Drosha regulates adipogenesis by modulating miR-204/miR-15b in OP9 cells

preprint OA: closed
Full text JSON View at publisher
Full text 130,377 characters · extracted from preprint-html · click to expand
Drosha regulates adipogenesis by modulating miR-204/miR-15b in OP9 cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Drosha regulates adipogenesis by modulating miR-204/miR-15b in OP9 cells Wenjun Xiao, Haoyu Wang, Jiaying liu, Weiqian Chen, Chuwen Lin, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7599201/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Mesenchymal stem cells (MSCs), being multipotent progenitors, have received the most widespread regulatory approval for commercialization as off-the-shelf cell therapies. Understanding the key molecular mechanisms regulating MSC differentiation is crucial for advancing their clinical utilization. Drosha is a critical enzyme in miRNA biogenesis. Despite its established role in diverse physiological processes, the involvement of Drosha in the adipogenic differentiation of MSCs has not been previously characterized. Here the role of Drosha/microRNA pathway in regulating the adipogenesis of OP9, a MSC derived from mouse bone marrow stroma, is characterized. Knocking down Drosha in OP9 significantly reduced its adipogenic capacity. Small RNA-seq analysis revealed that miR-204 and miR-15b were significantly downregulated in the adipogenic process of OP9 cells upon Drosha removal. Further exploration showed that the activity of ERK1/2, which has been shown to be able to suppress the transcriptional activity of PPARγ, was significantly increased in Drosha KO OP9 cells. Introducing miR-204 or miR-15b into OP9 cells significantly enhanced their adipogenic capacity and partially rescued the adipogenic defects caused by Drosha knockout. Mechanistically, miR-15b regulates ERK mediated adipogenic differentiation via repressing NRP2. Our data demonstrate that the Drosha/miR-15/NRP2 axis regulates adipogenesis of MSCs by modulating the ERK/PPARγ pathway. This discovery unveils a previously unappreciated molecular mechanism governing MSC adipogenic differentiation and suggests new avenues for exploring the therapeutic potential of MSCs. Biological sciences/Cell biology Biological sciences/Molecular biology Biological sciences/Stem cells adipogenesis OP9 ERK1/2 miR204 miR15b Drosha Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Mesenchymal stem cells (MSCs), as multipotent stromal progenitors, have been widely used for the treatment of various diseases due to their capacity for self-renewal and differentiation into multi lineages, including adipogenic, osteogenic, and chondrogenic ones(Margiana et al., 2022 ). To date, 12 MSC-based therapies have been approved by regulatory agencies for commercial use.(Fernández-Garza et al., 2023 ) Understanding the molecular mechanisms underlying MSC differentiation will significantly enhance their clinical applications (Lee et al., 2021 ; Matsuzaka and Yashiro, 2022 ; Xiong et al., 2021 ). Since MSCs represent a promising source for clinical treatment, gaining deeper insights into these molecular mechanisms is particularly important for advancing their therapeutic potential(Almalki and Agrawal, 2016 ). Although numerous studies have been conducted to identify the factors influencing the differentiation of mesenchymal stem cells (MSCs), much remains unknown—particularly regarding the adipogenic differentiation of MSCs. To date, PPARγ and EBF-1 are the most well-established factors that regulate adipogenesis(Nuttall and Gimble, 2004 ) , (Hesslein et al., 2009 ).Additionally, GATA-2 and The TWIST family of basic helix-loop-helix transcription factors have also been reported to play a regulatory role in adipogenic differentiation(Isenmann et al., 2009 ; Okitsu et al., 2007 ). However, the involvement of other factors, such as epigenetic mechanisms, in the regulatory network of MSC adipogenesis is still largely unclear. The OP9 cells, derived from mouse bone marrow stroma, serve as an in vitro model of MSC(Gao et al., 2010 ). The OP9 cells are capable of undergoing adipogenic differentiation in a manner that closely mimics the natural progression of adipogenesis and is highly reproducible(Wolins et al., 2006 ). Adipogenesis in OP9 cells ccan be induced through several approaches, including over-confluent culture conditions, treatment with Rosiglitazone and other methods(Yang et al., 2009 ; Zhu et al., 2022 ). Elucidating the adipogenic differentiation of OP9 cells can provide valuable insights into the molecular mechanisms that regulate the adipogenesis of MSCs in humans. Adipogenesis refers to the process by which MSCs differentiate into mature adipocytes(Robert et al., 2020 ). This process is tightly regulated by a complex interplay of transcription factors, signaling pathways, and other epigenetic factors, including microRNAs (miRNAs) and etc. (Peng et al., 2014 ; Zhu et al., 2022 ). MiRNAs are small non-coding RNA molecules which have been shown to modulate gene expression post-transcriptionally, thereby influencing various cellular processes, including cell proliferation and differentiation(Ambros, 2004 ; Houbaviy et al., 2003 ; Yanaihara et al., 2006 ; Yang et al., 2015 ). In the context of adipogenesis, numerous miRNAs have been found to exhibit altered expression levels, during adipogenesis, highlighting the significant involvement of the miRNA pathway in this process(Engin, 2017 ). Several specific miRNAs have been shown to either promote or inhibit the differentiation of adipocytes(Bibiloni et al., 2023 ; Engin, 2017 ; Esau et al., 2004 ). Drosha is a type III ribonuclease (RNase III) which functions as the catalytic subunit of the microprocessor complex, processing the primary miRNA transcripts into precursor miRNA in nucleus(Lee et al., 2003 ). Dicer, another member of the RNase III family, mediates the cleavage of precursor miRNAs into mature miRNAs in the cytoplasm(Rowley et al., 2016 ). Drosha and Dicer collaborate on the processing and maturation of miRNAs and play key roles in various cellular processes and physical functions(Denli et al., 2004 ). It has been observed that the expression levels of both Drosha and Dicer are changed in the process of adipogenesis(Martin et al., 2018 ). Additionally, multiple researches have shown the significant role of Dicer in the process of adipogenesis(Fujimoto et al., 2012 ; Mudhasani et al., 2010 ; Mudhasani et al., 2011 ). Mudhasani et al. demonstrated that Dicer is required for the early stages of adipogenic cell differentiation using primary cultures of fibroblasts and pre-adipocytes(Mudhasani et al., 2010 ). Furthermore, they showed that Dicer is necessary for the terminal differentiation of adipocytes in vivo and for the formation of white adipose tissue (WAT), but not brown adipose tissue (BAT)(Mudhasani et al., 2011 ). These findings underscore the importance of miRNAs in adipogenesis, however, the specific miRNAs and the mechanistic pathways through which Dicer act remain largely unknown. To date, the role of Drosha in adipogenic differentiation of MSCs has not been studied. The extracellular signal-regulated kinase (ERK)1/2 pathway is a well-characterized signaling cascade that plays a role in cell growth, differentiation, and metabolism(Sun et al., 2015 ). Recent studies have implicated the ERK1/2 pathway in the regulation of adipogenesis(Ma et al., 2023 ), with evidence suggesting that ERK1/2 phosphorylation can either promote or suppress adipocyte differentiation depending on the cellular context and the stage of differentiation(Li et al., 2011 ). Moreover, ERK1/2 pathway is regulated by various factor in a complex manner(Liao et al., 2024 ; Ma et al., 2023 ), the interplay between Drosha, miRNAs, and the ERK1/2 pathway in adipogenesis remains to be fully elucidated. Neuropilin-2 (NRP2) is a transmembrane receptor that was originally thought to be involved in angiogenesis and neuronal guidance(Favier et al., 2006 ; Grandclement et al., 2011 ; Takashima et al., 2002 ; Xu et al., 2010 ). NRP2 interacts with receptor tyrosine kinases (RTKs) and integrins to amplify ERK1/2 activation, thereby influencing cellular processes such as migration and differentiation(Fung et al., 2016 ; Lee et al., 2020 ). For instance, Previous studies demonstrated that NRP2 forms complexes with integrinα9β1 to enhance ERK phosphorylation, promoting endothelial cell proliferation, migration and lymphatic formation(Ou et al., 2015 ). Although this regulatory interaction makes NRP2 a key node in ERK-mediated cell formation control, its specific role in ERK regulated adipogenesis remains unexplored. In an effort to understand the role of Drosha in adipocyte differentiation, Drosha KO OP9 cells were constructed and examined. Drosha KO OP9 cells exhibited impaired adipogenesis. Similarly, Dicer KO OP9 cells showed a decreased adipogenic capacity comparable to that of Drosha KO cells. Transcriptome sequencing revealed that PPARγand its targets genes were significantly decreased, accompanied by elevated ERK1/2 pathway activity. Sustained activation of the ERK1/2 signaling pathway has been shown to be able to inhibit adipocyte differentiation(Wu et al., 2022 ). Small RNA sequencing identified downregulation of miR-204 and miR-15b, which can target the ERK pathway, in Drosha KO cells compared to Ctrl. Moreover, exogenous miR-15b mimics were able to enhance the adipogenic capacity of OP9 cells and rescue the adipogenic defects of Drosha KO OP9 cells. Additionally, Nrp2, a positive regulator of ERK1/2 pathway, was found to be upregulated in Drosha KO OP9 cells. Taken together, our work suggest that the Drosha/miR-15b/Nrp2/ERK axis regulates the PPARγinduced adipogenesis of MSCs, thereby advancing the current understanding of molecular mechanisms governing adipogenesis of MSCs and provide valuable insights for clinical drug therapy. Results Drosha depletion hinders the differentiation of OP9 cells into adipocytes To elucidate the role of Drosha in the process of OP9 differentiation into adipocyte, depletion of Drosha (Drosha KO) in OP9 was achieved using a CRISPR-Cas9 system. qPCR analysis confirmed an 80% reduction in Drosha expression in cells edited with gRNA1 CRISPR-Cas9 system (Figure 1A), which was subsequently utilized for further experiments. Phenotypic analysis revealed that depletion of Drosha significantly impaired adipogenic differentiation of OP9, as evidenced by reduced lipid droplet formation in Drosha KO cells (Figure 1B). Given Drosha’s central role in miRNA biogenesis, we hypothesized that the observed adipogenic defects were mediated through miRNA-dependent mechanisms. To test this hypothesis, we generated a Dicer1 KO model in OP9 cells, as Dicer1 is another essential enzyme in miRNA processing. The knockout efficiency was validated by qPCR, with the CRISPR-Cas9 system using gRNA mix achieving the highest knockout efficiency; therefore, this approach was used for the subsequent experiments (Figure 1C). Consistent with the Drosha KO results, Dicer1 KO also markedly inhibited adipogenic capacity of OP9 cells (Figure 1D). Collectively, these findings underscore the critical involvement of Drosha/Dicer1/miRNAs in regulating adipogenesis. ERK/PPARγ pathway is responsible for the decreased adipogenic capacity in Drosha depleted OP9 cells. To further elucidate the mechanistic role of Drosha in adipogenesis, RNA-seq analysis were conducted on Drosha-depleted OP9 cells and control cells after adipogenesis induction. Consistently with previous observation, Molecular Signatures Database (MSigDB) hallmark gene set enrichment analysis of differentially expressed genes revealed significantly downregulation of genes associated with adipogenesis and fatty acid metabolism in Drosha KO cells (Figure 2A left panel). GSVA analysis confirmed the downregulation of adipogenesis and fatty acid metabolism (Figure 2A right panel). RNA-seq analysis of Dicer1 KO and control cells was also performed. Consistently, enrichment analysis of MSigDB Chemical and genetic perturbations pathway on differentially expressed genes demonstrated decreased adipogenesis (Supplementary Figure S1A). Subsequent qPCR analysis validated the most significantly altered genes, including Adipoq, Orm1 and C3 in these pathways in both Drosha KO and Dicer1 KO cells (Figure 2B). The two major adipogenesis regulatory pathways, PPARγ and EBF-1, are subjected to further examination. Notably, PPARγ pathway is significantly decreased in both Drosha KO or Dicer1 KO cells compared to control cells, while EBF-1/2 are not altered in either one (Figure 2C, right panel, Supplementary Figure S1B and Figure S2, data were already uploaded to GEO, GSE300228). Western blot analysis validated the downregulation of PPARγ in protein level in Drosha KO and Dicer KO cells (Figure 2D). Further analysis of transcriptome of Drosha KO and Dicer1 KO cells were performed to uncover the molecular mechanism regulating the PPARγ. Wiki pathway enrichment analysis of the differentially expressed genes revealed that the MAPK signaling pathway is significantly upregulated in both Drosha and Dicer1 KO cells (Figure 3A and Supplementary Figure S1C). The most deregulated genes, including Fos, Nlk, Nr4a1, Gadd45a, Il1a, and Sos2 were analyzed by qPCR, which confirmed the observation in RNA seq (Figure 3B). MAPKs, a family of evolutionarily conserved serine-threonine kinases, are known to play a pivotal role in regulating lipid metabolism, particularly through the ERK1/2 subfamily(Wu et al., 2022). To determine whether ERK1/2 is activated in Drosha depleted cells, western blot analysis was performed. The results displayed a significant upregulation of phosphorylated ERK1/2 (pERK1/2) in both Drosha and Dicer1 KO OP9 cells (Figure 3C). Previous studies demonstrated that ERK1/2 activation results in suppression of the transcriptional activity of PPARγ, suggesting that the upregulation of the MAPK/ERK pathway in Drosha and Dicer1 KO cells underlies the impaired adipogenic differentiation observed in these models. An ERK inhibitor reverses Drosha knockout-induced adipogenesis inhibition To verify whether Drosha regulates adipogenesis through an ERK signaling-dependent mechanism, the ERK1/2-specific inhibitor PD98059 was applied to OP9 cells in the process of adipogenesis. Notably, inhibition of ERK signaling significantly rescued the impaired adipogenic differentiation caused by either Drosha or Dicer1 knockout (Figure 4A). Subsequent western blot analysis confirmed that PD98059 effectively suppressed pERK1/2 levels (Figure 4B). These findings provide direct evidence that the inhibition of adipogenesis in Drosha and Dicer1 KO cells is mediated, at least in part, through the activation of the ERK signaling pathway. Drosha regulates the MAPK/ERK via miR-15b Since both Drosha and Dicer play essential roles in the adipogenesis of MSCs and are involved in the processing of microRNAs, it is reasonable to hypothesize that miRNAs contribute to this process. To identify the specific miRNAs involved, small RNA sequencing was performed on adipogenic Drosha KO and control OP9 cells. Among the most significantly dysregulated miRNAs, miR-204 and miR-15b were identified as key candidates, as both have been previously reported to be linked to ERK1/2 signaling(Chen et al., 2021; Zheng et al., 2013) (Figure 5A, data were already uploaded to GEO, GSE300227). Subsequent qPCR analysis confirmed a decrease of miR-204 and miR-15b expression (Figure 5B). Although miR-204 and miR-15b has been linked to ERK1/2 signaling, whether it regulates adipogenesis has never been studied. To investigate the role of miR-204 and miR-15b in the adipogenesis, OP9 cells transfected with miR-204-5p and miR15b-5p mimics were subjected to adipogenic differentiation. Both miR-204-5p and miR15b-5p significantly enhanced the adipogenic capacity of OP9 cells (Supplementary Figure S3). A literature review revealed that miR-204 targets ERK1/2 related genes Muc4 (Xie et al., 2022), Vasp (Liu et al., 2018), and Foxo1 (Liang et al., 2020), while miR-15b indirectly modulates ERK1/2 phosphorylation by targeting Nrp2 (Zheng et al., 2013). Muc4 was not expressed in OP9 cells. Transcript abundance of other established targets of miR-204 or miR-15b was assessed by qPCR analysis. The results showed that only Nrp2 expression was significantly upregulated in both Drosha KO and Dicer KO cells during adipogenic differentiation, suggesting its potential role in the Drosha/miRNA regulated adipogenesis of MSCs (Supplementary Figure S4). Luciferase activity assays were employed to further confirm that the expression of Nrp2 can be ascribed to the specific interaction between miR-15b and the binding sites for miR-15b in the 3’UTR of Nrp2 . Our data show that the miR-15b mimic targets the predicted binding site within the Nrp2 mRNA 3’-UTR, as it decreased the luciferase activity in 293T cells transfected with a luciferase reporter vector containing the predicted binding site of Nrp2 mRNA (Figure 5C). To further validate the functional involvement of these miRNAs in adipogenesis, exogenous miR-15b mimics was transfected into Drosha KO or Dicer KO OP9 cells (Figure 5D). This intervention significantly enhanced adipogenic capacity of both Drosha KO and Dicer KO cells compared to control cells (Figure 5E), as evaluated with Oil Red O staining. To confirm the intervention effect of miR-15b is exaggerated through modulating MAPK/ERK signaling, pERK1/2 levels was examined. Results showed that transfection of miR-15b mimic significantly suppressed pERK1/2 in Drosha KO and Dicer KO cells (Figure 6A). Consistently, NRP2 was downregulated while the level of PPARγwas partially restored in these cells (Figure 6B). Collectively, these findings suggest that Drosha regulates adipogenesis through the miR-15b-mediated modulation of the ERK signaling pathway. Discussion Our study delineates a critical role for Drosha in the adipogenic differentiation of OP9 cells. Drosha knockout suppresses the expression of miR-204 and miR-15b. MiR-15b is able to enhance the PPARγ-driven adipogenesis of MSCs through inhibiting MAPK/ERK via NRP2. This discovery advances our understanding of the molecular mechanisms underlying adipogenesis and provides comprehensive understanding into the regulation of this process by miRNAs. The escalating global prevalence of obesity and its metabolic comorbidities has positioned therapeutic interventions and preventive strategies targeting this multifaceted disorder as a critical frontier in biomedical research(Gregg and Shaw, 2017 ). Overweight and obesity, characterized by abnormal or excessive fat accumulation(Piché et al., 2020 ), are key factors in a variety of metabolic diseases, including cardiovascular disease, type 2 diabetes, nonalcoholic fatty liver disease, hypertension, and cancer(Bianchini et al., 2002 ; Després and Lemieux, 2006 ). According to previous reports, hyperplasia and hypertrophy of adipocytes, as the main cause of obesity, largely depend on the regulation of adipogenesis(Haider and Larose, 2019 ; Naaz et al., 2004 ; Zhao et al., 2021 ). Our studies highlight Drosha /miR15b/NRP2 axis in the regulation of adipogenesis and provide a novel target for treating obesity related metabolic disorder. Our findings demonstrate that miR-15b directly targets NRP2, suppressing ERK1/2 activity to enhance PPARγ-driven adipogenesis. Moreover, both antagomir-15b and delivery of miR-15b have been utilized to alleviate various diseases, including diabetic encephalopathy, diabetic nephropathy, encephalitis, diabetic osteoporosis in animal models(Jiang et al., 2022 ; Tsai et al., 2020 ; Xu et al., 2024 ; Zhu et al., 2015 ). This suggests that miR-15b is a promising therapeutic target for modulating adipose tissue development in vivo. Beyond miR-15b, miR-204 is also downregulated after Drosha gene knockout. It is plausible that more than one miRNA are involved in the adipogenesis of MSCs. These findings are consistent with previous studies that have highlighted the critical roles of miRNAs in adipogenesis(He et al., 2015 ; Huang et al., 2010 ; Kim et al., 2020 ). The role of miR-204 and miR-15b in adipogenesis was further demonstrated by their ability to regulate the expression of genes involved in this process. Although our results confirmed that miR-15b regulates the lipogenic differentiation of OP9 cells through the regulation of ERK1/2 through Nrp2, the specific targets and functions of miR-204 in adipocyte formation remain to be fully characterized. According to other studies, miR-204 has been reported to regulate the expression of genes such as Runx2, Muc4, Vasp and Foxo1, and to target multiple genes involved in adipocyte differentiation, tumor development, cell migration, and immune response(Liang et al., 2020 ; Liu et al., 2018 ; Xie et al., 2022 ). Unfortunately, we did not detect a significant alteration of these targets. Through bioinformatics analysis and experimental verification, we can further explore new targets of miR-204 in adipocyte differentiation(Alexander et al., 2011 ; Chen et al., 2019 ), which may provide a new perspective for understanding the molecular mechanism of adipocyte differentiation. The implications of our findings extend beyond the basic understanding of adipogenesis. Given the role of adipose tissue in metabolic regulation and disease, these findings may have therapeutic relevance, because the identification of miRNAs that can modulate adipogenic differentiation offers potential avenues for the development of interventions targeting metabolic disorders such as obesity and diabetes(Ji and Guo, 2019 ; Lorente-Cebrián et al., 2019 ; Zaiou et al., 2018 ). our study reveals a novel mechanism by which Drosha regulates adipogenesis through the modulation of miR-204 and miR-15b, and highlights the importance of these miRNAs in the control of ERK1/2 signaling. These findings contribute to the understanding of the molecular underpinnings of adipocyte differentiation and may have implications for the development of therapeutic strategies targeting adipose tissue. Methods Cell Culture and Maintenance OP9 is a stromal cell line derived from mouse bone marrow. OP9 cells used in current research was purchased from (Chinese Academy of Sciences Cell Bank, GNM17). The cell line was tested for mycoplasma contamination in CASCB and was confirmed negative. The cells were also subjected to bacterial contamination test and fungal contamination test, both of which were negative. In addition, short tandem repeat (STR) profiling was performed and verified that the cell line is of mouse origin, with no evidence of human or other species contamination. OP9 cells were maintained in MEMα (Gibco, C12571500BT) supplemented with 20% FBS (Excell, FSP500) and 1% penicillin–streptomycin at 37 °C in 5% CO₂. Medium was refreshed every two days. Cells were cultured to 90% confluence and passaged at a ratio of one to five. OP9 cells at passages 5–15 were used for experiments. OP9 cells were freezed in 90% FBS + 10% DMSO. For ERK inhibition, confluent cultures were treated with 30 μM PD98059 (MedChemExpress, HY-12028) for 10 days. Mycoplasma contamination was assessed by PCR using culture medium as template, with primer sequences provided in Table S1. Plasmid construction For lentiviral CRISPR/Cas9-mediated knockout, the sgRNA targeting Drosha or Dicer1 was cloned into the lenti-CRISPRv2 (Addgene, #52961) vector with an hSpCas9 expression cassette. For dual luciferase reporter assay, 80 nucleotide sequence partially complementary to miR-15b found in the 3’-UTR of Nrp-2 mRNA (GTTGCATATCAGTGGTAAACTGTCTGACCGTTTTTTTTGCTGCTGTGATCACCCACAATTTCATTTGTCTTGCACCCAGG) or a mutated 3’-UTR of Nrp-2 mRNA was cloned into psiCheck2 (Addgene, #78260) to generate psiCheck2-NRP2 or psiCheck2-mut-NRP2 vector, respectively. Lentivirus packaging For lentivirus packaging, HEK293T cells were co-transfected with lentiviral vectors, psPAX2 (Addgene, #12260) and pMD2G (Addgene, #12259) using PEI (Yeasen, MW40000). Viruses were harvested 48 h after transfection and filtered with 0.45 μm membrane. The viral titer was subsequently determined. Adipogenic differentiation Adipogenesis of OP9 cells were induced in two ways. Over-confluence culture: OP9 cells were plated and allowed to grow to over-confluence. The medium was changed every two days until lipid droplets were clearly observed under a microscope. Rosiglitazone induction: OP9 cells were plated, and rosiglitazone was added to the medium at a concentration of 1 μM when the cells reached 100% confluence. This treatment was continued for 10 days. Mimic Transfection Mimics and MCE transfection reagent (MedChemExpress, HY-K1014) were mixed with serum-free medium and incubated for 15 minutes. The mixture was subsequently added to complete medium without antibiotics. The mixture was then incubated with OP9 cells 8 hours, followed by medium change. Oil Red O Staining 0.35g of Oil Red O powder was dissolved in 100mL isopropanol, stored in the dark at 4°C. Cells were fixed with 4% paraformaldehyde at room temperature for 1 hour, washed three times with 1×PBS, and then air-dried completely. The cells were then incubated with working solution (Oil Red O stock solution : ddH2O = 6:4) at room temperature in the dark for 1 hour. qRT-PCR Total RNA preparation of OP9 cells was done by Ultrapure RNA Kit (Omega, R6834-02) according to the manufacturer’s instructions. Reverse transcription was done using HiScript® III RT SuperMix and genomic DNA wiper (Vazyme, R323-01). cDNA was subjected to qRT-PCR analysis using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02). For quantative PCR of miRNAs, stem-loop miR15b or miR2-4 cDNA were synthesized by miRNA 1st Strand cDNA Synthesis Kit (Vazyme, MR101) and subjected to qRT-PCR analysis using miRNA Universal SYBR qPCR Master Mix(Vazyme, MQ101). Gapdh was used as an internal control to normalize mRNA. U6 was used as an internal control to normalize miRNA expression. The primers used in qRT-PCR are listed in Supplementary Table 1. Western Blot Cells were lysed using pre-cooled RIPA buffer with protease inhibitor cocktail (APExBIO, K1007) and Phosphatase inhibitors cocktail (APExBIO, K1012) for 30-45 min on ice. Pierce™ BCA Protein Assay Kits (ThermoFisher, 23227) was used to determine the concentration. Equal amount of protein was loaded and separated by 10% SDS-PAGE. SDS-polyacrylamide gel electrophoresis and immunoblot analyses were performed as described previously(Lu et al., 2023) Antibody The following antibodies and dilution ratios were used: ERK1/2 (4A4ERK1/2 Mouse mAb; Zen BioScience,201245-4A4) 1:1000 dilution, pERK1/2 (Phospho-ERK1/2 (Thr202/Tyr204)/(Thr185/Tyr187) Rabbit pAb; Zen BioScience, 301245) 1:1000 dilution, β-actin (β-Actin (13E5) Rabbit mAb; Cell Signaling Technology, 4970L) 1:1000 dilution, NRP2 (Neuropilin-2 Rabbit pAb; Immunoway, YT5230)1:1000 dilution, PPARγ(Recombinant Rabbit mAb; Abways, CY6675)1:1000 dilution, Goat Anti-Mouse IgG H&L, HRP conjugated(Bioss, bs-0296G-HRP) 1:10000 dilution, Goat Anti-Rabbit IgG H&L, HRP conjugated(Bioss, bs-0295G-HRP) 1:10000 dilution. Analysis of mRNA sequencing data The total RNA of OP9 cells was extracted using Ultrapure RNA Kit (CW BIO, CW0581M) and sent to BGI for library preparation and sequencing by MGISEQ2000. Transcript abundances were quantified using the kallisto (version 0.48.0) under default settings. The transcript-level abundance estimates results were then imported into the R package tximport to summarize the gene-level abundance estimates for downstream analysis. Gene Ontology analysis and the Molecular Signatures Database (MSigDB) gene set analysis were conducted by the “clusterProfiler”R-package. Gene set variation analysis (GSVA) was performed with the “GSVA” R package. Adjusted p-value<0.05 was set as the threshold for statistical significance. Statistical analysis GraphPad Prism 9.0 was used to do the statistical analysis and generate all the graphs. Two-way ANOVA and one-way ANOVA were used to detect the differences among multiple groups, and T-test was used for comparison between two groups. At least three independent experiments were done for each analysis. Analysis of miRNA sequencing data Clean reads were aligned to the murine rRNA genome using Bowtie2 (v2.5.1), and unmapped sequences were retained for downstream analysis. Filtered reads were subsequently mapped to the Mus musculus GRCm38 reference genome (GENCODE vM23) using the mapper.pl module from the miRDeep2 suite, with a minimum read length of 18 nucleotides (-l 18). Known miRNAs were quantified via the quantifier.pl module after converting uracil to thymine in mature (mature.fa) and precursor (hairpin.fa) miRNA sequences from the miRBase database (v22.1). Differentially expressed miRNAs (DEMs) were identified using the edgeR package. Sequencing depth variation was normalized by the TMM method, and a generalized linear model (glmFit) was applied to assess inter-group differences. DEMs were defined as those with |log2(fold change)| ≥ 1 and a false discovery rate (FDR) < 0.05 (Benjamini-Hochberg correction). Volcano plots were generated using ggplot2, highlighting the top five most significant upregulated and downregulated miRNAs (lowest FDR). Target genes of DEMs were predicted and subjected to functional enrichment analysis (Gene Ontology and KEGG pathways) using the clusterProfiler package. Statistical significance was set at an adjusted p-value < 0.05. Declarations Acknowledgements and Funding Information The authors acknowledge Dr. Hailong Zhang for providing the psiCheck2 plasmid, Sun Yat-sen University School of Medicine for providing the experimental platform and instruments. The study was supported by the Program of Shenzhen Key Laboratory for Systems Medicine in Inflammatory Diseases (ZDSYS20220606100803007), Shenzhen Science and Technology program (JCYJ20240813151024032) , the GuangDong Basic and Applied Basic Research Foundation (2024A1515013147 2024A1515013077 and 2025A1515011679), the National Natural Science Foundation of China (82271899 and 32200927). Authors contributions X Jiang, X Li and W Xiao constructed the research. X Jiang and X Li supervised the whole project. W Xiao and H Wang performed the experiments. W Xiao and H Wang collected and analyzed the data. J Liu performed bioinformatic analyses. X Jiang, W Xiao and H Wang wrote the manuscript. All authors read and approved the final manuscript. Data availability statement The RNA sequencing data and small RNA sequencing data were both deposited to GEO, and are available through the following accession numbers: GSE300227 and GSE300228. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. Additional Information Competing Interests Statement The authors declare that they have no conflicts of interest that could compromise the objectivity of this research. Lead contactCompeting Interests Statement Information requests can be directed to the lead contact, Xuan Jiang ( [email protected] ) Materials availability Materials used in this study are available from the lead contact, Xuan Jiang, upon request. Supplemental information Document S1. Figures S1–S6 and Table S1. References Alexander, R., Lodish, H., and Sun, L. (2011). MicroRNAs in adipogenesis and as therapeutic targets for obesity. Expert Opin Ther Targets 15 , 623-636. Almalki, S.G., and Agrawal, D.K. (2016). Key transcription factors in the differentiation of mesenchymal stem cells. Differentiation 92 , 41-51. Ambros, V. (2004). The functions of animal microRNAs. Nature 431 , 350-355. Bianchini, F., Kaaks, R., and Vainio, H. (2002). Overweight, obesity, and cancer risk. Lancet Oncol 3 , 565-574. Bibiloni, P., Pomar, C.A., Palou, A., Sánchez, J., and Serra, F. (2023). miR-222 exerts negative regulation on insulin signaling pathway in 3T3-L1 adipocytes. Biofactors 49 , 365-378. Chen, J., Luo, X., Liu, M., Peng, L., Zhao, Z., He, C., and He, Y. (2021). Silencing long non-coding RNA NEAT1 attenuates rheumatoid arthritis via the MAPK/ERK signalling pathway by downregulating microRNA-129 and microRNA-204. RNA Biol 18 , 657-668. Chen, L., Heikkinen, L., Wang, C., Yang, Y., Sun, H., and Wong, G. (2019). Trends in the development of miRNA bioinformatics tools. Brief Bioinform 20 , 1836-1852. Denli, A.M., Tops, B.B., Plasterk, R.H., Ketting, R.F., and Hannon, G.J. (2004). Processing of primary microRNAs by the Microprocessor complex. Nature 432 , 231-235. Després, J.P., and Lemieux, I. (2006). Abdominal obesity and metabolic syndrome. Nature 444 , 881-887. Engin, A.B. (2017). MicroRNA and Adipogenesis. Adv Exp Med Biol 960 , 489-509. Esau, C., Kang, X., Peralta, E., Hanson, E., Marcusson, E.G., Ravichandran, L.V., Sun, Y., Koo, S., Perera, R.J., Jain, R. , et al. (2004). MicroRNA-143 regulates adipocyte differentiation. J Biol Chem 279 , 52361-52365. Favier, B., Alam, A., Barron, P., Bonnin, J., Laboudie, P., Fons, P., Mandron, M., Herault, J.P., Neufeld, G., Savi, P. , et al. (2006). Neuropilin-2 interacts with VEGFR-2 and VEGFR-3 and promotes human endothelial cell survival and migration. Blood 108 , 1243-1250. Fernández-Garza, L.E., Barrera-Barrera, S.A., and Barrera-Saldaña, H.A. (2023). Mesenchymal Stem Cell Therapies Approved by Regulatory Agencies around the World. Pharmaceuticals (Basel) 16 . Fujimoto, Y., Nakagawa, Y., Shingyouchi, A., Tokushige, N., Nakanishi, N., Satoh, A., Matsuzaka, T., Ishii, K.A., Iwasaki, H., Kobayashi, K. , et al. (2012). Dicer has a crucial role in the early stage of adipocyte differentiation, but not in lipid synthesis, in 3T3-L1 cells. Biochem Biophys Res Commun 420 , 931-936. Fung, T.M., Ng, K.Y., Tong, M., Chen, J.N., Chai, S., Chan, K.T., Law, S., Lee, N.P., Choi, M.Y., Li, B. , et al. (2016). Neuropilin-2 promotes tumourigenicity and metastasis in oesophageal squamous cell carcinoma through ERK-MAPK-ETV4-MMP-E-cadherin deregulation. J Pathol 239 , 309-319. Gao, J., Yan, X.L., Li, R., Liu, Y., He, W., Sun, S., Zhang, Y., Liu, B., Xiong, J., and Mao, N. (2010). Characterization of OP9 as authentic mesenchymal stem cell line. J Genet Genomics 37 , 475-482. Grandclement, C., Pallandre, J.R., Valmary Degano, S., Viel, E., Bouard, A., Balland, J., Rémy-Martin, J.P., Simon, B., Rouleau, A., Boireau, W. , et al. (2011). Neuropilin-2 expression promotes TGF-β1-mediated epithelial to mesenchymal transition in colorectal cancer cells. PLoS One 6 , e20444. Gregg, E.W., and Shaw, J.E. (2017). Global Health Effects of Overweight and Obesity. N Engl J Med 377 , 80-81. Haider, N., and Larose, L. (2019). Harnessing adipogenesis to prevent obesity. Adipocyte 8 , 98-104. He, H., Chen, K., Wang, F., Zhao, L., Wan, X., Wang, L., and Mo, Z. (2015). miR-204-5p promotes the adipogenic differentiation of human adipose-derived mesenchymal stem cells by modulating DVL3 expression and suppressing Wnt/β-catenin signaling. Int J Mol Med 35 , 1587-1595. Hesslein, D.G., Fretz, J.A., Xi, Y., Nelson, T., Zhou, S., Lorenzo, J.A., Schatz, D.G., and Horowitz, M.C. (2009). Ebf1-dependent control of the osteoblast and adipocyte lineages. Bone 44 , 537-546. Houbaviy, H.B., Murray, M.F., and Sharp, P.A. (2003). Embryonic stem cell-specific MicroRNAs. Dev Cell 5 , 351-358. Huang, J., Zhao, L., Xing, L., and Chen, D. (2010). MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells 28 , 357-364. Isenmann, S., Arthur, A., Zannettino, A.C., Turner, J.L., Shi, S., Glackin, C.A., and Gronthos, S. (2009). TWIST family of basic helix-loop-helix transcription factors mediate human mesenchymal stem cell growth and commitment. Stem Cells 27 , 2457-2468. Ji, C., and Guo, X. (2019). The clinical potential of circulating microRNAs in obesity. Nat Rev Endocrinol 15 , 731-743. Jiang, L., Yuan, N., Zhao, N., Tian, P., Zhang, D., Qin, Y., Shi, Z., Gao, Z., Zhang, N., Zhou, H. , et al. (2022). Advanced glycation end products induce Aβ(1-42) deposition and cognitive decline through H19/miR-15b/BACE1 axis in diabetic encephalopathy. Brain Res Bull 188 , 187-196. Kim, N.H., Ahn, J., Choi, Y.M., Son, H.J., Choi, W.H., Cho, H.J., Yu, J.H., Seo, J.A., Jang, Y.J., Jung, C.H. , et al. (2020). Differential circulating and visceral fat microRNA expression of non-obese and obese subjects. Clin Nutr 39 , 910-916. Lee, G., Kang, Y.E., Oh, C., Liu, L., Jin, Y., Lim, M.A., Won, H.R., Chang, J.W., and Koo, B.S. (2020). Neuropilin-2 promotes growth and progression of papillary thyroid cancer cells. Auris Nasus Larynx 47 , 870-880. Lee, P.-W., Wu, B.-S., Yang, C.-Y., and Lee, O.K.-S. (2021). Molecular mechanisms of mesenchymal stem cell-based therapy in acute kidney injury. International journal of molecular sciences 22 , 11406. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Rådmark, O., Kim, S. , et al. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425 , 415-419. Li, F., Yang, H., Duan, Y., and Yin, Y. (2011). Myostatin regulates preadipocyte differentiation and lipid metabolism of adipocyte via ERK1/2. Cell Biol Int 35 , 1141-1146. Liang, C.Y., Huang, Z.G., Tang, Z.Q., Xiao, X.L., Zeng, J.J., and Feng, Z.B. (2020). FOXO1 and hsa-microRNA-204-5p affect the biologic behavior of MDA-MB-231 breast cancer cells. Int J Clin Exp Pathol 13 , 1146-1158. Liao, Z., Zheng, X., Li, H., Deng, Z., Feng, S., Tan, H., and Zhao, L. (2024). Carboxypeptidase M modulates BMSCs osteogenesis–adipogenesis via the MAPK/ERK pathway: An integrated single‐cell and bulk transcriptomic study. The FASEB Journal 38 , e23657. Liu, Z., Wang, Y., Dou, C., Xu, M., Sun, L., Wang, L., Yao, B., Li, Q., Yang, W., Tu, K. , et al. (2018). Hypoxia-induced up-regulation of VASP promotes invasiveness and metastasis of hepatocellular carcinoma. Theranostics 8 , 4649-4663. Lorente-Cebrián, S., González-Muniesa, P., Milagro, F.I., and Martínez, J.A. (2019). MicroRNAs and other non-coding RNAs in adipose tissue and obesity: emerging roles as biomarkers and therapeutic targets. Clin Sci (Lond) 133 , 23-40. Lu, Y., Cao, Q., Yu, Y., Sun, Y., Jiang, X., and Li, X. (2023). Pan-cancer analysis revealed H3K4me1 at bivalent promoters premarks DNA hypermethylation during tumor development and identified the regulatory role of DNA methylation in relation to histone modifications. BMC Genomics 24 , 235. Ma, X., Yang, X., Zhang, D., Zhang, W., Wang, X., Xie, K., He, J., Mei, C., and Zan, L. (2023). RNA-seq analysis reveals the critical role of the novel lncRNA BIANCR in intramuscular adipogenesis through the ERK1/2 signaling pathway. J Anim Sci Biotechnol 14 , 21. Margiana, R., Markov, A., Zekiy, A.O., Hamza, M.U., Al-Dabbagh, K.A., Al-Zubaidi, S.H., Hameed, N.M., Ahmad, I., Sivaraman, R., Kzar, H.H. , et al. (2022). Clinical application of mesenchymal stem cell in regenerative medicine: a narrative review. Stem Cell Res Ther 13 , 366. Martin, E.C., Qureshi, A.T., Llamas, C.B., Burow, M.E., King, A.G., Lee, O.C., Dasa, V., Freitas, M.A., Forsberg, J.A., Elster, E.A. , et al. (2018). Mirna biogenesis pathway is differentially regulated during adipose derived stromal/stem cell differentiation. Adipocyte 7 , 96-105. Matsuzaka, Y., and Yashiro, R. (2022). Therapeutic strategy of mesenchymal-stem-cell-derived extracellular vesicles as regenerative medicine. International Journal of Molecular Sciences 23 , 6480. Mudhasani, R., Imbalzano, A.N., and Jones, S.N. (2010). An essential role for Dicer in adipocyte differentiation. J Cell Biochem 110 , 812-816. Mudhasani, R., Puri, V., Hoover, K., Czech, M.P., Imbalzano, A.N., and Jones, S.N. (2011). Dicer is required for the formation of white but not brown adipose tissue. J Cell Physiol 226 , 1399-1406. Naaz, A., Holsberger, D.R., Iwamoto, G.A., Nelson, A., Kiyokawa, H., and Cooke, P.S. (2004). Loss of cyclin-dependent kinase inhibitors produces adipocyte hyperplasia and obesity. Faseb j 18 , 1925-1927. Nuttall, M.E., and Gimble, J.M. (2004). Controlling the balance between osteoblastogenesis and adipogenesis and the consequent therapeutic implications. Curr Opin Pharmacol 4 , 290-294. Okitsu, Y., Takahashi, S., Minegishi, N., Kameoka, J., Kaku, M., Yamamoto, M., Sasaki, T., and Harigae, H. (2007). Regulation of adipocyte differentiation of bone marrow stromal cells by transcription factor GATA-2. Biochem Biophys Res Commun 364 , 383-387. Ou, J.J., Wei, X., Peng, Y., Zha, L., Zhou, R.B., Shi, H., Zhou, Q., and Liang, H.J. (2015). Neuropilin-2 mediates lymphangiogenesis of colorectal carcinoma via a VEGFC/VEGFR3 independent signaling. Cancer Lett 358 , 200-209. Peng, Y., Yu, S., Li, H., Xiang, H., Peng, J., and Jiang, S. (2014). MicroRNAs: emerging roles in adipogenesis and obesity. Cell Signal 26 , 1888-1896. Piché, M.E., Tchernof, A., and Després, J.P. (2020). Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ Res 126 , 1477-1500. Robert, A.W., Marcon, B.H., Dallagiovanna, B., and Shigunov, P. (2020). Adipogenesis, Osteogenesis, and Chondrogenesis of Human Mesenchymal Stem/Stromal Cells: A Comparative Transcriptome Approach. Front Cell Dev Biol 8 , 561. Rowley, J.W., Chappaz, S., Corduan, A., Chong, M.M., Campbell, R., Khoury, A., Manne, B.K., Wurtzel, J.G., Michael, J.V., Goldfinger, L.E. , et al. (2016). Dicer1-mediated miRNA processing shapes the mRNA profile and function of murine platelets. Blood 127 , 1743-1751. Sun, Y., Liu, W.Z., Liu, T., Feng, X., Yang, N., and Zhou, H.F. (2015). Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduct Res 35 , 600-604. Takashima, S., Kitakaze, M., Asakura, M., Asanuma, H., Sanada, S., Tashiro, F., Niwa, H., Miyazaki Ji, J., Hirota, S., Kitamura, Y. , et al. (2002). Targeting of both mouse neuropilin-1 and neuropilin-2 genes severely impairs developmental yolk sac and embryonic angiogenesis. Proc Natl Acad Sci U S A 99 , 3657-3662. Tsai, Y.C., Kuo, M.C., Hung, W.W., Wu, L.Y., Wu, P.H., Chang, W.A., Kuo, P.L., and Hsu, Y.L. (2020). High Glucose Induces Mesangial Cell Apoptosis through miR-15b-5p and Promotes Diabetic Nephropathy by Extracellular Vesicle Delivery. Mol Ther 28 , 963-974. Wolins, N.E., Quaynor, B.K., Skinner, J.R., Tzekov, A., Park, C., Choi, K., and Bickel, P.E. (2006). OP9 mouse stromal cells rapidly differentiate into adipocytes: characterization of a useful new model of adipogenesis. J Lipid Res 47 , 450-460. Wu, S.C., Lo, Y.M., Lee, J.H., Chen, C.Y., Chen, T.W., Liu, H.W., Lian, W.N., Hua, K., Liao, C.C., Lin, W.J. , et al. (2022). Stomatin modulates adipogenesis through the ERK pathway and regulates fatty acid uptake and lipid droplet growth. Nat Commun 13 , 4174. Xie, Z., Chen, J., and Chen, Z. (2022). MicroRNA-204 attenuates oxidative stress damage of renal tubular epithelial cells in calcium oxalate kidney-stone formation via MUC4-mediated ERK signaling pathway. Urolithiasis 50 , 1-10. Xiong, J., Hu, H., Guo, R., Wang, H., and Jiang, H. (2021). Mesenchymal Stem Cell Exosomes as a New Strategy for the Treatment of Diabetes Complications. Front Endocrinol (Lausanne) 12 , 646233. Xu, C., Wang, Z., Liu, Y., Duan, K., and Guan, J. (2024). Delivery of miR-15b-5p via magnetic nanoparticle-enhanced bone marrow mesenchymal stem cell-derived extracellular vesicles mitigates diabetic osteoporosis by targeting GFAP. Cell Biol Toxicol 40 , 52. Xu, Y., Yuan, L., Mak, J., Pardanaud, L., Caunt, M., Kasman, I., Larrivée, B., Del Toro, R., Suchting, S., Medvinsky, A. , et al. (2010). Neuropilin-2 mediates VEGF-C-induced lymphatic sprouting together with VEGFR3. J Cell Biol 188 , 115-130. Yanaihara, N., Caplen, N., Bowman, E., Seike, M., Kumamoto, K., Yi, M., Stephens, R.M., Okamoto, A., Yokota, J., Tanaka, T. , et al. (2006). Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9 , 189-198. Yang, H., Youm, Y.H., and Dixit, V.D. (2009). Inhibition of thymic adipogenesis by caloric restriction is coupled with reduction in age-related thymic involution. J Immunol 183 , 3040-3052. Yang, N., Ekanem, N.R., Sakyi, C.A., and Ray, S.D. (2015). Hepatocellular carcinoma and microRNA: new perspectives on therapeutics and diagnostics. Adv Drug Deliv Rev 81 , 62-74. Zaiou, M., El Amri, H., and Bakillah, A. (2018). The clinical potential of adipogenesis and obesity-related microRNAs. Nutr Metab Cardiovasc Dis 28 , 91-111. Zhao, G.N., Tian, Z.W., Tian, T., Zhu, Z.P., Zhao, W.J., Tian, H., Cheng, X., Hu, F.J., Hu, M.L., Tian, S. , et al. (2021). TMBIM1 is an inhibitor of adipogenesis and its depletion promotes adipocyte hyperplasia and improves obesity-related metabolic disease. Cell Metab 33 , 1640-1654.e1648. Zheng, X., Chopp, M., Lu, Y., Buller, B., and Jiang, F. (2013). MiR-15b and miR-152 reduce glioma cell invasion and angiogenesis via NRP-2 and MMP-3. Cancer Lett 329 , 146-154. Zhu, B., Ye, J., Nie, Y., Ashraf, U., Zohaib, A., Duan, X., Fu, Z.F., Song, Y., Chen, H., and Cao, S. (2015). MicroRNA-15b Modulates Japanese Encephalitis Virus-Mediated Inflammation via Targeting RNF125. J Immunol 195 , 2251-2262. Zhu, S., Wang, W., Zhang, J., Ji, S., Jing, Z., and Chen, Y.Q. (2022). Slc25a5 regulates adipogenesis by modulating ERK signaling in OP9 cells. Cell Mol Biol Lett 27 , 11. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure.pdf SupplementaryTable1PrimersequencesforalltheqRT.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 10 Apr, 2026 Reviews received at journal 28 Oct, 2025 Reviewers agreed at journal 20 Oct, 2025 Reviewers agreed at journal 19 Oct, 2025 Reviewers invited by journal 14 Oct, 2025 Editor assigned by journal 13 Oct, 2025 Editor invited by journal 29 Sep, 2025 Submission checks completed at journal 24 Sep, 2025 First submitted to journal 24 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7599201","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":536048465,"identity":"135d9b48-a7b0-4ca4-b29c-6efdd4b9712e","order_by":0,"name":"Wenjun Xiao","email":"","orcid":"","institution":"Shenzhen Campus of Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Wenjun","middleName":"","lastName":"Xiao","suffix":""},{"id":536048466,"identity":"812a480e-d439-441a-a237-c80b26511eb3","order_by":1,"name":"Haoyu Wang","email":"","orcid":"","institution":"Shenzhen Campus of Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Haoyu","middleName":"","lastName":"Wang","suffix":""},{"id":536048467,"identity":"83866d23-efc7-49e9-b572-40c07ecc7175","order_by":2,"name":"Jiaying liu","email":"","orcid":"","institution":"Shenzhen Campus of Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Jiaying","middleName":"","lastName":"liu","suffix":""},{"id":536048468,"identity":"857b1b9c-d9ee-4305-baef-cc032ed4c08d","order_by":3,"name":"Weiqian Chen","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Weiqian","middleName":"","lastName":"Chen","suffix":""},{"id":536048469,"identity":"248c1fa3-8e8e-4248-b017-318ecc55bae8","order_by":4,"name":"Chuwen Lin","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Chuwen","middleName":"","lastName":"Lin","suffix":""},{"id":536048470,"identity":"e58f9f76-521e-418b-8d72-e7384f6dfa7f","order_by":5,"name":"Xin Li","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Li","suffix":""},{"id":536048471,"identity":"f0e466b0-5c71-432a-b608-3f593dc3850d","order_by":6,"name":"Xuan Jiang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEklEQVRIiWNgGAWjYBACxmYw9V+OH0geeAAT5iGshdlYsgGoJYEYLVDAnLjhAJAiSgtzO/Ozh1/b2BI3Xzv8EGhLXeL8GQmMD962Mcib43QYm7mxzBke42230wyAWg4nbriRwGw4t43BcGcDTr+YSUtUSMhuu50A0nIgcYNEAps0bxsDkItLC/s3aQkDA8bNs9M/wBzG/hu/Fh4zyQ8VCYobpHNAtjAnNtxIYGMmoKVMmuHMAWOJ2zkFBxIMDhtvOPOwWXLOOQnDDTi0GPYf3yb5s+2AHP/s9M0fPlTUyc5vTz744U2ZjTwuWwyBwcKMiAUDBscGBkagGIMEdvVAIA9y3A8kAXucSkfBKBgFo2DEAgAipl6l0QmpIgAAAABJRU5ErkJggg==","orcid":"","institution":"Shenzhen Campus of Sun Yat-Sen University","correspondingAuthor":true,"prefix":"","firstName":"Xuan","middleName":"","lastName":"Jiang","suffix":""}],"badges":[],"createdAt":"2025-09-12 11:08:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7599201/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7599201/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94672806,"identity":"0440ab87-a51a-4c9e-b64a-7d3c5c41ceff","added_by":"auto","created_at":"2025-10-29 13:40:59","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":630180,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/6410b1e9f442399258593758.docx"},{"id":94658928,"identity":"d455d5dc-0be2-413b-bcfb-eeb73de1d0d1","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8754,"visible":true,"origin":"","legend":"","description":"","filename":"031bab361062435e9261687a274bac16.json","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/64e5ad2e9a99c13f5c01d582.json"},{"id":94672318,"identity":"1c2da638-0742-4a03-9b02-d543d38abab0","added_by":"auto","created_at":"2025-10-29 13:40:15","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1475033,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/5ee72631bb981e8bb193dd8c.pdf"},{"id":94672511,"identity":"94e65713-deba-4d4d-8ffb-3b25cf1992c5","added_by":"auto","created_at":"2025-10-29 13:40:40","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138368,"visible":true,"origin":"","legend":"","description":"","filename":"031bab361062435e9261687a274bac161enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/e1af0baf03f596f06167c433.xml"},{"id":94672940,"identity":"90506172-62cf-4055-b867-944500a4a6fe","added_by":"auto","created_at":"2025-10-29 13:41:06","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83255,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/9bd68453de6c9692853f9914.jpeg"},{"id":94672448,"identity":"184ea0d0-654a-48a6-9e52-23406be8d5ea","added_by":"auto","created_at":"2025-10-29 13:40:34","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71051,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/efff4ae3ac15b0a483e612b3.jpeg"},{"id":94658936,"identity":"688e6ee6-2e87-48f1-8b0a-0123eb4ea473","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65743,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/6361694a83f705e401ebc373.jpeg"},{"id":94672909,"identity":"5e4f97b8-f91a-44ed-bb62-0cf00eabe151","added_by":"auto","created_at":"2025-10-29 13:41:05","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102004,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/5beb29d0e58ae9317308c5cd.jpeg"},{"id":94658942,"identity":"a39265d5-ad7e-43fd-871a-4593807c1cbc","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98111,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/0c67a4feb9f7c45f352112aa.jpeg"},{"id":94658941,"identity":"747b8292-bd7a-43fe-b01e-a777c272b29c","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61094,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/c3c49876360af4daae59cef6.jpeg"},{"id":94672508,"identity":"027f85e3-2b53-401b-ab0e-2dd9c9b72937","added_by":"auto","created_at":"2025-10-29 13:40:40","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109923,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/5228422c9aa0871abf8181b0.png"},{"id":94658947,"identity":"91b9976b-97b2-4724-b16b-483040912c4e","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46923,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/07472db967d835840168cc27.png"},{"id":94658945,"identity":"9a5bcf5b-f635-4de2-98eb-81995412146d","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37422,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/c3650a9d055e0c96e9fdbe9c.png"},{"id":94672412,"identity":"0c2fb4e3-e0d9-4a28-9bbf-946fce7d2b16","added_by":"auto","created_at":"2025-10-29 13:40:30","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":151278,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/23ce2cc5ee9013d199bf48dd.png"},{"id":94658950,"identity":"f8915a7a-fa3d-40eb-917c-44a4104e3c6c","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125608,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/26e0c6281cf88e717b28be20.png"},{"id":94672439,"identity":"5516738c-e3f6-497f-be98-dde70a74e0fb","added_by":"auto","created_at":"2025-10-29 13:40:33","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33568,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/33b5c4dd0efd887637daacf4.png"},{"id":94658948,"identity":"020dbd66-714e-46ac-aba3-bdf88e23607f","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136975,"visible":true,"origin":"","legend":"","description":"","filename":"031bab361062435e9261687a274bac161structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/54e4891027da1725064166aa.xml"},{"id":94658951,"identity":"cd94c6f2-2508-4407-8ebe-7f3a5b90343f","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":146681,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/2873a01bf51e6aba479879bd.html"},{"id":94658926,"identity":"e3418652-7947-4aad-90d7-3e33c2c8543b","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":165770,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDrosha KO or Dicer1 KO inhibited the adipogenesis of OP9.\u003c/strong\u003e (A, C)\u003cstrong\u003e \u003c/strong\u003eqRT-PCR analysis of Drosha and Dgcr8 mRNA level in Drosha or Dicer1 KO OP9 cells. Results were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003eP\u003c/em\u003e values were generated by unpaired Student’s t test ( *\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ***\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001,****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001). (B, D) The representative images of Oil Red O staining of Drosha KO or Dicer1 KO and control cells. Results were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003eP \u003c/em\u003evalues were generated by unpaired Student’s t test (***\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001) (Scale bars, 50μm).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/c5a1debfbf90651f7b9ffcb4.jpeg"},{"id":94658925,"identity":"cb255e78-0659-45a7-8b73-04d978f5f945","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":134076,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdipogenesis and PPARγsignaling pathway is decreased in both Drosha and Dicer1 KO cells.\u003c/strong\u003e (A) MSigDB hallmark gene set enrichment analysis of downregulated DEGs in Drosha KO. (B) qPCR analysis of key genes among the hallmark genes of adipogenesis. Results were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003ep \u003c/em\u003evalues were generated by unpaired Student’s t test. (****\u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001). (C) Left panel: GTRD transcription factor targets gene set enrichment analysis of downregulated DEGs in Drosha KO. Right panel: qPCR analysis of key genes in PPARGC1A pathway. Results were plotted as Mean±SEM; n = 3 independent experiments. \u003cem\u003eP\u003c/em\u003e values were generated by unpaired Student’s t test ( *\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt;0.01 ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001,****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001). (D) Whole cell lysate of Drosha KO, Dicer1 KO or control cells were subjected to immunoblot analysis of PPARγ and β-Actin. Quantification of immunoblot was shown in the right panel. Results were plotted as Mean ± SEM; n = 2 independent experiments. \u003cem\u003eP \u003c/em\u003evalues were generated by unpaired Student’s t test( *\u003cem\u003ep \u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/ae9979d7534f72fbe07e6020.jpeg"},{"id":94658930,"identity":"f3bab693-51d0-4bf2-80c0-5423f035ef8a","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":137738,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003epERK1/2 signaling is increased in Drosha KO or Dicer1 KO cells.\u003c/strong\u003e (A) Wiki pathway gene set enrichment anlaysis of upregulated DEGs in Drosha KO. (B) qPCR analysis of key genes in Wiki pathway. Results were plotted as Mean±SEM; n = 3 independent experiments. \u003cem\u003eP\u003c/em\u003e values were generated by unpaired Student’s t test ( *\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001,****\u003cem\u003ep \u003c/em\u003e\u0026lt;0.0001, ns, not significant). (C) Whole cell lysates of Drosha KO, Dicer1 KO or control cells were subjected to immunoblot analysis of p-ERK and total ERK. Quantification of immunoblot was shown in the right panel. Results were plotted as Mean ± SEM; n = 2 independent experiments. \u003cem\u003eP \u003c/em\u003evalues were generated by unpaired Student’s t test ( **\u003cem\u003ep\u003c/em\u003e \u0026lt;0.01).\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/a60113bbc06edfe5dbd63d16.jpeg"},{"id":94672249,"identity":"dac27bd0-e45e-4778-9d9a-dc28d0b5e3cd","added_by":"auto","created_at":"2025-10-29 13:40:01","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":258807,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eERK inhibitor reverses the adipogenesis defect of Drosha or Dicer1-KO cells.\u003c/strong\u003e (A) The representative images of oil red O staining of Drosha or Dicer1-KO cells treated with PD98059 or vehicle. Quantification was shown in the lower panel. Results were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003eP\u003c/em\u003evalues were generated by unpaired Student’s t test ( *\u003cem\u003ep \u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt;0.01,***\u003cem\u003ep \u003c/em\u003e\u0026lt;0.001,****\u003cem\u003ep \u003c/em\u003e\u0026lt;0.0001, ns, not significant) (Scale bars, 50 μm.). (B) Whole cell lysates of Drosha KO, Dicer1 KO treated with PD98059 or vehicle were subjected to immunoblot analysis of p-ERK and total ERK. Quantification of immunoblot was shown in the right panel. Results were plotted as Mean ± SEM; n = 2 independent experiments. \u003cem\u003eP\u003c/em\u003e values were generated by unpaired Student’s t test. ( **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01,***\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001).\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/40e4fba8f06f1cc70a1e8c94.jpeg"},{"id":94672556,"identity":"99631adf-a921-4d83-be1f-0fcd3186e23a","added_by":"auto","created_at":"2025-10-29 13:40:42","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":249416,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDrosha regulates the adipogenesis of OP9 cells via miRNA.\u003c/strong\u003e (A) Scatterplot of DEGs between the Drosha-KO and control cells. (B) qPCR analysis of miR-204 and miR-15b in Drosha KO cells. Results were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003ep \u003c/em\u003evalues were generated by unpaired Student’s t test ( ****\u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001). (C) psiCheck2-NRP2 or psiCheck2-mut-NRP2 was cotransfected into HEK293 cells with or without miR-15b mimics. Relative activities of the reporter (renilla/firefly) were shown as Mean ± SEM, n = 3 independent experiments. \u003cem\u003ep \u003c/em\u003evalues were generated by unpaired Student’s t test ( ****\u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001). (D) Schematic diagram of gRNA and miRNA mimics transfection. (E) The representative images of oil red O staining of Drosha or Dicer1-KO cells transfected with miR-15b mimic or vehicleResults were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003eP\u003c/em\u003e values were generated by unpaired Student’s t test. (***\u003cem\u003ep \u003c/em\u003e\u0026lt;0.001,****\u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001) (Scale bars, 50μm.)\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/3a4111a7ac3569d2b2601582.jpeg"},{"id":94658933,"identity":"336cb291-5a7c-46a2-aace-4a4f0fb53efc","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":104364,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-15b mimic inhibited the ERK pathway.\u003c/strong\u003e (A) Whole cell lysates of Drosha KO, Dicer1 KO transfected with miR-15b or vehicle were subjected to immunoblot analysis of p-ERK, total ERK or β-actin. Quantification of immunoblot was shown in the right panel. Results were plotted as Mean ± SEM; n = 2 independent experiments. \u003cem\u003eP\u003c/em\u003evalues were generated by unpaired Student’s t test ( *\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05). (B) Whole cell lysates of Drosha KO, Dicer1 KO transfected with miR-15b or vehicle were subjected to immunoblot analysis of NRP2, PPARγ and β-actin. Quantification of immunoblot was shown in the right panel. Results were plotted as Mean ± SEM; n = 3 independent experiments. \u003cem\u003eP \u003c/em\u003evalues were generated by unpaired Student’s t test ( *\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/3866c0c3c10cb8ddc5de9541.jpeg"},{"id":94728050,"identity":"788b7bac-90e5-4e14-ae53-a5f3bfacf13f","added_by":"auto","created_at":"2025-10-30 07:02:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2008970,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/00042f56-e373-4a9f-bb0a-6b84fa357fb1.pdf"},{"id":94658937,"identity":"fbfa65fb-425e-4c2b-b87d-af5ac3f776de","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1475033,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/c9d94bf8d66052df0ff71bff.pdf"},{"id":94658927,"identity":"91ac7f47-e33d-4db2-8e01-88f57bc48b89","added_by":"auto","created_at":"2025-10-29 11:16:52","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":17589,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1PrimersequencesforalltheqRT.docx","url":"https://assets-eu.researchsquare.com/files/rs-7599201/v1/33504ec357787ee3f8a37830.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Drosha regulates adipogenesis by modulating miR-204/miR-15b in OP9 cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMesenchymal stem cells (MSCs), as multipotent stromal progenitors, have been widely used for the treatment of various diseases due to their capacity for self-renewal and differentiation into multi lineages, including adipogenic, osteogenic, and chondrogenic ones(Margiana et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). To date, 12 MSC-based therapies have been approved by regulatory agencies for commercial use.(Fern\u0026aacute;ndez-Garza et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) Understanding the molecular mechanisms underlying MSC differentiation will significantly enhance their clinical applications (Lee et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Matsuzaka and Yashiro, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Xiong et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Since MSCs represent a promising source for clinical treatment, gaining deeper insights into these molecular mechanisms is particularly important for advancing their therapeutic potential(Almalki and Agrawal, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Although numerous studies have been conducted to identify the factors influencing the differentiation of mesenchymal stem cells (MSCs), much remains unknown\u0026mdash;particularly regarding the adipogenic differentiation of MSCs. To date, PPARγ and EBF-1 are the most well-established factors that regulate adipogenesis(Nuttall and Gimble, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2004\u003c/span\u003e)\u003csup\u003e,\u003c/sup\u003e(Hesslein et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).Additionally, GATA-2 and The TWIST family of basic helix-loop-helix transcription factors have also been reported to play a regulatory role in adipogenic differentiation(Isenmann et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Okitsu et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). However, the involvement of other factors, such as epigenetic mechanisms, in the regulatory network of MSC adipogenesis is still largely unclear.\u003c/p\u003e\u003cp\u003eThe OP9 cells, derived from mouse bone marrow stroma, serve as an in vitro model of MSC(Gao et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The OP9 cells are capable of undergoing adipogenic differentiation in a manner that closely mimics the natural progression of adipogenesis and is highly reproducible(Wolins et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Adipogenesis in OP9 cells ccan be induced through several approaches, including over-confluent culture conditions, treatment with Rosiglitazone and other methods(Yang et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Elucidating the adipogenic differentiation of OP9 cells can provide valuable insights into the molecular mechanisms that regulate the adipogenesis of MSCs in humans.\u003c/p\u003e\u003cp\u003eAdipogenesis refers to the process by which MSCs differentiate into mature adipocytes(Robert et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). This process is tightly regulated by a complex interplay of transcription factors, signaling pathways, and other epigenetic factors, including microRNAs (miRNAs) and etc. (Peng et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). MiRNAs are small non-coding RNA molecules which have been shown to modulate gene expression post-transcriptionally, thereby influencing various cellular processes, including cell proliferation and differentiation(Ambros, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Houbaviy et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Yanaihara et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In the context of adipogenesis, numerous miRNAs have been found to exhibit altered expression levels, during adipogenesis, highlighting the significant involvement of the miRNA pathway in this process(Engin, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Several specific miRNAs have been shown to either promote or inhibit the differentiation of adipocytes(Bibiloni et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Engin, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Esau et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDrosha is a type III ribonuclease (RNase III) which functions as the catalytic subunit of the microprocessor complex, processing the primary miRNA transcripts into precursor miRNA in nucleus(Lee et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Dicer, another member of the RNase III family, mediates the cleavage of precursor miRNAs into mature miRNAs in the cytoplasm(Rowley et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Drosha and Dicer collaborate on the processing and maturation of miRNAs and play key roles in various cellular processes and physical functions(Denli et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). It has been observed that the expression levels of both Drosha and Dicer are changed in the process of adipogenesis(Martin et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additionally, multiple researches have shown the significant role of Dicer in the process of adipogenesis(Fujimoto et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Mudhasani et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Mudhasani et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Mudhasani et al. demonstrated that Dicer is required for the early stages of adipogenic cell differentiation using primary cultures of fibroblasts and pre-adipocytes(Mudhasani et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Furthermore, they showed that Dicer is necessary for the terminal differentiation of adipocytes in vivo and for the formation of white adipose tissue (WAT), but not brown adipose tissue (BAT)(Mudhasani et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). These findings underscore the importance of miRNAs in adipogenesis, however, the specific miRNAs and the mechanistic pathways through which Dicer act remain largely unknown. To date, the role of Drosha in adipogenic differentiation of MSCs has not been studied.\u003c/p\u003e\u003cp\u003eThe extracellular signal-regulated kinase (ERK)1/2 pathway is a well-characterized signaling cascade that plays a role in cell growth, differentiation, and metabolism(Sun et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Recent studies have implicated the ERK1/2 pathway in the regulation of adipogenesis(Ma et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), with evidence suggesting that ERK1/2 phosphorylation can either promote or suppress adipocyte differentiation depending on the cellular context and the stage of differentiation(Li et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Moreover, ERK1/2 pathway is regulated by various factor in a complex manner(Liao et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Ma et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), the interplay between Drosha, miRNAs, and the ERK1/2 pathway in adipogenesis remains to be fully elucidated.\u003c/p\u003e\u003cp\u003eNeuropilin-2 (NRP2) is a transmembrane receptor that was originally thought to be involved in angiogenesis and neuronal guidance(Favier et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Grandclement et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Takashima et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Xu et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). NRP2 interacts with receptor tyrosine kinases (RTKs) and integrins to amplify ERK1/2 activation, thereby influencing cellular processes such as migration and differentiation(Fung et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Lee et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). For instance, Previous studies demonstrated that NRP2 forms complexes with integrinα9β1 to enhance ERK phosphorylation, promoting endothelial cell proliferation, migration and lymphatic formation(Ou et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although this regulatory interaction makes NRP2 a key node in ERK-mediated cell formation control, its specific role in ERK regulated adipogenesis remains unexplored.\u003c/p\u003e\u003cp\u003eIn an effort to understand the role of Drosha in adipocyte differentiation, Drosha KO OP9 cells were constructed and examined. Drosha KO OP9 cells exhibited impaired adipogenesis. Similarly, Dicer KO OP9 cells showed a decreased adipogenic capacity comparable to that of Drosha KO cells. Transcriptome sequencing revealed that PPARγand its targets genes were significantly decreased, accompanied by elevated ERK1/2 pathway activity. Sustained activation of the ERK1/2 signaling pathway has been shown to be able to inhibit adipocyte differentiation(Wu et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Small RNA sequencing identified downregulation of miR-204 and miR-15b, which can target the ERK pathway, in Drosha KO cells compared to Ctrl. Moreover, exogenous miR-15b mimics were able to enhance the adipogenic capacity of OP9 cells and rescue the adipogenic defects of Drosha KO OP9 cells. Additionally, Nrp2, a positive regulator of ERK1/2 pathway, was found to be upregulated in Drosha KO OP9 cells. Taken together, our work suggest that the Drosha/miR-15b/Nrp2/ERK axis regulates the PPARγinduced adipogenesis of MSCs, thereby advancing the current understanding of molecular mechanisms governing adipogenesis of MSCs and provide valuable insights for clinical drug therapy.\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003eDrosha depletion hinders the differentiation of OP9 cells into adipocytes\u003c/h2\u003e\n\u003cp\u003eTo elucidate the role of Drosha in the process of OP9 differentiation into adipocyte, depletion of Drosha (Drosha KO) in OP9 was achieved using a CRISPR-Cas9 system. qPCR analysis confirmed an 80% reduction in Drosha expression in cells edited with gRNA1 CRISPR-Cas9 system (Figure 1A), which was subsequently utilized for further experiments. Phenotypic analysis revealed that depletion of Drosha significantly impaired adipogenic differentiation of OP9, as evidenced by reduced lipid droplet formation in Drosha KO cells (Figure 1B). Given Drosha\u0026rsquo;s central role in miRNA biogenesis, we hypothesized that the observed adipogenic defects were mediated through miRNA-dependent mechanisms. To test this hypothesis, we generated a Dicer1 KO model in OP9 cells, as Dicer1 is another essential enzyme in miRNA processing. The knockout efficiency was validated by qPCR, with the CRISPR-Cas9 system using gRNA mix achieving the highest knockout efficiency; therefore, this approach was used for the subsequent experiments (Figure 1C). Consistent with the Drosha KO results, Dicer1 KO also markedly inhibited adipogenic capacity of OP9 cells (Figure 1D). Collectively, these findings underscore the critical involvement of Drosha/Dicer1/miRNAs in regulating adipogenesis.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eERK/PPAR\u0026gamma;\u0026nbsp;pathway is responsible for the decreased adipogenic capacity in Drosha depleted OP9 cells.\u003c/h2\u003e\n\u003cp\u003eTo further elucidate the mechanistic role of Drosha in adipogenesis, RNA-seq analysis were conducted on Drosha-depleted OP9 cells and control cells after adipogenesis induction. Consistently with previous observation, Molecular Signatures Database (MSigDB) hallmark gene set enrichment analysis of differentially expressed genes revealed significantly downregulation of genes associated with adipogenesis and fatty acid metabolism in Drosha KO cells (Figure 2A left panel). GSVA analysis confirmed the downregulation of adipogenesis and fatty acid metabolism (Figure 2A right panel). \u0026nbsp;RNA-seq analysis of Dicer1 KO and control cells was also performed. Consistently, enrichment analysis of MSigDB Chemical and genetic perturbations pathway on differentially expressed genes demonstrated decreased adipogenesis (Supplementary Figure S1A). Subsequent qPCR analysis validated the most significantly altered genes, including Adipoq, Orm1 and C3 in these pathways in both Drosha KO and Dicer1 KO cells (Figure 2B). The two major adipogenesis regulatory pathways, PPAR\u0026gamma; and EBF-1, are subjected to further examination. Notably, PPAR\u0026gamma; pathway is significantly decreased in both Drosha KO or Dicer1 KO cells compared to control cells, while EBF-1/2 are not altered in either one (Figure 2C, right panel, Supplementary Figure S1B and Figure S2, data were already uploaded to GEO, GSE300228). Western blot analysis validated the downregulation of PPAR\u0026gamma; in protein level in Drosha KO and Dicer KO cells (Figure 2D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther analysis of transcriptome of Drosha KO and Dicer1 KO cells were performed to uncover the molecular mechanism regulating the PPAR\u0026gamma;. Wiki pathway enrichment analysis of the differentially expressed genes revealed that the MAPK signaling pathway is significantly upregulated in both Drosha and Dicer1 KO cells (Figure 3A and Supplementary Figure S1C). The most deregulated genes, including Fos, Nlk, Nr4a1, Gadd45a, Il1a, and Sos2 were analyzed by qPCR, which confirmed the observation in RNA seq (Figure 3B). MAPKs, a family of evolutionarily conserved serine-threonine kinases, are known to play a pivotal role in regulating lipid metabolism, particularly through the ERK1/2 subfamily(Wu et al., 2022). To determine whether ERK1/2 is activated in Drosha depleted cells, western blot analysis was performed. The results displayed a significant upregulation of phosphorylated ERK1/2 (pERK1/2) in both Drosha and Dicer1 KO OP9 cells (Figure 3C). Previous studies demonstrated that ERK1/2 activation results in suppression of the transcriptional activity of PPAR\u0026gamma;, suggesting that the upregulation of the MAPK/ERK pathway in Drosha and Dicer1 KO cells underlies the impaired adipogenic differentiation observed in these models.\u003c/p\u003e\n\u003ch2\u003eAn ERK inhibitor reverses Drosha knockout-induced adipogenesis inhibition\u003c/h2\u003e\n\u003cp\u003eTo verify whether Drosha regulates adipogenesis through an ERK signaling-dependent mechanism, the ERK1/2-specific inhibitor PD98059 was applied to OP9 cells in the process of adipogenesis. Notably, inhibition of ERK signaling significantly rescued the impaired adipogenic differentiation caused by either Drosha or Dicer1 knockout (Figure 4A). Subsequent western blot analysis confirmed that PD98059 effectively suppressed pERK1/2 levels (Figure 4B). These findings provide direct evidence that the inhibition of adipogenesis in Drosha and Dicer1 KO cells is mediated, at least in part, through the activation of the ERK signaling pathway.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eDrosha regulates the MAPK/ERK via miR-15b\u003c/h2\u003e\n\u003cp\u003eSince both Drosha and Dicer play essential roles in the adipogenesis of MSCs and are involved in the processing of microRNAs, it is reasonable to hypothesize that miRNAs contribute to this process. To identify the specific miRNAs involved, small RNA sequencing was performed on adipogenic Drosha KO and control OP9 cells. Among the most significantly dysregulated miRNAs, miR-204 and miR-15b were identified as key candidates, as both have been previously reported to be linked to ERK1/2 signaling(Chen et al., 2021; Zheng et al., 2013) (Figure 5A, data were already uploaded to GEO, GSE300227). Subsequent qPCR analysis confirmed a decrease of miR-204 and miR-15b expression (Figure 5B). Although miR-204 and miR-15b has been linked to ERK1/2 signaling, whether it regulates adipogenesis has never been studied. To investigate the role of miR-204 and miR-15b in the adipogenesis, OP9 cells transfected with miR-204-5p and miR15b-5p mimics were subjected to adipogenic differentiation. Both miR-204-5p and miR15b-5p significantly enhanced the adipogenic capacity of OP9 cells (Supplementary Figure S3).\u003c/p\u003e\n\u003cp\u003eA literature review revealed that miR-204 targets ERK1/2 related genes \u003cem\u003eMuc4\u0026nbsp;\u003c/em\u003e(Xie et al., 2022), \u003cem\u003eVasp\u0026nbsp;\u003c/em\u003e(Liu et al., 2018), and \u003cem\u003eFoxo1\u003c/em\u003e (Liang et al., 2020), while miR-15b indirectly modulates ERK1/2 phosphorylation by targeting \u003cem\u003eNrp2\u003c/em\u003e (Zheng et al., 2013). \u003cem\u003eMuc4\u003c/em\u003e was not expressed in OP9 cells. Transcript abundance of other established targets of miR-204 or miR-15b was assessed by qPCR analysis. The results showed that only \u003cem\u003eNrp2\u003c/em\u003e expression was significantly upregulated in both Drosha KO and Dicer KO cells during adipogenic differentiation, suggesting its potential role in the Drosha/miRNA regulated adipogenesis of MSCs (Supplementary Figure S4). Luciferase activity assays were employed to further confirm that the expression of \u003cem\u003eNrp2\u003c/em\u003e can be ascribed to the specific interaction between miR-15b and the binding sites for miR-15b in the 3\u0026rsquo;UTR of \u003cem\u003eNrp2\u003c/em\u003e. Our data show that the miR-15b mimic targets the predicted binding site within the \u003cem\u003eNrp2\u003c/em\u003e mRNA 3\u0026rsquo;-UTR, as it decreased the luciferase activity in 293T cells transfected with a luciferase reporter vector containing the predicted binding site of \u003cem\u003eNrp2\u003c/em\u003e mRNA (Figure 5C).\u003c/p\u003e\n\u003cp\u003eTo further validate the functional involvement of these miRNAs in adipogenesis, exogenous miR-15b mimics was transfected into Drosha KO or Dicer KO OP9 cells (Figure 5D). This intervention significantly enhanced adipogenic capacity of both Drosha KO and Dicer KO cells compared to control cells (Figure 5E), as evaluated with Oil Red O staining. To confirm the intervention effect of miR-15b is exaggerated through modulating MAPK/ERK signaling, pERK1/2 levels was examined. Results showed that transfection of miR-15b mimic significantly suppressed pERK1/2 in Drosha KO and Dicer KO cells (Figure 6A). Consistently, NRP2 was downregulated while the level of PPAR\u0026gamma;was partially restored in these cells (Figure 6B). Collectively, these findings suggest that Drosha regulates adipogenesis through the miR-15b-mediated modulation of the ERK signaling pathway.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study delineates a critical role for Drosha in the adipogenic differentiation of OP9 cells. Drosha knockout suppresses the expression of miR-204 and miR-15b. MiR-15b is able to enhance the PPARγ-driven adipogenesis of MSCs through inhibiting MAPK/ERK via NRP2. This discovery advances our understanding of the molecular mechanisms underlying adipogenesis and provides comprehensive understanding into the regulation of this process by miRNAs.\u003c/p\u003e\u003cp\u003eThe escalating global prevalence of obesity and its metabolic comorbidities has positioned therapeutic interventions and preventive strategies targeting this multifaceted disorder as a critical frontier in biomedical research(Gregg and Shaw, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Overweight and obesity, characterized by abnormal or excessive fat accumulation(Pich\u0026eacute; et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), are key factors in a variety of metabolic diseases, including cardiovascular disease, type 2 diabetes, nonalcoholic fatty liver disease, hypertension, and cancer(Bianchini et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Despr\u0026eacute;s and Lemieux, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). According to previous reports, hyperplasia and hypertrophy of adipocytes, as the main cause of obesity, largely depend on the regulation of adipogenesis(Haider and Larose, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Naaz et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Zhao et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Our studies highlight Drosha /miR15b/NRP2 axis in the regulation of adipogenesis and provide a novel target for treating obesity related metabolic disorder.\u003c/p\u003e\u003cp\u003eOur findings demonstrate that miR-15b directly targets NRP2, suppressing ERK1/2 activity to enhance PPARγ-driven adipogenesis. Moreover, both antagomir-15b and delivery of miR-15b have been utilized to alleviate various diseases, including diabetic encephalopathy, diabetic nephropathy, encephalitis, diabetic osteoporosis in animal models(Jiang et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Tsai et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xu et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This suggests that miR-15b is a promising therapeutic target for modulating adipose tissue development in vivo.\u003c/p\u003e\u003cp\u003eBeyond miR-15b, miR-204 is also downregulated after Drosha gene knockout. It is plausible that more than one miRNA are involved in the adipogenesis of MSCs. These findings are consistent with previous studies that have highlighted the critical roles of miRNAs in adipogenesis(He et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Huang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Kim et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The role of miR-204 and miR-15b in adipogenesis was further demonstrated by their ability to regulate the expression of genes involved in this process. Although our results confirmed that miR-15b regulates the lipogenic differentiation of OP9 cells through the regulation of ERK1/2 through Nrp2, the specific targets and functions of miR-204 in adipocyte formation remain to be fully characterized. According to other studies, miR-204 has been reported to regulate the expression of genes such as Runx2, Muc4, Vasp and Foxo1, and to target multiple genes involved in adipocyte differentiation, tumor development, cell migration, and immune response(Liang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Xie et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Unfortunately, we did not detect a significant alteration of these targets. Through bioinformatics analysis and experimental verification, we can further explore new targets of miR-204 in adipocyte differentiation(Alexander et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), which may provide a new perspective for understanding the molecular mechanism of adipocyte differentiation.\u003c/p\u003e\u003cp\u003eThe implications of our findings extend beyond the basic understanding of adipogenesis. Given the role of adipose tissue in metabolic regulation and disease, these findings may have therapeutic relevance, because the identification of miRNAs that can modulate adipogenic differentiation offers potential avenues for the development of interventions targeting metabolic disorders such as obesity and diabetes(Ji and Guo, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lorente-Cebri\u0026aacute;n et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zaiou et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). our study reveals a novel mechanism by which Drosha regulates adipogenesis through the modulation of miR-204 and miR-15b, and highlights the importance of these miRNAs in the control of ERK1/2 signaling. These findings contribute to the understanding of the molecular underpinnings of adipocyte differentiation and may have implications for the development of therapeutic strategies targeting adipose tissue.\u003c/p\u003e"},{"header":"Methods","content":"\u003ch2\u003eCell Culture and Maintenance\u003c/h2\u003e\n\u003cp\u003eOP9 is a stromal cell line derived from mouse bone marrow. OP9 cells used in current research was purchased from (Chinese Academy of Sciences Cell Bank,\u0026nbsp;GNM17). The cell line was tested for mycoplasma contamination in CASCB and was confirmed negative. The cells were also subjected to bacterial contamination test and fungal contamination test, both of which were negative. In addition, short tandem repeat (STR) profiling was performed and verified that the cell line is of mouse origin, with no evidence of human or other species contamination.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOP9 cells were maintained in MEM\u0026alpha; (Gibco, C12571500BT) supplemented with 20% FBS (Excell, FSP500) and 1% penicillin\u0026ndash;streptomycin at 37 \u0026deg;C in 5% CO₂. Medium was refreshed every two days. Cells were cultured to 90% confluence and passaged at a ratio of one to five. OP9 cells at passages 5\u0026ndash;15 were used for experiments. OP9 cells were freezed in 90% FBS + 10% DMSO.\u003c/p\u003e\n\u003cp\u003eFor ERK inhibition, confluent cultures were treated with 30 \u0026mu;M PD98059 (MedChemExpress, HY-12028) for 10 days. Mycoplasma contamination was assessed by PCR using culture medium as template, with primer sequences provided in Table S1.\u003c/p\u003e\n\u003ch2\u003ePlasmid construction\u003c/h2\u003e\n\u003cp\u003eFor lentiviral CRISPR/Cas9-mediated knockout, the sgRNA targeting \u003cem\u003eDrosha\u003c/em\u003e or \u003cem\u003eDicer1\u003c/em\u003e was cloned into the lenti-CRISPRv2 (Addgene, #52961) vector with an hSpCas9 expression cassette. For dual luciferase reporter assay, 80 nucleotide sequence partially complementary to miR-15b found in the 3\u0026rsquo;-UTR of Nrp-2 mRNA (GTTGCATATCAGTGGTAAACTGTCTGACCGTTTTTTTTGCTGCTGTGATCACCCACAATTTCATTTGTCTTGCACCCAGG) or a mutated 3\u0026rsquo;-UTR of Nrp-2 mRNA was cloned into psiCheck2 (Addgene, #78260) to generate psiCheck2-NRP2 or psiCheck2-mut-NRP2 vector, respectively.\u003c/p\u003e\n\u003ch2\u003eLentivirus packaging\u003c/h2\u003e\n\u003cp\u003eFor lentivirus packaging, HEK293T cells were co-transfected with lentiviral vectors, psPAX2 (Addgene, #12260) and pMD2G (Addgene, #12259) using PEI (Yeasen, MW40000). Viruses were harvested 48 h after transfection and filtered with 0.45\u0026nbsp;\u0026mu;m membrane. The viral titer was subsequently determined.\u003c/p\u003e\n\u003ch2\u003eAdipogenic differentiation\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eAdipogenesis of OP9 cells were induced in two ways.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOver-confluence culture: OP9 cells were plated and allowed to grow to over-confluence. The medium was changed every two days until lipid droplets were clearly observed under a microscope.\u003c/p\u003e\n\u003cp\u003eRosiglitazone induction: OP9 cells were plated, and rosiglitazone was added to the medium at a concentration of 1 \u0026mu;M when the cells reached 100% confluence. This treatment was continued for 10 days.\u003c/p\u003e\n\u003ch2\u003eMimic Transfection\u003c/h2\u003e\n\u003cp\u003eMimics and MCE transfection reagent (MedChemExpress, HY-K1014) were mixed with serum-free medium and incubated for 15 minutes. The mixture was subsequently added to complete medium without antibiotics. The mixture was then incubated with OP9 cells 8 hours, followed by medium change.\u003c/p\u003e\n\u003ch2\u003eOil Red O Staining\u003c/h2\u003e\n\u003cp\u003e0.35g of Oil Red O powder was dissolved in 100mL isopropanol, stored in the dark at 4\u0026deg;C. Cells were fixed with 4% paraformaldehyde at room temperature for 1 hour, washed three times with 1\u0026times;PBS, and then air-dried completely. The cells were then incubated with working solution (Oil Red O stock solution : ddH2O = 6:4) at room temperature in the dark for 1 hour.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eqRT-PCR\u003c/h2\u003e\n\u003cp\u003eTotal RNA preparation of OP9 cells was done by Ultrapure RNA Kit (Omega, R6834-02) according to the manufacturer\u0026rsquo;s instructions. Reverse transcription was done using HiScript\u0026reg; III RT SuperMix and genomic DNA wiper (Vazyme, R323-01). cDNA was subjected to qRT-PCR analysis using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02). For quantative PCR of miRNAs, stem-loop miR15b or miR2-4 cDNA were synthesized by miRNA 1st Strand cDNA Synthesis Kit (Vazyme, MR101) and subjected to qRT-PCR analysis using miRNA Universal SYBR qPCR Master Mix(Vazyme, MQ101). Gapdh was used as an internal control to normalize mRNA. U6 was used as an internal control to normalize miRNA expression. The primers used in qRT-PCR are listed in Supplementary Table 1.\u003c/p\u003e\n\u003ch2\u003eWestern Blot\u003c/h2\u003e\n\u003cp\u003eCells were lysed using pre-cooled RIPA buffer with protease inhibitor cocktail (APExBIO, K1007) and Phosphatase inhibitors cocktail (APExBIO, K1012) for 30-45\u0026thinsp;min on ice. Pierce\u0026trade; BCA Protein Assay Kits (ThermoFisher, 23227) was used to determine the concentration. Equal amount of protein was loaded and separated by 10% SDS-PAGE. SDS-polyacrylamide gel electrophoresis and immunoblot analyses were performed as described previously(Lu et al., 2023)\u003c/p\u003e\n\u003ch2\u003eAntibody\u003c/h2\u003e\n\u003cp\u003eThe following antibodies and dilution ratios were used: ERK1/2 (4A4ERK1/2 Mouse mAb; Zen BioScience,201245-4A4) 1:1000 dilution, pERK1/2 (Phospho-ERK1/2 (Thr202/Tyr204)/(Thr185/Tyr187) Rabbit pAb; Zen BioScience, 301245) 1:1000 dilution, \u0026beta;-actin (\u0026beta;-Actin (13E5) Rabbit mAb; Cell Signaling Technology, 4970L) 1:1000 dilution, NRP2 (Neuropilin-2 Rabbit pAb; Immunoway, YT5230)1:1000 dilution, PPAR\u0026gamma;(Recombinant Rabbit mAb; Abways, CY6675)1:1000 dilution, Goat Anti-Mouse IgG H\u0026amp;L, HRP conjugated(Bioss, bs-0296G-HRP) 1:10000 dilution, Goat Anti-Rabbit IgG H\u0026amp;L, HRP conjugated(Bioss, bs-0295G-HRP) 1:10000 dilution.\u003c/p\u003e\n\u003ch2\u003eAnalysis of mRNA sequencing data\u003c/h2\u003e\n\u003cp\u003eThe total RNA of OP9 cells was extracted using Ultrapure RNA Kit (CW BIO, CW0581M) and sent to BGI for library preparation and sequencing by MGISEQ2000. Transcript abundances were quantified using the kallisto (version 0.48.0) under default settings. The transcript-level abundance estimates results were then imported into the R package tximport to summarize the gene-level abundance estimates for downstream analysis. Gene Ontology analysis and the Molecular Signatures Database (MSigDB) gene set analysis were conducted by the \u0026ldquo;clusterProfiler\u0026rdquo;R-package. Gene set variation analysis (GSVA) was performed with the \u0026ldquo;GSVA\u0026rdquo; R package. Adjusted p-value\u0026lt;0.05 was set as the threshold for statistical significance.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eGraphPad Prism 9.0 was used to do the statistical analysis and generate all the graphs. Two-way ANOVA and one-way ANOVA were used to detect the differences among multiple groups, and T-test was used for comparison between two groups. At least three independent experiments were done for each analysis.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eAnalysis of miRNA sequencing data\u003c/h2\u003e\n\u003cp\u003eClean reads were aligned to the murine rRNA genome using Bowtie2 (v2.5.1), and unmapped sequences were retained for downstream analysis. Filtered reads were subsequently mapped to the\u0026nbsp;Mus musculus\u0026nbsp;GRCm38 reference genome (GENCODE vM23) using the\u0026nbsp;mapper.pl\u0026nbsp;module from the miRDeep2 suite, with a minimum read length of 18 nucleotides (-l 18). Known miRNAs were quantified via the\u0026nbsp;quantifier.pl\u0026nbsp;module after converting uracil to thymine in mature (mature.fa) and precursor (hairpin.fa) miRNA sequences from the miRBase database (v22.1).\u003c/p\u003e\n\u003cp\u003eDifferentially expressed miRNAs (DEMs) were identified using the edgeR package. Sequencing depth variation was normalized by the TMM method, and a generalized linear model (glmFit) was applied to assess inter-group differences. DEMs were defined as those with |log2(fold change)|\u0026nbsp;\u0026ge;\u0026nbsp;1 and a false discovery rate (FDR) \u0026lt; 0.05 (Benjamini-Hochberg correction). Volcano plots were generated using ggplot2, highlighting the top five most significant upregulated and downregulated miRNAs (lowest FDR).\u003c/p\u003e\n\u003cp\u003eTarget genes of DEMs were predicted and subjected to functional enrichment analysis (Gene Ontology and KEGG pathways) using the clusterProfiler package. Statistical significance was set at an adjusted p-value \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgements and Funding Information \u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThe authors acknowledge Dr. Hailong Zhang for providing the psiCheck2 plasmid, Sun Yat-sen University School of Medicine for providing the experimental platform and instruments. The study was supported by the Program of Shenzhen Key Laboratory for Systems Medicine in Inflammatory Diseases (ZDSYS20220606100803007), Shenzhen Science and Technology program (JCYJ20240813151024032) , the GuangDong Basic and Applied Basic Research Foundation (2024A1515013147 2024A1515013077 and 2025A1515011679), the National Natural Science Foundation of China (82271899 and 32200927).\u003c/p\u003e\n\u003ch2\u003eAuthors contributions\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eX Jiang, X Li and W Xiao constructed the research. X Jiang and X Li supervised the whole project. W Xiao and H Wang performed the experiments. W Xiao and H Wang collected and analyzed the data. J Liu performed bioinformatic analyses. X Jiang, W Xiao and H Wang wrote the manuscript. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eData availability statement\u003c/h2\u003e\n\u003cp\u003eThe RNA sequencing data and small RNA sequencing data were both deposited to GEO, and are available through the following accession numbers: GSE300227 and GSE300228. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.\u003c/p\u003e\n\u003ch2\u003eAdditional Information\u003c/h2\u003e\n\u003ch2\u003eCompeting Interests Statement\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest that could compromise the objectivity of this research.\u003c/p\u003e\n\u003ch2\u003eLead contactCompeting Interests Statement\u003c/h2\u003e\n\u003cp\u003eInformation requests can be directed to the lead contact, Xuan Jiang ([email protected])\u003c/p\u003e\n\u003ch2\u003eMaterials availability\u003c/h2\u003e\n\u003cp\u003eMaterials used in this study are available from the lead contact, Xuan Jiang, upon request.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003eSupplemental information\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eDocument S1. Figures S1\u0026ndash;S6 and Table S1.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlexander, R., Lodish, H., and Sun, L. (2011). MicroRNAs in adipogenesis and as therapeutic targets for obesity. Expert Opin Ther Targets\u003cem\u003e 15\u003c/em\u003e, 623-636.\u003c/li\u003e\n\u003cli\u003eAlmalki, S.G., and Agrawal, D.K. (2016). Key transcription factors in the differentiation of mesenchymal stem cells. Differentiation\u003cem\u003e 92\u003c/em\u003e, 41-51.\u003c/li\u003e\n\u003cli\u003eAmbros, V. (2004). The functions of animal microRNAs. Nature\u003cem\u003e 431\u003c/em\u003e, 350-355.\u003c/li\u003e\n\u003cli\u003eBianchini, F., Kaaks, R., and Vainio, H. (2002). Overweight, obesity, and cancer risk. Lancet Oncol\u003cem\u003e 3\u003c/em\u003e, 565-574.\u003c/li\u003e\n\u003cli\u003eBibiloni, P., Pomar, C.A., Palou, A., S\u0026aacute;nchez, J., and Serra, F. (2023). miR-222 exerts negative regulation on insulin signaling pathway in 3T3-L1 adipocytes. Biofactors\u003cem\u003e 49\u003c/em\u003e, 365-378.\u003c/li\u003e\n\u003cli\u003eChen, J., Luo, X., Liu, M., Peng, L., Zhao, Z., He, C., and He, Y. (2021). Silencing long non-coding RNA NEAT1 attenuates rheumatoid arthritis via the MAPK/ERK signalling pathway by downregulating microRNA-129 and microRNA-204. RNA Biol\u003cem\u003e 18\u003c/em\u003e, 657-668.\u003c/li\u003e\n\u003cli\u003eChen, L., Heikkinen, L., Wang, C., Yang, Y., Sun, H., and Wong, G. (2019). Trends in the development of miRNA bioinformatics tools. Brief Bioinform\u003cem\u003e 20\u003c/em\u003e, 1836-1852.\u003c/li\u003e\n\u003cli\u003eDenli, A.M., Tops, B.B., Plasterk, R.H., Ketting, R.F., and Hannon, G.J. (2004). Processing of primary microRNAs by the Microprocessor complex. Nature\u003cem\u003e 432\u003c/em\u003e, 231-235.\u003c/li\u003e\n\u003cli\u003eDespr\u0026eacute;s, J.P., and Lemieux, I. (2006). Abdominal obesity and metabolic syndrome. Nature\u003cem\u003e 444\u003c/em\u003e, 881-887.\u003c/li\u003e\n\u003cli\u003eEngin, A.B. (2017). MicroRNA and Adipogenesis. Adv Exp Med Biol\u003cem\u003e 960\u003c/em\u003e, 489-509.\u003c/li\u003e\n\u003cli\u003eEsau, C., Kang, X., Peralta, E., Hanson, E., Marcusson, E.G., Ravichandran, L.V., Sun, Y., Koo, S., Perera, R.J., Jain, R.\u003cem\u003e, et al.\u003c/em\u003e (2004). MicroRNA-143 regulates adipocyte differentiation. J Biol Chem\u003cem\u003e 279\u003c/em\u003e, 52361-52365.\u003c/li\u003e\n\u003cli\u003eFavier, B., Alam, A., Barron, P., Bonnin, J., Laboudie, P., Fons, P., Mandron, M., Herault, J.P., Neufeld, G., Savi, P.\u003cem\u003e, et al.\u003c/em\u003e (2006). Neuropilin-2 interacts with VEGFR-2 and VEGFR-3 and promotes human endothelial cell survival and migration. Blood\u003cem\u003e 108\u003c/em\u003e, 1243-1250.\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Garza, L.E., Barrera-Barrera, S.A., and Barrera-Salda\u0026ntilde;a, H.A. (2023). Mesenchymal Stem Cell Therapies Approved by Regulatory Agencies around the World. Pharmaceuticals (Basel)\u003cem\u003e 16\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eFujimoto, Y., Nakagawa, Y., Shingyouchi, A., Tokushige, N., Nakanishi, N., Satoh, A., Matsuzaka, T., Ishii, K.A., Iwasaki, H., Kobayashi, K.\u003cem\u003e, et al.\u003c/em\u003e (2012). Dicer has a crucial role in the early stage of adipocyte differentiation, but not in lipid synthesis, in 3T3-L1 cells. Biochem Biophys Res Commun\u003cem\u003e 420\u003c/em\u003e, 931-936.\u003c/li\u003e\n\u003cli\u003eFung, T.M., Ng, K.Y., Tong, M., Chen, J.N., Chai, S., Chan, K.T., Law, S., Lee, N.P., Choi, M.Y., Li, B.\u003cem\u003e, et al.\u003c/em\u003e (2016). Neuropilin-2 promotes tumourigenicity and metastasis in oesophageal squamous cell carcinoma through ERK-MAPK-ETV4-MMP-E-cadherin deregulation. J Pathol\u003cem\u003e 239\u003c/em\u003e, 309-319.\u003c/li\u003e\n\u003cli\u003eGao, J., Yan, X.L., Li, R., Liu, Y., He, W., Sun, S., Zhang, Y., Liu, B., Xiong, J., and Mao, N. (2010). Characterization of OP9 as authentic mesenchymal stem cell line. J Genet Genomics\u003cem\u003e 37\u003c/em\u003e, 475-482.\u003c/li\u003e\n\u003cli\u003eGrandclement, C., Pallandre, J.R., Valmary Degano, S., Viel, E., Bouard, A., Balland, J., R\u0026eacute;my-Martin, J.P., Simon, B., Rouleau, A., Boireau, W.\u003cem\u003e, et al.\u003c/em\u003e (2011). Neuropilin-2 expression promotes TGF-\u0026beta;1-mediated epithelial to mesenchymal transition in colorectal cancer cells. PLoS One\u003cem\u003e 6\u003c/em\u003e, e20444.\u003c/li\u003e\n\u003cli\u003eGregg, E.W., and Shaw, J.E. (2017). Global Health Effects of Overweight and Obesity. N Engl J Med\u003cem\u003e 377\u003c/em\u003e, 80-81.\u003c/li\u003e\n\u003cli\u003eHaider, N., and Larose, L. (2019). Harnessing adipogenesis to prevent obesity. Adipocyte\u003cem\u003e 8\u003c/em\u003e, 98-104.\u003c/li\u003e\n\u003cli\u003eHe, H., Chen, K., Wang, F., Zhao, L., Wan, X., Wang, L., and Mo, Z. (2015). miR-204-5p promotes the adipogenic differentiation of human adipose-derived mesenchymal stem cells by modulating DVL3 expression and suppressing Wnt/\u0026beta;-catenin signaling. Int J Mol Med\u003cem\u003e 35\u003c/em\u003e, 1587-1595.\u003c/li\u003e\n\u003cli\u003eHesslein, D.G., Fretz, J.A., Xi, Y., Nelson, T., Zhou, S., Lorenzo, J.A., Schatz, D.G., and Horowitz, M.C. (2009). Ebf1-dependent control of the osteoblast and adipocyte lineages. Bone\u003cem\u003e 44\u003c/em\u003e, 537-546.\u003c/li\u003e\n\u003cli\u003eHoubaviy, H.B., Murray, M.F., and Sharp, P.A. (2003). Embryonic stem cell-specific MicroRNAs. Dev Cell\u003cem\u003e 5\u003c/em\u003e, 351-358.\u003c/li\u003e\n\u003cli\u003eHuang, J., Zhao, L., Xing, L., and Chen, D. (2010). MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells\u003cem\u003e 28\u003c/em\u003e, 357-364.\u003c/li\u003e\n\u003cli\u003eIsenmann, S., Arthur, A., Zannettino, A.C., Turner, J.L., Shi, S., Glackin, C.A., and Gronthos, S. (2009). TWIST family of basic helix-loop-helix transcription factors mediate human mesenchymal stem cell growth and commitment. Stem Cells\u003cem\u003e 27\u003c/em\u003e, 2457-2468.\u003c/li\u003e\n\u003cli\u003eJi, C., and Guo, X. (2019). The clinical potential of circulating microRNAs in obesity. Nat Rev Endocrinol\u003cem\u003e 15\u003c/em\u003e, 731-743.\u003c/li\u003e\n\u003cli\u003eJiang, L., Yuan, N., Zhao, N., Tian, P., Zhang, D., Qin, Y., Shi, Z., Gao, Z., Zhang, N., Zhou, H.\u003cem\u003e, et al.\u003c/em\u003e (2022). Advanced glycation end products induce A\u0026beta;(1-42) deposition and cognitive decline through H19/miR-15b/BACE1 axis in diabetic encephalopathy. Brain Res Bull\u003cem\u003e 188\u003c/em\u003e, 187-196.\u003c/li\u003e\n\u003cli\u003eKim, N.H., Ahn, J., Choi, Y.M., Son, H.J., Choi, W.H., Cho, H.J., Yu, J.H., Seo, J.A., Jang, Y.J., Jung, C.H.\u003cem\u003e, et al.\u003c/em\u003e (2020). Differential circulating and visceral fat microRNA expression of non-obese and obese subjects. Clin Nutr\u003cem\u003e 39\u003c/em\u003e, 910-916.\u003c/li\u003e\n\u003cli\u003eLee, G., Kang, Y.E., Oh, C., Liu, L., Jin, Y., Lim, M.A., Won, H.R., Chang, J.W., and Koo, B.S. (2020). Neuropilin-2 promotes growth and progression of papillary thyroid cancer cells. Auris Nasus Larynx\u003cem\u003e 47\u003c/em\u003e, 870-880.\u003c/li\u003e\n\u003cli\u003eLee, P.-W., Wu, B.-S., Yang, C.-Y., and Lee, O.K.-S. (2021). Molecular mechanisms of mesenchymal stem cell-based therapy in acute kidney injury. International journal of molecular sciences\u003cem\u003e 22\u003c/em\u003e, 11406.\u003c/li\u003e\n\u003cli\u003eLee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., R\u0026aring;dmark, O., Kim, S.\u003cem\u003e, et al.\u003c/em\u003e (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature\u003cem\u003e 425\u003c/em\u003e, 415-419.\u003c/li\u003e\n\u003cli\u003eLi, F., Yang, H., Duan, Y., and Yin, Y. (2011). Myostatin regulates preadipocyte differentiation and lipid metabolism of adipocyte via ERK1/2. Cell Biol Int\u003cem\u003e 35\u003c/em\u003e, 1141-1146.\u003c/li\u003e\n\u003cli\u003eLiang, C.Y., Huang, Z.G., Tang, Z.Q., Xiao, X.L., Zeng, J.J., and Feng, Z.B. (2020). FOXO1 and hsa-microRNA-204-5p affect the biologic behavior of MDA-MB-231 breast cancer cells. Int J Clin Exp Pathol\u003cem\u003e 13\u003c/em\u003e, 1146-1158.\u003c/li\u003e\n\u003cli\u003eLiao, Z., Zheng, X., Li, H., Deng, Z., Feng, S., Tan, H., and Zhao, L. (2024). Carboxypeptidase M modulates BMSCs osteogenesis\u0026ndash;adipogenesis via the MAPK/ERK pathway: An integrated single‐cell and bulk transcriptomic study. The FASEB Journal\u003cem\u003e 38\u003c/em\u003e, e23657.\u003c/li\u003e\n\u003cli\u003eLiu, Z., Wang, Y., Dou, C., Xu, M., Sun, L., Wang, L., Yao, B., Li, Q., Yang, W., Tu, K.\u003cem\u003e, et al.\u003c/em\u003e (2018). Hypoxia-induced up-regulation of VASP promotes invasiveness and metastasis of hepatocellular carcinoma. Theranostics\u003cem\u003e 8\u003c/em\u003e, 4649-4663.\u003c/li\u003e\n\u003cli\u003eLorente-Cebri\u0026aacute;n, S., Gonz\u0026aacute;lez-Muniesa, P., Milagro, F.I., and Mart\u0026iacute;nez, J.A. (2019). MicroRNAs and other non-coding RNAs in adipose tissue and obesity: emerging roles as biomarkers and therapeutic targets. Clin Sci (Lond)\u003cem\u003e 133\u003c/em\u003e, 23-40.\u003c/li\u003e\n\u003cli\u003eLu, Y., Cao, Q., Yu, Y., Sun, Y., Jiang, X., and Li, X. (2023). Pan-cancer analysis revealed H3K4me1 at bivalent promoters premarks DNA hypermethylation during tumor development and identified the regulatory role of DNA methylation in relation to histone modifications. BMC Genomics\u003cem\u003e 24\u003c/em\u003e, 235.\u003c/li\u003e\n\u003cli\u003eMa, X., Yang, X., Zhang, D., Zhang, W., Wang, X., Xie, K., He, J., Mei, C., and Zan, L. (2023). RNA-seq analysis reveals the critical role of the novel lncRNA BIANCR in intramuscular adipogenesis through the ERK1/2 signaling pathway. J Anim Sci Biotechnol\u003cem\u003e 14\u003c/em\u003e, 21.\u003c/li\u003e\n\u003cli\u003eMargiana, R., Markov, A., Zekiy, A.O., Hamza, M.U., Al-Dabbagh, K.A., Al-Zubaidi, S.H., Hameed, N.M., Ahmad, I., Sivaraman, R., Kzar, H.H.\u003cem\u003e, et al.\u003c/em\u003e (2022). Clinical application of mesenchymal stem cell in regenerative medicine: a narrative review. Stem Cell Res Ther\u003cem\u003e 13\u003c/em\u003e, 366.\u003c/li\u003e\n\u003cli\u003eMartin, E.C., Qureshi, A.T., Llamas, C.B., Burow, M.E., King, A.G., Lee, O.C., Dasa, V., Freitas, M.A., Forsberg, J.A., Elster, E.A.\u003cem\u003e, et al.\u003c/em\u003e (2018). Mirna biogenesis pathway is differentially regulated during adipose derived stromal/stem cell differentiation. Adipocyte\u003cem\u003e 7\u003c/em\u003e, 96-105.\u003c/li\u003e\n\u003cli\u003eMatsuzaka, Y., and Yashiro, R. (2022). Therapeutic strategy of mesenchymal-stem-cell-derived extracellular vesicles as regenerative medicine. International Journal of Molecular Sciences\u003cem\u003e 23\u003c/em\u003e, 6480.\u003c/li\u003e\n\u003cli\u003eMudhasani, R., Imbalzano, A.N., and Jones, S.N. (2010). An essential role for Dicer in adipocyte differentiation. J Cell Biochem\u003cem\u003e 110\u003c/em\u003e, 812-816.\u003c/li\u003e\n\u003cli\u003eMudhasani, R., Puri, V., Hoover, K., Czech, M.P., Imbalzano, A.N., and Jones, S.N. (2011). Dicer is required for the formation of white but not brown adipose tissue. J Cell Physiol\u003cem\u003e 226\u003c/em\u003e, 1399-1406.\u003c/li\u003e\n\u003cli\u003eNaaz, A., Holsberger, D.R., Iwamoto, G.A., Nelson, A., Kiyokawa, H., and Cooke, P.S. (2004). Loss of cyclin-dependent kinase inhibitors produces adipocyte hyperplasia and obesity. Faseb j\u003cem\u003e 18\u003c/em\u003e, 1925-1927.\u003c/li\u003e\n\u003cli\u003eNuttall, M.E., and Gimble, J.M. (2004). Controlling the balance between osteoblastogenesis and adipogenesis and the consequent therapeutic implications. Curr Opin Pharmacol\u003cem\u003e 4\u003c/em\u003e, 290-294.\u003c/li\u003e\n\u003cli\u003eOkitsu, Y., Takahashi, S., Minegishi, N., Kameoka, J., Kaku, M., Yamamoto, M., Sasaki, T., and Harigae, H. (2007). Regulation of adipocyte differentiation of bone marrow stromal cells by transcription factor GATA-2. Biochem Biophys Res Commun\u003cem\u003e 364\u003c/em\u003e, 383-387.\u003c/li\u003e\n\u003cli\u003eOu, J.J., Wei, X., Peng, Y., Zha, L., Zhou, R.B., Shi, H., Zhou, Q., and Liang, H.J. (2015). Neuropilin-2 mediates lymphangiogenesis of colorectal carcinoma via a VEGFC/VEGFR3 independent signaling. Cancer Lett\u003cem\u003e 358\u003c/em\u003e, 200-209.\u003c/li\u003e\n\u003cli\u003ePeng, Y., Yu, S., Li, H., Xiang, H., Peng, J., and Jiang, S. (2014). MicroRNAs: emerging roles in adipogenesis and obesity. Cell Signal\u003cem\u003e 26\u003c/em\u003e, 1888-1896.\u003c/li\u003e\n\u003cli\u003ePich\u0026eacute;, M.E., Tchernof, A., and Despr\u0026eacute;s, J.P. (2020). Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ Res\u003cem\u003e 126\u003c/em\u003e, 1477-1500.\u003c/li\u003e\n\u003cli\u003eRobert, A.W., Marcon, B.H., Dallagiovanna, B., and Shigunov, P. (2020). Adipogenesis, Osteogenesis, and Chondrogenesis of Human Mesenchymal Stem/Stromal Cells: A Comparative Transcriptome Approach. Front Cell Dev Biol\u003cem\u003e 8\u003c/em\u003e, 561.\u003c/li\u003e\n\u003cli\u003eRowley, J.W., Chappaz, S., Corduan, A., Chong, M.M., Campbell, R., Khoury, A., Manne, B.K., Wurtzel, J.G., Michael, J.V., Goldfinger, L.E.\u003cem\u003e, et al.\u003c/em\u003e (2016). Dicer1-mediated miRNA processing shapes the mRNA profile and function of murine platelets. Blood\u003cem\u003e 127\u003c/em\u003e, 1743-1751.\u003c/li\u003e\n\u003cli\u003eSun, Y., Liu, W.Z., Liu, T., Feng, X., Yang, N., and Zhou, H.F. (2015). Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduct Res\u003cem\u003e 35\u003c/em\u003e, 600-604.\u003c/li\u003e\n\u003cli\u003eTakashima, S., Kitakaze, M., Asakura, M., Asanuma, H., Sanada, S., Tashiro, F., Niwa, H., Miyazaki Ji, J., Hirota, S., Kitamura, Y.\u003cem\u003e, et al.\u003c/em\u003e (2002). Targeting of both mouse neuropilin-1 and neuropilin-2 genes severely impairs developmental yolk sac and embryonic angiogenesis. Proc Natl Acad Sci U S A\u003cem\u003e 99\u003c/em\u003e, 3657-3662.\u003c/li\u003e\n\u003cli\u003eTsai, Y.C., Kuo, M.C., Hung, W.W., Wu, L.Y., Wu, P.H., Chang, W.A., Kuo, P.L., and Hsu, Y.L. (2020). High Glucose Induces Mesangial Cell Apoptosis through miR-15b-5p and Promotes Diabetic Nephropathy by Extracellular Vesicle Delivery. Mol Ther\u003cem\u003e 28\u003c/em\u003e, 963-974.\u003c/li\u003e\n\u003cli\u003eWolins, N.E., Quaynor, B.K., Skinner, J.R., Tzekov, A., Park, C., Choi, K., and Bickel, P.E. (2006). OP9 mouse stromal cells rapidly differentiate into adipocytes: characterization of a useful new model of adipogenesis. J Lipid Res\u003cem\u003e 47\u003c/em\u003e, 450-460.\u003c/li\u003e\n\u003cli\u003eWu, S.C., Lo, Y.M., Lee, J.H., Chen, C.Y., Chen, T.W., Liu, H.W., Lian, W.N., Hua, K., Liao, C.C., Lin, W.J.\u003cem\u003e, et al.\u003c/em\u003e (2022). Stomatin modulates adipogenesis through the ERK pathway and regulates fatty acid uptake and lipid droplet growth. Nat Commun\u003cem\u003e 13\u003c/em\u003e, 4174.\u003c/li\u003e\n\u003cli\u003eXie, Z., Chen, J., and Chen, Z. (2022). MicroRNA-204 attenuates oxidative stress damage of renal tubular epithelial cells in calcium oxalate kidney-stone formation via MUC4-mediated ERK signaling pathway. Urolithiasis\u003cem\u003e 50\u003c/em\u003e, 1-10.\u003c/li\u003e\n\u003cli\u003eXiong, J., Hu, H., Guo, R., Wang, H., and Jiang, H. (2021). Mesenchymal Stem Cell Exosomes as a New Strategy for the Treatment of Diabetes Complications. Front Endocrinol (Lausanne)\u003cem\u003e 12\u003c/em\u003e, 646233.\u003c/li\u003e\n\u003cli\u003eXu, C., Wang, Z., Liu, Y., Duan, K., and Guan, J. (2024). Delivery of miR-15b-5p via magnetic nanoparticle-enhanced bone marrow mesenchymal stem cell-derived extracellular vesicles mitigates diabetic osteoporosis by targeting GFAP. Cell Biol Toxicol\u003cem\u003e 40\u003c/em\u003e, 52.\u003c/li\u003e\n\u003cli\u003eXu, Y., Yuan, L., Mak, J., Pardanaud, L., Caunt, M., Kasman, I., Larriv\u0026eacute;e, B., Del Toro, R., Suchting, S., Medvinsky, A.\u003cem\u003e, et al.\u003c/em\u003e (2010). Neuropilin-2 mediates VEGF-C-induced lymphatic sprouting together with VEGFR3. J Cell Biol\u003cem\u003e 188\u003c/em\u003e, 115-130.\u003c/li\u003e\n\u003cli\u003eYanaihara, N., Caplen, N., Bowman, E., Seike, M., Kumamoto, K., Yi, M., Stephens, R.M., Okamoto, A., Yokota, J., Tanaka, T.\u003cem\u003e, et al.\u003c/em\u003e (2006). Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell\u003cem\u003e 9\u003c/em\u003e, 189-198.\u003c/li\u003e\n\u003cli\u003eYang, H., Youm, Y.H., and Dixit, V.D. (2009). Inhibition of thymic adipogenesis by caloric restriction is coupled with reduction in age-related thymic involution. J Immunol\u003cem\u003e 183\u003c/em\u003e, 3040-3052.\u003c/li\u003e\n\u003cli\u003eYang, N., Ekanem, N.R., Sakyi, C.A., and Ray, S.D. (2015). Hepatocellular carcinoma and microRNA: new perspectives on therapeutics and diagnostics. Adv Drug Deliv Rev\u003cem\u003e 81\u003c/em\u003e, 62-74.\u003c/li\u003e\n\u003cli\u003eZaiou, M., El Amri, H., and Bakillah, A. (2018). The clinical potential of adipogenesis and obesity-related microRNAs. Nutr Metab Cardiovasc Dis\u003cem\u003e 28\u003c/em\u003e, 91-111.\u003c/li\u003e\n\u003cli\u003eZhao, G.N., Tian, Z.W., Tian, T., Zhu, Z.P., Zhao, W.J., Tian, H., Cheng, X., Hu, F.J., Hu, M.L., Tian, S.\u003cem\u003e, et al.\u003c/em\u003e (2021). TMBIM1 is an inhibitor of adipogenesis and its depletion promotes adipocyte hyperplasia and improves obesity-related metabolic disease. Cell Metab\u003cem\u003e 33\u003c/em\u003e, 1640-1654.e1648.\u003c/li\u003e\n\u003cli\u003eZheng, X., Chopp, M., Lu, Y., Buller, B., and Jiang, F. (2013). MiR-15b and miR-152 reduce glioma cell invasion and angiogenesis via NRP-2 and MMP-3. Cancer Lett\u003cem\u003e 329\u003c/em\u003e, 146-154.\u003c/li\u003e\n\u003cli\u003eZhu, B., Ye, J., Nie, Y., Ashraf, U., Zohaib, A., Duan, X., Fu, Z.F., Song, Y., Chen, H., and Cao, S. (2015). MicroRNA-15b Modulates Japanese Encephalitis Virus-Mediated Inflammation via Targeting RNF125. J Immunol\u003cem\u003e 195\u003c/em\u003e, 2251-2262.\u003c/li\u003e\n\u003cli\u003eZhu, S., Wang, W., Zhang, J., Ji, S., Jing, Z., and Chen, Y.Q. (2022). Slc25a5 regulates adipogenesis by modulating ERK signaling in OP9 cells. Cell Mol Biol Lett\u003cem\u003e 27\u003c/em\u003e, 11.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"adipogenesis, OP9, ERK1/2, miR204, miR15b, Drosha","lastPublishedDoi":"10.21203/rs.3.rs-7599201/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7599201/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMesenchymal stem cells (MSCs), being multipotent progenitors, have received the most widespread regulatory approval for commercialization as off-the-shelf cell therapies. Understanding the key molecular mechanisms regulating MSC differentiation is crucial for advancing their clinical utilization. Drosha is a critical enzyme in miRNA biogenesis. Despite its established role in diverse physiological processes, the involvement of Drosha in the adipogenic differentiation of MSCs has not been previously characterized. Here the role of Drosha/microRNA pathway in regulating the adipogenesis of OP9, a MSC derived from mouse bone marrow stroma, is characterized. Knocking down Drosha in OP9 significantly reduced its adipogenic capacity. Small RNA-seq analysis revealed that miR-204 and miR-15b were significantly downregulated in the adipogenic process of OP9 cells upon Drosha removal. Further exploration showed that the activity of ERK1/2, which has been shown to be able to suppress the transcriptional activity of PPARγ, was significantly increased in Drosha KO OP9 cells. Introducing miR-204 or miR-15b into OP9 cells significantly enhanced their adipogenic capacity and partially rescued the adipogenic defects caused by Drosha knockout. Mechanistically, miR-15b regulates ERK mediated adipogenic differentiation via repressing NRP2. Our data demonstrate that the Drosha/miR-15/NRP2 axis regulates adipogenesis of MSCs by modulating the ERK/PPARγ pathway. This discovery unveils a previously unappreciated molecular mechanism governing MSC adipogenic differentiation and suggests new avenues for exploring the therapeutic potential of MSCs.\u003c/p\u003e","manuscriptTitle":"Drosha regulates adipogenesis by modulating miR-204/miR-15b in OP9 cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-29 11:16:47","doi":"10.21203/rs.3.rs-7599201/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-10T04:55:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-28T05:47:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"160697847031512056657593675227050772660","date":"2025-10-20T07:57:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"81095679064289462677433596382737157036","date":"2025-10-20T02:38:12+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-15T02:20:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-13T16:33:58+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-09-29T04:27:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-24T09:58:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-09-24T09:55:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e2ebba19-62d4-4483-9a51-964e3778f247","owner":[],"postedDate":"October 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":56991253,"name":"Biological sciences/Cell biology"},{"id":56991254,"name":"Biological sciences/Molecular biology"},{"id":56991255,"name":"Biological sciences/Stem cells"}],"tags":[],"updatedAt":"2026-05-05T14:53:47+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-29 11:16:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7599201","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7599201","identity":"rs-7599201","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00