protection measures to prevent mosquito bites, biological control aims to reduce the number of mosquito larvae and prevent their development into adult mosquitoes. This treatment utilises a larvicide toxin produced by Bacillus thuringiensis israelensis (Bti), a naturally occurring soil bacterium. Both physical and biological methods are highly effective in reducing mosquito populations at their source. In contrast, the chemical method aims to eliminate adult mosquitoes. Although chemical control has a long history and has been widely used to control mosquito populations, it has several technical and biological drawbacks. In the European Union, pyrethroids are the only licensed substances for adult insect control since 2010 [ 5 ]. Besides its legal use, it is important to highlight that as a neurotoxin, pyrethroids have a non-selective effect, meaning they can also reduce populations of other non-target insects, show high toxicity to aquatic life, and potentially harm vertebrates[ 6 – 8 ]. Hence, limited use of chemical treatment and extreme caution is required when using them, particularly around water surfaces [ 8 , 9 ]. In 2020, aerial spraying of pyrethroids was banned across the EU due to its imprecise application from the air and the associated risk to nearby water bodies. Also, the commonly used fogging from trucks (ground application of chemical control) should be conducted after sunset to minimise harm to diurnal insects and because the active substance is photosensitive [ 10 ]. This technology is limited to urban areas but is inefficient in densely built-up environments, which may require more frequent treatments. However, it is crucial to avoid overuse or unilateral application of any control methods. The excessive or one-sided use of chemical substances can exert strong selection pressure on mosquito populations, leading to the development of resistance that can manifest as changes in behaviour, epidermal structure, metabolic enzyme activity, and genetic mutations[ 11 – 13 ]. In resistant populations, chemical control becomes less effective or may fail to impact the targeted mosquito population at all. According to the recommendations of the European Commission and the European Centre for Disease Prevention and Control (ECDC), chemical control should be employed only in targeted and necessary cases, such as during an epidemic caused by mosquito-borne diseases, to control vector populations [ 14 – 17 ]. Most mosquito-borne diseases are associated with Culex and invasive Aedes mosquito species. For instance, Culex pipiens (Linnaeus, 1758), a species native to Europe and commonly found in urban environments, can transmit several mosquito-borne pathogens. It is the primary vector for West Nile virus (WNV), Usutu virus, Sindbis virus, and Rift Valley fever virus [ 18 – 21 ]. Notably, WNV has caused numerous outbreaks in European countries, including Hungary [ 22 – 24 ]. Hungary is an important ecological niche for the WNV lineage 2, since its first European detection can be linked to the country in 2004. Furthermore, a comprehensive study proved that the virus strains circulating in Central and Southeastern Europe continued to spread from Hungary after the first detection. Also, Aedes albopictus (Skuse, 1894 ) (Asian tiger mosquito), the most widespread invasive species in Europe, serves as a vector of several exotic pathogens, including Dengue virus, Chikungunya virus, and Zika virus [ 25 – 26 ]. The rapid increase in autochthonous cases of Dengue infections in Europe is associated with the presence of stable populations of the tiger mosquito in the continent [ 27 – 29 ]. The public health concern is also relevant in Hungary, where Cx. pipiens is distributed countrywide, and Ae. albopictus has spread to several regions of the country since its first emergence in 2014 [ 30 ]. However, the IVM approach is still not established and mosquito control in Hungary currently relies mostly on chemical intervention [ 31 ]. This situation requires not only an urgent change in the control approach in Hungary, but looking ahead, it is also crucial to prevent the development of insecticide resistance, as this would severely compromise the ability to control vector populations during epidemics. To date, there is no information on pyrethroid resistance in mosquitoes in Hungary, although one of the most significant genetically diverse hotspot of West Nile virus is this region. Therefore, this study aims to investigate the kdr mutations responsible for resistance in Cx. pipiens , one of the most common native species in Hungary and a primary target of the commonly used chemical treatments, and in Ae. albopictus , a widespread and recently established invasive species in the country. In this study we intend to highlight the importance of monitoring the resistance in vector populations with public health importance and fill the data gap from our region. Methods Study sites and mosquito samples Mosquito samples were investigated retrospectively; the specimens were collected from urban environments, in the frame of local mosquito monitoring programs during 2021-2023 (captured with CO 2 baited standard traps), identified by morphological characteristics at the species level [32–34] and stored at -20°C until further laboratory processes. Altogether, n = 302 Cx. pipiens and n = 120 Ae. albopictus specimens were selected for our analysis, originating from five different counties of Hungary: Győr-Moson-Sopron, Pest, Hajdú-Bihar, Baranya, and Somogy county (Fig. 1, Table 1, for detailed sampling information on investigated specimens, see Additional file 1: Dataset S1.). As a retrospective investigation, due to the different amounts of samples available and suitable for our study, it was impossible to analyse each region or mosquito species in equal proportions. Since the national centralised mosquito control strategy has been applied in all the investigated regions for several years, we evaluated our results at the species level. Genomic DNA extraction Specimens were processed individually (one by one separately). For the genomic DNA extraction, the entire body of the mosquitoes was homogenized manually in 200 µl sterile water, using sterile quartz sand and sterile plastic tissue disruptor sticks. Nucleic acid was extracted with Quick-DNA TM Miniprep Plus Kit (Zymo Research, Irvine, USA), and with QIAamp ® Viral RNA Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturers’ protocols (see Additional file 1: Dataset S1.). Detection of kdr mutation L1014F in Culex pipiens For the detection of kdr mutation in Cx. pipiens specimens, we performed a quick, allele-specific PCR-based diagnostic test described previously by Martinez-Torres et al. [35]. Briefly, two separate PCR reactions were run in parallel, using Cgd1 (GTGGAACTTCACCGACTTC), Cgd2 (GCAAGGCTAAGAAAAGGTTAAG) and Cgd3 (CCACCGTAGTGATAGGAAATTTA) primers to identify the presence of the wild-type (L1014) susceptible allele, and the Cgd1, Cgd2 and Cgd4 (CCACCGTAGTGATAGGAAATTTT) primers to detect the Leucine-Phenylalanine substitution, i.e. to identify the presence of the resistant allele (F1014). For the PCR reactions, the HotStarTaq Master Mix Kit (QIAGEN, Hilden, Germany) was used, with the following parameters and conditions: 12.5 µl Master Mix, 7.5 µl 2mM primer mix (contained an equal amount of each primer), 4 µl nuclease-free water, and 1 µl template per tube. The thermocycler conditions included an initial activation step at 95 °C for 15 min followed by 40 cycles of denaturation step at 94 °C for 30 sec, an elongation step at 52 °C for 30 sec, an extension step at 72 °C for 1 min and a final extension at 72 °C for 10 min. The PCR amplicons were visualized by electrophoresis in 1.5% agarose gel. The results of both reactions were used to determine the genotype for each individual, as resistant homozygote (F/F: RR), resistant heterozygote (L/F: SR) or susceptible homozygote (L/L: SS) (Fig. 2). Detection of kdr mutation V1016G in Aedes albopictus For the detection of kdr mutation in Ae. albopictus specimens, we followed the protocol described by Pichler et al. [36] modified as we ran two separate PCR parallels to detect the Valine-Glycine substitution, i.e. to identify the presence of resistant allele (G1016) of the vssc gene. Briefly, Albo1016F (5' -AGTGCTGCGTGACCAACAGATCYGWACTAATCGGAGAATG-3') with Gly1016R (5′-GCGGGCAGGGCGGCGGGGGCGGGGCCAGCAAGGCTAAGAAAAGGTTAACTC-3’), and Albo1016F with Val1016R (5′-GCGGGCAGCAAGGCTAAGAAAAGGTTAATTA-3′) primers were applied, in parallel, using the HotStarTaq Master Mix Kit (QIAGEN, Hilden, Germany). Each reaction included 12.5 µl Master Mix, 2-2 µl 2 µM primers (F and R), 6.5 µl nuclease-free water and 1 µl template. The thermocycler conditions included an initial heat activation at 95 °C for 15 minutes followed by 40 cycles of denaturation step at 94 °C for 30 sec, an elongation step at 57 °C for 30 sec, an extension step at 72 °C for 1 minute, and a final extension at 10 minutes at 72 °C. After the PCR, the amplicons were separated by electrophoresis on 4% agarose gel, allowing the visualization and determination of the genotype similar to the case of genotyping Cx. pipiens . Results Overall, 302 Cx. pipiens mosquito specimens were analysed for the presence of the point mutation L1014F responsible for pyrethroid resistance. The mutation, i.e. resistance alleles were detected in all the 5 counties involved in the study at a frequency ranging from 18.1% to 36.3%, with the highest frequency in the population originating from Pest county. The overall (all study sites/mosquito samples) frequency of resistance allele was recorded at 30.4% (Table 2). Resistance alleles were identified in homozygosity (24 out of the 302 investigated specimens) and in heterozygosity with the susceptible allele as well (136 out of the 302 investigated specimens), resulting 53% of the investigated Cx. pipiens mosquito individuals were resistant to pyrethroids. Although we were able to analyse a different number of specimens in each county, the homozygous susceptible genotype (L/L) was most dominant (>45%), except in Baranya county where heterozygous genotype (L/F) showed the highest prevalence (52% of the investigated specimens) (Table 2). In the case of Ae. albopictus , a total of 120 mosquito specimens were involved in the analysis for the presence of V1016G kdr mutation, responsible for pyrethroid resistance. Based on the genotyping, we detected exclusively the susceptible allele, i.e. all the individuals (n = 20 from Pest, n = 50 from Baranya, n = 50 from Somogy counties) showed a homozygous susceptible (SS) genotype, the resistance allele was not present in the investigated populations. Discussion In the field of pyrethroid resistance research, extensive studies have been conducted globally, particularly in regions where mosquito-borne diseases are endemic and mainly in mosquito species that serve as potential vectors. In Africa and Asia, significant resistance has been documented in Anopheles and Aedes species, posing challenges for malaria and dengue control programs [ 37 – 41 ]. In Europe, studies have primarily focused on Cx. pipiens and Ae. albopictus species, and typically involve the detection of kdr mutations, which are known to confer resistance to pyrethroids. Although, resistance has been reported in several countries in the last decades, there is still limited data available from the continent, especially from regions where chemical mosquito control is still dominant. Here we report the first research on pyrethroid resistance in mosquito populations from Hungary. Based on PCR-genotyping, we detected the presence of the L1014F mutation in all the investigated field populations of Cx. pipiens , showing over 50% resistance to pyrethroids. Considering Hungary's mosquito control strategy, where chemical treatments (using deltamethrin) are applied in approximately 90% of the controlled areas [ 31 ], this extensive use of insecticides could have contributed significantly to the development and spread of resistance within the populations of Cx. pipiens . The high reliance on chemical methods (extensive and frequent use of deltamethrin) increased selection pressure, leading to the widespread presence of resistant individuals. Similar results have been found in other European countries, including Italy, Spain, Belgium, Greece, Slovakia, and Romania. Culex pipiens mosquitoes carry the resistant allele for pyrethroids with a high frequency (both in homozygous genotype and heterozygosity with the susceptible allele) [ 42 – 44 ]. Also, the species show phenotypic resistance to deltamethrin based on the WHO bottle assay, a standard operating procedure for testing insecticide susceptibility of adult mosquitoes [ 45 – 47 ]. In the case of Ae. albopictus , studies on insecticide resistance have primarily focused on countries where the species has become well-established and have shown varying levels of resistance across different regions. For instance, significant pyrethroids resistance has been observed in Ae. albopictus populations in Italy, particularly in urban areas with frequent insecticide use [ 36 , 48 ]. In Spain, varying levels of susceptibility have been detected across different regions, as demonstrated by WHO bottle assays and biochemical tests [ 47 , 49 ]. Furthermore, the study by Pichler et al. also suggests that pyrethroid resistance is emerging across Europe, including France, Switzerland, Romania, Bulgaria, and Turkey, as evidenced by the geographic distribution of the V1016G kdr mutation in European Ae. albopictus populations [ 50 ]. Based on our analysis, the genetic allele responsible for resistance was not present in the Hungarian Ae. albopictus populations. Although the invasive species emerged in Europe more than 30 years ago and has been distributed across the continent since then [ 51 ], it has been recently introduced to Hungary, first recorded in 2014 [ 30 ]. The origin of its introduction into the country and its genetic relationship with other European populations has not yet been uncovered, but during this relatively short period, it has had limited exposure to chemical insecticides in the frame of the mosquito control program. It is possible that the local population has not yet encountered the intense selection pressure required to drive the development of resistant traits. As a result, these populations may still be largely susceptible to pyrethroids. However, this also means that if chemical control is not carefully managed, there is a risk that resistance could rapidly develop as the population is exposed to insecticides, such as in the case of Cx. pipiens . Therefore, these findings serve as a wake-up call for mosquito surveillance programs, underscoring the importance of including pyrethroid resistance monitoring in their activities [ 50 ]. Moreover, our results indicate an urgent need for a change of concept in mosquito control strategy in Hungary. There is no countrywide surveillance of mosquitoes or vector-borne diseases, and the current national mosquito control program focuses on the rapid decrease of mosquito populations, dominantly by chemical adulticide treatments. The IVM concept, mentioned before, along with limited (restricted) use of chemical control according to the EU standards, is crucial to prevent the emergence of resistance in Ae. albopictus populations in Hungary, and to decrease the public health risk of vector-borne diseases like WNV. Even if the use of deltamethrin is halted soon, the kdr mutation will not disappear from the resistant Cx. pipiens populations probably for decades [ 52 ]. Therefore, it is crucial to act as soon as possible. Our present study may be an important initial step towards sustainable mosquito control in Hungary, provided that our results reach and are effectively implemented by decision-makers. However, it is essential to continue these efforts with regular monitoring of pyrethroid resistance patterns in Ae. albopictus populations, as well as to get a whole picture of the situation in the country. Given that public awareness and community engagement are crucial elements of an effective strategy, it is important to educate the public about the importance of participating locally in mosquito control efforts, particularly by eliminating artificial breeding sites in private gardens. In Hungary, chemical control is often considered the most effective option by society due to its long-established use and the lack of information. Therefore, public education is vital to introduce and promote alternative, sustainable solutions as viable options. Conclusions Our study on pyrethroid resistance in Cx. pipiens and Ae. albopictus mosquitoes are gap-filling research in Hungary and a major step toward more sustainable vector control. We revealed the presence of the kdr mutation responsible for pyrethroid resistance in Cx. pipiens mosquitoes, highlighting the consequences of the unilateral and long-term use of chemical treatments on native mosquito fauna. Moreover, this indicates an urgent need for a change of concept in the control strategy in countries where mosquito control still relies dominantly on chemical treatments. The moderate use of chemical control is highly recommended to prevent the development of pyrethroid resistance in recently established populations of the invasive Ae. albopictus , which has already shown responsible kdr mutation in several European countries. The most severe consequence of emerging resistance is that in the event of a vector-borne disease epidemic, chemical treatments - the only tool available to us to rapidly eliminate vectors - would become ineffective against resistant mosquito populations. Hence, these findings serve as a wake-up call for mosquito surveillance programs to address and incorporate resistance monitoring into their strategies. Declarations Acknowledgments: We would acknowledge the Biological and Sportbiological Doctoral School of the University of Pécs, Hungary for providing research opportunities for ZsV and DP during their PhD studies. Funding: The work was supported by the National Research, Development and Innovation Office, grant numbers FK-138563, K-135841, PD-135143 and by RRF-2.3.1-21-2022-00010 “National Laboratory of Virology”. Open access funding provided by the University of Pécs. Availability of data and materials: All data presented in this paper are available in the Supplementary information: Additional file 1: Dataset S1. Authors’ contributions: RCS: investigations, collection of mosquito samples and species identification, laboratory processes, writing the original draft, visualization. ZsV: collection of mosquito samples and laboratory processes. DP and BS: laboratory processes. ZS: collection of mosquito samples and species identification. KB: review and editing the manuscript. BZ and GK: conceptualization and review the manuscript. KK: conceptualization, supervision of the investigations, editing the manuscript. Ethics approval and consent to participate: Not applicable. Consent for publication: All the authors consent the publication of the manuscript. Competing interests: The authors declare that they have no conflict of interest. References European Centre for Disease Prevention and Control. Mosquito-borne diseases: An emerging threat. 2024. https://www.ecdc.europa.eu/en/publications-data/mosquito-borne-diseases-emerging-threat . Accessed 14 June 2024. World Health Organization. Vector-borne diseases. 2020. https://www.who.int/news-room/fact-sheets/detail/vector-borne-diseases . Accessed 2 May 2020. World Health Organization. Integrated vector Management. https://www.who.int/westernpacific/activities/integrating-vector-management . Centers for Disease Control and Prevention. Guidelines for West Nile virus surveillance and control. 2024. https://www.cdc.gov/west-nile-virus/php/surveillance-and-control-guidelines/index.html . Accessed 18 July 2024. Dusfour I, Chaney SC. Mosquito control: Success, failure and expectations in the context of arbovirus expansion and emergence. In: Hall M, Tamir D, editors. Mosquitopia: The Place of Pests in a Healthy World. New York: Routledge; 2022. Chapter 14. doi: 10.4324/9781003056034-19 . Corcellas C, Andreu A, Máñez M, Sergio F, Hiraldo F, Eljarrat E, Barceló D. Pyrethroid insecticides in wild bird eggs from a World Heritage Listed Park: A case study in Doñana National Park (Spain). Environ Pollut. 2017;228:321–330. doi: 10.1016/j.envpol.2017.05.035 . Epub 2017 May 25. PMID: 28551562. Abeyasuriya KGTN, Nugapola NWNP, Perera MDB. et al. Effect of dengue mosquito control insecticide thermal fogging on non-target insects. Int J Trop Insect Sci. 2017;37:11–18. doi: 10.1017/S1742758416000254 . Koprucu K, Aydin R. The toxic effects of pyrethroid deltamethrin on the common carp ( Cyprinus carpio L .) embryos and larvae. Pestic Biochem Physiol. 2004;80(1):47–53. doi: 10.1016/j.pestbp.2004.05.004 . Maguire RJ. Aquatic environmental fate of deltamethrin. Water Sci Technol. 1992;25(11):99–102. Johnson M, Luukinen B, Buhl K, Stone D. Deltamethrin general fact sheet: National pesticide information center, Oregon State University Extension Services. 2010; http://npic.orst.edu/factsheets/DeltaGen.html . Török E, Hochkirch A, Soltész Z, Tscharntke T, Batáry P. Unmeasured side effects of mosquito control on biodiversity. Eur J Ecol. 2020;6(1):71–76. doi: 10.17161/eurojecol.v6i1.13855 . Rinkevich FD, Du Y, Dong K. Diversity and convergence of sodium channel mutations involved in resistance to pyrethroids. Pestic Biochem Physiol. 2013;106(3):93–100. doi: 10.1016/j.pestbp.2013.02.007 . Liu N. Insecticide resistance in mosquitoes: impact, mechanisms, and research directions. Annu Rev Entomol. 2015;60:537–59. doi: 10.1146/annurev-ento-010814-020828 . European Commission. EU countries should use pesticides more sustainably. 2017; https://ec.europa.eu/commission/presscorner/detail/en/IP_17_3750 Accessed 10 October 2017. European Centre for Disease Prevention and Control. Vector control with a focus on Aedes aegypti and Aedes albopictus mosquitoes: literature review and analysis of information. Stockholm: ECDC; 2017. European Centre for Disease Prevention and Control. Vector control practices and strategies against West Nile virus. Stockholm: ECDC; 2020. European Centre for Disease Prevention and Control. West Nile virus risk assessment tool Stockholm: ECDC; 2013. Jansen S, Heitmann A, Uusitalo R, Korhonen EM, Lühken R, Kliemke K, Lange U, Helms M, Kirjalainen L, Nykänen R, et al. Vector competence of Northern European Culex pipiens Biotype pipiens and Culex torrentium to West Nile Virus and Sindbis Virus. Viruses. 2023;15(3):592. doi: 10.3390/v15030592 . Turell MJ. Members of the Culex pipiens complex as vectors of viruses. J Am Mosq Control Assoc. 2012;28(4 Suppl):123–126. doi: 10.2987/8756-971X-28.4.123 . Talavera S, Birnberg L, Nuñez AI et al. Culex flavivirus infection in a Culex pipiens mosquito colony and its effects on vector competence for Rift Valley fever phlebovirus. Parasites Vectors. 2018;11:310. doi: 10.1186/s13071-018-2887-4 . Krambrich J, Bole-Feysot E, Höller P, Lundkvist A, Hesson JC. Vector competence of Swedish Culex pipiens mosquitoes for Usutu virus. One Health. 2024;18:100707. doi: 10.1016/j.onehlt.2024.100707 . Szentpáli-Gavallér K, Antal L, Tóth M, Kemenesi G, Soltész Z, Dán A, et al. Monitoring of West Nile virus in mosquitoes between 2011–2012 in Hungary. Vector Borne Zoonotic Dis. 2014;14(9):648–55. doi: 10.1089/vbz.2013.1549 . Zana B, Erdélyi K, Nagy A, Mezei E, Nagy O, Takács M, et al. Multi-approach investigation regarding the West Nile virus situation in Hungary, 2018. Viruses. 2020;12(1):123. doi: 10.3390/v12010123 . European Centre for Disease Prevention and Control. West Nile virus - distribution of human and animal infections, 2023. 2024. https://www.ecdc.europa.eu/en/publications-data/west-nile-virus-distribution-human-and-animal-infections-2023 . Accessed 20 Feb 2024. Gloria-Soria A, Payne AF, Bialosuknia SM, et al. Vector competence of Aedes albopictus populations from the northeastern United States for Chikungunya, Dengue, and Zika Viruses. Am J Trop Med Hyg. 2020;104(3):1123–1130. doi: 10.4269/ajtmh.20-0874 . Schaffner F, Mathis A. Dengue and dengue vectors in the WHO European region: past, present, and scenarios for the future. Lancet Infect Dis 2014;14:1271–1280. doi: 10.1016/S1473-3099(14)70834-5 . Zatta M, Brichler S, Vindrios W, Melica G, Gallien S. Autochthonous Dengue outbreak, Paris region, France, September-October 2023. Emerg Infect Dis. 2023;29(12):2538–2540. doi: 10.3201/eid2912.231472 . European Centre for Disease Prevention and Control. Communicable disease threats report. 2023; https://www.ecdc.europa.eu/sites/default/files/documents/communicable-disease-threats-report-week-50-2023 .pdf Accessed 16 Dec 2023. Cochet A, Calba C, Jourdain F, Grard G, Durand GA, Guinard AIT, Noël H, Paty MC, Franke F. Autochthonous dengue in mainland France, 2022: geographical extension and incidence increase. Euro Surveill. 2022;27(44):pii = 2200818. doi: 10.2807/1560-7917.ES.2022.27.44.2200818 . Mosquito Monitor [Szúnyogmonitor in Hungarian]. Asian tiger mosquito. https://szunyogmonitor.hu/index.php/albopictus-english/ . Ministry of Interior Hungary, National Disaster Management Directorate [Belügyminisztérium Országos Katasztrófavédelmi Főigazgatóság - Szúnyoggyérítés in Hungarian]. Mosquito control in Hungary. https://www.katasztrofavedelem.hu/37838/heti-programok . Tóth S. Csípőszúnyog határozó II. (Imágók). Keszthely; 2008. (Pannónia füzetek: 2.). Becker N, Petrić D, Zgomba M, Boase C, Madon MB, Dahl C, et al. Mosquitoes - Identification, Ecology and Control. 2020. European Centre for Disease Prevention and Control & EFSA. Guidelines for the surveillance of invasive mosquitoes in Europe. ECDC Technical Report. 2012; doi: 10.2900/61134 . Martínez-Torres D, Chevillon C, Brun-Barale A, Bergé JB, Pasteur N, Pauron D. Voltage-dependent Na + channels in pyrethroid-resistant Culex pipiens L mosquitoes. Pesticide Science, 1999;55,1012–1020. Pichler V, Mancini E, Micocci M, et al. A novel allele specific polymerase chain reaction (AS-PCR) assay to detect the V1016G knockdown resistance mutation confirms its widespread presence in Aedes albopictus populations from Italy. Insects. 2021;12(1):79. doi: 10.3390/insects12010079 . Wanjala CL, Mbugi JP, Ototo E, et al. Pyrethroid and DDT resistance and organophosphate susceptibility among Anopheles spp . mosquitoes, Western Kenya. Emerg Infect Dis. 2015;21(12):2178–2181. doi: 10.3201/eid2112.150814 . Carson J, Erriah B, Herodotou S, et al. Overcoming insecticide resistance in Anopheles mosquitoes by using faster-acting solid forms of deltamethrin. Malar J. 2023;22(1):129. doi: 10.1186/s12936-023-04554-x . Toé KH, Jones CM, N’Fale S, Ismail HM, Dabiré RK, Ranson H. Increased pyrethroid resistance in malaria vectors and decreased bed net effectiveness, Burkina Faso. Emerg Infect Dis. 2014; 20(10):1691–1696. doi:10.3201%2Feid2010.140619. Amelia-Yap ZH, Chen CD, Sofian-Azirun M et al. Pyrethroid resistance in the dengue vector Aedes aegypti in Southeast Asia: present situation and prospects for management. Parasites Vectors. 2018;11:332. doi: 10.1186/s13071-018-2899-0 . Hassan MR, Azit NA, Fadzil SM, Ghani SRA, Ahmad N, Nawi AM. Insecticide resistance of Dengue vectors in South East Asia: a systematic review. Afr Health Sci. 2021;21(3):1124–1140. doi: 10.4314/AHS.V21I3.21 . Stancu IG, Prioteasa FL, Tiron GV, et al. Distribution of insecticide resistance genetic markers in the West Nile Virus vector Culex pipiens from South-Eastern Romania. Insects. 2022;13(11):1062. doi: 10.3390/insects13111062 . Pichler V, Giammarioli C, Bellini R, et al. First evidence of pyrethroid resistance in Italian populations of West Nile virus vector Culex pipiens . Med Vet Entomol. 2022;36(3):390–395. doi: 10.1111/mve.12573 . Taskin BG, Dogaroglu T, Kilic S, Dogac E, Taskin V. Seasonal dynamics of insecticide resistance, multiple resistance, and morphometric variation in field populations of Culex pipiens . Pestic Biochem Physiol. 2016;129:14–27. doi: 10.1016/j.pestbp.2015.10.012 . Iľko I, Peterková V, Heregová M, Strelková L, Preinerová K, Derka T, et al. The study on biocidal resistance of mosquitoes of genus Culex and Aedes to commonly used biocides cypermethrin and deltamethrin in Central Europe. Biologia. 2023;78:2727–2736. doi: 10.1007/s11756-023-01392-9 . Vereecken S, Vanslembrouck A, Kramer IM, et al. Phenotypic insecticide resistance status of the Culex pipiens complex: a European perspective. Parasites Vectors. 2022;15:423. doi: 10.1186/s13071-022-05542-x . Paaijmans K, Brustollin M, Aranda C, Eritja R, Talavera S, Pagès N, et al. Phenotypic insecticide resistance in arbovirus mosquito vectors in Catalonia and its capital Barcelona (Spain). PLoS ONE. 2019;14(7):e0217860. doi: 10.1371/journal.pone.0217860 . Pichler V, Malandruccolo C, Serini P, Bellini R, Severini F, Toma L, Di Luca M, Montarsi F, Ballardini M, Manica M, Petrarca V, Vontas J, Kasai S, della Torre A, Caputo B. Phenotypic and genotypic pyrethroid resistance of Aedes albopictus , with focus on the 2017 chikungunya outbreak in Italy. Pest Management Science. 2019;75(10):2642–2651. doi: 10.1002/PS.5369 . Bengoa M, Eritja R, Delacour S, Miranda MÁ, Sureda A, Lucientes J. First data on resistance to pyrethroids in wild populations of Aedes albopictus from Spain. J Am Mosq Control Assoc. 2017;33(3):246–249. doi: 10.2987/17-6636R.1 . Pichler V, Caputo B, Valadas V, et al. Geographic distribution of the V1016G knockdown resistance mutation in Aedes albopictus : a warning bell for Europe. Parasites Vectors. 2022;15:280. doi: 10.1186/s13071-022-05407-3 . European Centre for Disease Prevention and Control and European Food Safety Authority. Mosquito maps. Stockholm: ECDC. 2024; https://ecdc.europa.eu/en/disease-vectors/surveillance-and-disease-data/mosquito-maps . Macoris ML, Martins AJ, Andrighetti MTM, Lima JBP, Valle D. Pyrethroid resistance persists after ten years without usage against Aedes aegypti in governmental campaigns: lessons from São Paulo State, Brazil. PLoS Negl Trop Dis. 2018;12(3):e0006390. doi: 10.1371/journal.pntd.0006390 . Tables Table 1 Number of Culex pipiens and Aedes albopictus mosquito specimens involved in the analysis, originating from different counties of Hungary and collected in different years. County Sampling sites number on the Map (see Fig. 1) No of investigated mosquito individuals Total (n) (Sampling year / Mosquito species) 2021 2022 2023 Győr-Moson-Sopron (1, 2, 3) Cx. pipiens 100 100 Pest (4, 5) Cx. pipiens 20 6 26 Ae. albopictus 20 20 Hajdú-Bihar (6) Cx. pipiens 5 5 Baranya (7) Cx. pipiens 24 100 124 Ae. albopictus 4 46 50 Somogy (8) Cx. pipiens 42 5 47 Ae. albopictus 31 19 50 Total (n) Cx. pipiens 42 54 206 302 Ae. albopictus 31 43 46 120 Table 2 Genotype and allele frequencies of the L1014F kdr mutation in Culex pipiens populations from Hungary. (RR: the number of mosquitoes representing homozygous for the resistant mutation, SR: the number of heterozygous mosquitoes holding both susceptible and resistant alleles, SS: the number of mosquitoes representing homozygous for the susceptible allele, %R alleles: frequency of the resistant allele in the investigated populations, evaluated according to the Hardy-Weinberg equilibrium. County No of investigated mosquito individuals (n) RR (n) SR (n) SS (n) %R alleles Győr-Moson-Sopron 100 7 46 47 30.0 Pest 26 5 9 12 36.3 Hajdú-Bihar 5 0 2 3 20.0 Baranya 124 11 64 49 34.7 Somogy 47 1 15 31 18.1 Total 302 24 136 142 30.4 Additional Declarations No competing interests reported. Supplementary Files Supplementaryinformationfinal.pdf Additional file 1: Dataset S1. Data on field collection of Culex pipiens and Aedes albopictus mosquito specimens involved in the present analyses. Cite Share Download PDF Status: Published Journal Publication published 16 Jan, 2025 Read the published version in Parasites & Vectors → Version 1 posted Editorial decision: Revision requested 16 Oct, 2024 Reviews received at journal 12 Oct, 2024 Reviews received at journal 08 Oct, 2024 Reviewers agreed at journal 03 Oct, 2024 Reviewers agreed at journal 01 Oct, 2024 Reviewers invited by journal 29 Sep, 2024 Editor assigned by journal 11 Sep, 2024 Submission checks completed at journal 11 Sep, 2024 First submitted to journal 10 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5062656","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":366943984,"identity":"b8c5c81f-197b-4fac-858b-31be3b761412","order_by":0,"name":"Rebeka Csiba","email":"","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Rebeka","middleName":"","lastName":"Csiba","suffix":""},{"id":366943985,"identity":"7a09d345-0240-43f9-acbb-196b553a73b4","order_by":1,"name":"Zsaklin Varga","email":"","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Zsaklin","middleName":"","lastName":"Varga","suffix":""},{"id":366943986,"identity":"6a1c18b1-9d21-4b48-bdad-fb7d153ab665","order_by":2,"name":"Dorina Pásztor","email":"","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Dorina","middleName":"","lastName":"Pásztor","suffix":""},{"id":366943987,"identity":"61d8e0b3-0d08-4c48-b072-caf5585339f8","order_by":3,"name":"Bianka Süle","email":"","orcid":"","institution":"Institute of Biology, Faculty of Sciences, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Bianka","middleName":"","lastName":"Süle","suffix":""},{"id":366943988,"identity":"12bff2ef-82b7-495d-bcdf-14b2547e70eb","order_by":4,"name":"Zoltán Soltész","email":"","orcid":"","institution":"National Laboratory for Health Security, HUN-REN Centre for Ecological Research","correspondingAuthor":false,"prefix":"","firstName":"Zoltán","middleName":"","lastName":"Soltész","suffix":""},{"id":366943989,"identity":"2df8aa12-77f6-411b-895b-c00ab509aec8","order_by":5,"name":"Brigitta Zana","email":"","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Brigitta","middleName":"","lastName":"Zana","suffix":""},{"id":366943990,"identity":"ce1b5a1b-3a83-41a2-922b-2dbd04517023","order_by":6,"name":"Krisztián Bányai","email":"","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Krisztián","middleName":"","lastName":"Bányai","suffix":""},{"id":366943991,"identity":"40e0a4bd-c632-4071-adf2-66965d346c72","order_by":7,"name":"Gábor Kemenesi","email":"","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":false,"prefix":"","firstName":"Gábor","middleName":"","lastName":"Kemenesi","suffix":""},{"id":366943992,"identity":"b5ceeb8a-4d56-447d-b3f6-bb13e137bf48","order_by":8,"name":"Kornélia Kurucz","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAElEQVRIiWNgGAWjYBACCTBZAKR4IAJyIOLAA4JaDBBajMFaEghrYYBrSWwAkfi0SLb3PnvwwcBCnoHnjNlnnpq69Plhhx8CbbGT023ArkWa57i54QwDCcMG3h7j2TzH2HI33k4zAGpJNjY7gF2LnEQamzSPgQRjAz+PMTNvA0/uxtkJIC0HErfh0/LHQMIeqkUi3XB2+ge8WqRBWoAhlghyGFCLQYK8dA5+WyR7jrFJ9hhIJLfxHCtmnHMswXCDdE7BgQQD3H6RON7GJvGjos62nyd5M8Obmjp5+dnpmz98qLCTw6UFDthgDAOwSgMCylGAfAMpqkfBKBgFo2AkAADmgVEzfr28mwAAAABJRU5ErkJggg==","orcid":"","institution":"National Laboratory of Virology, Szentágothai Research Centre, University of Pécs","correspondingAuthor":true,"prefix":"","firstName":"Kornélia","middleName":"","lastName":"Kurucz","suffix":""}],"badges":[],"createdAt":"2024-09-10 07:36:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5062656/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5062656/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13071-024-06635-5","type":"published","date":"2025-01-16T15:57:15+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":70655158,"identity":"af6a7175-f89c-4bf7-9f6b-2ab729a08171","added_by":"auto","created_at":"2024-12-05 09:47:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":387195,"visible":true,"origin":"","legend":"\u003cp\u003eSampling sites of investigated mosquitoes (\u003cem\u003eCulex pipiens \u003c/em\u003eand \u003cem\u003eAedes albopictus \u003c/em\u003especimens) in Hungary, 1-3: Győr-Moson-Sopron county, 4-5: Pest county, 6: Hajdú-Bihar county, 7: Baranya county, 8: Somogy county.\u003c/p\u003e","description":"","filename":"Fig1final.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5062656/v1/65fff12669f3c276bfb16871.jpg"},{"id":70655159,"identity":"43afc43e-b50f-43fc-86dc-349ae5777ebf","added_by":"auto","created_at":"2024-12-05 09:47:30","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":354987,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative electrophoretic profiles of the allele-specific diagnostic PCR assay for detecting the kdr mutation L1014F in \u003cem\u003eCulex pipiens\u003c/em\u003e: RR - homozygous for the resistant allele, SR - heterozygous, SS - homozygous for the susceptible allele, L - 100 bp DNA Ladder (Promega, Wisconsin, USA).\u003c/p\u003e","description":"","filename":"Fig.2final.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5062656/v1/5f47c98024d82bd60b6a4eb3.jpg"},{"id":74284516,"identity":"b0eda535-0be5-4c44-94f3-5d207ec5676f","added_by":"auto","created_at":"2025-01-20 16:08:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1432371,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5062656/v1/52431ba5-1579-43cb-b67b-da0b6f67bb0a.pdf"},{"id":70655160,"identity":"4256a408-c14a-4115-8819-9ef357af3bbd","added_by":"auto","created_at":"2024-12-05 09:47:30","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3991928,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 1: Dataset S1. \u003c/strong\u003eData on field collection of \u003cem\u003eCulex pipiens \u003c/em\u003eand \u003cem\u003eAedes albopictus\u003c/em\u003e mosquito specimens involved in the present analyses.\u003c/p\u003e","description":"","filename":"Supplementaryinformationfinal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5062656/v1/f65bc3b299029fa1573d8b32.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Consequences of insecticide overuse in Hungary: assessment of pyrethroid resistance in Culex pipiens and Aedes albopictus mosquitoes","fulltext":[{"header":"Background","content":"\u003cp\u003eFor centuries, mosquitoes as vectors of various pathogens have presented a significant global health challenge, promoting numerous efforts to control their populations. In our increasingly globalised world, human activities such as international travel and trade facilitate the nearly limitless spread of non-native invasive mosquito species and novel pathogens across continents and countries. Climate change further facilitates the establishment of invasive mosquitoes and enables pathogens to survive in new territories, ultimately increasing the risk of mosquito-borne diseases [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. A holistic research approach to investigate the problem is essential to mitigate the related public health risk and apply appropriate techniques to control the vector population [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. As a leading example of such an effort, the concept of Integrated Vector Management (IVM) considers surveillance data, emphasises communication between stakeholders, and encompasses a variety of treatment methods for different purposes, including physical, biological, and chemical strategies [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. While physical control focuses on eliminating or modifying artificial mosquito breeding sites and incorporates personal protection measures to prevent mosquito bites, biological control aims to reduce the number of mosquito larvae and prevent their development into adult mosquitoes. This treatment utilises a larvicide toxin produced by \u003cem\u003eBacillus thuringiensis israelensis\u003c/em\u003e (Bti), a naturally occurring soil bacterium. Both physical and biological methods are highly effective in reducing mosquito populations at their source. In contrast, the chemical method aims to eliminate adult mosquitoes.\u003c/p\u003e \u003cp\u003eAlthough chemical control has a long history and has been widely used to control mosquito populations, it has several technical and biological drawbacks. In the European Union, pyrethroids are the only licensed substances for adult insect control since 2010 [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Besides its legal use, it is important to highlight that as a neurotoxin, pyrethroids have a non-selective effect, meaning they can also reduce populations of other non-target insects, show high toxicity to aquatic life, and potentially harm vertebrates[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Hence, limited use of chemical treatment and extreme caution is required when using them, particularly around water surfaces [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In 2020, aerial spraying of pyrethroids was banned across the EU due to its imprecise application from the air and the associated risk to nearby water bodies. Also, the commonly used fogging from trucks (ground application of chemical control) should be conducted after sunset to minimise harm to diurnal insects and because the active substance is photosensitive [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This technology is limited to urban areas but is inefficient in densely built-up environments, which may require more frequent treatments. However, it is crucial to avoid overuse or unilateral application of any control methods. The excessive or one-sided use of chemical substances can exert strong selection pressure on mosquito populations, leading to the development of resistance that can manifest as changes in behaviour, epidermal structure, metabolic enzyme activity, and genetic mutations[\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In resistant populations, chemical control becomes less effective or may fail to impact the targeted mosquito population at all. According to the recommendations of the European Commission and the European Centre for Disease Prevention and Control (ECDC), chemical control should be employed only in targeted and necessary cases, such as during an epidemic caused by mosquito-borne diseases, to control vector populations [\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMost mosquito-borne diseases are associated with \u003cem\u003eCulex\u003c/em\u003e and invasive \u003cem\u003eAedes\u003c/em\u003e mosquito species. For instance, \u003cem\u003eCulex pipiens\u003c/em\u003e (Linnaeus, 1758), a species native to Europe and commonly found in urban environments, can transmit several mosquito-borne pathogens. It is the primary vector for West Nile virus (WNV), Usutu virus, Sindbis virus, and Rift Valley fever virus [\u003cspan additionalcitationids=\"CR19 CR20\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Notably, WNV has caused numerous outbreaks in European countries, including Hungary [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Hungary is an important ecological niche for the WNV lineage 2, since its first European detection can be linked to the country in 2004. Furthermore, a comprehensive study proved that the virus strains circulating in Central and Southeastern Europe continued to spread from Hungary after the first detection. Also, \u003cem\u003eAedes albopictus\u003c/em\u003e (Skuse, 1894\u003cem\u003e)\u003c/em\u003e (Asian tiger mosquito), the most widespread invasive species in Europe, serves as a vector of several exotic pathogens, including Dengue virus, Chikungunya virus, and Zika virus [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The rapid increase in autochthonous cases of Dengue infections in Europe is associated with the presence of stable populations of the tiger mosquito in the continent [\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The public health concern is also relevant in Hungary, where \u003cem\u003eCx. pipiens\u003c/em\u003e is distributed countrywide, and \u003cem\u003eAe. albopictus\u003c/em\u003e has spread to several regions of the country since its first emergence in 2014 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. However, the IVM approach is still not established and mosquito control in Hungary currently relies mostly on chemical intervention [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. This situation requires not only an urgent change in the control approach in Hungary, but looking ahead, it is also crucial to prevent the development of insecticide resistance, as this would severely compromise the ability to control vector populations during epidemics.\u003c/p\u003e \u003cp\u003eTo date, there is no information on pyrethroid resistance in mosquitoes in Hungary, although one of the most significant genetically diverse hotspot of West Nile virus is this region. Therefore, this study aims to investigate the kdr mutations responsible for resistance in \u003cem\u003eCx. pipiens\u003c/em\u003e, one of the most common native species in Hungary and a primary target of the commonly used chemical treatments, and in \u003cem\u003eAe. albopictus\u003c/em\u003e, a widespread and recently established invasive species in the country. In this study we intend to highlight the importance of monitoring the resistance in vector populations with public health importance and fill the data gap from our region.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eStudy sites and mosquito samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMosquito samples were investigated retrospectively; the specimens were collected from urban environments, in the frame of local mosquito monitoring programs during 2021-2023 (captured with CO\u003csub\u003e2\u003c/sub\u003e baited standard traps), identified by morphological characteristics at the species level [32\u0026ndash;34] and stored at -20\u0026deg;C until further laboratory processes. Altogether, n = 302 \u003cem\u003eCx. pipiens\u0026nbsp;\u003c/em\u003eand n = 120 \u003cem\u003eAe. albopictus\u003c/em\u003e specimens were selected for our analysis, originating from five different counties of Hungary: Győr-Moson-Sopron, Pest, Hajd\u0026uacute;-Bihar, Baranya, and Somogy county (Fig. 1, Table 1, for detailed sampling information on investigated specimens, see Additional file 1: Dataset S1.). As a retrospective investigation, due to the different amounts of samples available and suitable for our study, it was impossible to analyse each region or mosquito species in equal proportions. Since the national centralised mosquito control strategy has been applied in all the investigated regions for several years, we evaluated our results at the species level.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGenomic DNA extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecimens were processed individually (one by one separately). For the genomic DNA extraction, the entire body of the mosquitoes was homogenized manually in 200 \u0026micro;l sterile water, using sterile quartz sand and sterile plastic tissue disruptor sticks. Nucleic acid was extracted with Quick-DNA\u003csup\u003eTM\u003c/sup\u003e Miniprep Plus Kit (Zymo Research, Irvine, USA), and with QIAamp\u003csup\u003e\u0026reg;\u003c/sup\u003e Viral RNA Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturers\u0026rsquo; protocols (see Additional file 1: Dataset S1.).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of kdr mutation L1014F in \u003cem\u003eCulex pipiens\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the detection of kdr mutation in \u003cem\u003eCx. pipiens\u003c/em\u003e specimens, we performed a quick, allele-specific PCR-based diagnostic test described previously by Martinez-Torres et al. [35]. Briefly, two separate PCR reactions were run in parallel, using Cgd1\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(GTGGAACTTCACCGACTTC), Cgd2\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(GCAAGGCTAAGAAAAGGTTAAG) and Cgd3\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(CCACCGTAGTGATAGGAAATTTA) primers to identify the presence of the wild-type (L1014) susceptible allele, and the Cgd1, Cgd2 and Cgd4\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(CCACCGTAGTGATAGGAAATTTT) primers to detect the Leucine-Phenylalanine substitution, i.e. to identify the presence of the resistant allele (F1014). For the PCR reactions, the HotStarTaq Master Mix Kit (QIAGEN, Hilden, Germany) was used, with the following parameters and conditions: 12.5 \u0026micro;l Master Mix, 7.5 \u0026micro;l 2mM primer mix (contained an equal amount of each primer), 4 \u0026micro;l nuclease-free water, and 1 \u0026micro;l template per tube. The thermocycler conditions included an initial activation step at 95 \u0026deg;C for 15 min followed by 40 cycles of denaturation step at 94 \u0026deg;C for 30 sec, an elongation step at 52 \u0026deg;C for 30 sec, an extension step at 72 \u0026deg;C for 1 min and a final extension at 72 \u0026deg;C for 10 min. The PCR amplicons were visualized by electrophoresis in 1.5% agarose gel. The results of both reactions were used to determine the genotype for each individual, as resistant homozygote (F/F: RR), resistant heterozygote (L/F: SR) or susceptible homozygote (L/L: SS) (Fig. 2).\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of kdr mutation V1016G in \u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the detection of \u003cem\u003ekdr\u003c/em\u003e mutation in \u003cem\u003eAe. albopictus\u003c/em\u003e specimens, we followed the protocol described by Pichler et al.\u0026nbsp;[36]\u0026nbsp;modified as we ran two separate PCR parallels to detect the Valine-Glycine substitution, i.e. to identify the presence of resistant allele (G1016) of the \u003cem\u003evssc\u003c/em\u003e gene. Briefly, Albo1016F (5\u0026apos; -AGTGCTGCGTGACCAACAGATCYGWACTAATCGGAGAATG-3\u0026apos;) with Gly1016R (5\u0026prime;-GCGGGCAGGGCGGCGGGGGCGGGGCCAGCAAGGCTAAGAAAAGGTTAACTC-3\u0026rsquo;), and Albo1016F with Val1016R (5\u0026prime;-GCGGGCAGCAAGGCTAAGAAAAGGTTAATTA-3\u0026prime;) primers were applied, in parallel, using the HotStarTaq Master Mix Kit (QIAGEN, Hilden, Germany). Each reaction included 12.5 \u0026micro;l Master Mix, 2-2 \u0026micro;l 2 \u0026micro;M primers (F and R), 6.5 \u0026micro;l nuclease-free water and 1 \u0026micro;l template. The thermocycler conditions included an initial heat activation at 95\u0026nbsp;\u0026deg;C for 15 minutes followed by 40 cycles of denaturation step at 94 \u0026deg;C for 30 sec, an elongation step at 57 \u0026deg;C for 30 sec, an extension step at 72 \u0026deg;C for 1 minute, and a final extension at 10 minutes at 72 \u0026deg;C. After the PCR, the amplicons were separated by electrophoresis on 4% agarose gel,\u0026nbsp;allowing the visualization and determination of the genotype similar to the case of genotyping \u003cem\u003eCx. pipiens\u003c/em\u003e.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eOverall, 302 \u003cem\u003eCx. pipiens\u003c/em\u003e mosquito specimens were analysed for the presence of the point mutation L1014F responsible for pyrethroid resistance. The mutation, i.e. resistance alleles were detected in all the 5 counties involved in the study at a frequency ranging from 18.1% to 36.3%, with the highest frequency in the population originating from Pest county. The overall (all study sites/mosquito samples) frequency of resistance allele was recorded at 30.4% (Table 2). Resistance alleles were identified in homozygosity (24 out of the 302 investigated specimens) and in heterozygosity with the susceptible allele as well (136 out of the 302 investigated specimens), resulting 53% of the investigated \u003cem\u003eCx. pipiens\u003c/em\u003e mosquito individuals were resistant to pyrethroids. Although we were able to analyse a different number of specimens in each county, the homozygous susceptible genotype (L/L) was most dominant (\u0026gt;45%), except in Baranya county where heterozygous genotype (L/F) showed the highest prevalence (52% of the investigated specimens) (Table 2).\u003c/p\u003e\n\u003cp\u003eIn the case of \u003cem\u003eAe. albopictus\u003c/em\u003e, a total of 120 mosquito specimens were involved in the analysis for the presence of V1016G kdr mutation, responsible for pyrethroid resistance. Based on the genotyping, we detected exclusively the susceptible allele, i.e. all the individuals (n = 20 from Pest, n = 50 from Baranya, n = 50 from Somogy counties) showed a homozygous susceptible (SS) genotype, the resistance allele was not present in the investigated populations.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the field of pyrethroid resistance research, extensive studies have been conducted globally, particularly in regions where mosquito-borne diseases are endemic and mainly in mosquito species that serve as potential vectors. In Africa and Asia, significant resistance has been documented in \u003cem\u003eAnopheles\u003c/em\u003e and \u003cem\u003eAedes\u003c/em\u003e species, posing challenges for malaria and dengue control programs [\u003cspan additionalcitationids=\"CR38 CR39 CR40\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In Europe, studies have primarily focused on \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e species, and typically involve the detection of kdr mutations, which are known to confer resistance to pyrethroids. Although, resistance has been reported in several countries in the last decades, there is still limited data available from the continent, especially from regions where chemical mosquito control is still dominant.\u003c/p\u003e \u003cp\u003eHere we report the first research on pyrethroid resistance in mosquito populations from Hungary. Based on PCR-genotyping, we detected the presence of the L1014F mutation in all the investigated field populations of \u003cem\u003eCx. pipiens\u003c/em\u003e, showing over 50% resistance to pyrethroids. Considering Hungary's mosquito control strategy, where chemical treatments (using deltamethrin) are applied in approximately 90% of the controlled areas [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], this extensive use of insecticides could have contributed significantly to the development and spread of resistance within the populations of \u003cem\u003eCx. pipiens\u003c/em\u003e. The high reliance on chemical methods (extensive and frequent use of deltamethrin) increased selection pressure, leading to the widespread presence of resistant individuals. Similar results have been found in other European countries, including Italy, Spain, Belgium, Greece, Slovakia, and Romania. \u003cem\u003eCulex pipiens\u003c/em\u003e mosquitoes carry the resistant allele for pyrethroids with a high frequency (both in homozygous genotype and heterozygosity with the susceptible allele) [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Also, the species show phenotypic resistance to deltamethrin based on the WHO bottle assay, a standard operating procedure for testing insecticide susceptibility of adult mosquitoes [\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the case of \u003cem\u003eAe. albopictus\u003c/em\u003e, studies on insecticide resistance have primarily focused on countries where the species has become well-established and have shown varying levels of resistance across different regions. For instance, significant pyrethroids resistance has been observed in \u003cem\u003eAe. albopictus\u003c/em\u003e populations in Italy, particularly in urban areas with frequent insecticide use [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. In Spain, varying levels of susceptibility have been detected across different regions, as demonstrated by WHO bottle assays and biochemical tests [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Furthermore, the study by Pichler et al. also suggests that pyrethroid resistance is emerging across Europe, including France, Switzerland, Romania, Bulgaria, and Turkey, as evidenced by the geographic distribution of the V1016G kdr mutation in European \u003cem\u003eAe. albopictus\u003c/em\u003e populations [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBased on our analysis, the genetic allele responsible for resistance was not present in the Hungarian \u003cem\u003eAe. albopictus\u003c/em\u003e populations. Although the invasive species emerged in Europe more than 30 years ago and has been distributed across the continent since then [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], it has been recently introduced to Hungary, first recorded in 2014 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The origin of its introduction into the country and its genetic relationship with other European populations has not yet been uncovered, but during this relatively short period, it has had limited exposure to chemical insecticides in the frame of the mosquito control program. It is possible that the local population has not yet encountered the intense selection pressure required to drive the development of resistant traits. As a result, these populations may still be largely susceptible to pyrethroids. However, this also means that if chemical control is not carefully managed, there is a risk that resistance could rapidly develop as the population is exposed to insecticides, such as in the case of \u003cem\u003eCx. pipiens\u003c/em\u003e. Therefore, these findings serve as a wake-up call for mosquito surveillance programs, underscoring the importance of including pyrethroid resistance monitoring in their activities [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMoreover, our results indicate an urgent need for a change of concept in mosquito control strategy in Hungary. There is no countrywide surveillance of mosquitoes or vector-borne diseases, and the current national mosquito control program focuses on the rapid decrease of mosquito populations, dominantly by chemical adulticide treatments. The IVM concept, mentioned before, along with limited (restricted) use of chemical control according to the EU standards, is crucial to prevent the emergence of resistance in \u003cem\u003eAe. albopictus\u003c/em\u003e populations in Hungary, and to decrease the public health risk of vector-borne diseases like WNV. Even if the use of deltamethrin is halted soon, the kdr mutation will not disappear from the resistant \u003cem\u003eCx. pipiens\u003c/em\u003e populations probably for decades [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Therefore, it is crucial to act as soon as possible.\u003c/p\u003e \u003cp\u003eOur present study may be an important initial step towards sustainable mosquito control in Hungary, provided that our results reach and are effectively implemented by decision-makers. However, it is essential to continue these efforts with regular monitoring of pyrethroid resistance patterns in \u003cem\u003eAe. albopictus\u003c/em\u003e populations, as well as to get a whole picture of the situation in the country. Given that public awareness and community engagement are crucial elements of an effective strategy, it is important to educate the public about the importance of participating locally in mosquito control efforts, particularly by eliminating artificial breeding sites in private gardens. In Hungary, chemical control is often considered the most effective option by society due to its long-established use and the lack of information. Therefore, public education is vital to introduce and promote alternative, sustainable solutions as viable options.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur study on pyrethroid resistance in \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e mosquitoes are gap-filling research in Hungary and a major step toward more sustainable vector control. We revealed the presence of the kdr mutation responsible for pyrethroid resistance in \u003cem\u003eCx. pipiens\u003c/em\u003e mosquitoes, highlighting the consequences of the unilateral and long-term use of chemical treatments on native mosquito fauna. Moreover, this indicates an urgent need for a change of concept in the control strategy in countries where mosquito control still relies dominantly on chemical treatments. The moderate use of chemical control is highly recommended to prevent the development of pyrethroid resistance in recently established populations of the invasive \u003cem\u003eAe. albopictus\u003c/em\u003e, which has already shown responsible kdr mutation in several European countries. The most severe consequence of emerging resistance is that in the event of a vector-borne disease epidemic, chemical treatments - the only tool available to us to rapidly eliminate vectors - would become ineffective against resistant mosquito populations. Hence, these findings serve as a wake-up call for mosquito surveillance programs to address and incorporate resistance monitoring into their strategies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u0026nbsp;\u003c/strong\u003eWe would acknowledge the\u0026nbsp;Biological and Sportbiological Doctoral School of the University of P\u0026eacute;cs, Hungary for providing research opportunities for ZsV and DP during their PhD studies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe work was supported by the National Research, Development and Innovation Office, grant numbers FK-138563,\u0026nbsp;K-135841, PD-135143 and by RRF-2.3.1-21-2022-00010 \u0026ldquo;National Laboratory of Virology\u0026rdquo;. Open access funding provided by the University of P\u0026eacute;cs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u003c/strong\u003e All data presented in this paper are available in the Supplementary information: Additional file 1: Dataset S1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions:\u003c/strong\u003e RCS: investigations, collection of mosquito samples and species identification, laboratory processes, writing the original draft, visualization. ZsV: collection of mosquito samples and laboratory processes. DP and BS: laboratory processes. ZS: collection of mosquito samples and species identification. KB: review and editing the manuscript. BZ and GK: conceptualization and review the manuscript. KK: conceptualization, supervision of the investigations, editing the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e All the authors consent the publication of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e The authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control. Mosquito-borne diseases: An emerging threat. 2024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ecdc.europa.eu/en/publications-data/mosquito-borne-diseases-emerging-threat\u003c/span\u003e\u003cspan address=\"https://www.ecdc.europa.eu/en/publications-data/mosquito-borne-diseases-emerging-threat\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 14 June 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. Vector-borne diseases. 2020. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/news-room/fact-sheets/detail/vector-borne-diseases\u003c/span\u003e\u003cspan address=\"https://www.who.int/news-room/fact-sheets/detail/vector-borne-diseases\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 2 May 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. Integrated vector Management. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/westernpacific/activities/integrating-vector-management\u003c/span\u003e\u003cspan address=\"https://www.who.int/westernpacific/activities/integrating-vector-management\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCenters for Disease Control and Prevention. Guidelines for West Nile virus surveillance and control. 2024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.cdc.gov/west-nile-virus/php/surveillance-and-control-guidelines/index.html\u003c/span\u003e\u003cspan address=\"https://www.cdc.gov/west-nile-virus/php/surveillance-and-control-guidelines/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 18 July 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDusfour I, Chaney SC. Mosquito control: Success, failure and expectations in the context of arbovirus expansion and emergence. In: Hall M, Tamir D, editors. Mosquitopia: The Place of Pests in a Healthy World. New York: Routledge; 2022. Chapter 14. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4324/9781003056034-19\u003c/span\u003e\u003cspan address=\"10.4324/9781003056034-19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorcellas C, Andreu A, M\u0026aacute;\u0026ntilde;ez M, Sergio F, Hiraldo F, Eljarrat E, Barcel\u0026oacute; D. Pyrethroid insecticides in wild bird eggs from a World Heritage Listed Park: A case study in Do\u0026ntilde;ana National Park (Spain). Environ Pollut. 2017;228:321\u0026ndash;330. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envpol.2017.05.035\u003c/span\u003e\u003cspan address=\"10.1016/j.envpol.2017.05.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2017 May 25. PMID: 28551562.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbeyasuriya KGTN, Nugapola NWNP, Perera MDB. et al. Effect of dengue mosquito control insecticide thermal fogging on non-target insects. Int J Trop Insect Sci. 2017;37:11\u0026ndash;18. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/S1742758416000254\u003c/span\u003e\u003cspan address=\"10.1017/S1742758416000254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoprucu K, Aydin R. The toxic effects of pyrethroid deltamethrin on the common carp (\u003cem\u003eCyprinus carpio L\u003c/em\u003e.) embryos and larvae. Pestic Biochem Physiol. 2004;80(1):47\u0026ndash;53. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pestbp.2004.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2004.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaguire RJ. Aquatic environmental fate of deltamethrin. Water Sci Technol. 1992;25(11):99\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson M, Luukinen B, Buhl K, Stone D. Deltamethrin general fact sheet: National pesticide information center, Oregon State University Extension Services. 2010; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://npic.orst.edu/factsheets/DeltaGen.html\u003c/span\u003e\u003cspan address=\"http://npic.orst.edu/factsheets/DeltaGen.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT\u0026ouml;r\u0026ouml;k E, Hochkirch A, Solt\u0026eacute;sz Z, Tscharntke T, Bat\u0026aacute;ry P. Unmeasured side effects of mosquito control on biodiversity. Eur J Ecol. 2020;6(1):71\u0026ndash;76. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.17161/eurojecol.v6i1.13855\u003c/span\u003e\u003cspan address=\"10.17161/eurojecol.v6i1.13855\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRinkevich FD, Du Y, Dong K. Diversity and convergence of sodium channel mutations involved in resistance to pyrethroids. Pestic Biochem Physiol. 2013;106(3):93\u0026ndash;100. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pestbp.2013.02.007\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2013.02.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu N. Insecticide resistance in mosquitoes: impact, mechanisms, and research directions. Annu Rev Entomol. 2015;60:537\u0026ndash;59. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev-ento-010814-020828\u003c/span\u003e\u003cspan address=\"10.1146/annurev-ento-010814-020828\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Commission. EU countries should use pesticides more sustainably. 2017; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ec.europa.eu/commission/presscorner/detail/en/IP_17_3750\u003c/span\u003e\u003cspan address=\"https://ec.europa.eu/commission/presscorner/detail/en/IP_17_3750\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e Accessed 10 October 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control. Vector control with a focus on \u003cem\u003eAedes aegypti\u003c/em\u003e and \u003cem\u003eAedes albopictus\u003c/em\u003e mosquitoes: literature review and analysis of information. Stockholm: ECDC; 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control. Vector control practices and strategies against West Nile virus. Stockholm: ECDC; 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control. West Nile virus risk assessment tool Stockholm: ECDC; 2013.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJansen S, Heitmann A, Uusitalo R, Korhonen EM, L\u0026uuml;hken R, Kliemke K, Lange U, Helms M, Kirjalainen L, Nyk\u0026auml;nen R, et al. Vector competence of Northern European \u003cem\u003eCulex pipiens\u003c/em\u003e Biotype \u003cem\u003epipiens\u003c/em\u003e and \u003cem\u003eCulex torrentium\u003c/em\u003e to West Nile Virus and Sindbis Virus. Viruses. 2023;15(3):592. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v15030592\u003c/span\u003e\u003cspan address=\"10.3390/v15030592\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurell MJ. Members of the \u003cem\u003eCulex pipiens\u003c/em\u003e complex as vectors of viruses. J Am Mosq Control Assoc. 2012;28(4 Suppl):123\u0026ndash;126. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2987/8756-971X-28.4.123\u003c/span\u003e\u003cspan address=\"10.2987/8756-971X-28.4.123\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTalavera S, Birnberg L, Nu\u0026ntilde;ez AI et al. Culex flavivirus infection in a \u003cem\u003eCulex pipiens\u003c/em\u003e mosquito colony and its effects on vector competence for Rift Valley fever phlebovirus. Parasites Vectors. 2018;11:310. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-018-2887-4\u003c/span\u003e\u003cspan address=\"10.1186/s13071-018-2887-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrambrich J, Bole-Feysot E, H\u0026ouml;ller P, Lundkvist A, Hesson JC. Vector competence of Swedish \u003cem\u003eCulex pipiens\u003c/em\u003e mosquitoes for Usutu virus. One Health. 2024;18:100707. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.onehlt.2024.100707\u003c/span\u003e\u003cspan address=\"10.1016/j.onehlt.2024.100707\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzentp\u0026aacute;li-Gavall\u0026eacute;r K, Antal L, T\u0026oacute;th M, Kemenesi G, Solt\u0026eacute;sz Z, D\u0026aacute;n A, et al. Monitoring of West Nile virus in mosquitoes between 2011\u0026ndash;2012 in Hungary. Vector Borne Zoonotic Dis. 2014;14(9):648\u0026ndash;55. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/vbz.2013.1549\u003c/span\u003e\u003cspan address=\"10.1089/vbz.2013.1549\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZana B, Erd\u0026eacute;lyi K, Nagy A, Mezei E, Nagy O, Tak\u0026aacute;cs M, et al. Multi-approach investigation regarding the West Nile virus situation in Hungary, 2018. Viruses. 2020;12(1):123. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v12010123\u003c/span\u003e\u003cspan address=\"10.3390/v12010123\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control. West Nile virus - distribution of human and animal infections, 2023. 2024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ecdc.europa.eu/en/publications-data/west-nile-virus-distribution-human-and-animal-infections-2023\u003c/span\u003e\u003cspan address=\"https://www.ecdc.europa.eu/en/publications-data/west-nile-virus-distribution-human-and-animal-infections-2023\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 20 Feb 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGloria-Soria A, Payne AF, Bialosuknia SM, et al. Vector competence of \u003cem\u003eAedes albopictus\u003c/em\u003e populations from the northeastern United States for Chikungunya, Dengue, and Zika Viruses. Am J Trop Med Hyg. 2020;104(3):1123\u0026ndash;1130. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.20-0874\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.20-0874\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaffner F, Mathis A. Dengue and dengue vectors in the WHO European region: past, present, and scenarios for the future. Lancet Infect Dis 2014;14:1271\u0026ndash;1280. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1473-3099(14)70834-5\u003c/span\u003e\u003cspan address=\"10.1016/S1473-3099(14)70834-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZatta M, Brichler S, Vindrios W, Melica G, Gallien S. Autochthonous Dengue outbreak, Paris region, France, September-October 2023. Emerg Infect Dis. 2023;29(12):2538\u0026ndash;2540. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2912.231472\u003c/span\u003e\u003cspan address=\"10.3201/eid2912.231472\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control. Communicable disease threats report. 2023; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ecdc.europa.eu/sites/default/files/documents/communicable-disease-threats-report-week-50-2023\u003c/span\u003e\u003cspan address=\"https://www.ecdc.europa.eu/sites/default/files/documents/communicable-disease-threats-report-week-50-2023\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.pdf Accessed 16 Dec 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCochet A, Calba C, Jourdain F, Grard G, Durand GA, Guinard AIT, No\u0026euml;l H, Paty MC, Franke F. Autochthonous dengue in mainland France, 2022: geographical extension and incidence increase. Euro Surveill. 2022;27(44):pii\u0026thinsp;=\u0026thinsp;2200818. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2807/1560-7917.ES.2022.27.44.2200818\u003c/span\u003e\u003cspan address=\"10.2807/1560-7917.ES.2022.27.44.2200818\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMosquito Monitor [Sz\u0026uacute;nyogmonitor in Hungarian]. Asian tiger mosquito. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://szunyogmonitor.hu/index.php/albopictus-english/\u003c/span\u003e\u003cspan address=\"https://szunyogmonitor.hu/index.php/albopictus-english/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinistry of Interior Hungary, National Disaster Management Directorate [Bel\u0026uuml;gyminiszt\u0026eacute;rium Orsz\u0026aacute;gos Katasztr\u0026oacute;fav\u0026eacute;delmi Főigazgat\u0026oacute;s\u0026aacute;g - Sz\u0026uacute;nyoggy\u0026eacute;r\u0026iacute;t\u0026eacute;s in Hungarian]. Mosquito control in Hungary. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.katasztrofavedelem.hu/37838/heti-programok\u003c/span\u003e\u003cspan address=\"https://www.katasztrofavedelem.hu/37838/heti-programok\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT\u0026oacute;th S. Cs\u0026iacute;pősz\u0026uacute;nyog hat\u0026aacute;roz\u0026oacute; II. (Im\u0026aacute;g\u0026oacute;k). Keszthely; 2008. (Pann\u0026oacute;nia f\u0026uuml;zetek: 2.).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBecker N, Petrić D, Zgomba M, Boase C, Madon MB, Dahl C, et al. Mosquitoes - Identification, Ecology and Control. 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control \u0026amp; EFSA. Guidelines for the surveillance of invasive mosquitoes in Europe. ECDC Technical Report. 2012; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2900/61134\u003c/span\u003e\u003cspan address=\"10.2900/61134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Torres D, Chevillon C, Brun-Barale A, Berg\u0026eacute; JB, Pasteur N, Pauron D. Voltage-dependent Na\u0026thinsp;+\u0026thinsp;channels in pyrethroid-resistant \u003cem\u003eCulex pipiens\u003c/em\u003e L mosquitoes. Pesticide Science, 1999;55,1012\u0026ndash;1020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePichler V, Mancini E, Micocci M, et al. A novel allele specific polymerase chain reaction (AS-PCR) assay to detect the V1016G knockdown resistance mutation confirms its widespread presence in \u003cem\u003eAedes albopictus\u003c/em\u003e populations from Italy. Insects. 2021;12(1):79. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/insects12010079\u003c/span\u003e\u003cspan address=\"10.3390/insects12010079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWanjala CL, Mbugi JP, Ototo E, et al. Pyrethroid and DDT resistance and organophosphate susceptibility among \u003cem\u003eAnopheles spp\u003c/em\u003e. mosquitoes, Western Kenya. Emerg Infect Dis. 2015;21(12):2178\u0026ndash;2181. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2112.150814\u003c/span\u003e\u003cspan address=\"10.3201/eid2112.150814\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarson J, Erriah B, Herodotou S, et al. Overcoming insecticide resistance in \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes by using faster-acting solid forms of deltamethrin. Malar J. 2023;22(1):129. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12936-023-04554-x\u003c/span\u003e\u003cspan address=\"10.1186/s12936-023-04554-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTo\u0026eacute; KH, Jones CM, N\u0026rsquo;Fale S, Ismail HM, Dabir\u0026eacute; RK, Ranson H. Increased pyrethroid resistance in malaria vectors and decreased bed net effectiveness, Burkina Faso. Emerg Infect Dis. 2014; 20(10):1691\u0026ndash;1696. doi:10.3201%2Feid2010.140619.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmelia-Yap ZH, Chen CD, Sofian-Azirun M et al. Pyrethroid resistance in the dengue vector \u003cem\u003eAedes aegypti\u003c/em\u003e in Southeast Asia: present situation and prospects for management. Parasites Vectors. 2018;11:332. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-018-2899-0\u003c/span\u003e\u003cspan address=\"10.1186/s13071-018-2899-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassan MR, Azit NA, Fadzil SM, Ghani SRA, Ahmad N, Nawi AM. Insecticide resistance of Dengue vectors in South East Asia: a systematic review. Afr Health Sci. 2021;21(3):1124\u0026ndash;1140. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4314/AHS.V21I3.21\u003c/span\u003e\u003cspan address=\"10.4314/AHS.V21I3.21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStancu IG, Prioteasa FL, Tiron GV, et al. Distribution of insecticide resistance genetic markers in the West Nile Virus vector \u003cem\u003eCulex pipiens\u003c/em\u003e from South-Eastern Romania. Insects. 2022;13(11):1062. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/insects13111062\u003c/span\u003e\u003cspan address=\"10.3390/insects13111062\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePichler V, Giammarioli C, Bellini R, et al. First evidence of pyrethroid resistance in Italian populations of West Nile virus vector \u003cem\u003eCulex pipiens\u003c/em\u003e. Med Vet Entomol. 2022;36(3):390\u0026ndash;395. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/mve.12573\u003c/span\u003e\u003cspan address=\"10.1111/mve.12573\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaskin BG, Dogaroglu T, Kilic S, Dogac E, Taskin V. Seasonal dynamics of insecticide resistance, multiple resistance, and morphometric variation in field populations of \u003cem\u003eCulex pipiens\u003c/em\u003e. Pestic Biochem Physiol. 2016;129:14\u0026ndash;27. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pestbp.2015.10.012\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2015.10.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIľko I, Peterkov\u0026aacute; V, Heregov\u0026aacute; M, Strelkov\u0026aacute; L, Preinerov\u0026aacute; K, Derka T, et al. The study on biocidal resistance of mosquitoes of genus \u003cem\u003eCulex\u003c/em\u003e and \u003cem\u003eAedes\u003c/em\u003e to commonly used biocides cypermethrin and deltamethrin in Central Europe. Biologia. 2023;78:2727\u0026ndash;2736. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11756-023-01392-9\u003c/span\u003e\u003cspan address=\"10.1007/s11756-023-01392-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVereecken S, Vanslembrouck A, Kramer IM, et al. Phenotypic insecticide resistance status of the \u003cem\u003eCulex pipiens\u003c/em\u003e complex: a European perspective. Parasites Vectors. 2022;15:423. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-022-05542-x\u003c/span\u003e\u003cspan address=\"10.1186/s13071-022-05542-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaaijmans K, Brustollin M, Aranda C, Eritja R, Talavera S, Pag\u0026egrave;s N, et al. Phenotypic insecticide resistance in arbovirus mosquito vectors in Catalonia and its capital Barcelona (Spain). PLoS ONE. 2019;14(7):e0217860. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0217860\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0217860\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePichler V, Malandruccolo C, Serini P, Bellini R, Severini F, Toma L, Di Luca M, Montarsi F, Ballardini M, Manica M, Petrarca V, Vontas J, Kasai S, della Torre A, Caputo B. Phenotypic and genotypic pyrethroid resistance of \u003cem\u003eAedes albopictus\u003c/em\u003e, with focus on the 2017 chikungunya outbreak in Italy. Pest Management Science. 2019;75(10):2642\u0026ndash;2651. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/PS.5369\u003c/span\u003e\u003cspan address=\"10.1002/PS.5369\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBengoa M, Eritja R, Delacour S, Miranda M\u0026Aacute;, Sureda A, Lucientes J. First data on resistance to pyrethroids in wild populations of \u003cem\u003eAedes albopictus\u003c/em\u003e from Spain. J Am Mosq Control Assoc. 2017;33(3):246\u0026ndash;249. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2987/17-6636R.1\u003c/span\u003e\u003cspan address=\"10.2987/17-6636R.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePichler V, Caputo B, Valadas V, et al. Geographic distribution of the V1016G knockdown resistance mutation in \u003cem\u003eAedes albopictus\u003c/em\u003e: a warning bell for Europe. Parasites Vectors. 2022;15:280. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-022-05407-3\u003c/span\u003e\u003cspan address=\"10.1186/s13071-022-05407-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEuropean Centre for Disease Prevention and Control and European Food Safety Authority. Mosquito maps. Stockholm: ECDC. 2024; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ecdc.europa.eu/en/disease-vectors/surveillance-and-disease-data/mosquito-maps\u003c/span\u003e\u003cspan address=\"https://ecdc.europa.eu/en/disease-vectors/surveillance-and-disease-data/mosquito-maps\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacoris ML, Martins AJ, Andrighetti MTM, Lima JBP, Valle D. Pyrethroid resistance persists after ten years without usage against \u003cem\u003eAedes aegypti\u003c/em\u003e in governmental campaigns: lessons from S\u0026atilde;o Paulo State, Brazil. PLoS Negl Trop Dis. 2018;12(3):e0006390. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pntd.0006390\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0006390\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003eNumber of \u003cem\u003eCulex pipiens\u003c/em\u003e and \u003cem\u003eAedes albopictus\u003c/em\u003e mosquito specimens involved in the analysis, originating from different counties of Hungary and collected in different years.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"671\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 123px;\"\u003e\n \u003cp\u003eCounty\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 142px;\"\u003e\n \u003cp\u003eSampling sites number on the Map (see Fig. 1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" style=\"width: 321px;\"\u003e\n \u003cp\u003eNo of investigated mosquito individuals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 85px;\"\u003e\n \u003cp\u003eTotal (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" style=\"width: 321px;\"\u003e\n \u003cp\u003e(Sampling year / Mosquito species)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 87px;\"\u003e\n \u003cp\u003e2021\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eGyőr-Moson-Sopron\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\n \u003cp\u003e(1, 2, 3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 123px;\"\u003e\n \u003cp\u003ePest\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 142px;\"\u003e\n \u003cp\u003e(4, 5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eHajd\u0026uacute;-Bihar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\n \u003cp\u003e(6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 123px;\"\u003e\n \u003cp\u003eBaranya\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 142px;\"\u003e\n \u003cp\u003e(7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e124\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 123px;\"\u003e\n \u003cp\u003eSomogy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 142px;\"\u003e\n \u003cp\u003e(8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 123px;\"\u003e\n \u003cp\u003eTotal (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e206\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e302\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 142px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 73px;\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003eGenotype and allele frequencies of the L1014F kdr mutation in \u003cem\u003eCulex pipiens\u003c/em\u003e populations from Hungary. (RR: the number of mosquitoes representing homozygous for the resistant mutation, SR: the number of heterozygous mosquitoes holding both susceptible and resistant alleles, SS: the number of mosquitoes representing homozygous for the susceptible allele, %R alleles: frequency of the resistant allele in the investigated populations, evaluated according to the Hardy-Weinberg equilibrium.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"671\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eCounty\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003eNo of investigated mosquito individuals\u0026nbsp;(n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003eRR (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003eSR (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003eSS (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e%R alleles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eGyőr-Moson-Sopron\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e30.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003ePest\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e36.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eHajd\u0026uacute;-Bihar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e20.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eBaranya\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003e124\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e34.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eSomogy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e18.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 162px;\"\u003e\n \u003cp\u003e302\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 161px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e136\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67px;\"\u003e\n \u003cp\u003e142\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e30.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Asian tiger mosquito, common house mosquito, AIM, IVM, deltamethrin, West Nile virus, Dengue, genotyping","lastPublishedDoi":"10.21203/rs.3.rs-5062656/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5062656/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMosquitoes, as vectors of various pathogens, have been a public health risk for centuries. Human activities such as international travel and trade, along with climate change, have facilitated the spread of invasive mosquitoes and novel pathogens across Europe, increasing the risk of mosquito-borne disease introduction and spread. Despite this threat, mosquito control in Hungary still relies predominantly on chemical treatments, which poses the risk of developing insecticide resistance in local populations. While pyrethroid resistance has been documented in several countries, there is no information on this issue from Hungary. This study aims to investigate the presence of resistance in Hungarian mosquito populations by analysing a native, already-known disease vector and a recently established invasive species with public health significance.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe assessed the presence of kdr mutations L1014F and V1016G in \u003cem\u003eCulex pipiens\u003c/em\u003e and \u003cem\u003eAedes albopictus\u003c/em\u003e mosquitoes, respectively, responsible for pyrethroid resistance. Mosquito specimens were investigated retrospectively, i.e. collected from previous years within the framework of local monitoring programs run in urban areas representing five regions of Hungary. The mutations in mosquitoes were detected individually by allele-specific PCR and gel electrophoresis, following generally used protocols.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn \u003cem\u003eCx. pipiens\u003c/em\u003e, the kdr mutation was detected across all five collection sites, with resistance allele frequencies ranging from 18.1\u0026ndash;36.3%. Resistance alleles were identified in homozygosity and in heterozygosity with the susceptible allele as well, resulting in 53% of the investigated mosquitoes showing resistance to pyrethroids in the Hungarian populations. In contrast, for \u003cem\u003eAe. albopictus\u003c/em\u003e, all the analysed individuals were found to carry only the susceptible alleles, indicating a homozygous susceptible genotype across all the investigated populations.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur work highlights the consequences of the unilateral and long-term use of chemical treatments on mosquitoes. This indicates an urgent need for a change of concept in mosquito control strategy in Hungary, as well as in countries where mosquito control still relies dominantly on insecticides. The restricted use of chemical treatment is highly recommended to prevent the development of pyrethroid resistance in recently established populations of the invasive \u003cem\u003eAe. albopictus\u003c/em\u003e, and to decrease the public health risk of vector-borne diseases.\u003c/p\u003e","manuscriptTitle":"Consequences of insecticide overuse in Hungary: assessment of pyrethroid resistance in Culex pipiens and Aedes albopictus mosquitoes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-05 09:47:26","doi":"10.21203/rs.3.rs-5062656/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-16T20:48:04+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-12T16:31:49+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-09T01:09:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"330700952646348096927127907592687597666","date":"2024-10-03T09:32:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"11330941940410149162849722559697770334","date":"2024-10-02T01:06:33+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-30T00:56:38+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-12T01:51:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-11T14:39:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2024-09-10T07:35:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ce1b63d2-4e13-4839-ae14-652b29230832","owner":[],"postedDate":"December 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-20T16:00:30+00:00","versionOfRecord":{"articleIdentity":"rs-5062656","link":"https://doi.org/10.1186/s13071-024-06635-5","journal":{"identity":"parasites-and-vectors","isVorOnly":false,"title":"Parasites \u0026 Vectors"},"publishedOn":"2025-01-16 15:57:15","publishedOnDateReadable":"January 16th, 2025"},"versionCreatedAt":"2024-12-05 09:47:26","video":"","vorDoi":"10.1186/s13071-024-06635-5","vorDoiUrl":"https://doi.org/10.1186/s13071-024-06635-5","workflowStages":[]},"version":"v1","identity":"rs-5062656","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5062656","identity":"rs-5062656","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}