On site discrimination between two closely related commercial strains of Oyster mushroom using a loop-mediated isothermal amplification (LAMP) test

On site discrimination between two closely related commercial strains of Oyster mushroom using a loop-mediated isothermal amplification (LAMP) test | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article On site discrimination between two closely related commercial strains of Oyster mushroom using a loop-mediated isothermal amplification (LAMP) test Johan Baars, Viola Kurm, Bart Scholten, Yvonne Griekspoor, Brian Lavrijssen, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6294117/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Oct, 2025 Read the published version in Molecular Biology Reports → Version 1 posted 10 You are reading this latest preprint version Abstract This article describes the development of tools for the on-site identification of two closely related sporeless strains of Oyster mushroom, using either the LAMP technique or a modification of that technique. It allows for fast (within 30 minutes) identification of the commercially used strains SPOPPO and ALLERPO. Fast on-site answers on strain identity can be important when experiencing unexpected strain behavior or when strains are of suspect origin. Both strains are discriminated from sporulating strains by a LAMP reaction on the intact version of the msh4 gene; sporeless strains contain a msh4 gene with a large insert that renders the associated protein inactive. SPOPPO and ALLERPO are distinguished from each other by LAMP reactions that target genomic regions with strain specific recombinations. Oyster mushroom Pleurotus ostreatus LAMP Plant Breeder’s Rights Figures Figure 1 Figure 2 Introduction Oyster mushrooms ( Pleurotus species) are among the most widely cultivated mushrooms in the world, together with Lentinula edodes , Auricularia species, Agaricus bisporus and Flammulina species (Royse et al. 2017). In Europe, the main Pleurotus species that are being cultivated are King Oyster mushroom ( Pleurotus eryngii ) and Grey Oyster mushroom ( Pleurotus ostreatus ). Workers who are harvesting and handling the crop during the cultivation of Oyster mushrooms often develop respiratory problems. These are associated with the exposure to spores of Pleurotus spp. (Hausen et al. 1974; Olsen 1987; Elliot Horner et al. 1988). Under controlled laboratory conditions it has been shown that the inhalation of spores of P . ostreatus provokes the development of an extrinsic allergic alveolitis (Cox et al. 1988). Around the turn of the 20th century the Netherlands’ Ministry of Agriculture commissioned the development of a sporeless strain of Oyster mushroom to alleviate respiratory problems of workers in the cultivation of Oyster mushroom. This resulted in two sporeless varieties of P. ostreatus that are currently commercially available: SPOPPO and ALLERPO. Both the SPOPPO variety and the ALLERPO variety were developed in a breeding program based on crosses between a spontaneous sporeless P. ostreatus mutant, ATCC58937 (F42 x 11; (Eger et al. 1976)) and the commercial variety HK35. More detailed research has shown that the poMSH4 gene in the sporeless P . ostreatus was interrupted by a large DNA fragment containing a region encoding a CxC5/CxC6 cysteine cluster associated with Copia-type retrotransposons (Lavrijssen et al. 2020). A disruption of the same gene was shown to cause sporelessness in Pleurotus pulmonarius (Okuda et al. 2013). Many countries facilitate the protection of intellectual property rights on mushroom varieties that have been developed for horticultural purposes. Three systems can be discerned: plant breeders’ rights (PBR, also called plant variety protection or PVP) system, the Utility Patent, and (in the US) the Plant Patent (Jong 2012). The plant breeder’s right system is a dedicated system for plant and mushroom varieties based on the International Convention for the Protection of New Varieties of Plants. It is administered by the International Union for the Protection of New Varieties of Plants (UPOV), an intergovernmental organization with headquarters in Geneva (Switzerland). After having been granted plant breeder’s rights, the breeder has the exclusive rights to give licenses to others to multiply or use the variety and to charge a license fee on the multiplications or use of the variety for agricultural production (for a period of 20 or 25 years). A plant variety that is traded must be identified by its official name. This helps the owner to trace the use of its variety. The US has a similar type of protection for new varieties of non-tuberous, asexually propagated species, termed a “Plant Patent (PP)”. A Utility Patent is for inventions that are novel, inventive and industrially applicable ((Lukasiewicz et al. 2024). It may cover plant parts or a plant with an inserted gene rather than a variety containing the gene (Jong 2012). Currently there are 15 Plant Patents known for strains of edible mushrooms (Jong 2012; Smulders et al. 2021) and 27 US patents granted for new mushroom strains. Intellectual property rights of at least 45 varieties of P. ostreatus are protected (Supplementary file, Table 1 ). The varieties SPOPPO and ALLERPO are protected in the European Union, the United Kingdom and Israel by PBR and in the US by a Plant Patent. Table 1 Oyster mushroom strains used in this study. Strain Sporulation Commercial vendors SPOPPO No Sylvan Spawn (Langeais, France) ALLERPO No Amycel (Vendôme, France) ATCC58937 No No longer commercially available HK35 Yes Sylvan Spawn (Langeais) P24 Yes Italspawn (Onigo, Italy) P80 Yes Italspawn (Onigo, Italy) 3015 Yes Amycel (Vendôme, France) Table 2 Primer sequences targeting the msh4 insert, the ALLERPO specific AQU07 and the SPOPPO specific AQP58 and crRNA sequence. Primer Sequence 5’-3’ Target MSH4-F3 AAATCGGTCACTGTCGGA msh4 insertion MSH4-B3 ACTGGATTCAGTTGGTGTT msh4 insertion MSH4-FIP CTTTTTGAGTGCAAAAACAAACCCGGTGCACTCATTATCATTGTC msh4 insertion MSH4-BIP ACTTCCAAGTGGCTTTATCAATGCCACTTGTAGACGTGGTGA msh4 insertion MSH4-LoopB AGAGGAAGCTGTATATCTGGCAGT msh4 insertion AQU07-F3 AAGTTGGCACAGCCATGT AQU07 AQU07-B3 CCGTTCCTTCTCCACAACAT AQU07 AQU07-FIP GCACGGGTTCCTGGAGCAATGTACCTCTGCTTTCCCCCA AQU07 AQU07-BIP CGAGGTGGCAGTAGCCTTGCCAAGCGCCTCAATTTTGACA AQU07 AQU07-LoopB CCGGCATGAGTGGAAAGGCA AQU07 AQP58-F3 GGAAGGCCTTGAACACTGT AQP58 AQP58-B3 TCGGGATGGCCTACATTGA AQP58 AQP58-FIP CCAGGGCACGAGTGTATAGTCGGCCAGGACGTTTCGCTTC AQP58 AQP58-BIP CAACCTTACCGCGATCCGTCAACAGCCAGGCATCTGTCA AQP58 AQP58-LoopF GTAGCATTCCGGAGGGGT AQP58 AQP58-LoopB CTCTCAACAGCTAGTTCAGCG AQP58 crRNA AUUGCGACGCUAGUUCAGCGCUGGAAUAUGACAGAUGCCUGGCUGU Protection of the intellectual property (IP) rights on new crop varieties are important as it allows the breeding company or entity that produced the variety to earn back (part of) the investment. For breeding programs that are not publicly funded, IP protection is generally considered to be indispensable (Smulders et al. 2021). Without protection of IP rights, hardly any new mushroom strains would enter the market, and as a result the industry would not develop as well as it potentially could or even diminish when existing strains no longer suffice contemporary needs . Infringement on the IP rights of mushrooms varieties is not uncommon. As fungi are vegetatively propagated it is very easy to make copies of varieties through tissue cultures. A well-known case within the mushroom industry is the infringement of the IP rights on strains from spawn company Amycel (Jong 2012; Anonymous 2020; Anonymous 2024). Also in case of P. ostreatus variety SPOPPO, cases of infringement of the IP rights have occurred. In order to combat infringement of the IP rights on SPOPPO and ALLERPO it is important to be able to readily recognize and discriminate the two strains in commercial practice. Both strains do not produce basidiospores and as such distinguish themselves from all other commercial strains currently on the market (with the exception of the ‘Purati’ that is also sporeless but has pronounced morphological differences). When seen side by side in the same growing room, the color difference between SPOPPO and ALLERPO is clear. However, when encountering one of the two strains by itself in a growing room, it is very difficult to determine the identity. We therefore looked for a molecular method that may be used in the field to differentiate the two strains. By basing the method both on DNA features close to the mutated gene and strain specific recombination sites, the test should also be useful to differentiate the two sporeless strains from all other strains. Loop-mediated isothermal amplification (LAMP) is a molecular technique (Notomi et al. 2000) that is frequently used for the detection of plant pathogens. It makes use of up to six primers and a Bst DNA polymerase with strand displacement activity for amplification of nucleic acids at an isothermal temperature. A large amount of amplicon is produced that can be visualized by either end-point detection using, for example, intercalating dyes or ion indicators or by real-time detection, generally with intercalating fluorescent dyes (Panno et al. 2020). Due to the number of primers LAMP is reported to be highly species-specific, allowing for the differentiation of various bacteria, fungal and viral pathogens (Tomlinson et al. 2010; Yasuhara-Bell et al. 2013; Qiao et al. 2020). In addition, combining LAMP pre-amplification with a CRISPR-detection step (Steens et al. 2021), allows for differentiation between targets on the basis of a single nucleotide polymorphism (SNP). Another advantage of LAMP is its potential for on-site detection, making it an ideal tool for distinguishing closely related organisms. The LAMP polymerase is less sensitive to inhibitors than commonly used PCR polymerases, and therefore crude, rapid extracts from various sources are often sufficient (Francois et al. 2011). In addition, isothermal amplification and result read-out can be performed with portable equipment (Notomi et al. 2015). Due to its specificity, speed of operation and on-site applicability LAMP has been used previously for distinguishing plant species and even cultivars. A LAMP assay with end-point detection has been developed for the specific identification of saffron ( Crocus sativus ) that enabled its distinction from commonly used plants used to adulterate saffron (Zhao et al. 2016). LAMP assays have been used to identify transgenic rice based on the junction sequences of the transgenic events (Chen et al. 2012). LAMP also makes it possible to distinguish strains of Cannabis sativus based on several single nucleotide polymorphisms (SNPs), indicating the high specificity of this technique (Kitamura et al. 2018). In addition, Kitamura and colleagues developed a simplified protocol for DNA extraction and amplicon visualization allowing for quick on-site detection. We are not aware of studies using LAMP for the discrimination of mushroom cultivars. Materials and methods Strains used For the development and validation of the LAMP assays for the varieties SPOPPO and ALLERPO, additionally the sporeless strain ATCC58937 and the sporulating varieties HK35, P24, P80 and 3015 were used (Table 1 ). To further test specificity of the method, the varieties P24, P80 and 3015 were included. The fungal cultures were stored in liquid nitrogen and revived when needed. Mycelium was grown on malt extract agar. Spawn was either obtained from Sylvan Spawn (Langeais, France) or was made from sorghum grains. Preparation of spawn and colonized substrate was performed as described by Lavrijssen and colleagues (Lavrijssen et al. 2020). Raw materials for preparing colonized substrate were kindly provided by VeMe Specials, Gemert, The Netherlands. The varieties SPOPPO and ALLERPO have been developed in a breeding program based on the strains HK35 and ATCC 58937 as starting material(Baars et al. 2000; Baars 2004). Strain ATCC 58937 donated the sporeless trait. Figure 1 depicts the genomic make-up of the three monokaryotic strains that were used to make the varieties SPOPPO (cross of AQP-58 and ASA-53) and ALLERPO (cross of AQU-07 and ASA-53). The specific locations of the recombinations discriminate between these two varieties. Since both SPOPPO and ALLERPO contain genomic material of ASA53, only recombinations in the genomes of AQU-07 and AQP-58 are available to differentiate between SPOPPO and ALLERPO. Monokaryotic strain AQP-58 only shows a recombination on linkage group 5 while AQU07 shows recombinations on chromosomes 2, 3, 4, 5, 10 and 11. Primer sequences All primers were designed using Primer Explorer v. 5. One primer set was designed on the left flank of the msh4-gene insert present in the sporeless strains, partly extending over the insert (Table 3 ). The primer set AQU07 was designed to target a sequence on the AQU07 chromosome 3 differing in a few SNPs from the corresponding sequence of AQP58. The primer set AQP58 was designed to target a sequence on the AQP58 chromosome 5 differing in a few SNPs from the corresponding sequence on AQU07. Both the AQU07 and AQP58 primer sets also target the corresponding sequence on HK35. Therefore, the MSH4 assay is also required for strain identification. Table 3 Overview of Time of positivity (Tpos) and melting temperature (Tm) of two LAMP and one LAMP-CC assay for the msh4-gene, ALLERPO and SPOPPO respectively on various types of sample; n.d.=not done, n.a. = not applicable.. With respect to the CRISPR-CAS AQP58 assay; due to the use of a fluorescent probe, this assay does not produce a melting curve. Experiment Strain Sample type Target msh4 insert AQU07 (ALLERPO specific) CRISPR-Cas AQP58 (SPOPPO specific) Tpos (min Tm (°C) Tpos (min Tm (°C) Tpos (min) Mycelium tests SPOPPO mycelium 18:30 84.8 - - 18:15–19:00 (duplicates) ALLERPO mycelium 18:00 84.9 20:15 89.6 - ATCC58937 mycelium 17:45 84.9 - - - HK35 mycelium - - 22:00 89.5 18:30 − 19:15 (duplicates) NC water - - - - - PC msh4 gBlock 16:15 84.9 n.d. n.d. n.d. NC AQU07 gBlock n.d. n.d. n.d. n.d. - PC AQP58 gBlock n.d. n.d. n.d. n.d. 15:45 Mushroom tests SPOPPO Mushroom 1 20:15 84.8 - - 18:30 SPOPPO Mushroom 2 20:30 89.4 - - 18:00 ALLERPO Mushroom 1 20:00 85.0 25:15 89.4 - ALLERPO Mushroom 2 19:45 85.0 25:30 89.4 - 3015 Amycel Mushroom - - 23:00 89.5 19:00 P24 Italspawn Mushroom - - 24:00 89.4 18:45 P80 Italspawn Mushroom - - - - 18:30 NC AQU07 gBlock n.d. n.d. n.d. n.d. - PC AQP58 gBlock n.d. n.d. n.d. n.d. 16.30 PC ALLERPO mycelium 19:45 84.9 25:45 89.5 n.d. PC HK35 mycelium - 66.7 26.15 89.5 n.d. PC SPOPPO mycelium n.d. n.d. - - n.d. NC water - - - - - Spawn tests SPOPPO Spawn; 2 kernels 24:00 84.6 - - 21:30 SPOPPO Spawn; 6 kernels 22.45 84.6 - - 20:30 SPOPPO Spawn; 10 kernels 22.00 84.6 - - 20:00 NC AQU07 gBlock n.d. n.d. n.d. n.d. - PC AQP58 gBlock n.d. n.d. n.d. n.d. 17:45 PC ALLERPO mycelium n.d. n.d. 22:30 89.5 n.d. PC SPOPPO mycelium 20:30 84.9 n.d. n.d. n.d. NC water - - - - - Substrate tests SPOPPO Substrate 18:30 84.7 - - 16:45 ALLERPO Substrate 18:45 84.7 20:45 89.5 - P80 Substrate - - - - 16:45 HK35 Substrate - - 21:30 89.4 18:15 PC SPOPPO mycelium n.d. n.d. n.d. n.d. 18:30 PC ALLERPO mycelium 24:00 84.8 22.45 89.5 n.d. NC water - - - - - The standard LAMP assay AQP58 was not sufficiently specific and was therefore used as a base for the design of a LAMP CRISPR-Cas assay. The addition of the CRISPR-Cas based read-out of the ScopeDx assay to the LAMP assay increases its specificity to enable required distinction between AQP58 and AQU07. A crRNA is designed which together with Cmr subunits forms a CRISPR-Cas complex to distinguish between the LAMP-amplicons of AQP58 and AQU07 (Table 3 ). Only when perfect complementarity between crRNA and AQP58 is present, the CRISPR-Cas complex is activated which sets off a signaling cascade that generates a fluorescent probe-based read-out. LAMP assay Primer mixes were prepared for the MSH4 and AQU07 primer sets consisting of 5 µM F3 and B3 primer, 20 µM FIP and BIP primers and 10 µM Loop primer. Each reaction mix contained 15 µl ISO-001 mix (OptiGene), 1 µl primer mix, 4 µl HyClone water (Cytiva) and 5 µl sample extract. The assays were performed at 65°C for 40 minutes followed by a melting curve at 98°C-65°C. The LAMP CRISPR-Cas method is based on a method developed by Steens et al. (2021) and further developed by Scope Bioscience to a one-pot assay. The reaction mix contained 15 µl master mix (Scope Biosciences) and 5 µl sample extract and the reaction was performed at 65°C for 40 minutes. Combinations of the three LAMP assays allow discrimination between SPOPPO and ALLERPO. A positive signal in both the MSH4 and AQU07 LAMP assays is indicative for ALLERPO. A positive signal in both the AQP58 (CRISPR-Cas method) and the MSH4 LAMP assay is indicative for SPOPPO. Sample extraction Mycelium extracts were made from oyster mushroom mycelium grown on agar petri dishes by scraping off a small amount of mycelium using a 1 µl inoculation loop and transferring it to a 1.5 ml Eppendorf tube with 100 µl PEG lysis buffer (OptiGene). The mycelium was crushed manually using a miniature pestle for 60 seconds. The samples were incubated for 20 minutes at 95°C and subsequently diluted 50 times in sample dilution buffer (OptiGene). Of these extracts 5 µl was used per LAMP reaction. In addition to mycelium, all LAMP assays were performed on mushroom caps, spawn and colonized substrate (wheat straw based). For colonized substrate the LAMP assays were performed on substrate colonized by either SPOPPO, ALLERPO, HK35, P24, P80 and 3015. Mushroom cap extracts were made using 125 mg mushroom tissue. The tissue was added to a 5 ml extraction tube containing 1ml PEG lysis buffer (OptiGene) with 40 w/v % Chelex 100 and a metal ball (Ø 11.1 mm). After shaking the tube by hand for 1 minute the samples were incubated for 20 minutes at room temperature and subsequently diluted 50 times in sample dilution buffer (OptiGene). Of these extracts 5 µl was used per LAMP reaction. Oyster mushroom strains are commercially available as millet grains covered with mycelium. Spawn extracts were made using 2, 6 or 10 kernels in a 5 ml extraction tube with 1 ml PEG lysis buffer (OptiGene), 40 w/v % Chelex 100 and a metal ball (Ø 11.1 mm). The tubes were shaken for 1 minute by hand followed by a 20-minute incubation at room temperature. Subsequently the extract was diluted 50 times with sample dilution buffer (OptiGene). Of these extracts 5 µl was used per LAMP reaction. In Europe, Oyster mushroom strains are mostly grown on a substrate of pasteurized wheat straw. For extraction from colonized substrate 1–2 straws of substrate partly covered in mycelium were placed in a 5 ml extraction tube with 1 ml PEG lysis buffer (OptiGene), 40 w/v % Chelex 100 and a metal ball (Ø 11.1 mm). After shaking the tube by hand for 1 minute and 5-minute incubation at room temperature the samples were diluted 50 times with sample dilution buffer (OptiGene). Of these extracts 5 µl was used per LAMP reaction. Specificity For assessing the specificity of the three assays, all were tested on mycelium extracts of the strains SPOPPO, ALLERPO, HK35 and ATCC58937. Results The three different LAMP assays were tested on a number of different sample types as they may appear in commercial practice. Specificity test on mycelium With the MSH4-assay, extract from SPOPPO, ALLERPO and ATCC58937 mycelium showed a positive reaction with a time of positivity of 17:45 − 18:30 minutes and a melting temperature of approximately 84.9°C (Table 3 , Fig. 2 ). There was no amplification with the HK35 extract. The AQU07 assay showed positive amplification with the ALLERPO mycelium extract and the HK35 mycelium extract, but not the SPOPPO and ATCC58937 mycelium extracts (Table 3 Supplemental Fig. 1). Time of positivity for the ALLERPO target was 20:15 min with a melting temperature of 89.6. °C. The LAMP-CRISPR-Cas AQP58 assay in turn amplified SPOPPO and HK35 mycelium, but not ALLERPO mycelium with an approximate time of positivity of 18:00–19:00 min (Table 3 , Supplemental Fig. 2). Due to the use of a fluorescent probe, this assay does not produce a melting curve. Test in a mushroom cap matrix With mushroom caps, following a simple DNA extraction, the MSH4-assay showed a positive reaction with the sporeless varieties SPOPPO and ALLERPO, but not with the sporulating varieties 3015 (Amycel) and P24 and P80 (Italspawn) (Table 3 ). SPOPPO and ALLERPO could be distinguished with the AQU07 and AQP58 assays specific for ALLERPO and SPOPPO respectively. The latter two assays also showed positive reactions with the sporulating varieties. Test in a spawn matrix The MSH4 and the AQP58 assay, but not the AQU07 assay were positive for all SPOPPO spawn samples (Table 3 , Supplemental Fig. 3–5). Two kernels of spawn were sufficient for a positive reaction within 24 minutes. Test in substrate The three LAMP assays specifically detected SPOPPO and ALLERPO in colonized wheat straw based substrate. The MSH4 assay showed positive amplification for ALLERPO- and SPOPPO-colonized substrate, but not for substrate colonized by P80 and HK35 (Table 3 , Supplemental Fig. 6–8). The AQU07 assay was positive with ALLERPO-colonized substrate (Supplemental Fig. 7) and the AQP58 assay was positive with SPOPPO-colonized substrate (Supplemental Fig. 8). Time of positivity for the different assays was between 16 and 21 minutes. Discussions and conclusions The unambiguous identification of mushroom varieties in an on-site setting is of high importance for the protection of IP rights. In many countries, infringement of PBR/PVP is punishable by law (Brahmi and Chaudhary 2011). On the one hand infringement of PBR/PVP is hard to prove as evidenced by the case of lettuce seed (Murakeözy 2021). On the other hand, one should be cautious not to falsely accuse people or organizations. Knowing, on the basis of on-site identification of strains, early on that infringement is a possibility, may help building a legal case. Such a method may also serve as a way for spawn companies to verify if growers have used their strains in case cultivation problems have risen that are accompanied by deviant mushroom morphology or even lack of mushrooms. Here we have developed three LAMP-(based) assays that together can identify the varieties SPOPPO and ALLERPO and distinguish them from all tested sporulating strains and the sporeless parent ATCC58937. The MSH4 LAMP assay targets the region of an insertion in the msh4 gene, which is responsible for the non-sporulating phenotype. Our MSH4 assay amplified varieties with this particular insertion with a high specificity. It is unlikely that new oyster mushroom varieties developed from other sporeless parents than ATCC58937 will contain the exact same insertion. Therefore, the MSH4 LAMP assay is expected to be suitable for the specific identification of SPOPPO and ALLERPO. Developing specific LAMPs to distinguish the two sporeless varieties SPOPPO and ALLERPO was more challenging since both share one parent haplotype (ASA-53) while the complementing differing parent haplotypes (AQU07 or AQP58) are closely related. Nevertheless, the developed AQU07 assay showed a positive reaction with ALLERPO, but not with SPOPPO. This specificity is likely based on several SNPs occurring in the primer binding region near the 3’ end of the FIP (F1c + F2) primer as the primers’ 3’ end is highly important for annealing and elongation (Shirshikov and Bespyatykh 2022). However, it was not possible to design a LAMP assay specific for AQP58 present in SPOPPO. Therefore, a LAMP-CRISPR-Cas assay (Steens et al. 2021)was needed to distinguish SPOPPO from ALLERPO with a positive reaction. Addition of the AQP58-specific CRISPR-Cas complex enabled binary distinction between SPOPPO and ALLERPO. This illustrates the added value of the CRISPR-Cas based detection when only minimal genetic differences exist without increasing detection time. Both assays showed amplification with the parent HK35 and other sporulating varieties. Therefore, the MSH4 assay is required in addition for specific identification. On-site applicability of assays for identity confirmation in cases of suspected IP infringements is crucial. Current techniques for strain identification include RAPD (Moore et al. 2001), SSR markers (Lee et al. 2018) and other PCR-based tests. These methods require laboratory equipment and trained personnel for DNA extraction and for conducting the respective tests. However, the transportation of samples from the breeder to the laboratory requires a chain of procedures to be followed to ensure that the samples are not compromised. In addition, in the time from sampling until obtaining the results material with potentially copied mushroom strains can be destroyed or removed. Therefore, a LAMP assay that can be performed on-site, and works with various matrices, is highly advantageous. Similarly, when problems in production are encountered, a rapid confirmation of strain identity is desirable. In this study we tested if the three developed assays can be used with three different matrices, namely mushroom fruiting bodies, spawn and colonized substrate. Spawn is typically produced with millet, sorghum or wheat grain, while substrate contains straw. These materials often contain inhibitors such as humic acids and polysaccharides. However, all three assays (MSH4, AQU07 and AQP58) showed amplification as expected in all three tested materials with no increase in time of positivity. Thus, a simple extraction procedure was sufficient for strain identification in all substrates. Therefore, the LAMP assays are suitable for on-site application. In addition, we demonstrated that already two kernels of spawn or one piece of colonized straw substrate is sufficient for a positive reaction. Still, a few challenges remain for the use of LAMP in general and the assays developed here specifically. While performing a LAMP assay is relatively simple compared to other molecular techniques, it still requires basic laboratory skills such as pipetting and consumables, such as primers, enzymes and specific tubes that are relatively costly. In addition, the read-out method in the case of this study relies on real-time fluorescence detection, for which a (portable) device such as a Genie III (OptiGene) is needed. Alternative read-out methods include end-point read-outs relying on a color change or an increase in turbidity, which do not require a read-out device. However, these methods do not allow for assessing the melting temperature and therefore can lead to false positives. In addition, there is of yet no alternative read-out method for the LAMP-CRISPR-Cas assay, which relies on a fluorophore signal. Currently, smaller and more cost-efficient devices have been developed, for instance the Genie-Lite system from Optigene ( https://www.optigene.co.uk/instruments/genie-lite/ ). However, these remain to be implemented in practice. Declarations B.S. and J.A.S. are founders and shareholders of Scope Biosciences B.V. J.A.S. is inventor on CRISPR-Cas related patents and patent applications. The other authors declare no financial interests. Wageningen Research owns the sporeless oyster mushroom varieties SPOPPO and ALLERPO. Author Contributions Conceptualization: Johan Baars, Viola Kurm, Jurre A. Steens, Marinus J.M. Smulders, Arend van Peer; Methodology: Viola Kurm, Bart Scholten, Yvonne Griekspoor, Brian Lavrijssen; Formal analysis and investigation: Viola Kurm, Bart Scholten , Yvonne Griekspoor, Brian Lavrijssen; Writing - original draft preparation: Johan Baars, Viola Kurm; Writing - review and editing: Johan Baars, Viola Kurm, Bart Scholten, Yvonne Griekspoor, Brian Lavrijssen, Jurre A. Steens, Marinus J.M. Smulders, Arend van Peer References Anonymous (2020) Amycel files patent infringement lawsuit. In: R. Dreve (ed) Mushroom Business Anonymous (2024) Court grants PI against Spyra for infringement of Amycel patent. In: Dreve R (ed) Mushroom Business. Mushroom Business Baars JJP, Hendrickx, P.M., Sonnenberg, A.S.M. (2004) Prototype of a Sporeless Oyster Mushroom. Mushroom Science 16:139-148 Baars JJP, Sonnenberg ASM, Mikosch TSP, Van Griensven LJLD (2000) Development of a sporeless strain of oyster mushroom Pleurotus ostreatus. Mushroom Science 15:317-323 Brahmi P, Chaudhary V (2011) Protection of plant varieties: Systems across countries. Plant Genetic Resources: Characterisation and Utilisation 9:392-403 Chen X, Wang X, Jin N, Zhou Y, Huang S, Miao Q, Zhu Q, Xu J (2012) Endpoint visual detection of three genetically modified rice events by loop-mediated isothermal amplification. International Journal of Molecular Sciences 13:14421-14433 Cox A, Folgering HTM, Van Griensven LJLD (1988) Extrinsic allergic alveolitis caused by spores of the oyster mushroom Pleurotus ostreatus. European Respiratory Journal 1:466-468 Eger G, Eden G, Wissig E (1976) Pleurotus Ostreatus - breeding potential of a new cultivated mushroom. Theoretical and Applied Genetics 47:155-163 Elliot Horner W, Ibanez MD, Liengswangwong V, Salvaggio JE, Lehrer SB (1988) Characterization of allergens from spores of the oyster mushroom, Pleurotus ostreatus. The Journal of Allergy and Clinical Immunology 82:978-986 Francois P, Tangomo M, Hibbs J, Bonetti EJ, Boehme CC, Notomi T, Perkins MD, Schrenzel J (2011) Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunology and Medical Microbiology 62:41-48 Hausen BM, Schulz KH, Noster U (1974) Allergic disease caused by the spores of an edible fungus Pleurotus florida. Mushroom Science 9:219-225 Jong S (2012) The Legal Protection of New Mushroom Strains with US Patents for Commercial Production and Marketing Strategies. Mushroom Science 18:921-933 Kitamura M, Aragane M, Nakamura K, Adachi T, Watanabe K, Sasaki Y (2018) Improved on-site protocol for the DNA-based species identification of Cannabis sativa by loop-mediated isothermal amplification. Biological and Pharmaceutical Bulletin 41:1303-1306 Lavrijssen B, Baars JP, Lugones LG, Scholtmeijer K, Telgerd NS, Sonnenberg ASM, van Peer AF (2020) Interruption of an MSH4 homolog blocks meiosis in metaphase I and eliminates spore formation in Pleurotus ostreatus. PLoS ONE 15: e0241749 Lee HY, Raveendar S, An H, Oh YL, Jang KY, Kong WS, Ryu H, So YS, Chung JW (2018) Development of polymorphic simple sequence repeat markers using high-throughput sequencing in button mushroom (Agaricus bisporus). Mycobiology 46:421-428 Lukasiewicz JM, van de Wiel CCM, Lotz LAP, Smulders MJM (2024) Intellectual property rights and plants made by new genomic techniques: Access to technology and gene-edited traits in plant breeding. Outlook on Agriculture 53: 205-215. https://doi.org/10.1177/00307270241277219 Moore AJ, Challen MP, Warner PJ, Elliott TJ (2001) RAPD discrimination of Agaricus bisporus mushroom cultivars. Applied Microbiology and Biotechnology 55:742-749 Murakeözy E (2021) Dealing with counterfeit lettuces – The challenges of plant variety right enforcement. In: Law Blogs Maastricht, Maastricht Notomi T, Mori Y, Tomita N, Kanda H (2015) Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. Journal of Microbiology 53:1-5 Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Research 28:E63 Okuda Y, Murakami S, Honda Y, Matsumoto T (2013) An MSH4 homolog, stpp1, from pleurotus pulmonarius is a silver bullet for resolving problems caused by spores in cultivated mushrooms. Applied and Environmental Microbiology 79:4520-4527 Olsen JA (1987) Pleurotus spores as allergens. Mushroom Journal 172:115-117 Panno S, Matić S, Tiberini A, Caruso AG, Bella P, Torta L, Stassi R, Davino S (2020) Loop mediated isothermal amplification: Principles and applications in plant virology. Plants 9: 461 Qiao N, Dai H, Liu J, Zhu X, Li J, Zhang D, Liu Y (2020) Detection of melon necrotic spot virus by one-step reverse transcription loop-mediated isothermal amplification assay. PLoS ONE 15 Royse DJ, Baars J, Tan Q (2017) Current overview of mushroom production in the world. In: Cunha Zied D, Pardo-Giménez A (eds) Edible and Medicinal Mushrooms: Technology and Applications. John Wiley & Sons Ltd., pp 5-13 Shirshikov FV, Bespyatykh JA (2022) Loop-Mediated Isothermal Amplification: From Theory to Practice. Russian Journal of Bioorganic Chemistry 48:1159-1174 Smulders MJM, van de Wiel CCM, Lotz LAP (2021) The Use of Intellectual Property Systems in Plant Breeding for Ensuring Deployment of Good Agricultural Practices. Agronomy 11:1163 Steens JA, Zhu Y, Taylor DW, Bravo JPK, Prinsen SHP, Schoen CD, Keijser BJF, Ossendrijver M, Hofstra LM, Brouns SJJ, Shinkai A, van der Oost J, Staals RHJ (2021) SCOPE enables type III CRISPR-Cas diagnostics using flexible targeting and stringent CARF ribonuclease activation. Nature Communications 12: 5033 Tomlinson JA, Dickinson MJ, Boonham N (2010) Detection of Botrytis cinerea by loop-mediated isothermal amplification. Letters in Applied Microbiology 51:650-657 Yasuhara-Bell J, Kubota R, Jenkins DM, Alvarez AM (2013) Loop-mediated amplification of the clavibacter michiganensis subsp. Michiganensis mica gene is highly specific. Phytopathology 103:1220-1226 Zhao M, Shi Y, Wu L, Guo L, Liu W, Xiong C, Yan S, Sun W, Chen S (2016) Rapid authentication of the precious herb saffron by loop-mediated isothermal amplification (LAMP) based on internal transcribed spacer 2 (ITS2) sequence. Scientific Reports 6: 25370 Additional Declarations No competing interests reported. Supplementary Files SupplementaldataOystermushroomstrainsLAMPtest.docx Cite Share Download PDF Status: Published Journal Publication published 28 Oct, 2025 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 09 Aug, 2025 Reviews received at journal 08 Aug, 2025 Reviewers agreed at journal 02 Aug, 2025 Reviewers agreed at journal 16 May, 2025 Reviews received at journal 18 Apr, 2025 Reviewers agreed at journal 17 Apr, 2025 Reviewers invited by journal 25 Mar, 2025 Editor assigned by journal 24 Mar, 2025 Submission checks completed at journal 24 Mar, 2025 First submitted to journal 24 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6294117","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":440356206,"identity":"d47fdbe8-9fc0-4df8-a09d-0084ff967635","order_by":0,"name":"Johan Baars","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYBAC9gYeEPUHRDA+gAgR0MII0XIMRDAbgIWYidNyGESwSRCnpb334OcChmPy/LOPP6vmbbvHYE5QS8+5ZOkZDH8MZ5zLMbvN21bMYNlMSMuMHANpHoZjjA1neNhu57YlMBgcJqzF+DcPw2H7+WfYnxUTpUVwRo4Z0JbDiRvOMJgxE6VFmueMmTWPwbHkjWd4jKX/nEvgIaiFj73H+DZPxR/beWfYH36cUZYgZ3C8gYAeMDBAMHmIUT8KRsEoGAWjgAAAAGR8PYw96jd+AAAAAElFTkSuQmCC","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":true,"prefix":"","firstName":"Johan","middleName":"","lastName":"Baars","suffix":""},{"id":440356207,"identity":"b4ed700d-c69e-4938-90b3-0f5fac78cf66","order_by":1,"name":"Viola Kurm","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Viola","middleName":"","lastName":"Kurm","suffix":""},{"id":440356208,"identity":"c55c0d4f-ebca-4e1d-adf1-a19dc5d11dfc","order_by":2,"name":"Bart Scholten","email":"","orcid":"","institution":"Scope Biosciences BV, Wageningen, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Bart","middleName":"","lastName":"Scholten","suffix":""},{"id":440356209,"identity":"8fc7c11e-263e-43d1-a03b-29a2f7feb63a","order_by":3,"name":"Yvonne Griekspoor","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Yvonne","middleName":"","lastName":"Griekspoor","suffix":""},{"id":440356210,"identity":"9e92c98e-d69b-49d8-b66a-35fbb0293fd4","order_by":4,"name":"Brian Lavrijssen","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Brian","middleName":"","lastName":"Lavrijssen","suffix":""},{"id":440356212,"identity":"8f65fb83-bc38-4b4d-8ff1-4eebf3f15d23","order_by":5,"name":"Jurre A. Steens","email":"","orcid":"","institution":"Scope Biosciences BV, Wageningen, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Jurre","middleName":"A.","lastName":"Steens","suffix":""},{"id":440356214,"identity":"18e9e2a0-f905-4e7d-8dee-b47af1768234","order_by":6,"name":"Marinus J.M. Smulders","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Marinus","middleName":"J.M.","lastName":"Smulders","suffix":""},{"id":440356216,"identity":"9e32c2ee-74df-4079-b090-ace22e92c5fc","order_by":7,"name":"Arend Peer","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Arend","middleName":"","lastName":"Peer","suffix":""}],"badges":[],"createdAt":"2025-03-24 10:08:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6294117/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6294117/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-025-11156-0","type":"published","date":"2025-10-28T15:58:34+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80293473,"identity":"da313880-5605-4523-9d42-5e210e6566f8","added_by":"auto","created_at":"2025-04-10 08:20:52","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":59713,"visible":true,"origin":"","legend":"\u003cp\u003eLocation of recombination events in strains AQP-58 and AQU-07. Blue represents genetic material originating from strain HK-35, while red indicates genetic material originating from strain ATCC58937.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6294117/v1/90c8c25a9b7dbbe2b5a6a3c3.png"},{"id":80293475,"identity":"e7ed669b-a478-4de9-93cf-2f36baf56324","added_by":"auto","created_at":"2025-04-10 08:20:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":342400,"visible":true,"origin":"","legend":"\u003cp\u003ea) Amplification curves and b) melting curves of a msh4-LAMP assay on mycelium samples of SPOPPO, ALLERPO, ATCC58937 and HK35, a negative control, and a gBlock of the disrupted msh4-gene as a positive control.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6294117/v1/e03202651c1d6e7f764eefad.png"},{"id":95040044,"identity":"f08063de-5450-441b-9783-96b134035940","added_by":"auto","created_at":"2025-11-03 16:07:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1075261,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6294117/v1/2dd0081e-27c4-4c35-8387-04a1cdeadf3f.pdf"},{"id":80293476,"identity":"7476ce57-5427-4360-96e1-16ab12da7993","added_by":"auto","created_at":"2025-04-10 08:20:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1434027,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaldataOystermushroomstrainsLAMPtest.docx","url":"https://assets-eu.researchsquare.com/files/rs-6294117/v1/e34d9e585c0d1a4e615425e4.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"On site discrimination between two closely related commercial strains of Oyster mushroom using a loop-mediated isothermal amplification (LAMP) test","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOyster mushrooms (\u003cem\u003ePleurotus\u003c/em\u003e species) are among the most widely cultivated mushrooms in the world, together with \u003cem\u003eLentinula edodes\u003c/em\u003e, \u003cem\u003eAuricularia\u003c/em\u003e species, \u003cem\u003eAgaricus bisporus\u003c/em\u003e and \u003cem\u003eFlammulina\u003c/em\u003e species (Royse et al. 2017). In Europe, the main \u003cem\u003ePleurotus\u003c/em\u003e species that are being cultivated are King Oyster mushroom (\u003cem\u003ePleurotus eryngii\u003c/em\u003e) and Grey Oyster mushroom (\u003cem\u003ePleurotus ostreatus\u003c/em\u003e). Workers who are harvesting and handling the crop during the cultivation of Oyster mushrooms often develop respiratory problems. These are associated with the exposure to spores of \u003cem\u003ePleurotus\u003c/em\u003e spp. (Hausen et al. 1974; Olsen 1987; Elliot Horner et al. 1988). Under controlled laboratory conditions it has been shown that the inhalation of spores of \u003cem\u003eP\u003c/em\u003e. \u003cem\u003eostreatus\u003c/em\u003e provokes the development of an extrinsic allergic alveolitis (Cox et al. 1988).\u003c/p\u003e \u003cp\u003eAround the turn of the 20th century the Netherlands\u0026rsquo; Ministry of Agriculture commissioned the development of a sporeless strain of Oyster mushroom to alleviate respiratory problems of workers in the cultivation of Oyster mushroom. This resulted in two sporeless varieties of \u003cem\u003eP. ostreatus\u003c/em\u003e that are currently commercially available: SPOPPO and ALLERPO. Both the SPOPPO variety and the ALLERPO variety were developed in a breeding program based on crosses between a spontaneous sporeless \u003cem\u003eP. ostreatus\u003c/em\u003e mutant, ATCC58937 (F42 x 11; (Eger et al. 1976)) and the commercial variety HK35. More detailed research has shown that the \u003cem\u003epoMSH4\u003c/em\u003e gene in the sporeless \u003cem\u003eP\u003c/em\u003e. \u003cem\u003eostreatus\u003c/em\u003e was interrupted by a large DNA fragment containing a region encoding a CxC5/CxC6 cysteine cluster associated with Copia-type retrotransposons (Lavrijssen et al. 2020). A disruption of the same gene was shown to cause sporelessness in \u003cem\u003ePleurotus pulmonarius\u003c/em\u003e (Okuda et al. 2013).\u003c/p\u003e \u003cp\u003eMany countries facilitate the protection of intellectual property rights on mushroom varieties that have been developed for horticultural purposes. Three systems can be discerned: plant breeders\u0026rsquo; rights (PBR, also called plant variety protection or PVP) system, the Utility Patent, and (in the US) the Plant Patent (Jong 2012). The plant breeder\u0026rsquo;s right system is a dedicated system for plant and mushroom varieties based on the International Convention for the Protection of New Varieties of Plants. It is administered by the International Union for the Protection of New Varieties of Plants (UPOV), an intergovernmental organization with headquarters in Geneva (Switzerland). After having been granted plant breeder\u0026rsquo;s rights, the breeder has the exclusive rights to give licenses to others to multiply or use the variety and to charge a license fee on the multiplications or use of the variety for agricultural production (for a period of 20 or 25 years). A plant variety that is traded must be identified by its official name. This helps the owner to trace the use of its variety. The US has a similar type of protection for new varieties of non-tuberous, asexually propagated species, termed a \u0026ldquo;Plant Patent (PP)\u0026rdquo;. A Utility Patent is for inventions that are novel, inventive and industrially applicable ((Lukasiewicz et al. 2024). It may cover plant parts or a plant with an inserted gene rather than a variety containing the gene (Jong 2012). Currently there are 15 Plant Patents known for strains of edible mushrooms (Jong 2012; Smulders et al. 2021) and 27 US patents granted for new mushroom strains. Intellectual property rights of at least 45 varieties of \u003cem\u003eP. ostreatus\u003c/em\u003e are protected (Supplementary file, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The varieties SPOPPO and ALLERPO are protected in the European Union, the United Kingdom and Israel by PBR and in the US by a Plant Patent.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOyster mushroom strains used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSporulation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCommercial vendors\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSylvan Spawn (Langeais, France)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmycel (Vend\u0026ocirc;me, France)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATCC58937\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo longer commercially available\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHK35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSylvan Spawn (Langeais)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eItalspawn (Onigo, Italy)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eItalspawn (Onigo, Italy)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3015\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmycel (Vend\u0026ocirc;me, France)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences targeting the msh4 insert, the ALLERPO specific AQU07 and the SPOPPO specific AQP58 and crRNA sequence.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMSH4-F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAATCGGTCACTGTCGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emsh4 insertion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMSH4-B3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGGATTCAGTTGGTGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emsh4 insertion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMSH4-FIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTTTTGAGTGCAAAAACAAACCCGGTGCACTCATTATCATTGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emsh4 insertion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMSH4-BIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTTCCAAGTGGCTTTATCAATGCCACTTGTAGACGTGGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emsh4 insertion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMSH4-LoopB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGGAAGCTGTATATCTGGCAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emsh4 insertion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQU07-F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGTTGGCACAGCCATGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQU07-B3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGTTCCTTCTCCACAACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQU07-FIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCACGGGTTCCTGGAGCAATGTACCTCTGCTTTCCCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQU07-BIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGAGGTGGCAGTAGCCTTGCCAAGCGCCTCAATTTTGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQU07-LoopB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGCATGAGTGGAAAGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQP58-F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAAGGCCTTGAACACTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQP58-B3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGGGATGGCCTACATTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQP58-FIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGGGCACGAGTGTATAGTCGGCCAGGACGTTTCGCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQP58-BIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACCTTACCGCGATCCGTCAACAGCCAGGCATCTGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQP58-LoopF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTAGCATTCCGGAGGGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAQP58-LoopB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCTCAACAGCTAGTTCAGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecrRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAUUGCGACGCUAGUUCAGCGCUGGAAUAUGACAGAUGCCUGGCUGU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eProtection of the intellectual property (IP) rights on new crop varieties are important as it allows the breeding company or entity that produced the variety to earn back (part of) the investment. For breeding programs that are not publicly funded, IP protection is generally considered to be indispensable (Smulders et al. 2021). Without protection of IP rights, hardly any new mushroom strains would enter the market, and as a result the industry would not develop as well as it potentially could or even diminish when existing strains no longer suffice contemporary needs .\u003c/p\u003e \u003cp\u003eInfringement on the IP rights of mushrooms varieties is not uncommon. As fungi are vegetatively propagated it is very easy to make copies of varieties through tissue cultures. A well-known case within the mushroom industry is the infringement of the IP rights on strains from spawn company Amycel (Jong 2012; Anonymous 2020; Anonymous 2024). Also in case of \u003cem\u003eP. ostreatus\u003c/em\u003e variety SPOPPO, cases of infringement of the IP rights have occurred. In order to combat infringement of the IP rights on SPOPPO and ALLERPO it is important to be able to readily recognize and discriminate the two strains in commercial practice. Both strains do not produce basidiospores and as such distinguish themselves from all other commercial strains currently on the market (with the exception of the \u0026lsquo;Purati\u0026rsquo; that is also sporeless but has pronounced morphological differences). When seen side by side in the same growing room, the color difference between SPOPPO and ALLERPO is clear. However, when encountering one of the two strains by itself in a growing room, it is very difficult to determine the identity. We therefore looked for a molecular method that may be used in the field to differentiate the two strains. By basing the method both on DNA features close to the mutated gene and strain specific recombination sites, the test should also be useful to differentiate the two sporeless strains from all other strains.\u003c/p\u003e \u003cp\u003eLoop-mediated isothermal amplification (LAMP) is a molecular technique (Notomi et al. 2000) that is frequently used for the detection of plant pathogens. It makes use of up to six primers and a Bst DNA polymerase with strand displacement activity for amplification of nucleic acids at an isothermal temperature. A large amount of amplicon is produced that can be visualized by either end-point detection using, for example, intercalating dyes or ion indicators or by real-time detection, generally with intercalating fluorescent dyes (Panno et al. 2020). Due to the number of primers LAMP is reported to be highly species-specific, allowing for the differentiation of various bacteria, fungal and viral pathogens (Tomlinson et al. 2010; Yasuhara-Bell et al. 2013; Qiao et al. 2020). In addition, combining LAMP pre-amplification with a CRISPR-detection step (Steens et al. 2021), allows for differentiation between targets on the basis of a single nucleotide polymorphism (SNP). Another advantage of LAMP is its potential for on-site detection, making it an ideal tool for distinguishing closely related organisms. The LAMP polymerase is less sensitive to inhibitors than commonly used PCR polymerases, and therefore crude, rapid extracts from various sources are often sufficient (Francois et al. 2011). In addition, isothermal amplification and result read-out can be performed with portable equipment (Notomi et al. 2015).\u003c/p\u003e \u003cp\u003eDue to its specificity, speed of operation and on-site applicability LAMP has been used previously for distinguishing plant species and even cultivars. A LAMP assay with end-point detection has been developed for the specific identification of saffron (\u003cem\u003eCrocus sativus\u003c/em\u003e) that enabled its distinction from commonly used plants used to adulterate saffron (Zhao et al. 2016). LAMP assays have been used to identify transgenic rice based on the junction sequences of the transgenic events (Chen et al. 2012). LAMP also makes it possible to distinguish strains of \u003cem\u003eCannabis sativus\u003c/em\u003e based on several single nucleotide polymorphisms (SNPs), indicating the high specificity of this technique (Kitamura et al. 2018). In addition, Kitamura and colleagues developed a simplified protocol for DNA extraction and amplicon visualization allowing for quick on-site detection. We are not aware of studies using LAMP for the discrimination of mushroom cultivars.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStrains used\u003c/h2\u003e \u003cp\u003eFor the development and validation of the LAMP assays for the varieties SPOPPO and ALLERPO, additionally the sporeless strain ATCC58937 and the sporulating varieties HK35, P24, P80 and 3015 were used (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). To further test specificity of the method, the varieties P24, P80 and 3015 were included. The fungal cultures were stored in liquid nitrogen and revived when needed. Mycelium was grown on malt extract agar. Spawn was either obtained from Sylvan Spawn (Langeais, France) or was made from sorghum grains. Preparation of spawn and colonized substrate was performed as described by Lavrijssen and colleagues (Lavrijssen et al. 2020). Raw materials for preparing colonized substrate were kindly provided by VeMe Specials, Gemert, The Netherlands.\u003c/p\u003e \u003cp\u003eThe varieties SPOPPO and ALLERPO have been developed in a breeding program based on the strains HK35 and ATCC 58937 as starting material(Baars et al. 2000; Baars 2004). Strain ATCC 58937 donated the sporeless trait. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e depicts the genomic make-up of the three monokaryotic strains that were used to make the varieties SPOPPO (cross of AQP-58 and ASA-53) and ALLERPO (cross of AQU-07 and ASA-53). The specific locations of the recombinations discriminate between these two varieties. Since both SPOPPO and ALLERPO contain genomic material of ASA53, only recombinations in the genomes of AQU-07 and AQP-58 are available to differentiate between SPOPPO and ALLERPO. Monokaryotic strain AQP-58 only shows a recombination on linkage group 5 while AQU07 shows recombinations on chromosomes 2, 3, 4, 5, 10 and 11.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePrimer sequences\u003c/h3\u003e\n\u003cp\u003eAll primers were designed using Primer Explorer v. 5. One primer set was designed on the left flank of the msh4-gene insert present in the sporeless strains, partly extending over the insert (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The primer set AQU07 was designed to target a sequence on the AQU07 chromosome 3 differing in a few SNPs from the corresponding sequence of AQP58. The primer set AQP58 was designed to target a sequence on the AQP58 chromosome 5 differing in a few SNPs from the corresponding sequence on AQU07. Both the AQU07 and AQP58 primer sets also target the corresponding sequence on HK35. Therefore, the MSH4 assay is also required for strain identification.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOverview of Time of positivity (Tpos) and melting temperature (Tm) of two LAMP and one LAMP-CC assay for the msh4-gene, ALLERPO and SPOPPO respectively on various types of sample; n.d.=not done, n.a. = not applicable.. With respect to the CRISPR-CAS AQP58 assay; due to the use of a fluorescent probe, this assay does not produce a melting curve.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eExperiment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSample type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c8\" namest=\"c4\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003emsh4 insert\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eAQU07\u003c/p\u003e \u003cp\u003e(ALLERPO specific)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCRISPR-Cas AQP58 (SPOPPO specific)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTpos\u003c/p\u003e \u003cp\u003e(min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003cp\u003e(\u0026deg;C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTpos\u003c/p\u003e \u003cp\u003e(min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003cp\u003e(\u0026deg;C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTpos\u003c/p\u003e \u003cp\u003e(min)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"7\" rowspan=\"8\"\u003e \u003cp\u003eMycelium tests\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:15\u0026ndash;19:00 (duplicates)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20:15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCC58937\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e17:45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHK35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:30\u0026thinsp;\u0026minus;\u0026thinsp;19:15 (duplicates)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ewater\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emsh4 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16:15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e15:45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"12\" rowspan=\"13\"\u003e \u003cp\u003eMushroom tests\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20:15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e89.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e25:15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19:45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e25:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3015 Amycel\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e19:00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP24 Italspawn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP80 Italspawn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMushroom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e16.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC ALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19:45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e25:45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC HK35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e66.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC SPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ewater\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"7\" rowspan=\"8\"\u003e \u003cp\u003eSpawn tests\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSpawn; 2 kernels\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e21:30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSpawn; 6 kernels\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e20:30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSpawn; 10 kernels\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e20:00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQU07 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAQP58 gBlock\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e17:45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC ALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC SPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ewater\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"6\" rowspan=\"7\"\u003e \u003cp\u003eSubstrate tests\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSubstrate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e16:45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSubstrate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18:45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20:45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSubstrate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e16:45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHK35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSubstrate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21:30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC SPOPPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18:30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePC ALLERPO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emycelium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24:00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003en.d.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ewater\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe standard LAMP assay AQP58 was not sufficiently specific and was therefore used as a base for the design of a LAMP CRISPR-Cas assay.\u003c/p\u003e \u003cp\u003eThe addition of the CRISPR-Cas based read-out of the ScopeDx assay to the LAMP assay increases its specificity to enable required distinction between AQP58 and AQU07. A crRNA is designed which together with Cmr subunits forms a CRISPR-Cas complex to distinguish between the LAMP-amplicons of AQP58 and AQU07 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Only when perfect complementarity between crRNA and AQP58 is present, the CRISPR-Cas complex is activated which sets off a signaling cascade that generates a fluorescent probe-based read-out.\u003c/p\u003e\n\u003ch3\u003eLAMP assay\u003c/h3\u003e\n\u003cp\u003ePrimer mixes were prepared for the MSH4 and AQU07 primer sets consisting of 5 \u0026micro;M F3 and B3 primer, 20 \u0026micro;M FIP and BIP primers and 10 \u0026micro;M Loop primer. Each reaction mix contained 15 \u0026micro;l ISO-001 mix (OptiGene), 1 \u0026micro;l primer mix, 4 \u0026micro;l HyClone water (Cytiva) and 5 \u0026micro;l sample extract. The assays were performed at 65\u0026deg;C for 40 minutes followed by a melting curve at 98\u0026deg;C-65\u0026deg;C.\u003c/p\u003e \u003cp\u003eThe LAMP CRISPR-Cas method is based on a method developed by Steens et al. (2021) and further developed by Scope Bioscience to a one-pot assay. The reaction mix contained 15 \u0026micro;l master mix (Scope Biosciences) and 5 \u0026micro;l sample extract and the reaction was performed at 65\u0026deg;C for 40 minutes.\u003c/p\u003e \u003cp\u003eCombinations of the three LAMP assays allow discrimination between SPOPPO and ALLERPO. A positive signal in both the MSH4 and AQU07 LAMP assays is indicative for ALLERPO. A positive signal in both the AQP58 (CRISPR-Cas method) and the MSH4 LAMP assay is indicative for SPOPPO.\u003c/p\u003e\n\u003ch3\u003eSample extraction\u003c/h3\u003e\n\u003cp\u003eMycelium extracts were made from oyster mushroom mycelium grown on agar petri dishes by scraping off a small amount of mycelium using a 1 \u0026micro;l inoculation loop and transferring it to a 1.5 ml Eppendorf tube with 100 \u0026micro;l PEG lysis buffer (OptiGene). The mycelium was crushed manually using a miniature pestle for 60 seconds. The samples were incubated for 20 minutes at 95\u0026deg;C and subsequently diluted 50 times in sample dilution buffer (OptiGene). Of these extracts 5 \u0026micro;l was used per LAMP reaction.\u003c/p\u003e \u003cp\u003eIn addition to mycelium, all LAMP assays were performed on mushroom caps, spawn and colonized substrate (wheat straw based). For colonized substrate the LAMP assays were performed on substrate colonized by either SPOPPO, ALLERPO, HK35, P24, P80 and 3015.\u003c/p\u003e \u003cp\u003eMushroom cap extracts were made using 125 mg mushroom tissue. The tissue was added to a 5 ml extraction tube containing 1ml PEG lysis buffer (OptiGene) with 40 w/v % Chelex 100 and a metal ball (\u0026Oslash; 11.1 mm). After shaking the tube by hand for 1 minute the samples were incubated for 20 minutes at room temperature and subsequently diluted 50 times in sample dilution buffer (OptiGene). Of these extracts 5 \u0026micro;l was used per LAMP reaction.\u003c/p\u003e \u003cp\u003eOyster mushroom strains are commercially available as millet grains covered with mycelium. Spawn extracts were made using 2, 6 or 10 kernels in a 5 ml extraction tube with 1 ml PEG lysis buffer (OptiGene), 40 w/v % Chelex 100 and a metal ball (\u0026Oslash; 11.1 mm). The tubes were shaken for 1 minute by hand followed by a 20-minute incubation at room temperature. Subsequently the extract was diluted 50 times with sample dilution buffer (OptiGene). Of these extracts 5 \u0026micro;l was used per LAMP reaction.\u003c/p\u003e \u003cp\u003eIn Europe, Oyster mushroom strains are mostly grown on a substrate of pasteurized wheat straw. For extraction from colonized substrate 1\u0026ndash;2 straws of substrate partly covered in mycelium were placed in a 5 ml extraction tube with 1 ml PEG lysis buffer (OptiGene), 40 w/v % Chelex 100 and a metal ball (\u0026Oslash; 11.1 mm). After shaking the tube by hand for 1 minute and 5-minute incubation at room temperature the samples were diluted 50 times with sample dilution buffer (OptiGene). Of these extracts 5 \u0026micro;l was used per LAMP reaction.\u003c/p\u003e\n\u003ch3\u003eSpecificity\u003c/h3\u003e\n\u003cp\u003eFor assessing the specificity of the three assays, all were tested on mycelium extracts of the strains SPOPPO, ALLERPO, HK35 and ATCC58937.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThe three different LAMP assays were tested on a number of different sample types as they may appear in commercial practice.\u003c/p\u003e\n\u003ch3\u003eSpecificity test on mycelium\u003c/h3\u003e\n\u003cp\u003eWith the MSH4-assay, extract from SPOPPO, ALLERPO and ATCC58937 mycelium showed a positive reaction with a time of positivity of 17:45\u0026thinsp;\u0026minus;\u0026thinsp;18:30 minutes and a melting temperature of approximately 84.9\u0026deg;C (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). There was no amplification with the HK35 extract. The AQU07 assay showed positive amplification with the ALLERPO mycelium extract and the HK35 mycelium extract, but not the SPOPPO and ATCC58937 mycelium extracts (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e Supplemental Fig.\u0026nbsp;1). Time of positivity for the ALLERPO target was 20:15 min with a melting temperature of 89.6. \u0026deg;C. The LAMP-CRISPR-Cas AQP58 assay in turn amplified SPOPPO and HK35 mycelium, but not ALLERPO mycelium with an approximate time of positivity of 18:00\u0026ndash;19:00 min (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Supplemental Fig.\u0026nbsp;2). Due to the use of a fluorescent probe, this assay does not produce a melting curve.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eTest in a mushroom cap matrix\u003c/h3\u003e\n\u003cp\u003eWith mushroom caps, following a simple DNA extraction, the MSH4-assay showed a positive reaction with the sporeless varieties SPOPPO and ALLERPO, but not with the sporulating varieties 3015 (Amycel) and P24 and P80 (Italspawn) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). SPOPPO and ALLERPO could be distinguished with the AQU07 and AQP58 assays specific for ALLERPO and SPOPPO respectively. The latter two assays also showed positive reactions with the sporulating varieties.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTest in a spawn matrix\u003c/h2\u003e \u003cp\u003eThe MSH4 and the AQP58 assay, but not the AQU07 assay were positive for all SPOPPO spawn samples (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Supplemental Fig.\u0026nbsp;3\u0026ndash;5). Two kernels of spawn were sufficient for a positive reaction within 24 minutes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTest in substrate\u003c/h2\u003e \u003cp\u003eThe three LAMP assays specifically detected SPOPPO and ALLERPO in colonized wheat straw based substrate. The MSH4 assay showed positive amplification for ALLERPO- and SPOPPO-colonized substrate, but not for substrate colonized by P80 and HK35 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Supplemental Fig.\u0026nbsp;6\u0026ndash;8). The AQU07 assay was positive with ALLERPO-colonized substrate (Supplemental Fig.\u0026nbsp;7) and the AQP58 assay was positive with SPOPPO-colonized substrate (Supplemental Fig.\u0026nbsp;8). Time of positivity for the different assays was between 16 and 21 minutes.\u003c/p\u003e \u003c/div\u003e "},{"header":"Discussions and conclusions","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003cp\u003eThe unambiguous identification of mushroom varieties in an on-site setting is of high importance for the protection of IP rights. In many countries, infringement of PBR/PVP is punishable by law (Brahmi and Chaudhary 2011). On the one hand infringement of PBR/PVP is hard to prove as evidenced by the case of lettuce seed (Murake\u0026ouml;zy 2021). On the other hand, one should be cautious not to falsely accuse people or organizations. Knowing, on the basis of on-site identification of strains, early on that infringement is a possibility, may help building a legal case. Such a method may also serve as a way for spawn companies to verify if growers have used their strains in case cultivation problems have risen that are accompanied by deviant mushroom morphology or even lack of mushrooms.\u003c/p\u003e \u003cp\u003eHere we have developed three LAMP-(based) assays that together can identify the varieties SPOPPO and ALLERPO and distinguish them from all tested sporulating strains and the sporeless parent ATCC58937. The MSH4 LAMP assay targets the region of an insertion in the msh4 gene, which is responsible for the non-sporulating phenotype. Our MSH4 assay amplified varieties with this particular insertion with a high specificity. It is unlikely that new oyster mushroom varieties developed from other sporeless parents than ATCC58937 will contain the exact same insertion. Therefore, the MSH4 LAMP assay is expected to be suitable for the specific identification of SPOPPO and ALLERPO.\u003c/p\u003e \u003cp\u003eDeveloping specific LAMPs to distinguish the two sporeless varieties SPOPPO and ALLERPO was more challenging since both share one parent haplotype (ASA-53) while the complementing differing parent haplotypes (AQU07 or AQP58) are closely related. Nevertheless, the developed AQU07 assay showed a positive reaction with ALLERPO, but not with SPOPPO. This specificity is likely based on several SNPs occurring in the primer binding region near the 3\u0026rsquo; end of the FIP (F1c\u0026thinsp;+\u0026thinsp;F2) primer as the primers\u0026rsquo; 3\u0026rsquo; end is highly important for annealing and elongation (Shirshikov and Bespyatykh 2022). However, it was not possible to design a LAMP assay specific for AQP58 present in SPOPPO. Therefore, a LAMP-CRISPR-Cas assay (Steens et al. 2021)was needed to distinguish SPOPPO from ALLERPO with a positive reaction. Addition of the AQP58-specific CRISPR-Cas complex enabled binary distinction between SPOPPO and ALLERPO. This illustrates the added value of the CRISPR-Cas based detection when only minimal genetic differences exist without increasing detection time. Both assays showed amplification with the parent HK35 and other sporulating varieties. Therefore, the MSH4 assay is required in addition for specific identification.\u003c/p\u003e \u003cp\u003eOn-site applicability of assays for identity confirmation in cases of suspected IP infringements is crucial. Current techniques for strain identification include RAPD (Moore et al. 2001), SSR markers (Lee et al. 2018) and other PCR-based tests. These methods require laboratory equipment and trained personnel for DNA extraction and for conducting the respective tests. However, the transportation of samples from the breeder to the laboratory requires a chain of procedures to be followed to ensure that the samples are not compromised. In addition, in the time from sampling until obtaining the results material with potentially copied mushroom strains can be destroyed or removed. Therefore, a LAMP assay that can be performed on-site, and works with various matrices, is highly advantageous. Similarly, when problems in production are encountered, a rapid confirmation of strain identity is desirable.\u003c/p\u003e \u003cp\u003eIn this study we tested if the three developed assays can be used with three different matrices, namely mushroom fruiting bodies, spawn and colonized substrate. Spawn is typically produced with millet, sorghum or wheat grain, while substrate contains straw. These materials often contain inhibitors such as humic acids and polysaccharides. However, all three assays (MSH4, AQU07 and AQP58) showed amplification as expected in all three tested materials with no increase in time of positivity. Thus, a simple extraction procedure was sufficient for strain identification in all substrates. Therefore, the LAMP assays are suitable for on-site application. In addition, we demonstrated that already two kernels of spawn or one piece of colonized straw substrate is sufficient for a positive reaction.\u003c/p\u003e \u003cp\u003eStill, a few challenges remain for the use of LAMP in general and the assays developed here specifically. While performing a LAMP assay is relatively simple compared to other molecular techniques, it still requires basic laboratory skills such as pipetting and consumables, such as primers, enzymes and specific tubes that are relatively costly. In addition, the read-out method in the case of this study relies on real-time fluorescence detection, for which a (portable) device such as a Genie III (OptiGene) is needed. Alternative read-out methods include end-point read-outs relying on a color change or an increase in turbidity, which do not require a read-out device. However, these methods do not allow for assessing the melting temperature and therefore can lead to false positives. In addition, there is of yet no alternative read-out method for the LAMP-CRISPR-Cas assay, which relies on a fluorophore signal. Currently, smaller and more cost-efficient devices have been developed, for instance the Genie-Lite system from Optigene (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.optigene.co.uk/instruments/genie-lite/\u003c/span\u003e\u003cspan address=\"https://www.optigene.co.uk/instruments/genie-lite/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). However, these remain to be implemented in practice.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eB.S. and J.A.S. are founders and shareholders of Scope Biosciences B.V. J.A.S. is inventor on CRISPR-Cas related patents and patent applications. The other authors declare no financial interests. Wageningen Research owns the sporeless oyster mushroom varieties SPOPPO and ALLERPO.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: Johan Baars, Viola Kurm, Jurre A. Steens, Marinus J.M. Smulders, Arend van Peer; Methodology: Viola Kurm, Bart Scholten, Yvonne Griekspoor, Brian Lavrijssen; Formal analysis and investigation: Viola Kurm, Bart Scholten , Yvonne Griekspoor, Brian Lavrijssen; Writing - original draft preparation: Johan Baars, Viola Kurm; Writing - review and editing: Johan Baars, Viola Kurm, Bart Scholten, Yvonne Griekspoor, Brian Lavrijssen, Jurre A. Steens, Marinus J.M. Smulders, Arend van Peer\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAnonymous (2020) Amycel files patent infringement lawsuit. In: R. Dreve (ed) Mushroom Business\u003c/li\u003e\n\u003cli\u003eAnonymous (2024) Court grants PI against Spyra for infringement of Amycel patent. In: Dreve R (ed) Mushroom Business. Mushroom Business\u003c/li\u003e\n\u003cli\u003eBaars JJP, Hendrickx, P.M., Sonnenberg, A.S.M. (2004) Prototype of a Sporeless Oyster Mushroom. Mushroom Science 16:139-148\u003c/li\u003e\n\u003cli\u003eBaars JJP, Sonnenberg ASM, Mikosch TSP, Van Griensven LJLD (2000) Development of a sporeless strain of oyster mushroom Pleurotus ostreatus. Mushroom Science 15:317-323\u003c/li\u003e\n\u003cli\u003eBrahmi P, Chaudhary V (2011) Protection of plant varieties: Systems across countries. Plant Genetic Resources: Characterisation and Utilisation 9:392-403\u003c/li\u003e\n\u003cli\u003eChen X, Wang X, Jin N, Zhou Y, Huang S, Miao Q, Zhu Q, Xu J (2012) Endpoint visual detection of three genetically modified rice events by loop-mediated isothermal amplification. International Journal of Molecular Sciences 13:14421-14433\u003c/li\u003e\n\u003cli\u003eCox A, Folgering HTM, Van Griensven LJLD (1988) Extrinsic allergic alveolitis caused by spores of the oyster mushroom Pleurotus ostreatus. European Respiratory Journal 1:466-468\u003c/li\u003e\n\u003cli\u003eEger G, Eden G, Wissig E (1976) Pleurotus Ostreatus - breeding potential of a new cultivated mushroom. Theoretical and Applied Genetics 47:155-163\u003c/li\u003e\n\u003cli\u003eElliot Horner W, Ibanez MD, Liengswangwong V, Salvaggio JE, Lehrer SB (1988) Characterization of allergens from spores of the oyster mushroom, Pleurotus ostreatus. The Journal of Allergy and Clinical Immunology 82:978-986\u003c/li\u003e\n\u003cli\u003eFrancois P, Tangomo M, Hibbs J, Bonetti EJ, Boehme CC, Notomi T, Perkins MD, Schrenzel J (2011) Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunology and Medical Microbiology 62:41-48\u003c/li\u003e\n\u003cli\u003eHausen BM, Schulz KH, Noster U (1974) Allergic disease caused by the spores of an edible fungus Pleurotus florida. Mushroom Science 9:219-225\u003c/li\u003e\n\u003cli\u003eJong S (2012) The Legal Protection of New Mushroom Strains with US Patents for Commercial Production and Marketing Strategies. Mushroom Science 18:921-933\u003c/li\u003e\n\u003cli\u003eKitamura M, Aragane M, Nakamura K, Adachi T, Watanabe K, Sasaki Y (2018) Improved on-site protocol for the DNA-based species identification of Cannabis sativa by loop-mediated isothermal amplification. Biological and Pharmaceutical Bulletin 41:1303-1306\u003c/li\u003e\n\u003cli\u003eLavrijssen B, Baars JP, Lugones LG, Scholtmeijer K, Telgerd NS, Sonnenberg ASM, van Peer AF (2020) Interruption of an MSH4 homolog blocks meiosis in metaphase I and eliminates spore formation in Pleurotus ostreatus. PLoS ONE 15: e0241749\u003c/li\u003e\n\u003cli\u003eLee HY, Raveendar S, An H, Oh YL, Jang KY, Kong WS, Ryu H, So YS, Chung JW (2018) Development of polymorphic simple sequence repeat markers using high-throughput sequencing in button mushroom (Agaricus bisporus). Mycobiology 46:421-428\u003c/li\u003e\n\u003cli\u003eLukasiewicz JM, van de Wiel CCM, Lotz LAP, Smulders MJM (2024) Intellectual property rights and plants made by new genomic techniques: Access to technology and gene-edited traits in plant breeding. Outlook on Agriculture 53: 205-215. https://doi.org/10.1177/00307270241277219\u003c/li\u003e\n\u003cli\u003eMoore AJ, Challen MP, Warner PJ, Elliott TJ (2001) RAPD discrimination of Agaricus bisporus mushroom cultivars. Applied Microbiology and Biotechnology 55:742-749\u003c/li\u003e\n\u003cli\u003eMurake\u0026ouml;zy E (2021) Dealing with counterfeit lettuces \u0026ndash; The challenges of plant variety right enforcement. In: Law Blogs Maastricht, Maastricht\u003c/li\u003e\n\u003cli\u003eNotomi T, Mori Y, Tomita N, Kanda H (2015) Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. Journal of Microbiology 53:1-5\u003c/li\u003e\n\u003cli\u003eNotomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Research 28:E63\u003c/li\u003e\n\u003cli\u003eOkuda Y, Murakami S, Honda Y, Matsumoto T (2013) An MSH4 homolog, stpp1, from pleurotus pulmonarius is a silver bullet for resolving problems caused by spores in cultivated mushrooms. Applied and Environmental Microbiology 79:4520-4527\u003c/li\u003e\n\u003cli\u003eOlsen JA (1987) Pleurotus spores as allergens. Mushroom Journal 172:115-117\u003c/li\u003e\n\u003cli\u003ePanno S, Matić S, Tiberini A, Caruso AG, Bella P, Torta L, Stassi R, Davino S (2020) Loop mediated isothermal amplification: Principles and applications in plant virology. Plants 9: 461\u003c/li\u003e\n\u003cli\u003eQiao N, Dai H, Liu J, Zhu X, Li J, Zhang D, Liu Y (2020) Detection of melon necrotic spot virus by one-step reverse transcription loop-mediated isothermal amplification assay. PLoS ONE 15\u003c/li\u003e\n\u003cli\u003eRoyse DJ, Baars J, Tan Q (2017) Current overview of mushroom production in the world. In: Cunha Zied D, Pardo-Gim\u0026eacute;nez A (eds) Edible and Medicinal Mushrooms: Technology and Applications. John Wiley \u0026amp; Sons Ltd., pp 5-13\u003c/li\u003e\n\u003cli\u003eShirshikov FV, Bespyatykh JA (2022) Loop-Mediated Isothermal Amplification: From Theory to Practice. Russian Journal of Bioorganic Chemistry 48:1159-1174\u003c/li\u003e\n\u003cli\u003eSmulders MJM, van de Wiel CCM, Lotz LAP (2021) The Use of Intellectual Property Systems in Plant Breeding for Ensuring Deployment of Good Agricultural Practices. Agronomy 11:1163\u003c/li\u003e\n\u003cli\u003eSteens JA, Zhu Y, Taylor DW, Bravo JPK, Prinsen SHP, Schoen CD, Keijser BJF, Ossendrijver M, Hofstra LM, Brouns SJJ, Shinkai A, van der Oost J, Staals RHJ (2021) SCOPE enables type III CRISPR-Cas diagnostics using flexible targeting and stringent CARF ribonuclease activation. Nature Communications 12: 5033\u003c/li\u003e\n\u003cli\u003eTomlinson JA, Dickinson MJ, Boonham N (2010) Detection of Botrytis cinerea by loop-mediated isothermal amplification. Letters in Applied Microbiology 51:650-657\u003c/li\u003e\n\u003cli\u003eYasuhara-Bell J, Kubota R, Jenkins DM, Alvarez AM (2013) Loop-mediated amplification of the clavibacter michiganensis subsp. Michiganensis mica gene is highly specific. Phytopathology 103:1220-1226\u003c/li\u003e\n\u003cli\u003eZhao M, Shi Y, Wu L, Guo L, Liu W, Xiong C, Yan S, Sun W, Chen S (2016) Rapid authentication of the precious herb saffron by loop-mediated isothermal amplification (LAMP) based on internal transcribed spacer 2 (ITS2) sequence. Scientific Reports 6: 25370\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Oyster mushroom, Pleurotus ostreatus, LAMP, Plant Breeder’s Rights","lastPublishedDoi":"10.21203/rs.3.rs-6294117/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6294117/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis article describes the development of tools for the on-site identification of two closely related sporeless strains of Oyster mushroom, using either the LAMP technique or a modification of that technique. It allows for fast (within 30 minutes) identification of the commercially used strains SPOPPO and ALLERPO. Fast on-site answers on strain identity can be important when experiencing unexpected strain behavior or when strains are of suspect origin. Both strains are discriminated from sporulating strains by a LAMP reaction on the intact version of the \u003cem\u003emsh4\u003c/em\u003e gene; sporeless strains contain a \u003cem\u003emsh4\u003c/em\u003e gene with a large insert that renders the associated protein inactive. SPOPPO and ALLERPO are distinguished from each other by LAMP reactions that target genomic regions with strain specific recombinations.\u003c/p\u003e","manuscriptTitle":"On site discrimination between two closely related commercial strains of Oyster mushroom using a loop-mediated isothermal amplification (LAMP) test","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-10 08:20:47","doi":"10.21203/rs.3.rs-6294117/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-09T10:15:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-09T01:56:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"297099012667532434565159684216985250795","date":"2025-08-02T13:44:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"46573077060271507338574774813223375725","date":"2025-05-16T10:34:25+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-18T08:41:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"320366544355172576555282253074484218130","date":"2025-04-17T22:51:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-25T16:37:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-25T03:35:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-25T03:33:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2025-03-24T09:57:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d5091c49-53c6-4e54-ab69-6763bcce72d0","owner":[],"postedDate":"April 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-03T16:03:11+00:00","versionOfRecord":{"articleIdentity":"rs-6294117","link":"https://doi.org/10.1007/s11033-025-11156-0","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2025-10-28 15:58:34","publishedOnDateReadable":"October 28th, 2025"},"versionCreatedAt":"2025-04-10 08:20:47","video":"","vorDoi":"10.1007/s11033-025-11156-0","vorDoiUrl":"https://doi.org/10.1007/s11033-025-11156-0","workflowStages":[]},"version":"v1","identity":"rs-6294117","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6294117","identity":"rs-6294117","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}