Generation and initial characterization of in vivo knockout of tetherin/BST2 in chicken

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 41,147 characters · extracted from preprint-html · click to expand
Generation and initial characterization of in vivo knockout of tetherin/BST2 in chicken | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Generation and initial characterization of in vivo knockout of tetherin/BST2 in chicken Lenka Ungrová , Pavel Trefil , Jiří Plachý , Jitka Mucksová , Jiří Kalina , Markéta Reinišová , Sonja Härtle , Eliška Gáliková , Dana Kučerová , Veronika Krchlíková , Vladimír Pečenka , Vít Karafiát , Jiří Hejnar , Daniel Elleder doi: https://doi.org/10.1101/2024.06.24.600038 Lenka Ungrová 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Pavel Trefil 2 BIOPHARM, Research Institute of Biopharmacy and Veterinary Drugs , Pohoří-Chotouň 90, 254 49 Jílové u Prahy, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiří Plachý 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jitka Mucksová 2 BIOPHARM, Research Institute of Biopharmacy and Veterinary Drugs , Pohoří-Chotouň 90, 254 49 Jílové u Prahy, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiří Kalina 2 BIOPHARM, Research Institute of Biopharmacy and Veterinary Drugs , Pohoří-Chotouň 90, 254 49 Jílové u Prahy, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Markéta Reinišová 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sonja Härtle 3 Department for Veterinary Sciences, Ludwig-Maximilians-Universität Munich , Munich, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Eliška Gáliková 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dana Kučerová 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Veronika Krchlíková 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic 4 Institute for Medical Virology and Epidemiology of Viral Diseases, University Hospital Tübingen , 72076 Tübingen, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Vladimír Pečenka 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Vít Karafiát 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiří Hejnar 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site Daniel Elleder 1 Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the Czech Academy of Sciences , Vídeňská 1083, Prague 4, 142 20, Czech Republic Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: daniel.elleder{at}img.cas.cz Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Tetherin/BST2 is an antiviral restriction factor initially described in mammals. It is active against multiple enveloped viruses at the budding phase, where it is able to physically link the budding virions to the virus-producing cell. We and others have previously identified tetherin orthologs in birds, and characterized the antiviral activity and interferon-inducibility of chicken tetherin. In this work, we have generated an in vivo model of tetherin absence in chicken by CRISPR/Cas9 modification of chicken primordial germ cells (PGC). The modified PGCs were transplanted into roosters with suppressed endogenous spermatogenesis, and transgenic (tetherin knockout) progeny was obtained by further crosses. The viability and phenotype of tetherin knockout animals did not differ from wild type chicken. In more detailed investigation, flow cytometry based differential white blood cell count revealed an increased number of heterophils in tetherin knockouts. Upon challenge with avian sarcoma and leukosis virus (ASLV), a prototypic avian retrovirus, we detected increase in viremia at days 6 and 13 post infection in tetherin knockout animals. The increased virus susceptibility is consistent with absence of antiviral tetherin. In summary, we introduce a new in vivo knockout model of chicken antiviral gene tetherin. These animals can be used in further characterizations of avian antiviral defenses and also to define thus far unknown physiological effects of tetherin in birds. 1. INTRODUCTION Birds represent important hosts for a variety of pathogens, including viruses with large economic impact and zoonotic potential ( Nabi et al. 2021 ). A major type of antiviral defense is executed by dedicated antiviral genes, also called antiviral restriction factors, whose products target various steps in viral replication cycle ( Duggal and Emerman 2012 ). Tetherin (also known as bone marrow stromal antigen 2 [BST2] or cluster of differentiation 317 [CD317]) was originally identified as a surface protein expressed on terminally differentiated B-cells ( Duggal and Emerman 2012 ; Goto et al. 1994 ). It was later identified as a restriction factor blocking the release of virus particles by linking (tethering) the budding virions to the surface of the virus-producing cell ( Neil, Zang, and Bieniasz 2008 ; Van Damme et al. 2008 ). The tethering is enabled by the unique topology of tetherin, where two membrane associated domains (a transmembrane N-terminal domain and a glycosylphosphatidylinositol [GPI] C-terminal domain) can span the virus and host membranes. In this way, the tethering effect can extend to multiple enveloped viruses ( Mahauad-Fernandez and Okeoma 2016 ). In response, many viruses developed tetherin antagonists, which at least partially block its antiviral actions ( Sauter 2014 ). Although tetherin was initially considered to be present only in mammals, it was later identified in other vertebrate genomes, including birds ( Blanco-Melo, Venkatesh, and Bieniasz 2016 ; Krchlíková et al. 2020 ; Heusinger et al. 2015 ). Chicken possesses antiviral tetherin, inducible by interferon (IFN). In other birds, intriguing patterns of functional tetherin losses have been described. These include premature stop codon in turkey and pheasant species ( Krchlíková et al. 2023 ), and loss of IFN induction in other galliform birds mediated by mutation of IFN-sensitive response element (ISRE) in tetherin promoter region. Other types of tetherin gene losses are predicted in the genomes of additional avian species (data not shown). Overall, in birds, tetherin seems to have very complex interaction with viruses and any potential, thus far unknown, virus-encoded antagonists. This is in agreement with a strong pattern of diversifying selection detected in intact tetherin orthologs from galliform and passeriform birds ( Krchlíková et al. 2020 ). To analyze the role of tetherin in in vivo infections, we generated tetherin-deficient chicken by using the CRISPR/Cas9 technology employed previously to generate genetically modified chicken ( Koslová et al. 2021 ; Trefil et al. 2017 ; Koslová et al. 2020 ). In this work, we describe the generation of tetherin-deficient chicken and initial analysis of their phenotype and susceptibility to virus infection. 2. RESULTS 2.1 Preparation and Breeding of Tetherin/BST2 KO Chickens In freshly derived primordial germ cells (PGCs), we introduced indel mutations into the first coding exon of the chicken tetherin gene ( Fig. 1A ). After nucleofection of the CRISPR/Cas9 construct pX458-tetherin and single cell FACS sorting, we expanded four proliferative clones with indel mutations 5’ to the cleavage site. For further work, we chose one male clone PGC RIR No. 1G6 homozygous for a frame-shifting deletion of 4 nt 5’ to the cleavage site. In order to obtain chickens with a knock out of the tetherin gene, we used orthotopic PGC transplantation into the testes of roosters with suppressed endogenous spermatogenesis ( Fig. 1B ). Two azoospermic roosters were transplanted and both resumed spermatogenesis after 13 weeks. The presence of 4 nt deletion was detected by PCR in the DNA isolated from the sperm. After insemination, both intramagnal and intravaginal, of four SH hens, we obtained four F 1 offspring, two males and two females, with the expected tetherin KO +/-genotype. After sexual maturation, F 1 chickens were mated to produce F 2 generation with observed tetherin KO -/-, +/-, and +/+ genotypes in a ratio 8 : 56 : 36, respectively. In F 3 offspring, we observed segregation of tetherin KO genotypes in a ratio of 17 (-/-) : 44(+/-) : 39 (+/+) in correspondence to the expected Mendelian ratio. Download figure Open in new tab Fig. 1. Generation and genotyping of tetherin/BST2 knockout in chicken. (A) Schematic representation of four coding exons of chicken tetherin gene. Position and alignment of sequences around the region targeted by the CRISPR/Cas9 construct are shown (sequences used in the targeting oligonucleotide are highlighted in bold). The 4-bp deletion in the knockout (KO) clone is shown as dashes. (B) Summary of the workflow during generation of the tetherin knockout chicken. 2.2 Phenotype and White Blood Cell Count of Tetherin/BST2 Knockout Animals The tetherin knockout animals do not show any apparent changes in viability or growth compared to wild type siblings (data not shown). The ratio of various genotypes in F 2 and F 3 generations approximately complies with expected Mendelian frequencies. In mammals, in addition to antiviral effects, tetherin influences blood cell development and function ( Tiwari et al. 2019 ; Urata et al. 2023 ; Epeldegui, Blom, and Uittenbogaart 2015 ; Yoo et al. 2016 ; Cao et al. 2009 ). We therefore analyzed the total white blood cell count of knockout animals to characterize their phenotype in more detail. All cell populations were comparable among the three tetherin genotypes ( Fig. 2 ). The only exception was detected in heterophils, whose numbers were significantly higher in tetherin -/- animals. Download figure Open in new tab Fig. 2. Flow cytometric white blood cell count differential in tetherin knockout chicken. Cell counts for all three genotypes are shown. *; P ≤ 0.05 2.3 Susceptibility of tetherin/BST2 Knockout Animals to ASLV Infection For initial testing of virus susceptibility phenotype, we decided to use avian sarcoma and leukosis virus (ASLV), because this work is well established in our animal facility. We used ASLV-based replication competent vector RCASBP(C)GFP with the envelope ( ENV ) gene of subgroup C virus specificity ( Elleder et al. 2005 ), which encodes a GFP reporter. The outcome of infection was monitored by quantifying viremia in sera of infected animals by quantitative reverse transcriptase PCR (qRT-PCR). Each of the three tetherin genotypes (+/+, +/-, -/-) was represented by 3-7 animals with the age spanning 4-5 weeks. The virus challenge was done by i.v. injection of 10 5 infectious units RCASBP(C)GFP, the serum was collected from the birds repeatedly at days 6 and 13 post infection (dpi). At both timepoints, the detected viremia was significantly higher in tetherin -/-animals ( Fig.3 ). This is consistent with slightly higher sensitivity of tetherin knockout chicken to ASLV infection. Download figure Open in new tab Fig. 3. Susceptibility of tetherin/BST2 knockout chicken to in vivo infection with RCASBP(C)GFP vector. Viremia was analyzed by quantification of the ENV subgroup C gene in the serum by qPCR. Upper part shows the titer of viral RNA molecules in individual animals, with averages and standard deviation of three technical replicates. Lower part depicts averages and standard deviations for the three genotype groups. ****; P ≤ 0.0001 3. DISCUSSION In this study, we generated a homozygous in vivo knockout of the chicken tetherin/BST2 gene. We observed no decrease in viability in the tetherin-deficient animals. This is consistent with the normal viability of tetherin KO in mice ( Liberatore and Bieniasz 2011 ). It is also consistent with the natural absence of functional tetherin in multiple galliform birds ( Krchlíková et al. 2023 ). Multiple physiological functions of tetherin have been described, which are to varying degrees affected by its decrease or absence. These include effects on lipid rafts and platelet receptor signaling, tethering of exosomes and cytokinetic midbody remnants, and organization of the actin cytoskeleton in polarized epithelial cells ( Billcliff et al. 2013 ; Zhao et al. 2021 ; Edgar et al. 2016 ; Rollason et al. 2009 ). Our knockout model can help to dissect these more subtle effects of tetherin in the context of avian cells. The only significant finding in our phenotypical characterization of tetherin knockout chicken was the increased number of heterophils. These cells are considered the avian equivalent of mammalian neutrophils, and are therefore primary components of innate immunity ( Genovese et al. 2013 ). Heterophils are reactive to microbial stimuli and exhibit chemotaxis, phagocytosis, and production of multiple cytokines. In mammals, tetherin can regulate cytokine production through interaction with ligand ILT7 expressed on plasmacytoid dendritic cells (pDC) ( Cao et al. 2009 ). However, ILT7 is present only in mammals, and the existence of a pDC cell population was only recently suggested in chickens ( Wu et al. 2023 ). Therefore, it is currently not understood how tetherin deficiency could cause the increased heterophil numbers and what are the possible consequences for virus susceptibility. Tetherin deficiency in mammals does not have major effects on retrovirus replication. The reason is, at least partially, determined by the ability of retroviruses to evade innate immune reaction and IFN induction ( Gómez-Lucía et al. 2009 ; Cingöz and Goff 2019 ). Without IFN induction, tetherin expression is restricted to several cell types ( Goto et al. 1994 ). Consequently, the replication and disease progression of Moloney murine leukemia virus (Mo-MLV) was similar in wild-type and tetherin-deficitent mice ( Liberatore and Bieniasz 2011 ). External IFN induction was needed to allow tetherin induction and to reveal its antiviral activity. Later work in the mammalian system showed tetherin influence on cell-mediated antiviral responses and sometimes paradoxical positive effects on virus replication ( Li et al. 2014 ; Swiecki et al. 2012 ). In this study, we detected higher ASLV viremia in tetherin knockout chickens, without externally added IFN. One possibility is that constitutive expression of tetherin is higher in chickens than in mammals and such endogenous levels are sufficient for antiviral activity. Indeed, analysis of publicly available RNAseq data from various chicken tissues shows substantial tetherin mRNA expression in several organs ( Fig. 4 ). Further studies, including generation of antibodies against chicken tetherin, are needed to characterize its in vivo expression profile and response to retrovirus infection (work in progress). It will also be interesting to assess the susceptibility of tetherin KO chicken to additional enveloped avian viruses, which are potential targets of tetherin. Some of these viruses, including Newcastle disease virus (NDV), avian influenza viruses (AIV) and Usutu virus, are more potent IFN inducers than retroviruses, and might therefore be even more affected by tetherin absence. Download figure Open in new tab Fig. 4. Expression pattern of tetherin/BST2 in various chicken tissues. The expression values were obtained from NCBI Sequence Read Archive (SRA) data PRJEB4677 as described in Methods and expressed in relative expression units (RPKM, Reads per kilobase per million mapped reads). In summary, we introduce a new in vivo knockout model of the chicken antiviral gene tetherin/BST2. Transgenesis in birds remains challenging, but there were major advances in the application of gene editing technology in chicken, which represents an important model in the fields of immunology and infectious disease ( Woodcock, Idoko-Akoh, and McGrew 2017 ; Sid and Schusser 2018 ; Khwatenge and Nahashon 2021 ). As in other animal models, the CRISPR/Cas9 system is revolutionizing the possibilities of gene modification. The availability of tetherin knockout animals should facilitate the in vivo studies of the complex antiviral defense in birds. 4. METHODS Ethical Statement In this work, we conducted all experiments and procedures in accordance with the Czech legislation for animal handling and welfare. The Animal Commodities Department of the Ministry of Agriculture of the Czech Republic approved all animal experiments described in this study (approval no. 65823/2019-MZE-18134). Experimental Chickens Embryos of the commercial chicken breed RIR D159 (Líheň Studenec, Czech Republic) were used as a source of PGCs and hybrid roosters (♂ CC21 × ♀ L15) were used as recipients in orthotopic PGC transplantation. Hens of the breed SH were used for insemination. Inbred lines CC21, L15, and outbred population SH were maintained at the Institute of Molecular Genetics, Czech Academy of Sciences, Prague, Czech Republic ( Plachý 2000 ). Standard husbandry conditions applied in this work included 16 h light/8 h dark cycle, food/water provided ad libitum, and housing the birds in either deep litter individual cages (recipient roosters) or battery cages (inseminated hens). The laid eggs were incubated in a forced air incubator (BIOS MIDI). PGC Cultivation and Editing of Tetherin/BST2 Gene We derived PGCs from the blood aspirations of RIR D159 embryos at 2.5 days of incubation, which corresponds to the Hamburger and Hamilton stage 16. Specifically, we transferred 5 μL of blood from the dorsal aorta on a 48-well plate with 150 μL of Avian KO-DMEM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with growth factors, as described previously ( Mucksová et al. 2019 ). We cultured the PGCs for 3 weeks, expanded them up to 10 5 cells, and determined their sex by detection of the W chromosome. Oligonucleotide primers and cycling conditions used for W detection were as described in Mucksová et al. ( Mucksová et al. 2019 ). DNA for W amplification was isolated from PGC aliquots using the PureGene kit (Qiagen, Hilden, Germany). Two proliferative male PGC lines (RIR PGC 4 and RIR PGC 7) were selected for the tetherin knock-out at the age of 42 d in culture. We used the CRISPR/Cas9 construct pX458-tetherin already adjusted for targeting the first exon of the chicken tetherin gene ( Krchlíková et al. 2020 ). Suspension of 2.5 × 10 5 PGCs in Nucleofector Solution V (Lonza) was mixed with 10 μg of pX458-tetherin in total volume of 100 μL and nucleofection was performed with the AMAXA nucleofector (Lonza) using the A-27 program. GFP-positive cells with the highest fluorescence intensity (top 5%) were single-cell-sorted 3 d post nucleofection and expanded for two weeks. The resulting clones were characterized as to the hit of the target sequence of the chicken tetherin gene; oligonucleotide primers and PCR conditions used for tetherin characterization are described in Krchlíková et al. ( Krchlíková et al. 2020 ). Sterilization of Recipient Roosters and Orthotopic PGC Transplantation We used orthotopic PGC transplantation into roosters with suppressed endogenous spermatogenesis in order to obtain founder animals transducing the edited tetherin allele in offspring F1 generation. The procedures of rooster irradiation and PGC transplantation were described previously ( Koslová et al. 2020 ; Trefil et al. 2017 ; Mucksová et al. 2019 ). Briefly, hybrids of inbred lines CC21I × L15 at the age of 8 months were irradiated with five doses of 8 Gy over two weeks using the Terabalt radiation unit (UJP Prague) with Co 60 as a source of gamma rays. Subsequent decline of endogenous spermatogenesis was monitored in semen samples collected by dorsoabdominal massage. Azoospermic recipient roosters were anesthetized and bilaterally injected through tunica albuginea with a dose of 7.4 × 10 6 PGCs in 250 μL of culture medium. Anesthesia was performed by intramuscular injection of 15 mg/kg ketamine (Narkamon, Bioveta, Czech Republic) and 4 mg/kg xylazine (Rometar, Bioveta, Czech Republic). We did not encounter any mortality or side effects associated with irradiation, anesthesia, or transplantation surgery. The appearance of PGC-derived spermatogenesis was monitored in semen samples collected by dorsoabdominal massage starting from the third week after transplantation. The threshold for intramagnal insemination was the semen concentration of 10 4 sperms per mL, and 0.1 to 0.4 mL of undiluted semen was used as the insemination dose. Genotyping PCR for tetherin locus Short genomic sequence containing the CRISPR/Cas9-induced deletion site in the tetherin locus was PCR-amplified with primers 5’ TGGGGACGGGGACAGGAAGA and 5’ TCCCGCAGCCGTGCCA from blood lysates. Deletion of 4 nucleotides was then directly checked on 4% low melting MetaPhor® agarose gel (Lonza) and in some cases verified by sequencing. Flow cytometry method for total white blood cell count The differential white blood cell count was done as described in Seliger et al. ( Seliger et al. 2012 ). Briefly, EDTA blood samples of 3-6 weeks old animals were stabilized by the addition of TransFix Reagent (R) (Cytomark, Buckingham, UK); 24 h later,1μl of blood was diluted 1:50 and stained with an antibody mixture of anti-chicken CD45-APC (clone 16-6; 1:2.000), anti-chicken CD4 FITC (clone CT4; 1:2.500), anti-chicken CD8-FITC (clone CT8 1:2.500), anti-chicken TCRγδ-FITC (clone TCR1; 1:300), Bu1-PerCP-Cy5.5 (clone AV20, 1:800), K1-RPE (clone K1, 1:1.000) and anti-chicken MRC1L-B-RPE (clone KulO1, 1:2.000) using the described no-lyse no-wash single-step one-tube technique. CD4-FITC, CD8-FITC, TCRγδ-FITC and MRC1L-B-RPE were obtained from Southern Biotech (Birmingham, USA). CD45-APC and Bu1-PerCP-Cy5.5 were generated by conjugation of the antibody with the respective Lynx Rapid conjugation kit (Bio-Rad, Feldkirchen, Germany). Samples were analyzed on a FACS Canto II and FlowJo 10.9 software (BD, Heidelberg, Germany). In vivo infection of chicken with ASLV vector and quantitative PCR Animals of all three tetherin genotype groups were infected by i.v. injection of RCAS-C-GFP, with dose 10 5 infectious units (IU). 6 and 13 dpi blood samples were obtained and coagulated into blood sera. For viral RNA isolation from the chicken sera, QIAamp Viral RNA Mini Kit (Qiagen) was used. Two independent isolations were performed according to the manufacturer’s protocol from 140 μL and 280 μL of sera respectively. Then we used ProtoScript® II First Strand cDNA Synthesis Kit (NEB) and 3′-RACE CDS primer (ClonTech) for cDNA synthesis from 5,4 μL uf viral RNA. Next, qPCR was performed using PowerTrack SYBR Green Master Mix (Thermofisher) with primers for ASLV-C env (5’-TGTGTATATTTCGCCCCAAGG, 5’-CCTCTGCACCAGGTTTCAGG). We used serial dilution of RCASBP-C plasmids to generate the standard curve for absolute gene quantification. Reaction was run in the QuantStudio™ 5 Real-Time PCR System (Thermofisher) with the following protocol: one cycle of 8 min at 95°C then 40 cycles of 15 s at 95°C, 25 s at 60°C, and 35 s at 72°C and final polymerization step at 72°C for 10 min. Analysis of publicly available RNAseq data To obtain the in silico mRNA expression pattern of tetherin, its coding sequences were used in blast searches against the SRA data PRJEB4677. Number of blast hits from RNAseq datasets of individual chicken tissues were recalculated to obtain relative measures of mRNA expression levels (RPKM; Reads per kilobase per million mapped reads). Statistical tests For statistical evaluation of the differences between WT and KO animals, unpaired Student’s t-test was used. 5. ACKNOWLEDGEMENTS This work was funded by grant 20-22063S from the Czech Science Foundation. D.E. and J.H. were further supported by the project National Institute of virology and bacteriology (Programme EXCELES, No. LX22NPO5103) funded by the European Union—Next Generation EU. 6. REFERENCES ↵ Billcliff , Peter G. , Ruth Rollason , Ian Prior , Dylan M. Owen , Katharina Gaus , and George Banting . 2013 . “ CD317/tetherin Is an Organiser of Membrane Microdomains .” Journal of Cell Science 126 ( Pt 7 ): 1553 – 64 . OpenUrl Abstract / FREE Full Text ↵ Blanco-Melo , Daniel , Siddarth Venkatesh , and Paul D. Bieniasz . 2016 . “ Origins and Evolution of Tetherin, an Orphan Antiviral Gene .” Cell Host & Microbe 20 ( 2 ): 189 – 201 . OpenUrl CrossRef ↵ Cao , Wei , Laura Bover , Minkwon Cho , Xiaoxia Wen , Shino Hanabuchi , Musheng Bao , David B. Rosen , et al. 2009 . “ Regulation of TLR7/9 Responses in Plasmacytoid Dendritic Cells by BST2 and ILT7 Receptor Interaction .” The Journal of Experimental Medicine 206 ( 7 ): 1603 – 14 . OpenUrl Abstract / FREE Full Text ↵ Cingöz , Oya , and Stephen P. Goff . 2019 . “ HIV-1 Is a Poor Inducer of Innate Immune Responses .” mBio 10 ( 1 ). doi: 10.1128/mBio.02834-18 . OpenUrl Abstract / FREE Full Text ↵ Duggal , Nisha K. , and Michael Emerman . 2012 . “ Evolutionary Conflicts between Viruses and Restriction Factors Shape Immunity .” Nature Reviews. Immunology 12 ( 10 ): 687 – 95 . OpenUrl CrossRef PubMed ↵ Edgar , James R. , Paul T. Manna , Shinichi Nishimura , George Banting , and Margaret S. Robinson . 2016 . “ Tetherin Is an Exosomal Tether .” eLife 5 ( September ). doi: 10.7554/eLife.17180 . OpenUrl CrossRef PubMed ↵ Elleder , Daniel , Volodymir Stepanets , Deborah C. Melder , Filip Senigl , Josef Geryk , Petr Pajer , Jirí Plachý , Jirí Hejnar , Jan Svoboda , and Mark J. Federspiel . 2005 . “ The Receptor for the Subgroup C Avian Sarcoma and Leukosis Viruses, Tvc, Is Related to Mammalian Butyrophilins, Members of the Immunoglobulin Superfamily .” Journal of Virology 79 ( 16 ): 10408 – 19 . OpenUrl Abstract / FREE Full Text ↵ Epeldegui , Marta , Bianca Blom , and Christel H. Uittenbogaart . 2015 . “ BST2/Tetherin Is Constitutively Expressed on Human Thymocytes with the Phenotype and Function of Treg Cells .” European Journal of Immunology 45 ( 3 ): 728 – 37 . OpenUrl CrossRef PubMed ↵ Genovese , Kenneth J. , Haiqi He , Christina L. Swaggerty , and Michael H. Kogut . 2013 . “ The Avian Heterophil .” Developmental and Comparative Immunology 41 ( 3 ): 334 – 40 . OpenUrl CrossRef PubMed ↵ Gómez-Lucía , Esperanza , Victorio M. Collado , Guadalupe Miró , and Ana Doménech . 2009 . “ Effect of Type-I Interferon on Retroviruses .” Viruses 1 ( 3 ): 545 – 73 . OpenUrl CrossRef PubMed ↵ Goto , T. , S. J. Kennel , M. Abe , M. Takishita , M. Kosaka , A. Solomon , and S. Saito . 1994 . “ A Novel Membrane Antigen Selectively Expressed on Terminally Differentiated Human B Cells .” Blood 84 ( 6 ): 1922 – 30 . OpenUrl Abstract / FREE Full Text ↵ Heusinger , Elena , Silvia F. Kluge , Frank Kirchhoff , and Daniel Sauter . 2015 . “ Early Vertebrate Evolution of the Host Restriction Factor Tetherin .” Journal of Virology 89 ( 23 ): 12154 – 65 . OpenUrl Abstract / FREE Full Text ↵ Khwatenge , Collins N. , and Samuel N. Nahashon . 2021 . “ Recent Advances in the Application of CRISPR/Cas9 Gene Editing System in Poultry Species .” Frontiers in Genetics 12 ( February ): 627714 . OpenUrl ↵ Koslová , Anna , Pavel Trefil , Jitka Mucksová , Veronika Krchlíková , Jiří Plachý , Jakub Krijt , Markéta Reinišová , et al. 2021 . “ Knock-Out of Retrovirus Receptor Gene in the Chicken Confers Resistance to Avian Leukosis Virus Subgroups A and K and Affects Cobalamin (Vitamin B)-Dependent Level of Methylmalonic Acid .” Viruses 13 ( 12 ). doi: 10.3390/v13122504 . OpenUrl CrossRef ↵ Koslová , Anna , Pavel Trefil , Jitka Mucksová , Markéta Reinišová , Jiří Plachý , Jiří Kalina , Dana Kucerová , et al. 2020 . “ Precise CRISPR/Cas9 Editing of the NHE1 Gene Renders Chickens Resistant to the J Subgroup of Avian Leukosis Virus .” Proceedings of the National Academy of Sciences of the United States of America 117 ( 4 ): 2108 – 12 . OpenUrl Abstract / FREE Full Text ↵ Krchlíková , Veronika , Helena Fábryová , Tomáš Hron , Janet M. Young , Anna Koslová , Jiří Hejnar , Klaus Strebel , and Daniel Elleder . 2020 . “ Antiviral Activity and Adaptive Evolution of Avian Tetherins .” Journal of Virology 94 ( 12 ). doi: 10.1128/JVI.00416-20 . OpenUrl Abstract / FREE Full Text ↵ Krchlíková , Veronika , Rishikesh Lotke , Isabell Haußmann , Markéta Reinišová , Dana Kucerová , Ľubomíra Pecnová , Lenka Ungrová , Jiří Hejnar , Daniel Sauter , and Daniel Elleder . 2023 . “ Independent Loss Events of a Functional Gene in Galliform Birds .” Journal of Virology 97 ( 10 ): e0080323 . OpenUrl ↵ Liberatore , Rachel A. , and Paul D. Bieniasz . 2011 . “ Tetherin Is a Key Effector of the Antiretroviral Activity of Type I Interferon in Vitro and in Vivo .” Proceedings of the National Academy of Sciences of the United States of America 108 ( 44 ): 18097 – 101 . OpenUrl Abstract / FREE Full Text ↵ Li , Sam X. , Bradley S. Barrett , Karl J. Heilman , Ronald J. Messer , Rachel A. Liberatore , Paul D. Bieniasz , George Kassiotis , Kim J. Hasenkrug , and Mario L. Santiago . 2014 . “ Tetherin Promotes the Innate and Adaptive Cell-Mediated Immune Response against Retrovirus Infection in Vivo .” Journal of Immunology 193 ( 1 ): 306 – 16 . OpenUrl Abstract / FREE Full Text ↵ Mahauad-Fernandez , Wadie D. , and Chioma M. Okeoma . 2016 . “ The Role of BST-2/Tetherin in Host Protection and Disease Manifestation .” Immunity, Inflammation and Disease 4 ( 1 ): 4 – 23 . OpenUrl ↵ Mucksová , Jitka , Markéta Reinišová , Jiří Kalina , Barbora Lejcková , Jiří Hejnar , and Pavel Trefil . 2019 . “ Conservation of Chicken Male Germline by Orthotopic Transplantation of Primordial Germ Cells from Genetically Distant Donors .” Biology of Reproduction 101 ( 1 ): 200 – 207 . OpenUrl ↵ Nabi , Ghulam , Yang Wang , Liang Lü , Chuan Jiang , Shahid Ahmad , Yuefeng Wu , and Dongming Li . 2021 . “ Bats and Birds as Viral Reservoirs: A Physiological and Ecological Perspective .” The Science of the Total Environment 754 ( February ): 142372 . OpenUrl ↵ Neil , Stuart J. D. , Trinity Zang , and Paul D. Bieniasz . 2008 . “ Tetherin Inhibits Retrovirus Release and Is Antagonized by HIV-1 Vpu .” Nature 451 ( 7177 ): 425 – 30 . OpenUrl CrossRef PubMed Web of Science ↵ Plachý , J. 2000 . “ The Chicken--a Laboratory Animal of the Class Aves .” Folia Biologica 46 ( 1 ): 17 – 23 . OpenUrl PubMed ↵ Rollason , Ruth , Viktor Korolchuk , Clare Hamilton , Mark Jepson , and George Banting . 2009 . “ A CD317/tetherin-RICH2 Complex Plays a Critical Role in the Organization of the Subapical Actin Cytoskeleton in Polarized Epithelial Cells .” The Journal of Cell Biology 184 ( 5 ): 721 – 36 . OpenUrl Abstract / FREE Full Text ↵ Sauter , Daniel . 2014 . “ Counteraction of the Multifunctional Restriction Factor Tetherin .” Frontiers in Microbiology 5 ( April ): 163 . OpenUrl ↵ Seliger , Christian , Beatrice Schaerer , Marina Kohn , Helene Pendl , Steffen Weigend , Bernd Kaspers , and Sonja Härtle . 2012 . “ A Rapid High-Precision Flow Cytometry Based Technique for Total White Blood Cell Counting in Chickens .” Veterinary Immunology and Immunopathology 145 ( 1-2 ): 86 – 99 . OpenUrl CrossRef PubMed ↵ Sid , Hicham , and Benjamin Schusser . 2018 . “ Applications of Gene Editing in Chickens: A New Era Is on the Horizon .” Frontiers in Genetics 9 ( October ): 456 . OpenUrl ↵ Swiecki , Melissa , Yaming Wang , Susan Gilfillan , Deborah J. Lenschow , and Marco Colonna . 2012 . “ Cutting Edge: Paradoxical Roles of BST2/tetherin in Promoting Type I IFN Response and Viral Infection .” Journal of Immunology 188 ( 6 ): 2488 – 92 . OpenUrl Abstract / FREE Full Text ↵ Tiwari , Ritudhwaj , Juan C. de la Torre , Dorian B. McGavern , and Debasis Nayak . 2019 . “ Beyond Tethering the Viral Particles: Immunomodulatory Functions of Tetherin ().” DNA and Cell Biology 38 ( 11 ): 1170 – 77 . OpenUrl CrossRef ↵ Trefil , Pavel , Dorothea Aumann , Anna Koslová , Jitka Mucksová , Barbora Benešová , Jiří Kalina , Christine Wurmser , et al. 2017 . “ Male Fertility Restored by Transplanting Primordial Germ Cells into Testes: A New Way towards Efficient Transgenesis in Chicken .” Scientific Reports 7 ( 1 ): 14246 . OpenUrl ↵ Urata , Shuzo , Sachiko Yamaguchi , Aya Nambu , Katsuko Sudo , Susumu Nakae , and Jiro Yasuda . 2023 . “ The Roles of BST-2 in Murine B Cell Development and on Virus Propagation .” Microbiology and Immunology 67 ( 3 ): 105 – 13 . OpenUrl ↵ Van Damme , Nanette , Daniel Goff , Chris Katsura , Rebecca L. Jorgenson , Richard Mitchell , Marc C. Johnson , Edward B. Stephens , and John Guatelli . 2008 . “ The Interferon-Induced Protein BST-2 Restricts HIV-1 Release and Is Downregulated from the Cell Surface by the Viral Vpu Protein .” Cell Host & Microbe 3 ( 4 ): 245 – 52 . OpenUrl CrossRef PubMed Web of Science ↵ Woodcock , Mark E. , Alewo Idoko-Akoh , and Michael J. McGrew . 2017 . “ Gene Editing in Birds Takes Flight .” Mammalian Genome: Official Journal of the International Mammalian Genome Society 28 ( 7-8 ): 315 – 23 . OpenUrl ↵ Wu , Zhiguang , Barbara Shih , Joni Macdonald , Dominique Meunier , Kris Hogan , Cosmin Chintoan-Uta , Hazel Gilhooley , et al. 2023 . “ Development and Function of Chicken XCR1 Conventional Dendritic Cells .” Frontiers in Immunology 14 ( October ): 1273661 . OpenUrl ↵ Yoo , Su-Hyang , Jae Goo Kim , Beom-Su Kim , Jun Lee , Sung-Hee Pi , Hyun-Dae Lim , Hong-In Shin , Eui-Sic Cho , and Hyung-Keun You . 2016 . “ BST2 Mediates Osteoblast Differentiation via the BMP2 Signaling Pathway in Human Alveolar-Derived Bone Marrow Stromal Cells .” PloS One 11 ( 6 ): e0158481 . OpenUrl ↵ Zhao , Xiaojuan , Dominic Alibhai , Ting Sun , Jawad Khalil , James L. Hutchinson , Kaya Olzak , Christopher M. Williams , et al. 2021 . “ Tetherin/BST2, a Physiologically and Therapeutically Relevant Regulator of Platelet Receptor Signalling .” Blood Advances 5 ( 7 ): 1884 – 98 . OpenUrl View the discussion thread. Back to top Previous Next Posted June 27, 2024. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Generation and initial characterization of in vivo knockout of tetherin/BST2 in chicken Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Generation and initial characterization of in vivo knockout of tetherin/BST2 in chicken Lenka Ungrová , Pavel Trefil , Jiří Plachý , Jitka Mucksová , Jiří Kalina , Markéta Reinišová , Sonja Härtle , Eliška Gáliková , Dana Kučerová , Veronika Krchlíková , Vladimír Pečenka , Vít Karafiát , Jiří Hejnar , Daniel Elleder bioRxiv 2024.06.24.600038; doi: https://doi.org/10.1101/2024.06.24.600038 Share This Article: Copy Citation Tools Generation and initial characterization of in vivo knockout of tetherin/BST2 in chicken Lenka Ungrová , Pavel Trefil , Jiří Plachý , Jitka Mucksová , Jiří Kalina , Markéta Reinišová , Sonja Härtle , Eliška Gáliková , Dana Kučerová , Veronika Krchlíková , Vladimír Pečenka , Vít Karafiát , Jiří Hejnar , Daniel Elleder bioRxiv 2024.06.24.600038; doi: https://doi.org/10.1101/2024.06.24.600038 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7651) Biochemistry (17746) Bioengineering (13928) Bioinformatics (42066) Biophysics (21499) Cancer Biology (18650) Cell Biology (25579) Clinical Trials (138) Developmental Biology (13409) Ecology (19947) Epidemiology (2067) Evolutionary Biology (24374) Genetics (15633) Genomics (22557) Immunology (17775) Microbiology (40505) Molecular Biology (17217) Neuroscience (88796) Paleontology (667) Pathology (2845) Pharmacology and Toxicology (4836) Physiology (7664) Plant Biology (15179) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9839) Zoology (2272)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00