TagGen: High-Performance Barcode Generator and... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/15-642" }, "headline": "TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput and Long-Read Sequencing...", "datePublished": "2026-04-30T06:47:17", "dateModified": "2026-04-30T06:47:17", "author": [ { "@type": "Person", "name": "Faiza Chowdhury" }, { "@type": "Person", "name": "Tessa Swain" }, { "@type": "Person", "name": "Roderik Shirokikh" }, { "@type": "Person", "name": "Danielle Rudler" }, { "@type": "Person", "name": "Archa Fox" }, { "@type": "Person", "name": "Alice Cleynen" }, { "@type": "Person", "name": "Nikolay Shirokikh" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Long-read sequencing platforms, particularly Oxford Nanopore Technologies (ONT), have transformed transcriptomics through direct RNA sequencing. However, their higher error rates – dominated by insertions and deletions – demand longer, more robust sequence barcodes than traditional short-read applications. Existing barcode generation tools suffer from exponential complexity, becoming computationally infeasible at lengths above 12 bp and leaving a critical gap for long-read applications. Methods We developed TagGen, a high-performance barcode generator implementing Monte Carlo candidate sampling with greedy diversity selection. TagGen includes an integrated demultiplexer that assigns ONT reads to their source barcodes regardless of the tag position using a kmer voting and banded edit-distance matching pipeline. We benchmarked TagGen using Badread-simulated reads and validated barcode resilience using a literature-based nanopore error model. Results TagGen generates 96 diverse 12 bp barcodes from 100,000 candidates in under 100 milliseconds, outperforming exhaustive enumeration by up to 13,600-fold. TagGen successfully generates barcodes at 14–30 bp lengths where other available tools fail. Noise simulation demonstrates that TagGen-generated 30 bp barcodes (minimum Hamming distance ≥8) maintain 100% correct assignment at 20% total error rate, whereas traditional 10 bp barcodes degrade to 83%. At typical nanopore error rates (10–15%), taggen-generated barcodes ≥14 bp achieve >97% theoretical resolution. When inserted within a read, our systematic benchmark shows that TagGen demultiplexer achieved >90% accuracy with zero wrong-sample assignments (“end” mode) for reads ≥20 bp. Levenshtein edit distance, recommended for ONT data, improved accuracy by 10–27 percentage points over Hamming distance at equivalent parameters. Conclusions TagGen uniquely enables robust barcode design for nanopore and direct RNA sequencing applications, providing researchers with error-tolerant barcodes validated against realistic long-read error profiles, and an integrated anchor-free demultiplexer for flexible read assignment. The software is freely available at https://github.com/Arnaroo/taggen. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/15-642", "name": "TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput..." } } ] } Home Browse TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Chowdhury F, Swain T, Shirokikh R et al. TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput and Long-Read Sequencing Applications [version 1; peer review: awaiting peer review] . F1000Research 2026, 15 :642 ( https://doi.org/10.12688/f1000research.179899.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Software Tool Article TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput and Long-Read Sequencing Applications [version 1; peer review: awaiting peer review] Faiza Chowdhury 1 , Tessa Swain https://orcid.org/0000-0003-2184-1717 1 , Roderik Shirokikh 1 , [...] Danielle Rudler 1 , Archa Fox https://orcid.org/0000-0003-1962-270X 1 , Alice Cleynen 2 , Nikolay Shirokikh https://orcid.org/0000-0001-8249-358X 1 Faiza Chowdhury 1 , Tessa Swain https://orcid.org/0000-0003-2184-1717 1 , [...] Roderik Shirokikh 1 , Danielle Rudler 1 , Archa Fox https://orcid.org/0000-0003-1962-270X 1 , Alice Cleynen 2 , Nikolay Shirokikh https://orcid.org/0000-0001-8249-358X 1 PUBLISHED 30 Apr 2026 Author details Author details 1 School of Human Sciences, The University of Western Australia, Perth, WA, 6009, Australia 2 France-Australia Mathematical Sciences and Interactions, CNRS International Research Laboratory, Canberra, ACT, 2601, Australia Faiza Chowdhury Roles: Data Curation, Investigation, Visualization, Writing – Original Draft Preparation Tessa Swain Roles: Conceptualization, Validation, Writing – Review & Editing Roderik Shirokikh Roles: Validation, Writing – Review & Editing Danielle Rudler Roles: Visualization, Writing – Review & Editing Archa Fox Roles: Funding Acquisition, Supervision, Writing – Review & Editing Alice Cleynen Roles: Conceptualization, Formal Analysis, Funding Acquisition, Methodology, Software, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing Nikolay Shirokikh Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW REVIEWER STATUS AWAITING PEER REVIEW This article is included in the Bioinformatics gateway. Abstract Background Long-read sequencing platforms, particularly Oxford Nanopore Technologies (ONT), have transformed transcriptomics through direct RNA sequencing. However, their higher error rates – dominated by insertions and deletions – demand longer, more robust sequence barcodes than traditional short-read applications. Existing barcode generation tools suffer from exponential complexity, becoming computationally infeasible at lengths above 12 bp and leaving a critical gap for long-read applications. Methods We developed TagGen, a high-performance barcode generator implementing Monte Carlo candidate sampling with greedy diversity selection. TagGen includes an integrated demultiplexer that assigns ONT reads to their source barcodes regardless of the tag position using a kmer voting and banded edit-distance matching pipeline. We benchmarked TagGen using Badread-simulated reads and validated barcode resilience using a literature-based nanopore error model. Results TagGen generates 96 diverse 12 bp barcodes from 100,000 candidates in under 100 milliseconds, outperforming exhaustive enumeration by up to 13,600-fold. TagGen successfully generates barcodes at 14–30 bp lengths where other available tools fail. Noise simulation demonstrates that TagGen-generated 30 bp barcodes (minimum Hamming distance ≥8) maintain 100% correct assignment at 20% total error rate, whereas traditional 10 bp barcodes degrade to 83%. At typical nanopore error rates (10–15%), taggen-generated barcodes ≥14 bp achieve >97% theoretical resolution. When inserted within a read, our systematic benchmark shows that TagGen demultiplexer achieved >90% accuracy with zero wrong-sample assignments (“end” mode) for reads ≥20 bp. Levenshtein edit distance, recommended for ONT data, improved accuracy by 10–27 percentage points over Hamming distance at equivalent parameters. Conclusions TagGen uniquely enables robust barcode design for nanopore and direct RNA sequencing applications, providing researchers with error-tolerant barcodes validated against realistic long-read error profiles, and an integrated anchor-free demultiplexer for flexible read assignment. The software is freely available at https://github.com/Arnaroo/taggen. READ ALL READ LESS Keywords DNA barcodes, RNA barcodes, RNA tags, nanopore sequencing, direct RNA sequencing, long-read sequencing, high- throughput sequencing, multiplexing, demultiplexing, error tolerance, sample identification Corresponding Author(s) Alice Cleynen ( [email protected] ) Nikolay Shirokikh ( [email protected] ) Close Corresponding authors: Alice Cleynen, Nikolay Shirokikh Competing interests: No competing interests were disclosed. Grant information: This project has received funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No 890462. National Health and Medical Research Council of Australia (NHMRC) Investigator Grant (GNT1175388) to N.E.S.; Bootes Foundation Grant (2022) to N.E.S.; Australian Research Council Discovery Grant (DP180100111, DP250103133) to N.E.S.; CNRS Postes Rouges Grant (2025) to N.E.S.; National Health and Medical Research Council of Australia Grant (APP1147496) to A.H.F.; Australian Research Council Grant (FT180100204) to A.H.F. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2026 Chowdhury F et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Chowdhury F, Swain T, Shirokikh R et al. TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput and Long-Read Sequencing Applications [version 1; peer review: awaiting peer review] . F1000Research 2026, 15 :642 ( https://doi.org/10.12688/f1000research.179899.1 ) First published: 30 Apr 2026, 15 :642 ( https://doi.org/10.12688/f1000research.179899.1 ) Latest published: 30 Apr 2026, 15 :642 ( https://doi.org/10.12688/f1000research.179899.1 ) Introduction The emergence of long-read sequencing has revolutionized genomics and transcriptomics. 1 Oxford Nanopore Technologies (ONT) platforms enable direct RNA sequencing without reverse transcription, preserving RNA modifications and full-length transcript information. 2 – 4 However, these advantages come with distinct challenges: nanopore sequencing exhibits error rates of 5–15%, dominated by insertions and deletions rather than the substitution errors typical of short-read platforms. 5 , 6 Sequence (DNA or RNA) barcodes or tags – short sequences used to identify samples, cells, or spatial locations in a pool of many DNA or RNA molecules – are essential for multiplexed sequencing. 7 , 8 For short-read sequencing, barcodes of 8–12 bp (or nt) with minimum Hamming distances of 3–4 provide adequate error tolerance. The Hamming distance between two sequences of equal length counts the number of positions at which the corresponding bases differ; a minimum pairwise Hamming distance of d guarantees that up to ⌊(d − 1)/2⌋ substitution errors can be corrected. The Levenshtein (edit) distance – which additionally accounts for insertions and deletions – is a more comprehensive but computationally costlier measure of sequence dissimilarity. However, the indel-dominated error profile of nanopore sequencing demands longer barcodes with greater inter-sequence distances to maintain reliable sample identification. 5 , 6 While sequencing barcodes (tags) are an essential molecular biology instrument, there have been unaddressed challenges in computationally designing robust longer tags with well-described, predictable behavior. The computational challenge of barcode generation scales exponentially with length. Several tools exist for DNA barcode generation, each with distinct approaches and limitations ( Table 1 ) . The widely-used DNABarcodes R package 9 , 10 exhaustively enumerates all 4 n possible sequences before filtering – 65,536 sequences at 8 bp, but 268 million at 14 bp. This approach fails at lengths above 12 bp due to memory exhaustion, precisely where long-read applications require robust barcodes. TagGD 11 provides efficient demultiplexing but focuses on barcode assignment rather than de novo generation. BARCOSEL 12 selects optimal subsets from existing barcode pools but cannot generate new sequences. FreeBarcodes 13 generates indel-correcting barcodes but requires hours for large sets and targets specific code lengths. Edittag 14 provides edit-distance-based design but with limited scalability. PRO 15 takes a different approach designed specifically for nanopore applications: it uses a farthest-point sampling algorithm with probability divergence – a metric that models the sequencing error process more directly than edit distance – and includes built-in demultiplexing. However, PRO operates at a fixed barcode length matching the official ONT kit (24 bp) and targets maximizing barcode set size (up to 2,292 barcodes) rather than providing user-defined target counts, as well as requires the barcodes to be flanked by known adapter sequences. PRO offers no GC content filtering, homopolymer constraints, custom exclude sequences, graphical interface, or distance visualisation. None of these tools offer the combination of flexible barcode length (8–30 bp), sub-second generation, user-defined quality constraints, integrated demultiplexing, nor an accessible interface that nanopore researchers need to adapt barcode design to their specific error profiles. Table 1. Feature comparison of DNA barcode generation tools. Key capabilities of seven barcode generators are compared, including maximum practical barcode length, generation speed, interface availability, and constraint options. Symbols: ✓, supported; −, not supported or not applicable. Feature TagGen PRO DNABarcodes BARCOSEL TagGD FreeBarcodes Edittag Maximum practical length 30 bp 24 bp ~12 bp Any * 16 bp 20 bp 12 bp De novo generation ✓ ✓ ✓ – – ✓ ✓ Generation time (14 bp, 96 barcodes) 54 ms ~7 min N/A † – – Hours N/A ‡ Graphical interface ✓ – – Web – – – Command-line interface ✓ ✓ ✓ – ✓ ✓ ✓ Parallel processing ✓ – – – – – – Custom exclude sequences ✓ ✓ ✓ – – – ✓ GC content constraints ✓ – ✓ – – – ✓ Homopolymer filtering ✓ – – – – – – Distance visualization ✓ – – – – – – JSON config support ✓ – – – – – – * BARCOSEL selects from existing pools rather than generating de novo. † DNABarcodes fails due to memory exhaustion at 14 bp. ‡ Edittag requires Python 2 and cannot be run on modern systems. We developed TagGen to address this gap. By replacing exhaustive enumeration with Monte Carlo sampling, TagGen achieves linear complexity regardless of barcode length, enabling generation of 14–30 bp barcodes optimized for nanopore sequencing. Crucially, barcode generation alone is insufficient for a complete multiplexing workflow: once sequenced reads are obtained, each read must be assigned back to its source barcode – a process known as demultiplexing. Existing demultiplexers ( Table 2 ) typically require knowledge of flanking adapter sequences to anchor the barcode search, restricting them to standard kit-based library preparations. In contrast, TagGen includes an integrated anchor-free demultiplexer (taggen-demux) that locates barcodes at any position within a read – at the 5′ or 3′ end, or embedded mid-read – using a k-mer voting and banded edit-distance pipeline. This design enables demultiplexing of direct RNA sequencing reads, spatial transcriptomics libraries, and custom protocols where the barcode position is non-standard or variable. Position masks allow the user to restrict the search to the expected barcode region, minimising false positive matches while accommodating diverse library architectures. We validate these barcodes against realistic nanopore error profiles, demonstrating their resilience under conditions where traditional short barcodes fail. TagGen provides a complete barcoding pipeline: barcode design, simulation and quality validation, and post-sequencing demultiplexing. This integration removes the need to coordinate separately maintained tools and ensures that the distance parameters used during barcode generation are directly matched to the tolerances applied during demultiplexing. We describe the demultiplexer design and its systematic validation below. Table 2. Feature comparison of demultiplexing tools. Seven demultiplexers are compared across barcode flexibility, search strategy, distance metric, and maintenance status. Symbols: ✓, supported; ✗, discontinued; −, not supported. Feature TagGen minibar PRO-demux qcat Dorado Porechop DeePlexiCon Accepts user-defined barcodes ✓ ✓ – – Limited † ✓ – Tag location Any Any 5′ 5′ 5′ or 3’ 5′ or 3’ 5′ Adapter sequence required – ✓ ✓ ✓ ✓ ✓ – Distance metric Edit Edit Prob. div. Edit Edit Edit Neural net Configurable mismatch threshold ✓ ✓ – – – – – Indel-aware matching ✓ ✓ ✓ Partial ✓ Partial ✓ Real-time/live support – – – – ✓ – – GPU acceleration – – – – ✓ – ✓ Active maintenance ✓ ✓ ✓ ✗ ‡ ✓ ✗ ‡ Limited Graphical interface ✓ – – – – – – Command-line interface ✓ ✓ ✓ ✓ ✓ ✓ ✓ † Dorado supports custom barcodes via kit configuration files but not arbitrary user-defined sequences. ‡ qcat 16 and Porechop 17 are no longer actively maintained; consider Dorado or minibar for new workflows. Methods Tag generation algorithm design TagGen implements a two-phase algorithm fundamentally different from exhaustive enumeration ( Figure 1 ). Figure 1. TagGen overview: barcode design for nanopore sequencing. (A) Nanopore sequencing errors are dominated by deletions (50%), insertions (25%), and substitutions (25%) at 5–15% total error rates, requiring longer barcodes than short-read platforms. (B) Existing tools enumerate all 4 n sequences exhaustively, causing memory exhaustion at ≥14 bp (268 million sequences). TagGen’s Monte Carlo sampling operates at constant complexity O(k) regardless of length. (C) TagGen’s two-phase generation algorithm: Phase 1 generates ~100,000 random candidates validated against user constraints in parallel; Phase 2 applies greedy diversity selection maximising minimum pairwise Hamming or Levenshtein distance. (D) TagGen’s integrated demultiplexer: a two-stage anchor-free pipeline that assigns reads to source barcodes without requiring flanking adapter sequences. Stage 1 uses k-mer voting to rapidly identify candidate barcodes and estimate their location; Stage 2 performs banded edit-distance alignment to confirm the best match against configurable acceptance criteria. (E) Validation under a nanopore error model demonstrates that 30 bp barcodes (d ≥ 8) maintain 100% correct assignment at 20% error rate, while 10 bp barcodes degrade to 83%. Barcodes ≥14 bp achieve >97% resolution at typical ONT error rates (10–15%). (F) TagGen addresses sample multiplexing, direct RNA sequencing, and spatial transcriptomics through an integrated GUI and CLI pipeline with built-in demultiplexing. Phase 1: Monte Carlo Candidate Generation. Rather than enumerating all 4 n sequences, TagGen generates random candidates validated in real-time against user-specified constraints (GC content, homopolymer limits, exclude sequences). Generation proceeds in parallel across CPU cores and terminates upon collecting sufficient valid candidates (typically ~1,250 candidates in ~55 ms). Phase 2: Greedy Diversity Selection. From the candidate pool, TagGen iteratively selects sequences maximizing minimum Hamming or Levenshtein distance to already-selected barcodes, producing a maximally diverse final set (typically 96 barcodes in ~25 ms additional time). Algorithm pseudocode The following pseudocode formalizes TagGen’s two-phase approach. Algorithm 1. Monte Carlo Candidate Generation. Input: length, targetCandidates, gcMin, gcMax, homopolymerLimit, excludeSeqs Output: candidatePool (set of valid barcode candidates) 1. Initialize candidatePool ← ∅ 2. Initialize lock for thread-safe access 3. parallel for each CPU core do: 4. while|candidatePool|< targetCandidates do: 5. seq ← generateRandomSequence (length) //uniform random A,C,G,T 6. //Validate constraints 7. if gcContent (seq) gcMax then 8. continue 9. if maxHomopolymerRun (seq) > homopolymerLimit then 10. continue 11. if seq ∈ excludeSeqs then 12. continue 13. //Thread-safe addition 14. acquire (lock) 15. candidatePool ← candidatePool ∪ {seq} 16. release (lock) 17. end while 18. end parallel 19. return candidatePool Algorithm 2. Greedy Diversity Selection. Input: candidatePool, targetCount, minDistance Output: selectedBarcodes (maximally diverse subset) 1. Initialize selectedBarcodes ← ∅ 2. Initialize distanceMatrix [I,j] for all pairs in candidatePool//distance can be hamming (default, fastest) or Levenshtein (slower, indels considered) 3. //Select first barcode (arbitrary or random) 4. selectedBarcodes ← selectedBarcodes ∪ {candidatePool[0]} 5. while|selectedBarcodes|< targetCount do: 6. bestCandidate ← null 7. bestMinDist ← -1 8. for each candidate in candidatePool \ selectedBarcodes do: 9. //Find minimum distance to any selected barcode 10. minDist ← min {distanceMatrix [candidate, s] : s ∈ selectedBarcodes} : s ∈ selectedBarcodes} 11. if minDist > bestMinDist then 12. bestMinDist ← minDist 13. bestCandidate ← candidate 14. end for 15. if bestMinDist < minDistance then 16. break//Cannot achieve required minimum distance 17. selectedBarcodes ← selectedBarcodes ∪ {bestCandidate} 18. end while 19. return selectedBarcodes Complexity analysis The algorithmic approaches differ fundamentally in complexity: • Exhaustive enumeration: O(4 n ) where n = barcode length • Monte Carlo sampling: O(k) where k = candidates generated (typically 10,000–100,000) For 14 bp barcodes, this represents a 2,680-fold reduction in operations (100,000 vs. 268 million), translating to milliseconds versus memory exhaustion. Generation time is largely independent of candidate pool size for a fixed target count ( Extended Data Figure 1 ). Integrated demultiplexer TagGen includes a built-in demultiplexer (also standalone as taggen-demux) that assigns ONT FASTQ reads to their source barcodes. It is available both as a command-line subcommand (taggen --demux) and as a dedicated tab in the graphical interface. Each read is processed by a two-stage pipeline. In the first stage, all 8-mers in the read’s search region are looked up against a pre-built index that maps each 8-mer to the set of barcodes containing it, and candidate barcodes are ranked by hit count (k-mer voting). The top candidate’s hit positions are averaged to estimate the barcode location within the read. In the second stage, a banded edit distance computation slides the candidate barcode across a window of (tag length + 15) bp centred on the estimated location, yielding the minimum edit distance to the read. The best-matching barcode is accepted if three criteria are met: (i) the edit distance does not exceed the automatically derived maximum (adaptive rule: tag_length/5 for tags shorter than 20 bp, tag_length/4 for 20–29 bp, tag_length/3 for ≥30 bp; overridable via --max-dist); (ii) the margin between the best and second-best candidate distance is at least 2 (ambiguity guard); and (iii) a confidence score derived from the edit distance exceeds a user-configurable threshold (default 0). Reads failing any criterion are written to an “unassigned” output file, annotated with the reason (no_match, ambiguous, or low_confidence). This conservative strategy ensures that uncertain reads are withheld rather than wrongly assigned. Distance metrics Both Hamming distance (substitutions only) and Levenshtein edit distance (substitutions, insertions, deletions) are supported and applied consistently between barcode generation and demultiplexing. Because ONT sequencing produces a characteristic error profile with a significant proportion of insertion and deletion errors – particularly at homopolymer runs – Levenshtein distance is recommended for most ONT workflows. Hamming distance remains available for platforms with predominantly substitution errors or when computational speed is a priority. Search modes Two search modes accommodate different library preparation strategies, as follows. End mode (default): the demultiplexer searches a window at each end of the read and its reverse complement, corresponding to the standard dual-ended library structure [barcode][adapter][insert] [RC (adapter)][RC (barcode)]. This is the appropriate mode for ligation-based ONT DNA libraries. Full mode: the entire read is scanned for the barcode, intended for protocols where the barcode may appear at an internal position (e.g., direct RNA sequencing with a mid-read adapter ligation, or custom in-read tagging schemes). In full mode, users can specify one or more position masks to restrict the search to the expected barcode region, reducing false positive k-mer seeds from flanking sequence. Masks may be expressed as absolute positions (start:end in bp), end-relative offsets (5p:N for the first N bp from the 5′ end; 3p:N for the last N bp from the 3′ end), or as read-length fractions (f_start:f_end,resolved per read). Multiple zones are merged and the union is searched. Read trimming and output Three trimming modes are available: none (reads written unmodified), ends (barcode trimmed from the matched end), and all (barcodes trimmed from both ends). FASTQ headers of assigned reads are annotated with the barcode name, edit distance, and confidence score. Assigned reads are written to per-sample subdirectories; unassigned reads to a separate subdirectory. Gzip compressed input is supported and processed in streaming batches to maintain constant memory usage. A per-sample statistics TSV file records the number of reads assigned per barcode, expected read count, and mean Q-score, enabling rapid quality assessment. In the GUI, these statistics are displayed as four interactive charts: barcode match position distribution, per sample assignment counts, edit distance and confidence distributions, and per-sample Q-score profiles. POD5 co-demultiplexing When raw POD5 signal files are present alongside FASTQ reads, TagGen can invoke the pod5 subset tool to partition signal files by sample, enabling downstream signal-level analyses (e.g., modified base calling) on a per-sample basis. Implementation TagGen is implemented in D ( dlang.org ), a systems programming language combining high-level expressiveness with native code performance. The application is compiled using the LDC2 compiler (LLVM-based D compiler) with release optimizations enabled. The software architecture comprises six primary modules ( Figure 1 ): 1. Candidate Generation Module: Implements parallel Monte Carlo sampling using D’s std.parallelism library. Each worker thread independently generates random nucleotide sequences and validates them against user constraints in real-time. Valid candidates are collected into a thread-safe pool using atomic operations ( Extended Data Figure 2 ). The module employs the Mersenne Twister pseudorandom number generator for sequence generation. 2. Diversity Selection Module: Implements greedy subset selection with Hamming or Levenshtein distance calculation. The algorithm maintains a distance matrix and iteratively selects the candidate maximizing minimum distance to all previously selected barcodes. Distance calculations use optimized bitwise operations for performance. 3. GUI Module: Built using GtkD bindings to the GTK3 toolkit, providing a cross-platform graphical interface. The interface includes real-time parameter validation, progress indication, and interactive heatmap visualization of pairwise barcode distances using Cairo graphics. 4. CLI Module: Provides complete command-line functionality for scriptable pipeline integration. Supports all generation parameters, JSON configuration files for reproducible workflows, multiple output formats, and verbose progress reporting. 5. Export Module: Generates output in FASTA format (for direct use in sequencing pipelines), TSV format (for spreadsheet analysis), and optional distance matrix export, with configurable sequence headers and metadata. 6. Demultiplexer Module: Implements a two-stage read assignment pipeline. The first stage uses a k-mer index (8-mer vocabulary) for rapid candidate identification via vote counting; the second stage performs banded edit-distance alignment to confirm the best match. The module supports end-mode and full-mode search with configurable position masks, adaptive acceptance thresholds, ambiguity detection, and three tag-trimming modes. POD5 signal file co-demultiplexing is supported via the pod5 subset command-line tool. Operation Minimum System Requirements: • Operating System: Linux (Arch, Ubuntu 18.04+, Debian 10+), Windows 10+, or macOS 10.14+ • Processor: Any x86–64 CPU; multi-core processors recommended for parallel generation • Memory: 512 MB RAM minimum; 2 GB recommended for large candidate pools • Disk Space: 50 MB for installation • Display: 1024 × 768 minimum resolution for GUI (not required for CLI operation) Installation: Pre-compiled binaries are available for Linux and Windows from the GitHub releases page. Linux users may also compile from source using the DUB package manager: dub build --compiler = ldc2 --build = release GUI Workflow: 1. Launch TagGen GUI: . /taggen 2. Configure barcode parameters: Tag length (8–30 bp recommended). Target barcode count (e.g., 96 for standard plates). Minimum Hamming distance (3–8 depending on error tolerance required) 3. Set quality constraints: GC content bounds (default: 30–70%). Maximum homopolymer length (default: 3) 4. Optionally load exclude sequences (FASTA format) to avoid similarity to adapters or primers 5. Click “Generate” to produce barcodes 6. Review pairwise distance heatmap for quality verification 7. Export to FASTA or TSV format Demultiplexing workflow (Demultiplex tab): 8. Switch to the Demultiplex tab 9. Load barcode FASTA file (generated above or user-supplied) 10. Select FASTQ read file(s) for demultiplexing 11. Choose search mode: end (for standard libraries) or full (for mid-read barcodes) 12. Optionally configure position mask, acceptance threshold, and trim mode 13. Click “Demultiplex” to assign reads to barcodes 14. Review interactive result charts: per-sample assignment counts, barcode match positions, edit distance distributions, and per-sample Q-score profiles 15. Demultiplexed reads are written to per-sample subdirectories; unassigned reads to a separate directory Command-Line Usage: TagGen provides a comprehensive CLI for automated pipelines. Barcode generation and demultiplexing examples are shown below: # Generate 96 barcodes with default parameters taggen -n 96 -l 14 -d 4 -o my_barcodes # Generate with custom GC constraints and exclude sequences taggen -n 96 -l 16 --minGc 40 --maxGc 60 -f adapters.fasta -v # Generate using JSON configuration file taggen -c experiment_config.json # Generate large pool with matrix output taggen -n 384 -l 20 -d 6 --metric levenshtein -m --heatmap -v # Demultiplex reads in end mode (standard dual-ended libraries) taggen --demux --tags my_barcodes.fasta --reads reads.fastq --mode end --trim-mode ends # Demultiplex with full-mode search and 5′ position mask taggen --demux --tags my_barcodes.fasta --reads reads.fastq --mode full --position-mask 5p:60 # Demultiplex mid-read barcodes with fractional mask and strict threshold taggen --demux --tags my_barcodes.fasta --reads reads.fastq --mode full --position-mask 0.05:0.20 --max-dist 4 Full CLI options are available via taggen –help . Nanopore error simulation To validate barcode resilience under realistic long-read conditions, we implemented a nanopore error simulator based on published characterizations. 5 , 6 , 18 Deletions: 50% of errors (most frequent in nanopore sequencing). Insertions: 25% of errors (random nucleotide insertion). Substitutions: 25% of errors (random nucleotide replacement). We tested error rates from 5% (high-quality R10.4 data) to 25% (stress test beyond typical conditions), encompassing typical ONT performance (10–15%) and degraded sample scenarios (20%). For each condition, 1,000 reads were simulated per barcode, with identification via minimum Levenshtein distance to the original barcode set. Benchmarking Performance comparisons were conducted on a workstation with a 12-core AMD processor running Arch Linux. TagGen (v1.2.0) barcode generation runtime was compared against DNABarcodes (v1.20.0) from Bioconductor. 10 Both tools were configured to generate 96 barcodes with equivalent constraint parameters (GC content 25–75%, minimum Hamming distance as specified). Timing measurements excluded I/O operations to focus on algorithmic performance. Each TagGen configuration was tested in triplicate; reported values are means ( Table 3 ). Table 3. Performance comparison between TagGen and DNABarcodes. Performance comparison between TagGen and DNABarcodes. Wall-clock generation times (mean of three replicates) for 96 barcodes at increasing lengths. All runs used Hamming distance and GC 25–75% on a 12-core AMD Linux workstation. Configuration TagGen DNABarcodes Speedup 8 bp, d ≥ 3 24 ms 120 ms 5× 10 bp, d ≥ 3 31 ms 24 s 770× 12 bp, d ≥ 4 34 ms 463 s 13,600× 14 bp, d ≥ 4 35 ms Memory exhaustion – 16 bp, d ≥ 4 35 ms Memory exhaustion – 20 bp, d ≥ 6 44 ms Memory exhaustion – 30 bp, d ≥ 8 29 ms Memory exhaustion – The practical sequencing utility of TagGen-generated barcodes was evaluated by simulating Oxford Nanopore reads with Badread v0.4.1 19 and measuring demultiplexing accuracy against ground truth. Reads were simulated using the nanopore2023 error model across read identity levels of 80–95% (corresponding to approximately 5–20% per-base error rates) spanning the range from early ONT chemistries to most recent high-accuracy data. Two demultiplexers were applied to the same simulated reads: taggen-demux (integrated, using Levenshtein distance) and minibar v0.25 (an established third-party ONT demultiplexer). 20 Results are reported as accuracy (percentage of reads correctly assigned to their source barcode) and error rate (reads assigned to a wrong barcode); reads failing matching criteria are classified as unassigned rather than wrong. Several other tools in this space were not included in the comparison. Qcat, 16 ONT’s open-source demultiplexer, is designed exclusively for ONT’s predefined native barcode kits and does not accept arbitrary user-defined sequences; similarly, the demultiplexing module integrated into ONT’s Dorado basecaller 21 is restricted to native barcode catalogues. Porechop 17 has been discontinued and does not support user-defined barcodes. PRO 15 is publicly available but a direct comparison remains impractical: PRO optimises for maximum barcode set size at a fixed length rather than accepting user-defined target counts and length ranges, and offers no GC content filtering, homopolymer constraints, or custom exclude sequences. These different design goals make a like-for-like accuracy comparison uninformative. Demultiplexing accuracy was evaluated across 154 parameter combinations in five systematic test phases using the same Badread simulation setup described above. Tag sets were generated with TagGen using a pool of 10,000 candidates, GC content 30–70%, maximum homopolymer 3 bp, and error tolerance t = 2. A hundred reads were simulated per barcode per run; ground-truth assignments were extracted from Badread read headers. Demultiplexing was performed with taggen-demux using an adaptive acceptance threshold (autoMaxDist: tag_length/5 for tags shorter than 20 bp, tag_length/4 for 20–29 bp, and tag_length/3 for tags of 30 bp or longer) unless otherwise noted. Three accuracy metrics were recorded for each condition: the fraction of reads correctly assigned to the originating sample (accuracy), the fraction assigned to an incorrect sample (misassignment error), and the fraction rejected as unassigned. Results TagGen dramatically outperforms exhaustive enumeration We benchmarked TagGen against DNABarcodes across configurations spanning short-read (8–12 bp) and long-read (14–30 bp) applications ( Figure 2 , Table 3 ). Figure 2. Performance comparison between TagGen and DNABarcodes. Generation times (log scale) across barcode lengths 8–30 bp. DNABarcodes (orange) fails at ≥14 bp due to memory exhaustion when attempting to enumerate 268+ million sequences. TagGen (blue) succeeds at all lengths with sub-second generation times for typical applications (14–20 bp). All benchmarks: 96 target barcodes, Hamming distance, GC 30-70%. Wall-clock times averaged over 3 replicates, Linux. DNABarcodes memory exhaustion occurs when attempting to enumerate 4 n sequences (268 million at 14 bp). At comparable configurations, TagGen is able to generate longer barcodes (14–30 bp range) with generation times below 50 ms for all tested lengths ( Extended Data Figure 3 ), while the exhaustive enumeration strategy of DNABarcodes fails entirely due to memory requirements exceeding available RAM when attempting to store 268+ million candidate sequences. Using a literature-based error model on the tags directly, we tested barcode resolution across lengths and error rates, showing that the generated tags are robust to most error rates, in particular longer barcodes ( Table 4 ). Table 4. Barcode resolution under simulated nanopore error profiles. Percentage of reads correctly assigned to the originating barcode across five error rates (5–25%) for six barcode lengths. Error model: 50% deletions, 25% insertions, 25% substitutions; N = 1,000 simulated reads per barcode per condition. Barcode Length Min. Dist. 5% Error 10% Error 15% Error 20% Error 25% Error 10 bp d ≥ 3 99.8% 96.2% 91.3% 83.3% 74.7% 12 bp d ≥ 4 99.7% 99.0% 96.1% 88.6% 82.0% 14 bp d ≥ 4 100% 99.5% 97.9% 94.1% 88.1% 16 bp d ≥ 5 99.9% 100% 99.1% 95.8% 92.2% 20 bp d ≥ 6 100% 99.9% 99.6% 98.6% 96.4% 30 bp d ≥ 8 100% 100% 100% 100% 99.6% Values indicate percentage of reads correctly assigned to original barcode. Error model: 50% deletions, 25% insertions, 25% substitutions based on published ONT characterizations. N = 1,000 simulated reads per barcode per condition. The results reveal a striking pattern. At typical nanopore error rates (10–15%), traditional 10 bp barcodes show degradation (91–96% correct), while barcodes ≥14 bp maintain >97% resolution. Under challenging conditions (20% error) – representing degraded RNA or difficult sequences – the contrast is dramatic: 10 bp barcodes achieve only 83.3% correct assignment (16.7% misassignment), while 30 bp barcodes maintain 100% correct assignment. Even at the extreme 25% error stress test, 30 bp barcodes maintain 99.6% accuracy while 10 bp barcodes fall to 74.7%. TagGen demultiplexer is designed for anchor-free tags To benchmark taggen-demux in a standard dual-ended library context, we compared its performance against minibar (v0.25), a widely used primer-anchored demultiplexer for ONT data. Simulated reads were generated with a dual-ended structure ([barcode [adapter][insert] [RC (adapter)][RC (barcode)]) using the same TagGen-generated Levenshtein barcodes (n = 96, l = 14/20/30 bp, d = 4/8/8) and Badread simulator used for the rest of the benchmarks. Both tools were given the same barcode FASTA; minibar was additionally provided the flanking adapter sequence, which taggen-demux does not use. The two tools differ fundamentally in their matching strategy. Taggen-demux performs an anchor-free alignment: it searches a window at the read end and computes the edit distance between each reference barcode and the raw read sequence. It therefore operates without any knowledge of where the barcode ends and the adapter begins. Minibar uses a two-step primer-anchored approach: it first locates the adapter by alignment, then extracts the bases immediately upstream as the barcode, and finally compares only those extracted bases against the reference set. When sequencing indels shift the barcode region within the read, primer-anchored extraction isolates the barcode cleanly; the anchor-free approach must absorb those indels within its edit-distance threshold. At high read identity (≥90%), minibar assigned more reads correctly than taggen-demux for 20 and 30 bp barcodes (95–100% vs 78–97%), with near-zero misassignment in both cases ( Figure 3 ). At 80% read identity, where an average 30 bp barcode carries approximately six sequencing errors, minibar still achieved 88% accuracy for 30 bp barcodes, compared to 59% for taggen-demux. For short barcodes (14 bp) at low identity (80–85%), the two tools performed comparably (17–42%), as the adapter itself becomes too corrupted for reliable anchoring and the tight acceptance threshold (2 edit operations) limits both approaches equally. Taggen-demux consistently produced a small misassignment rate (0.05–1.4%), while minibar produced near-zero misassignment across all conditions. The higher misassignment for taggen-demux at l = 20 bp and low identity reflects the more liberal acceptance threshold (edit_dist = 5 out of 20 bp = 25% of tag length) combined with the absence of primer-assisted barcode extraction. These results confirm that when flanking adapter sequences are known and library structure is fixed, primer-anchored tools such as minibar extract barcodes with higher sensitivity. Taggen-demux is not designed to compete in this scenario; its intended contribution lies in settings where primer sequences are unavailable, variable in position, or absent by design – including direct RNA sequencing, spatial transcriptomics capture plates, and custom library structures in which the barcode is not flanked by a consistent adapter. These scenarios, which minibar cannot address, are evaluated in the following sections. Figure 3. Comparison of taggen-demux and minibar demultiplexers. Both tools were applied to the same simulated dual-ended ONT reads ([barcode][adapter][insert] [RC (adapter)][RC (barcode)], 100 reads per barcode, n = 96, Badread nanopore2023 error model). taggen-demux operated in end mode without primer information; minibar additionally received the flanking adapter sequence as a positional anchor. (A) Demultiplexing accuracy and (B) misassignment rate as a function of simulated read identity, for three barcode lengths and minimum pairwise Levenshtein distances (l = 14 bp d = 4, l = 20 bp d = 8, l = 30 bp d = 8). Solid lines, taggen-demux; dashed lines, minibar. Minibar achieves higher assignment rates at medium-to-high read identity by leveraging the primer anchor, whereas taggen-demux is designed for library configurations in which no such anchor is available. Long barcodes provide superior nanopore error tolerance The key advantage of longer barcodes becomes evident under simulated nanopore errors ( Table 4 , Figure 4 ). End-mode demultiplexing accuracy increased monotonically with both tag length and read identity ( Figure 4A ). At 95% read identity – representative of latest ONT chemistry – accuracy reached 84.7%, 92.2%, 93.3%, and 97.5% for tag lengths of 14, 20, 24, and 30 bp, respectively, with near-zero misassignment (<0.03%) in all cases ( Extended Data Figure 4 ). At 85% identity, which corresponds to older R9.4.1 flow cells or low-complexity regions, accuracy ranged from 42.2% (14 bp) to 77.1% (30 bp). Reads that could not be confidently assigned were rejected as unassigned rather than being misassigned, preserving the integrity of all assigned reads. We therefore recommend 30 bp Levenshtein-generated tags for experiments where read quality is expected to be moderate (≤90% identity). Figure 4. Systematic evaluation of taggen-demux across library configurations and sequencing conditions. All simulations used Badread (nanopore2023 error model) at four read identity levels (80–95%) representing the range from older R9.4.1 to current R10.4.1/Kit14 chemistry. (A) End-mode demultiplexing accuracy as a function of read identity for four barcode lengths (14, 20, 24, and 30 bp) generated with Levenshtein distance at the maximum feasible minimum distance per length (d = 5, 8, 10, and 12, respectively; n = 96). Longer barcodes provide progressively higher accuracy; 30 bp barcodes reach ~97% at 95% identity. (B) Effect of distance metric during barcode generation: Levenshtein-generated tags (solid) outperform Hamming-generated tags (dashed) at equal nominal minimum distance, with a gap of 3–8 percentage points at 85–90% identity, owing to the higher realised inter-tag edit distance achieved by greedy selection in Levenshtein space (n = 48, end-mode, d = 8 for l = 20 bp and d = 12 for l = 30 bp). (C) Impact of full-mode position masks on demultiplexing accuracy for libraries with a 5′-end barcode (n = 96, l = 30 bp, d = 8, Levenshtein). End mode (reference) and full-mode with 5′ location information achieve very similar results, while full mode without a mask drops about 20% of accuracy. (D) Impact of full-mode position masks on demultiplexing accuracy for libraries with a mid-read barcode (n = 96, l = 30 bp, d = 8, Levenshtein). End mode (reference) achieves near-zero accuracy as expected, confirming correct mode-restriction behaviour. Full-mode search with a fractional mask (0.05:0.20) reaches ~45% accuracy at 95% identity; a fixed 5′ mask (5p:60) and full mode without a mask show intermediate and lower performance, respectively. (E) Scalability: accuracy as a function of barcode set size from n = 48 to n = 384, for dual-ended (circles) and spatial (diamonds) library types at three read identity levels (l = 30 bp, d = 8, Levenshtein). Accuracy varies by less than 2 percentage points across the full range, confirming applicability to high-throughput spatial transcriptomics and population-scale experiments. Levenshtein distance provides better accuracy At equal nominal minimum distance (d = 8) and tag length (20 bp), tags generated with Levenshtein distance constraints consistently outperformed Hamming-generated tags across all read identity levels, with a gap that widened at lower identity (+3–8 percentage points at 85–90% identity) ( Figure 4B ). This advantage stems from the greedy selection algorithm achieving a higher actual minimum pairwise Levenshtein distance when operating in Levenshtein space: for d = 8 Levenshtein generation, the realised minimum inter-tag edit distance typically reached 12–15 bp, whereas Hamming-designed tags of the same nominal d achieved lower Levenshtein separations due to the Hamming–Levenshtein inequality. We therefore recommend Levenshtein generation for all ONT applications. Hamming-distance results are provided for comparison. At 30 bp and d = 12, both metrics converged at high identity (>95%), but Levenshtein remained superior at the clinically relevant 85–90% range. Position masking recovers tags in any spatial configuration For libraries where the barcode is positioned at the 5′ end of the read (spatial transcriptomics configuration, Figure 4C ), end-mode demultiplexing was most effective (96.0% at 95% identity), as the tag is at the read terminus and is read with the lowest per-base error rate. Full-mode search with a 5′ position mask (5p:90, restricting the search window to the first 90 bp) matched end-mode performance (97.0% at 95% identity) and provided robustness to reads where the adapter truncated the tag start. Searching the full read without a mask reduced accuracy by 6–8 percentage points due to spurious off-target matches within the mRNA body, with a concomitant rise in misassignment to ~0.8% at 85% identity. This underscores the importance of correctly specifying the position mask to match the barcode location in the read. For mid-read barcodes (DRS configuration, Figure 4D ), end-mode correctly scored near-zero accuracy (~0%) as expected, confirming that the mode restriction works correctly. Full-mode with a 5p:90 mask achieved 98.0% accuracy at 95% identity. The fractional mask (0.05:0.20, covering 5–20% of read length) provided equivalent performance and is more portable across variable-length reads. TagGen scales to large barcode sets Despite increased difficulty of choosing from larger tag sets, accuracy was stable from n = 48 to n = 384 barcodes across all identity levels for both dual-ended and spatial library types, with less than 2 percentage points variation ( Figure 4E ). At 95% identity, dual-ended end-mode accuracy remained above 97% up to 384 barcodes, and spatial full-mode (5p:90 mask) reached 97% at the same scale. At 85% identity, accuracy declined slightly with increasing n (from ~80% at n = 48 to ~76% at n = 384 for dual-ended), consistent with a greater probability of ambiguous assignment when the tag set is denser. These results confirm that taggen-demux scales to high-throughput spatial transcriptomics or population scale sequencing experiments without sacrificing accuracy. Acceptance threshold can be tuned to reduce error rates The autoMaxDist parameter controls the maximum edit distance at which a read is accepted as matching a tag. The default adaptive rule (tag_length/5 for <20 bp, tag_length/4 for 20–29 bp, tag_length/3 for ≥30 bp) maximises read assignment while keeping misassignment below 0.5% for all recommended configurations (end-mode and full-mode with position mask) at read identities ≥85%. Users who require near-zero misassignment – for example in clinical or single-cell applications where sample cross-contamination must be minimised – should override the default with a more conservative threshold using the –max-dist flag. For instance, taggen-demux –max-dist 4 with 30 bp Levenshtein tags (d = 8) reduces the misassignment rate to <0.001% at the cost of leaving approximately 10–15% more reads unassigned at 85% identity ( Extended Data Figure 4 ). Use cases The following use cases demonstrate TagGen’s application to common long-read sequencing scenarios. Example input parameters are summarized in Table 5 . Table 5. Parameters for different use cases. Input settings for barcode generation and demultiplexing across three representative library scenarios: high-error-tolerance direct RNA sequencing (UC1), older-chemistry ONT multiplexing (UC2), and single-cell spatial transcriptomics (UC3). Use Case UC1 UC2 UC3 Barcode length 24 bp 30 bp 30 bp Target count 48 96 384 Minimum distance 10 8 8 GC content 45–55 40–60 40–60 Homopolymer limit 2 3 3 Custom exclude sequences – ✓ – Demultiplexer mode End mode Full mode Full mode Mask – 5p:60 0.05:0.20 Introductory example: Standard ONT Sample Multiplexing Scenario: A researcher needs to multiplex 96 samples for Oxford Nanopore sequencing using the standard flow cell configuration. Input Parameters: Barcode length: 14 bp Target count: 96 Minimum Hamming distance: 4 GC content: 40–60% Homopolymer limit: 3 CLI Command: taggen -n 96 -l 14 -d 4 --minGc 40 --maxGc 60 -r 3 -o ont_barcodes Example Output (first 4 barcodes in ont_barcodes.fasta): >Tag_001 ACGTACGTACGTAC >Tag_002 TGCATGCATGCATG >Tag_003 GATCGATCGATCGA >Tag_004 CTAGCTAGCTAGCT Generation time: 54 ms Demultiplexing command: taggen --demux --tags ont_barcodes.fasta --reads reads.fastq --mode end --trim-mode ends Expected performance: >97% correct barcode assignment at typical ONT error rates (10–15%). Use Case 1: High-Error-Tolerance Direct RNA Sequencing End-mode demultiplexing with custom adapter exclusion Scenario: Direct RNA sequencing of degraded clinical samples where higher error rates are expected. Maximum error tolerance is required. 48-sample multiplexing experiment using a custom ligation adapter containing an 18 bp recognition sequence. A common challenge in custom ONT library protocols is that proprietary or in-house adapters introduce short sequences that can cross-hybridise with naively generated barcodes, leading to spurious demultiplexing assignments. TagGen’s –exclude flag accepts a FASTA file of sequences to avoid; the greedy selection algorithm discards any candidate barcode whose edit distance to any excluded sequence falls below the minimum distance threshold, ensuring that the final tag set is orthogonal to the adapter. For this scenario we recommend 24 bp Levenshtein tags with a minimum pairwise distance of d=10 to provide sufficient error tolerance. At 95% read identity – achievable with current R10.4.1/Kit14 chemistry – end-mode demultiplexing reaches 93.3% accuracy with near-zero misassignment. At 90% identity, accuracy is 83.5%, still suitable for standard discovery scale experiments. Input Parameters: Barcode length: 24 bp Target count: 48 Minimum Levenshtein distance: 10 GC content: 45–55% (tighter for RNA stability) Homopolymer limit: 2 (stricter for basecalling accuracy) CLI Command: taggen -n 48 -l 24 -d 10 --metric levenshtein --minGc 45 --–maxGc 55 -r 2 --excludeFile custom_adapter.fasta -o uc1_tags -v taggen --demux --tags uc1_tags.fasta --reads reads.fastq --mode end --trim-mode all Generation time: ~30 ms Expected performance: >98% correct assignment even at 20% error rate. Use Case 2: Standard ONT Multiplexing with Older Chemistry Scenario: A user has older-chemistry flow cells and needs to generate 96 barcodes that can still be confidently demultiplexed at high error rates. Older R9.4.1 flow cells and high-molecular-weight or degraded samples routinely produce reads at 85–90% per-base identity. Under these conditions, strict end-mode demultiplexing is sensitive to read-start quality: partial exonuclease activity or pore clogging can introduce a few extra bases before the barcode, shifting it slightly from position 0. Full-mode search with a 5′ position mask (-position-mask 5p:60) restricts the alignment window to the first 60 bp of each read, tolerating this positional jitter while avoiding spurious matches in the downstream read body. We recommend 30 bp Levenshtein barcodes (d=8) for this scenario. Benchmarks with simulated 5′-tagged reads show that full-mode with a 5p:60 mask achieves 84% accuracy at 85% read identity and 97% at 95% identity, matching or slightly exceeding end mode across the full identity range and maintaining misassignment below 0.1% in all conditions. Input Parameters: Barcode length: 30 bp Target count: 96 Minimum Levenshtein distance: 8 Exclude sequences: Custom FASTA file containing adapter sequences Exclude File (adapters.fasta): >adapter_forward AGATCGGAAGAGCACACGTCT >adapter_reverse AGATCGGAAGAGCGTCGTGTA >custom_primer TCGTCGGCAGCGTCAGATGTG CLI Command: taggen -n 96 -l 30 -d 8 --metric levenshtein -f custom_adapter.fasta -o uc2_tags -v taggen --demux --tags uc2_tags.fasta --reads reads.fastq --mode full --position-mask 5p:60 --trim-mode all Generation time: ~95 ms Expected performance: At 95% identity, full-mode with 5p:60 mask achieves 97% accuracy with near-zero misassignment; at 85% identity, accuracy is 84%, suitable for older chemistry experiments. Use Case 3: Single-Cell RNA-seq with Spatial Barcodes (Zero Misassignment) Scenario: Designing location barcodes for a custom spatial transcriptomics array with 384 capture spots, requiring error correction capability for imaging-based readout combined with nanopore sequencing. In single-cell RNA-seq experiments where each barcode labels an individual patient sample or cell population, even a fraction of a percent of cross-sample contamination confounds downstream differential expression analysis. Here the barcode is embedded within a synthetic RNA spike-in added to each sample: during sequencing the tag appears mid-read, flanked by transcript sequence on both sides, at a position corresponding to roughly 5–20% of read length. The fractional position mask (--position-mask 0.05:0.20) directs the search to this window regardless of read length, making the parameter portable across cells with varying transcript sizes. To achieve near-zero misassignment, we override the default acceptance threshold with --max-dist 4: at 90% read identity, this reduces misassignment from <0.1% (default) to <0.001%, at the cost of leaving approximately 10–15% more reads unassigned – a worthwhile trade when sample integrity is paramount. Input Parameters: Barcode length: 30 bp Target count: 384 Minimum Levenshtein distance: 8 GC content: 40–60% Homopolymer limit: 3 CLI Command: taggen -n 384 -l 30 -d 8 --metric levenshtein --heatmap -o uc3_tags -v taggen --demux --tags uc3_tags.fasta --reads reads.fastq \ --mode full --position-mask 0.05:0.20 \ --max-dist 4 --trim-mode all Generation time: ~1.4 s. Expected performance: With –max-dist 4, misassignment is reduced to <0.001% at 90% read identity; approximately 10–15% of reads are left unassigned, which is acceptable when sample integrity is paramount. Discussion Filling a critical gap for long-read sequencing The adoption of nanopore sequencing for transcriptomics, metagenomics, and clinical applications has outpaced the development of supporting bioinformatic tools. While barcode generators designed for Illumina sequencing work well at 8–12 bp, they cannot scale to the lengths required for error-tolerant nanopore barcoding. TagGen (see Figure 5 for the graphical and command line user interface snapshots) addresses this gap through algorithmic innovation. By replacing O(4 n ) enumeration with O(k) sampling, we transform an exponentially scaling problem into a constant-time operation. The practical consequence is that TagGen succeeds – in milliseconds – at lengths where existing tools fail entirely. TagGen was designed to address a specific and underserved scenario in long-read sequencing: multiplexing experiments in which barcodes are not flanked by known primer or adapter sequences. In standard short-read or kit-based ONT workflows, demultiplexers such as minibar 20 or Dorado 21 leverage flanking adapter sequences as positional anchors, first locating the adapter and then extracting the adjacent barcode for comparison. This strategy works well when the library structure is fixed and the adapter sequence is intact. It fails – or cannot be applied at all – in custom library preparations, direct RNA sequencing, spatial transcriptomics capture plates, and synthetic RNA spike-in approaches, where either no consistent flanking sequence exists or the barcode can appear at variable positions within the read. Figure 5. TagGen graphical user interface and command-line interface. The composite screenshot shows four views of the TagGen application. Top left: the Generate tab, where users configure barcode parameters (tag length, count, minimum distance, GC content bounds, homopolymer limit, and exclude sequences) and preview generated barcodes with their core sequences, lengths, and GC content. Top right: the interactive pairwise distance heatmap displaying minimum Hamming or Levenshtein distances between all generated barcodes, enabling visual quality verification; generated barcodes can be exported in FASTA or TSV format. Bottom left: the Demultiplex tab, where users load barcode and FASTQ files, select search mode (end or full), configure position masks and acceptance thresholds, and view demultiplexing results. Centre: the command-line interface showing equivalent generation and demultiplexing commands with their options, demonstrating the full CLI workflow. Our benchmarks confirm both sides of this distinction. In a head-to-head comparison on primer-flanked dual-ended reads – the use case for which minibar was designed – minibar achieves higher assignment rates than taggen-demux in anchor-free mode, particularly at longer barcodes and higher read identities (88–100% vs 59–97% at 80–95% identity, 30 bp barcodes). This is expected: primer anchoring is a genuinely more powerful strategy when the primer is present and intact. The comparison therefore does not identify a weakness in TagGen; it demarcates the two tools’ intended operating regimes. Where TagGen adds unique value is the large class of applications in which a primer anchor is absent, unreliable, or structurally variable – precisely the conditions under which minibar and analogous tools cannot be used. Quantified error tolerance for nanopore applications Our systematic benchmarking across 154 simulated conditions ( Panels A–E , Figure 4 ) provides the first comprehensive characterisation of anchor-free barcode demultiplexing performance as a function of tag length, minimum distance, error metric, position mask, and barcode set size. The choice of error metric during tag generation has a direct and substantial effect on demultiplexing accuracy. Tags generated with Levenshtein distance constraints outperform Hamming-generated tags at equal nominal minimum distance, with a gap of 3–8 percentage points at 85–90% read identity. The mechanistic explanation is that the greedy selection algorithm, when operating in Levenshtein space, achieves a higher realised minimum pairwise edit distance between tags than the required minimum (typically 12–15 bp achieved vs 8 bp required for l = 30 bp, n = 96). Tags generated with Hamming d = 8 achieve lower realized Levenshtein separation due to the Hamming–Levenshtein inequality, leaving them more vulnerable to insertion and deletion errors characteristic of nanopore sequencing. We therefore recommend Levenshtein generation for all ONT applications. For standard 5′-tagged libraries, end-mode demultiplexing of 30 bp Levenshtein barcodes (d = 8, n = 96) achieves 96% accuracy at 95% read identity and 78% at 85% identity. Full-mode search with a 5′ position mask (−-position-mask 5p:60) matches or slightly exceeds end-mode performance and additionally tolerates reads in which the barcode is shifted from position 0 due to partial adapter degradation – a common occurrence with older R9.4.1 flow cells or degraded samples. This mode is recommended for high sample-count experiments on older chemistry where read starts are less uniform. For mid-read barcodes – including tags embedded in synthetic RNA spike-ins for single-cell applications or tags placed internal to amplicons – end-mode demultiplexing correctly assigns near-zero reads, confirming that the mode restriction functions as a safety mechanism: reads are rejected rather than misassigned when the search window does not encompass the barcode position. Full-mode with a fractional position mask (−-position-mask 0.05:0.20) achieves 98% accuracy at 90% identity and is robust across variable read lengths. For zero-misassignment applications such as patient sample tracking in single-cell clinical studies, the –max-dist override reduces misassignment to <0.001% at a cost of approximately 10–15% more unassigned reads. Noise simulation provides the first systematic validation of barcode resilience under realistic nanopore error profiles. The results have direct implications for experimental design. Standard ONT sequencing (10–15% error): Barcodes ≥14 bp with d ≥ 4 achieve >97% resolution. Challenging conditions (20% error): Barcodes ≥20 bp with d ≥ 6 maintain >98% resolution. Direct RNA sequencing with degraded samples: 30 bp barcodes with d ≥ 8 provide near-perfect resolution even at 25% error. These findings suggest that researchers using nanopore sequencing should consider migrating from traditional 10–12 bp barcodes to 14–20 bp barcodes for routine applications, and to 24–30 bp barcodes when sample quality is uncertain. Enabling new applications TagGen’s capabilities enable several applications previously impractical due to computational limitations: • Direct RNA sequencing: Full-length transcript barcoding with resilience to RNA degradation; anchor-free demultiplexing locates mid-read barcodes without adapter sequences • Spatial transcriptomics on ONT: Location barcodes robust to platform-specific errors, with fractional position masks enabling demultiplexing across variable-length reads • Environmental metagenomics: Sample multiplexing for long-read community profiling • Clinical nanopore diagnostics: High-confidence sample identification in point-of-care settings, with configurable acceptance thresholds to achieve near-zero misassignment rates Limitations Several limitations should be considered when using TagGen. Distance metric: TagGen supports both Hamming and Levenshtein distance for barcode generation, and uses Levenshtein distance for demultiplexing. While the validation results confirm high accuracy under indel-rich nanopore error profiles, future work could explore probability divergence 15 as an alternative metric for selection, which may offer additional gains in barcode separability for high-error profiles. Optimality: The greedy selection algorithm produces locally optimal but not globally optimal barcode sets. For most practical applications with 96–384 barcodes, this approximation is sufficient, but users requiring mathematically optimal sets for very large barcode counts may need to employ more computationally intensive methods such as integer linear programming. Memory scaling: While TagGen avoids the exponential memory requirements of exhaustive enumeration, very large candidate pools (>1 million sequences) for extremely long barcodes may still require substantial RAM. The default candidate pool size is tuned for typical applications. Conclusions TagGen represents the first barcode generator capable of producing error-tolerant barcodes for long-read sequencing applications. Key contributions include: 1. Algorithmic advance: Monte Carlo sampling replaces exponential enumeration, enabling barcode generation at 14–30 bp 2. Validated resilience: Systematic demonstration that longer barcodes maintain resolution under nanopore error profiles 3. Practical utility: Sub-second generation times for lengths where existing tools fail 4. Anchor-free demultiplexing: An integrated demultiplexer that locates barcodes at any read position without requiring adapter sequences, validated across 154 parameter combinations with near-zero misassignment. 5. Dual interface: Both GUI for interactive use and comprehensive CLI for automated pipelines As nanopore sequencing expands into transcriptomics, diagnostics, and field applications, TagGen provides researchers with the tools to design robust, validated barcodes matched to their platform’s error characteristics and library architecture. Data availability TagGen benchmark and validation data is available on a Zenodo repository: https://doi.org/10.5281/zenodo.19422508 (Shirokikh N, 2026). This repository also contains Extended Data figures relevant to this publication. This project contains the following underlying data: • nanopore_noise_results.csv – Simulated barcode resolution under nanopore error profiles ( Table 4 source data) • performance_comparison.csv – Performance benchmarks comparing TagGen and DNABarcodes ( Table 3 source data) • nanopore_noise_simulation.py – Python script for error simulation and barcode assignment testing • benchmark_scripts/ – Scripts used for performance benchmarking Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0) . Software availability Source code available from GitHub: https://github.com/Arnaroo/taggen Archived software available from Zenodo: https://doi.org/10.5281/zenodo.19490778 License: MIT License. Acknowledgments The authors are very grateful to the RNA Innovation Foundry (RIF) and The Australian Centre for RNA Therapeutics in Cancer (ACRTC) teams for the useful and enabling discussions around the project, and inspiring its idea. References 1. Amarasinghe SL, Su S, Dong X, et al. : Opportunities and challenges in long-read sequencing data analysis. Genome Biol. 2020 Feb 7; 21 (1): 30. Publisher Full Text 2. Garalde DR, Snell EA, Jachimowicz D, et al. : Highly parallel direct RNA sequencing on an array of nanopores. Nat Methods. 2018 Mar; 15 (3): 201–206. Publisher Full Text 3. Workman RE, Tang AD, Tang PS, et al. : Nanopore native RNA sequencing of a human poly(A) transcriptome. Nat Methods. 2019 Dec; 16 (12): 1297–1305. PubMed Abstract | Publisher Full Text | Free Full Text 4. Smith MA, Ersavas T, Ferguson JM, et al. : Molecular barcoding of native RNAs using nanopore sequencing and deep learning. Genome Research. 2020 Sep; 30 (9): 1345–1353. Publisher Full Text 5. Rang FJ, Kloosterman WP, de Ridder J : From squiggle to basepair: computational approaches for improving nanopore sequencing read accuracy. Genome Biol. 2018 Jul 13; 19 (1): 90. PubMed Abstract | Publisher Full Text | Free Full Text 6. Delahaye C, Nicolas J: Sequencing DNA with nanopores: Troubles and biases. PLoS One. 2021; 16 (10): e0257521. PubMed Abstract | Publisher Full Text | Free Full Text 7. Meyer M, Kircher M: Illumina Sequencing Library Preparation for Highly Multiplexed Target Capture and Sequencing. Cold Spring Harb Protoc. 2010 Jun; 2010 (6): pdb.prot5448. Publisher Full Text 8. Smith AM, Heisler LE, St Onge RP, et al. : Highly-multiplexed barcode sequencing: an efficient method for parallel analysis of pooled samples. Nucleic Acids Res. 2010 Jul; 38 (13): e142. Publisher Full Text 9. Buschmann T, Bystrykh LV: Levenshtein error-correcting barcodes for multiplexed DNA sequencing. BMC Bioinformatics. 2013 Sep 11; 14 (1): 272. Publisher Full Text 10. Buschmann T: DNABarcodes: an R package for the systematic construction of DNA sample tags. Bioinformatics. 2017 Mar 15; 33 (6): 920–922. Publisher Full Text 11. Costea PI, Lundeberg J, Akan P: TagGD: Fast and Accurate Software for DNA Tag Generation and Demultiplexing. PLOS ONE. 2013 Mar 4; 8 (3): e57521. PubMed Abstract | Publisher Full Text | Free Full Text 12. Somervuo P, Koskinen P, Mei P, et al. : BARCOSEL: a tool for selecting an optimal barcode set for high-throughput sequencing. BMC Bioinformatics. 2018 Jul 5; 19 (1): 257. Publisher Full Text 13. Hawkins JA, Jones SK, Finkelstein IJ, et al. : Indel-correcting DNA barcodes for high-throughput sequencing. Proc Natl Acad Sci U S A. 2018 Jul 3; 115 (27): E6217–E6226. 14. Faircloth BC, Glenn TC: Not All Sequence Tags Are Created Equal: Designing and Validating Sequence Identification Tags Robust to Indels. PLoS ONE. 2012 Aug 10; 7 (8): e42543. Publisher Full Text 15. Yu T, Ren Z, Gao X, et al. : Generating barcodes for nanopore sequencing data with PRO. Fundamental Research. 2024 Jul; 4 (4): 785–794. PubMed Abstract | Publisher Full Text | Free Full Text 16. Technologies ON: qcat: Oxford Nanopore read demultiplexer.2020. Reference Source 17. Wick RR: Porechop: adapter trimmer for Oxford Nanopore reads.2018. Reference Source 18. Wick RR, Judd LM, Holt KE: Performance of neural network basecalling tools for Oxford Nanopore sequencing. Genome Biol. 2019 Jun 24; 20 (1): 129. Publisher Full Text 19. Wick R: Badread: simulation of error-prone long reads. Journal of Open Source Software. 2019 Apr 4; 4 (36): 1316. Publisher Full Text 20. Krehenwinkel H, Pomerantz A, Henderson JB, et al. : Nanopore sequencing of long ribosomal DNA amplicons enables portable and simple biodiversity assessments with high phylogenetic resolution across broad taxonomic scale. GigaScience. 2019 May 1; 8 (5). PubMed Abstract | Publisher Full Text | Free Full Text 21. Oxford Nanopore Technologies: Dorado: Oxford Nanopore’s basecaller.2024. Reference Source Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 30 Apr 2026 ADD YOUR COMMENT Comment Author details Author details 1 School of Human Sciences, The University of Western Australia, Perth, WA, 6009, Australia 2 France-Australia Mathematical Sciences and Interactions, CNRS International Research Laboratory, Canberra, ACT, 2601, Australia Faiza Chowdhury Roles: Data Curation, Investigation, Visualization, Writing – Original Draft Preparation Tessa Swain Roles: Conceptualization, Validation, Writing – Review & Editing Roderik Shirokikh Roles: Validation, Writing – Review & Editing Danielle Rudler Roles: Visualization, Writing – Review & Editing Archa Fox Roles: Funding Acquisition, Supervision, Writing – Review & Editing Alice Cleynen Roles: Conceptualization, Formal Analysis, Funding Acquisition, Methodology, Software, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing Nikolay Shirokikh Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This project has received funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No 890462. National Health and Medical Research Council of Australia (NHMRC) Investigator Grant (GNT1175388) to N.E.S.; Bootes Foundation Grant (2022) to N.E.S.; Australian Research Council Discovery Grant (DP180100111, DP250103133) to N.E.S.; CNRS Postes Rouges Grant (2025) to N.E.S.; National Health and Medical Research Council of Australia Grant (APP1147496) to A.H.F.; Australian Research Council Grant (FT180100204) to A.H.F. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (1) version 1 Published: 30 Apr 2026, 15:642 https://doi.org/10.12688/f1000research.179899.1 Copyright © 2026 Chowdhury F et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Chowdhury F, Swain T, Shirokikh R et al. TagGen: High-Performance Barcode Generator and Demultiplexer for High-Throughput and Long-Read Sequencing Applications [version 1; peer review: awaiting peer review] . F1000Research 2026, 15 :642 ( https://doi.org/10.12688/f1000research.179899.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: AWAITING PEER REVIEW AWAITING PEER REVIEW ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 30 Apr 2026 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status AWAITING PEER REVIEW Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "TagGen: High-Performance Barcode Generator...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/15-642/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/15-642/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/15-642/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Chowdhury F et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/15-642/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/15-642", templates : { twitter : "TagGen: High-Performance Barcode Generator and Demultiplexer.... Chowdhury F et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/15-642/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/179899/198458") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "198458"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "481895": 0, "481904": 0, "481903": 0, "481902": 0, "481901": 0, "481900": 0, "481899": 0, "481898": 0, "481897": 0, "481896": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "135ec8bd-3ac5-4c09-b121-12d260b15b72"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.