Plant defensin PgD1 a biotechnological alternative against plant pathogens

preprint OA: closed
Full text JSON View at publisher
Full text 97,688 characters · extracted from preprint-html · click to expand
Plant defensin PgD1 a biotechnological alternative against plant pathogens | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Plant defensin PgD1 a biotechnological alternative against plant pathogens A. C.B. Matos, Elisa Maria Pazinatto Telli, Luana C. Camillo, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4378807/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Sep, 2024 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted 9 You are reading this latest preprint version Abstract Plant defensins are antimicrobial proteins (AMP) with a molecular weight of approximately 5 kDa that participate in the immune defense of plants through their antimicrobial, antiviral and antifungal activities. PgD1 is a defensin from Picea glauca (Canadian Pine) and presents antifungal activity against plant pathogens. This activity positions it as an alternative biotechnological route to pesticides commonly used against these diseases. The present study aimed to recombinantly produce PgD1 in Escherichia coli to report its in vitro antifungal potential against different phytopathogens. To achieve this, the coding gene was amplified and cloned into pET30a(+). Recombinant plasmid was subsequently introduced into E. coli for the soluble expression defensin PgD1. To evaluate the antifungal activity of the expressed protein, the growth inhibition test was used in solid and liquid media for approximately 7 days against significant plant pathogens: Botrytis cinerea , Colletotrichum gloeosporioides , Colletotrichum musae , Colletotrichum graminicola and Fusarium oxysporum . Additionally, stability assessments involved temperature variation experiments and inhibition tests using dithiothreitol (DTT). The results show that there was significant inhibition of the fungal species tested when in the presence of PgD1. Furthermore, defensin proved to be resistant to temperature variations and demonstrated that part of its stability is due to its primary structure rich in cysteine ​​residues through the denaturation test with dithiothreitol (DTT) where the antifungal activity of PgD1 defensin was inhibited. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Introduction Plant defensins are a class of small cationic proteins typically composed of 45–54 amino acids. They are characterized by a high cysteine content and adopt a structural conformation featuring both mixed beta-sheet and alpha-helix motifs (da Silva Gebara et al., 2020 ; Vriens et al., 2014 ; Cornet et al., 1995 ). Functionally, these proteins serve as antimicrobial peptides integral to the plant's immune defense system due to their small size (approximately 5 kDa) and antimicrobial activity (Lima et al., 2022 ; da Silva Gebara et al., 2020 ; Lacerda et al., 2014 ), which manifests through various mechanisms of action (Vriens et al., 2014 ). Studies by Vriens et al. ( 2014 ) and Van Der Weerden et al. (2013) have categorized plant defensins into 11 distinct groups based on their specific targets. Cardillo (2018) has highlighted the potential of defensins in combating fungi and bacteria, serving as innate plant immunity factors. Additionally, Tetorya (2023) has demonstrated the application of these proteins in enhancing plant defense mechanisms. Due to their non-toxicity to human cells (Cools et al., 2017 ; Tavares et al., 2008 ), plant defensins present a promising biotechnological alternative to chemical control methods (Rojas et al., 2010; Pérez et al., 2022 ). These proteins exhibit activity against various pathogens, including Botrytis cinerea , Alternaria brassicae (Berk.), Fusarium culmorum (W.G. Smith) Sacc., Verticillium dahliae (Kleb.), Rhizoctonia solani (Kühn), and Magnaporthe oryzae (B. Couch) (Rojas et al., 2010). They can serve as potential substitutes for chemical control or be utilized in combination with chemicals to mitigate environmental damage (Pérez et al., 2022 ). One such promising defensin is PgD1 from Picea glauca (Moench) Voss., which consists of 50 amino acids and operates through the mechanism of membrane permeabilization. Studies by Picart et al. ( 2012 ) and Azmi et al. (2021) have demonstrated its efficacy against fungal pathogens such as Cylindrocladium floridanum (Sobers & C.P. Seym), Fusarium oxysporum (Schlecht.), and Nectria galligena (Bress.) (Picart et al., 2012 ). Plant defensins are commonly isolated from various plant parts, including roots, seeds, leaves, flowers, and fruits, across a wide range of species (De Coninck et al., 2013 ; Hoskin et al., 2008). However, the isolation of defensins from plant tissues may not be efficient, as it is subject to seasonal variations and cultivar flowering patterns, resulting in reduced productivity (Broekaert et al., 1995 ). In our study, we employed recombinant expression of PgD1 defensin in E. coli followed by its purification. This method, as demonstrated by recent research such as that by Liu et al. ( 2022 ), has proven to be efficient and yield high quantities of the desired product. In light of the growing need for sustainable agricultural practices, this study aims to contribute by elucidating the expression, purification, and potent antifungal activity of PgD1 defensin, offering insights into its potential as a sustainable solution for plant disease management. Material and methods Cloning and Bioinformatic analysis The gene encoding the P. glauca full-length PgD1 protein (83 amino acids) is deposited in the Gene Bank under the accession code AAR84643. In the present work we amplified and cloned the coding gene, which corresponds to the last amino acids of the PgD1 protein in its full-length, which was kindly provided by Dr. Armand Segúin from Natural Resources Canada and the Canadian Forest Service. Synthetic oligonucleotide primers were used to amplify the DNA fragment containing the PgD1 protein coding sequence using standard PCR conditions. The upstream primer (5'AAGGCC ATG GGTCGAACCTGCAAA ACCCCAAGC 3') included an Nco I restriction site (underlined) by adding two extra amino acids (Met and Gly) at the N-terminal end of PgD1, while the downstream primer (5'GGTGCTCGAGATCAAGGGCAGGGCTTGGAGACGTA3') included an Xho I restriction site (underlined). Following purification using the PureLink Quick Gel Extraction Kit (Invitrogen®), the amplified fragments were adenylation-reacted with Taq DNA polymerase and ligated into pGEM-T-Easy® cloning vector using T4 DNA ligase. The ligation product was transformed into electrocompetent E. coli DH10B cells. Recombinant clones were expanded in a liquid LB medium with antibiotic selection, and plasmidial DNA was purified using the PureLink Quick Plasmid Miniprep Kit (Invitrogen®). The purified fragment was cloned into a pET30a(+) expression vector between the Nco I and Xho I restriction sites, therefore the full-length expressed protein includes a histidine tag followed by an S tag at the N-terminal end of the protein. To confirm the identity of the cloned gene and ensure the absence of mutations, sequencing of the cloned gene was performed using the Sanger method, and the nucleotide sequence was compared to the PGD1 sequence present in the database using the BLAST tool ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ). Furthermore, the sequence was submitted to Phyre and Pymol software to predict the three-dimensional. Expression and purification of PgD1 defensin The recombinant plasmid pET30a(+): PgD1 previously produced, was electroporated into E. coli Rosetta (DE3) cells and the transformed cells were inoculated into LB liquid medium containing kanamycin and chloramphenicol as selection markers and incubated at 37ºC until an OD600nm of 0.6 was achieved. Induction occurred in the presence of 0.05 mM IPTG at 17°C for 24 hours. For purification, cells were suspended in Tris-HCl pH 8.0; 300 mM NaCl and 1.5 mM imidazole (Buffer A), containing PMSF, lysozyme (20 mg/mL) and DNAse I (5 µg/mL), and sonication was performed. Cellular debris was removed by centrifugation and the supernatant was applied to a Ni-NTA Agarose pre-equilibrated with buffer A. The resin was washed with buffer B (50 mM Tris-HCl pH 8.0; 300 mM NaCl; 40 mM imidazole) and proteins were eluted in buffer C (500 mM imidazole; 50 mM Tris-HCl pH 8.0). The active fractions were dialyzed against buffer A, lyophilized, and stored at 4ºC. The last step of purification consisted of dialysis to remove excess imidazole with 50 mM Tris HCl buffer pH 7.0 at 4ºC. After dialysis, the protein concentration was measured using the Thermo Scientific nanodrop NanoDrop® 2000 spectrophotometer. Protein purification was confirmed by SDS-Page and Western Blotting. In Vitro Antifungal Activity Assay The evaluation of the antifungal potential of PgD1 defensin was carried out using two techniques: the growth inhibition test in solid medium in a Petri dish, and in liquid medium in a 96-well plate. For the first technique, fungal growth was monitored by inoculating fungi ( B. cinerea , C. gloeosporioides , C. musae , C. graminicola , and F. oxysporum ) on Petri dishes and inserting 0.5 cm paper discs containing 2 mM of PgD1 defensin into plates with Potato Dextrose Agar (PDA). The plates were stored at 28°C for 6 days. After this period, growth was measured. For the second technique, fungal growth was monitored in microtiter plates containing 200 µL of liquid Potato Dextrose medium, inoculated with 2000 spores of each fungus ( B. cinerea , C. gloeosporioides , C. musae , C. graminicola , and F. oxysporum ), and supplemented with varying concentrations of PgD1 defensin (0.5 µM, 0.75 µM, 1 µM, 1.5 µM, 2 µM, and 4 µM). The plates were stored at 28°C, and absorbance was measured at 595 nm for 6 days. Percentages of growth inhibition were assessed by analyzing the area under the curve (AUC) of the growth curves for each replicate (three). All experiments were repeated at least twice. The means were subjected to statistical analysis using the Student's t-test. Temperature Variation Resistance Test* The thermal stability of PgD1 defensin, at a final concentration of 2 µM against C. gloeosporioides spores, was evaluated after pretreating the protein at 25°C, 50°C, 75°C, and 100°C for 30 minutes. The activity of PgD1 was then assessed in comparison to a control reaction conducted at 25°C. Denaturation Assay Using Dithiothreitol (DTT) The activity of PgD1 defensin at 2 µM, treated with 0.1 mM and 1 mM DTT, was tested against C. gloeosporioides spores over three days and compared to a control reaction without DTT. Results Cloning and Bioinformatic Analysis A DNA fragment encompassing the PgD1 sequence was successfully amplified via PCR, resulting in a specific product of 154 bp. Post-amplification, the DNA fragment was ligated into the pGEM vector. The ligated construct was then transformed into E. coli DH10B cells. Positive clones harboring the desired insert were identified through colony PCR screening, with five colonies confirming the presence of the PgD1 insert (Fig. 1 s - supplementary material). Colony #3 was propagated in LB medium and subjected to plasmid extraction using the PureLink Quick Plasmid Miniprep kit (Invitrogen®). The extracted plasmid, designated pGEM::Def3, was further characterized by PCR as shown in Fig. 2 s (supplementary material). Subsequently, the pGEM::Def3 plasmid was subcloned into the pET30a(+) vector using Nco I and Xho I restriction sites, resulting in the construct pET30a(+)::Def. This construct was transformed into electrocompetent E. coli DH10B cells. Colony PCR screening across these transformations demonstrated the ubiquity of the PgD1 gene within the colonies, as documented in Fig. 3 s (supplementary material). Finally, the sequence of the recombinant vector pET30a(+)::Def2 was confirmed by sequencing, with the sequence data provided by the sequencing service displayed in Fig. 1 . The obtained sequence was analyzed using the BLAST tool ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ) to observe the similarity between the pET30::Def2 clone sequence and the PgD1 defensin sequence present in the database under GenBank accession number AAR84643. The sequence obtained showed 100% identity with the PgD1 gene of P. glauca , as shown in Fig. 2 . The defensin PgD1 amino acid sequence was submitted to Phyre and Pymol software to determine 3D structure which enabled analysis of specific regions of the proteins as shown in Fig. 3 . Hydrogen bonds (Fig. 3 A), disulfide bonds (Fig. 3 C), and repulsive interactions (Fig. 3 B) play critical roles in shaping the structure and function of proteins. Hydrogen bonds and repulsive interactions contribute to the stability of protein secondary structures like alpha helices and beta sheets, while disulfide bonds provide additional stability to the tertiary structure, crucial for maintaining the protein's integrity amidst varying environmental conditions. In antimicrobial proteins, positive charges (Fig. 3 D), often attributed to amino acid residues like lysine or arginine, facilitate electrostatic interactions with negatively charged components on microbial cell surfaces. This interaction aids in membrane disruption and penetration into microbial cells, where the antimicrobial protein can exert its activity, targeting vital intracellular components and processes, ultimately leading to microbial cell death. The striking resemblance in sequence (Fig. 4 C) and conformation (Fig. 4 A and B) between the defensin PgD1 and RAsFP1 suggests a potential similarity in their antifungal properties. The shared structural characteristics, particularly in their 3D arrangements, likely represent the functional moiety responsible for their antimicrobial activity. This similarity underscores the importance of structural features in dictating the efficacy of antimicrobial proteins. Expression and purification of PgD1 defensin For the expression of the recombinant protein PgD1 (pET30a(+)::Def2), E. coli BL21(DE3) was chosen. This strain contains the lambda DE3 prophage, which includes the gene for T7 RNA polymerase under the control of a lacUV5 promoter. This setup allows for the induction of T7 RNA polymerase expression with IPTG. During the expression, various optimization procedures were tested, including different concentrations of IPTG and various induction temperatures. The optimal conditions determined for our process were an induction temperature of 18°C, which resulted in enhanced expression of the protein in the soluble fraction. To identify the expressed PgD1 defensin, a 15% SDS-PAGE was utilized, allowing for the separation of proteins based on their molecular size. As depicted in Fig. 4 , an intense band is visible in lane three, corresponding to a protein with a molecular mass of approximately 14 kDa—matching the expected size for the protein. In lane seven, the presence of PgD1 is observed post-purification, confirming the effectiveness of the purification protocols employed. Lanes four, five, and six exhibit the absence of the 14 kDa band. This absence is attributed to the histidine tail of PgD1 defensin binding to the Ni-NTA agarose during the purification process, indicating successful adherence to the chromatographic column as anticipated. The Western Blot technique was used to demonstrate the presence of the protein through its histidine tail. The proteins were transferred to the nitrocellulose membrane and treated with a blocking solution, anti-His Tag primary antibody, and anti-mouse secondary antibodies anchored in the alkaline phosphatase enzyme, for detection of the target protein. Figure 4 S shows a band signaling a protein with approximately 14kDa, which indicates the presence of the PgD1 defensin (Fig. 4 s - supplementary material). In vitro antifungal activity assay Antifungal activity assays were conducted in microtiter plates against plant pathogenic fungi using varying concentrations of recombinant PgD1, ranging from 0.5 µM to 4.0 µM. The results demonstrated that PgD1 defensin significantly inhibited the growth of C. gloeosporioides at concentrations from 0.5 µM to 4.0 µM (Fig. 6 ). The inhibition of the growth of other strains of C. gloeosporioides (isolated from different plants) was also tested. We can see that the PgD1 defensin promoted the inhibition of fungal growth for all strains of C. gloeosporioides , corroborating the results of the previous experiment (Fig. 7 ). The tests with C. gloeosporioides showed very similar results at concentrations of 2 µM and 4 µM. Consequently, tests on other fungi were conducted using only the 2 µM concentration. In the inhibition test with C. graminicola , PgD1 defensin reduced fungal growth but did not completely inhibit it (see Fig. 8 ). In the test with C. musae , total inhibition occurred at a concentration of 2µM throughout the experiment (Fig. 8 ). Inhibition was also tested for the fungi B. cinerea and F. oxysporum , using defensin concentrations of 0.5µM to 4µM, measuring growth after 7 days. The results show that there was inhibition for the fungus B. cinerea , however for the fungus F. oxysporum there was a significative reduction in growth, but there was no total inhibition (Fig. 9 ). The antifungal activity assay, carried out in a Petry dish, against phytopathogenic fungi was carried out with a concentration of 2µM of recombinant PgD1. The results showed that PgD1 defensin reduces the growth of C. gloeosporioides , B. cinerea and F. oxysporum , however only for the fungus B. cinerea this reduction was significant (Fig. 10 ). Temperature variation resistance test The stability test at different temperatures showed that PgD1 defensin against C. gloeosporioides is resistant to temperature variation. As shown in Fig. 11 the antifungal activity remains above 90% even when the defensin is subjected to heating at 50ºC, 75ºC, and 100ºC. Denaturation assay using Dithiothreitol (DTT) Dithiothreitol (DTT) is a denaturing agent as it cleaves the disulfide bonds formed between cysteine residues (Galdos-Riveros, 2010; Rocha et al., 2005 ). The PgD1 defensin denaturation test 2µM of the protein treated with DTT in two concentrations 0.1mM and 1mM. The results showed that in the presence of DTT in both concentrations, Defensin PgD1 was completely inhibited, with the growth of the fungus C. gloeosporioides occurring at the same speed as the control sample (without defensin) (Fig. 12 ), as expected, as this defensin is rich in cysteines. Discussion Almost 30 years ago, Broekaert and colleagues ( 1995 ) published the first articles describing plant defensins as part of the innate immune system of plants. From this discovery, we've learned about the role of these proteins in protecting plants against invading agents like fungi and bacteria. Today, these defensins are isolated or expressed and purified in laboratories for use as antimicrobial proteins (AMPs) against numerous pathogens. This is exemplified in Koo's (2019) work, which demonstrates the use of plant defensins not only in treating plants but also in combating pathogens that affect both animals and humans. In our study, we expressed and purified PgD1, a defensin from P. glauca . This protein is rich in cysteines and has a molecular weight of 13.752 kDa, which is comparable to other pine defensins. For instance, Liu and colleagues ( 2022 ) found PaDef to have a molecular weight of 9.0665 kDa, while Picart and collaborators (2012) reported PgD5 at 18 kDa. Additionally, PsDef, another pine defensin, exhibits antifungal activity similar to PgD1. The work of Shalovylo and colleagues ( 2021 ) illustrates a close genetic relationship between PsDef and PgD1, which may lead to similar functional characteristics. The similarity between these defensins is linked to their primary protein structures (Van Der Weerden et al., 2013). Research by Thomma (2002) and Shalovylo (2021) demonstrates that cysteine residues are essential for maintaining the stable conformation of plant defensins. The presence of disulfide bonds is also necessary for pore formation in membranes, which is fundamental to antimicrobial activity. Wang et al. ( 2019 ) confirmed that antimicrobial activity is closely associated with the stability of the β-hairpin structures, and removing disulfide bonds significantly diminishes their antimicrobial function. This was confirmed in our study through the DTT denaturation test (Fig. 12 ), which showed a complete loss of antifungal function after breaking disulfide bonds. Other amino acid residues in the primary protein structure are also crucial. Samblanx and collaborators (1997) observed that mutating specific amino acids in the RsAFP1 defensin led to the loss of function. Since PgD1 and RsAFP1 defensins share these residues (Fig. 4 ), part of their antifungal properties can be attributed to these amino acids (Shalovylo et al., 2021 ). The recombinant defensin PgD1 exhibited antifungal activity against five phytopathogenic fungi: C. gloeosporioides, C. musae, C. graminicola, F. oxysporum, and B. cinerea. Pervieux and colleagues ( 2004 ) found that PgD1 also has activity against F. oxysporum . At the time of writing, no studies had examined PgD1 against C. and B. species. However, Liu et al. ( 2022 ) reported that PaDef, another pine defensin, also has antifungal activity against C. gloeosporioides and B. cinerea . Kovalera and collaborators (2011) and Picart et al. ( 2012 ) showed that the pine defensins PsDef and PgD5, respectively, are effective against B. cinerea and F. oxysporum . This confirms that pine defensins are effective antifungal agents. Further research (Parisi et al., 2024 ; Shahmiri et al., 2023 ; Wang et al., 2019 ) suggests that pine defensins interact with fungal membranes, forming pores that lead to cell death. In this study, we've demonstrated the potent antifungal activity of plant defensins. However, large quantities are necessary for field applications. We opted for recombinant expression in E. coli cells, a highly efficient protocol for protein expression and purification. This method provides a fast, cost-effective, and reliable means to produce recombinant proteins at scale, making it an ideal strategy for manufacturing bioinputs (Deo et al., 2022 ; Kovalera, 2011). Besides efficient expression, plant defensins are also resistant to degradation caused by temperature changes. This makes them suitable for various applications (Ermakova et al., 2016 ). The PgD1 defensin has shown stability under varying temperatures, which aligns with findings from other studies, such as those by Kovalera (2020) and Wu (2022). Given its stability, relatively simple production, and excellent potential to inhibit phytopathogenic fungi, PgD1 defensin can be a viable alternative or complement to pesticides, reducing the socio-environmental impacts of food production. This potential is also seen in other plant defensins, such as MtDef4 (Tetorya & Li, 2023), PvDef (Mohamed et al., 2023 ), and GMA4CG_V6 (Djami-Tchatchou et al., 2023). Using defensins as antifungals represents a promising biotechnological innovation that warrants further research for improving environmental health. Declarations Funding Partial financial support was received from Grant PAP2023011000003 FAPESC No 48/2022 Conflicts of interest/Competing interests The authors have no relevant financial or non-financial interests to disclose. Data Availability The data that support the findings of this study are available on request from the corresponding author, M.L.B.M. Author Contribution A. C.B. M. performed the antifungal experimentsE. M.P.T cloned expressed and purified defensinL. C. Camillo wrote the manuscript and assisted with antifungal experimentsG.F. D. S Wrote the manuscript, prepared the figures, and conceptualized the projectM. J. G isolated fungal speciesR. C. isolated fungal speciesL. R. isolated fungal speciesM.L.B. M. Wrote the manuscript, prepared the figures and conceptualize the project Acknowledgement Authors acknowledge Dr. Armand Segúin from Natural Resources Canada and the Canadian Forest Service for providing PgD1 gene. References Azmi, S., & Hussain, M. K. (2021). Analysis of structures, functions, and transgenicity of phytopeptides defensin and thionin: a review. Beni-Suef Univ J Basic Appl Sci, 10(5). doi: https://doi.org/10.1186/s43088-020-00093-5 Broekaert, W. F., Terras, F. R. G., & Cammue, B. P. A. (1995). Plant Defensins: Novel Antimicrobial Peptides as Components of the Host Defense System. Plant Physiol, 1995. Cardillo, A. B., Ceron, M. C. M., & Romero, S. M. (2018). Antimicrobial peptides from plants. National Academy of Pharmacy and Biochemistry; Pharmaceutical Magazine, 160(1), 28-46. doi: https://ri.conicet.gov.ar/handle/11336/83586 Cools, T. L., et al. (2017). Antifungal plant defensins: Increased insight into their mode of action as a basis for their use to combat fungal infections. Future Microbiology, 12(5), 441-454. doi: 10.2217/fmb-2016-0181. Cornet, B., Bonmatin, J. -M., Hetru, C., Hoffmann, J. A., Ptak, M., & Vovelle, F. (1995). Refined three-dimensional solution structure of insect defensin A. Structure, 3, 435–448. https://doi.org/10.1016/S0969-2126(01)00177-0. da Silva Gebara, R., Taveira, G. B., de Azevedo dos Santos, L., et al. (2020). Identificação e caracterização de duas defensinas de frutos de Capsicum annuum que apresentam atividade antimicrobiana. Probióticos e Antimicro. Prot., 12, 1253–1265. https://doi.org/10.1007/s12602-020-09647-6. De Coninck, B., Cammue, B. P. A., & Thevissen, K. (2013). Modes of antifungal action and in planta functions of plant defensins and defensin-like peptides. Fungal Biol Rev, 26, 109–120. Deo, S., Turton, K.L., Kainth T., et al. (2022). Strategies for improving antimicrobial peptide production. Biotechnol Adv, 59, 107968. https://doi.org/10.1016/j.biotechadv.2022.107968. Djami-Tchatchou, A. T., Tetoria, M., Godwin, J., Codjoe, J. M., Li, H., & Shah, D. M. (2023). Small cationic cysteine-rich defensin-derived antifungal peptide controls white mold in soybeans. J. Fungi, 9, 873. https://doi.org/10.3390/jof9090873. Ermakova, E. A., Faizullin, D. A., Idiyatullin, B. Z., Khairutdinov, B. I., Mukhamedova, L. N., Tarasova, N. B., Toporkova, Y. Y., Osipova, E. V., Kovaleva, V., Gogolev, Y. V., Zuev, Y. F., & Nesmelova, I. V. (2016). Structure of Scots pine defensin 1 by spectroscopic methods and computational modeling. International Journal of Biological Macromolecules, 84, 142-152. ISSN 0141-8130. https://doi.org/10.1016/j.ijbiomac.2015.12.011. Galdos-Riveros, G., Piza, A. T., Resende, L., Maria, D. A., & Miglino, M. A. (2010). Enciclopédia Biosfera, Centro Científico Conhecer - Goiânia, vol.6, N.11. Hoskin, D. W., & Ramamoorthy, A. (2008). Studies on anticancer activities of antimicrobial peptides. Biochim Biophys Acta, 1778, 357–375. https://doi.org/10.1016/j.bbamem.2007.11.008. Koo, H. B. & Seo, J. (2019). Antimicrobial peptides under clinical investigation. Pept Sci. doi: https://doi.org/10.1002/pep2.24122 Kovalera, V., Bukhteeva, I., Kit, O. Y. et al. Plant Defensins from a structural perspective. Int J Mol Sci. 2020 Jul 26. doi: 10.3390/ijms21155307. Kovalera, V., Krynytskyy, H., Gout, I., et al. (2011). Recombinant expression, affinity purification and functional characterization of Scots pine defensin 1. Appl Microbiol Biotechnol, 89, 1093-1101. https://doi.org/10.1007/s00253-010-2935-2. Lacerda, A. F., Vasconcelos, Ã. R. A. R., Pelegrini, P. C. B., & Grossi De Sá, M. F. (2014). Antifungal defensins and their role in plant defense. Front Microbiol, 5, 116. Lima, A. M., Azevedo, M. I. G., Souza, L. M., et al. (2022). Plant antimicrobial peptides: An overview about classification, toxicity and clinical applications. International Journal of Biological Macromolecules, 214, 10-21. doi: https://doi.org/10.1016/j.ijbiomac.2022.06.043. Liu, Y., Liu, L., Yang, C., et al. (2022). Identificação molecular e atividade antifúngica de uma defensina (PaDef) de Spruce. J Plant Growth Regul, 41, 494–506. https://doi.org/10.1007/s00344-021-10316-3. Mohamed, S. S., El-Mahdy, M. M., Mabrouk, A. M., Salem, R., Shehata, M. M., El-Kholy, I. M. A., & Abouseadaa, H. H. (2023). Molecular Characterization, Heterologous Expression and Antimicrobial Activity of Phaseolus vulgaris L. Defensin Peptide (Pv-Def) against various Human MDR Pathogens. Egypt. J. Bot., 63(3), 841-849. http://ejbo.journals.ekb.eg/ Parisi, K., McKenna, J. A., Mais baixo, Harris, K. S., Shafee, T., Guarino, R., Lee, E., van der Weerden, Países Baixos, Bleckley, M. R., & Anderson, M. A. (2024). Hyperpolarisation of Mitochondrial Membranes Is a Critical Component of the Antifungal Mechanism of the Plant Defensin, Ppdef1. J. Fungos, 10, 54. https://doi.org/10.3390/jof10010054. Pérez, N. S., Obregón, G. A. E., Avera, Y. H., et al. (2022). Transgenic soybean modification event for greater resistance to Asian rust. Anais do ACC, Havana, 12(3). doi:http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S2304-01062022000300007&lng=es&nrm=iso. acesso em 09 fev. 2024. Epub 01 de novembro de 2022. Pervieux, I., Bourassa, M., Laurans, F., et al. (2004). A spruce defensin showing strong antifungal activity and increased transcript accumulation after wounding and jasmonate treatments. Physiological and Molecular Plant Pathology, 64, 331-341. Doi: https://doi.org/10.1016/j.pmpp.2004.09.008. Picart, P., Pirttila, A. M., Raventos, D., Kristensen, H. H., & Sahl, H. G. (2012). Identification of spruce defensin encoding genes: Characterization of PgD5, a conserved spruce defensin with strong antifungal activity. BMC Plant Biol, 12, 180. Rocha, T. L., Costa, P. H. A., Magalhães, J. C. C., Evaristo, R. G. S., Vasconcelos, E. A. R., Coutinho, M. V., Paes, N. S., Silva, M. C. M., & Grossi-de-Sá, M. F. (2005). Eletroforese bidimensional e análise de proteomas. Comunicado Técnico, Embrapa Recursos Genéticos e Biotecnologia, n. 136, p. 1-12. Rojas Arias, A. C. R., & Espitia, H. M. Z. (2010). Plant defensins and their potential use as pest controllers in agriculture. Acta Biológica Colombiana, 15(3), 33-46. Samblanx, G. W., Goderis, I. J., Thevissen, K., Raemaekers, R., Fant, F., Borremans, F., et al. (1997). Mutational analysis of a plant defensin from radish (Raphanus sativus L.) reveals two adjacent sites important for antifungal activity. J Biol Chem, 272, 1171–1179. Schrödinger, L. & DeLano, W., 2020. PyMOL, Available at: http://www.pymol.org/pymol. Shahmiri, M., Bleackley, M. R., Dawson, C. S., van der Weerden, N. L., Anderson, M. A., & Mechler, A. (2023). Membrane-binding properties of plant defensins. Phytochemistry, 209, 113618. ISSN 0031-9422. https://doi.org/10.1016/j.phytochem.2023.113618. Shalovylo, Y. I., Yusypovych, Y. M., Hrunyk, N. I., Roman, I. I., Zaika, V. K., Krynytskyy, H. T., Nesmelova, I. V., & Kovaleva, V. A. (2021, November 24). Seed-derived defensins from Scots pine: structural and functional features. Planta, 254(6), 129. doi: 10.1007/s00425-021-03788-w. PMID: 34817648. Tavares, L. S., et al. (2008). Biotechnological potential of antimicrobial peptides from flowers. Peptides, 29(10), 1842-1851. doi: 10.1016/j.peptides.2008.06.003. Tetorya, M., Li, H., Djami-Tchatchou, A. T., Buchko, G. W., Czymmek, K. J., & Xá, D. M. (2023). Plant defensin MtDef4-derived antifungal peptide with multiple modes of action and potential as a bio-inspired fungicide. Publicado em Molecular Plant Pathology. DOI: 10.1111/mpp Thomma, B. P. H. J., Thevissen, K., & Cammue, B. P. (2002). Plant defensins. Plant, 216, 193-202. Van Der Weerden, N. L., & Anderson, M. A. (2013). Plant defensins: Common fold, multiple functions. Fungal Biology Reviews, 26(4), 121-131. doi: https://doi.org/10.1016/j.fbr.2012.08.004. Vriens, K., Cammue, B., & Thevissen, K. (2014). Antifungal plant defensins: mechanisms of action and production. Molecules, 19, 12280–12303. Wang, J., Dou, X., Canção, J., & outros. (2019). Antimicrobial peptides: promising alternatives in the post-antibiotic era. Med Res Rev, 39, 831-859. https://doi.org/10.1002/med.21542. Wu, J., Zhou, X., Chen, Q. et al. Defensins as a promising class of tick antimicrobial peptides: a scoping review. Infect Dis Poverty. 2022 Jun 20. doi: 10.1186/s40249-022-00996-8. Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Published Journal Publication published 07 Sep, 2024 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted Editorial decision: Revision requested 23 May, 2024 Reviews received at journal 23 May, 2024 Reviews received at journal 22 May, 2024 Reviewers agreed at journal 21 May, 2024 Reviewers agreed at journal 16 May, 2024 Reviewers invited by journal 16 May, 2024 Editor assigned by journal 14 May, 2024 Submission checks completed at journal 14 May, 2024 First submitted to journal 06 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4378807","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":305419514,"identity":"85387a14-11a9-4d49-8a6e-a65e545831b3","order_by":0,"name":"A. C.B. Matos","email":"","orcid":"","institution":"Universidade do Estado de Santa Catarina – UDESC","correspondingAuthor":false,"prefix":"","firstName":"A.","middleName":"C.B.","lastName":"Matos","suffix":""},{"id":305419515,"identity":"70dd8c19-315c-4ad3-87d2-d15257954704","order_by":1,"name":"Elisa Maria Pazinatto Telli","email":"","orcid":"","institution":"Biomedicina Universidade do Planalto Catarinense","correspondingAuthor":false,"prefix":"","firstName":"Elisa","middleName":"Maria Pazinatto","lastName":"Telli","suffix":""},{"id":305419516,"identity":"5fbc20c4-7dd6-494a-a715-cba6bd3ce01a","order_by":2,"name":"Luana C. Camillo","email":"","orcid":"","institution":"Universidade do Estado de Santa Catarina – UDESC","correspondingAuthor":false,"prefix":"","firstName":"Luana","middleName":"C.","lastName":"Camillo","suffix":""},{"id":305419517,"identity":"9a753466-722e-4e10-9b1f-eb9078ef947c","order_by":3,"name":"Gustavo Da da Silva","email":"","orcid":"","institution":"Universidade do Estado de Santa Catarina – UDESC","correspondingAuthor":false,"prefix":"","firstName":"Gustavo","middleName":"Da da","lastName":"Silva","suffix":""},{"id":305419519,"identity":"10e10961-bb60-4009-b2c3-44fc57aa7433","order_by":4,"name":"Mayra Juline Gonçalves","email":"","orcid":"","institution":"Departamento de P\u0026D - Plant Colab Pesquisa e Desenvolvimento Ltda.","correspondingAuthor":false,"prefix":"","firstName":"Mayra","middleName":"Juline","lastName":"Gonçalves","suffix":""},{"id":305419520,"identity":"407373c9-4295-4655-98f9-db03e17565b5","order_by":5,"name":"Ricardo Casa","email":"","orcid":"","institution":"Universidade do Estado de Santa Catarina – UDESC","correspondingAuthor":false,"prefix":"","firstName":"Ricardo","middleName":"","lastName":"Casa","suffix":""},{"id":305419521,"identity":"c2c0da41-d117-4d12-9707-2fd1cc3c3e93","order_by":6,"name":"Leo Rufatto","email":"","orcid":"","institution":"Universidade do Estado de Santa Catarina – UDESC","correspondingAuthor":false,"prefix":"","firstName":"Leo","middleName":"","lastName":"Rufatto","suffix":""},{"id":305419522,"identity":"a6f3c9f6-bd2f-4ada-bf6a-440aeb46d3ca","order_by":7,"name":"Maria de Lourdes Magalhães","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABM0lEQVRIie3PMUvDQBTA8XceZGp1PUion0CIBOIkfhCXFqFZciC4ZEhDoHBZiq4FpX4Fu3S+cHBdIl0LdmgRMjnYRVMQMU3sYlp0dLg/Cffy4Ec4AJXqn8aLh3x/7ReDl78Yh38jWjEka4J2EqgSxNbjdnIUPS54BrPGyW13vjf1O4ea3l0sVoPO+UGUk8wb/SR24phxD1LLmEkTu3J8zAxpWfXRmPYFClEveaoQ3gZeA9Hqk2ZONIkYado6Gkka5gQjViWTFOKPgjiv2P2UZ4w476vVnaT3u8i0DaL8i2tiyvwWI64N9dCnDztJCsIwU4sYyaWg1/wiJ1d6TXI6zEm87S6TNl6+eLMG0aPhs/sWnN4QZ7jM/IAOJiKeZ16FlJnlwQHEZiU2m18LKoNKpVKpvgCOS314aepRewAAAABJRU5ErkJggg==","orcid":"","institution":"Universidade do Estado de Santa Catarina – UDESC","correspondingAuthor":true,"prefix":"","firstName":"Maria","middleName":"de Lourdes","lastName":"Magalhães","suffix":""}],"badges":[],"createdAt":"2024-05-06 19:25:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4378807/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4378807/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12602-024-10333-0","type":"published","date":"2024-09-07T15:57:01+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57509904,"identity":"c47729e8-5a60-498d-b4fa-e6552eb0cde9","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":197725,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequencing of pET30::Def2.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/0a9f43ef551d4d48b6df4231.jpeg"},{"id":57509901,"identity":"71f09c33-b175-434d-8456-1e55a7831daa","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":52244,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSearch results using BLAST comparing the sequence of interest (query) against a database (subject).\u003c/strong\u003e The sequence of interest from the pET30(+)::Def2 clone amplified by PCR.\u003c/p\u003e\n\u003cp\u003eSource: \u003ca href=\"https://blast.ncbi.nlm.nih.gov/Blast.cgi#116789573\"\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi#116789573\u003c/a\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/2b866ede775da5bf863801b8.png"},{"id":57510409,"identity":"6b4e5265-6e49-4119-b1df-070f7a960b51","added_by":"auto","created_at":"2024-05-31 16:27:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":226751,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e3D structures of PgD1 \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP. glauca\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e defensin generated according to the bioinformatics program Phyre 2 and analyzed into Pymol 3.0.\u003c/strong\u003e (A) Hydrogens bonds in yellow; (B) Repulsive interactions in orange; (C) Disulfide bonds in blue and (D) Positive charges in pink.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/c477475da1700e108e25f268.png"},{"id":57509906,"identity":"37bf6882-cfa8-401e-a093-cdeb86e84838","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":377482,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAlignment, generated to the bioinformatics program MEGA 11 and structural comparison use program Pymol 3.0, of PgD1 (A) defensin amino acid sequences with another plant defensin RsAFP1 (B) that exhibit known antifungal activity.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/99b81324dbdefe1df71daa24.jpeg"},{"id":57510661,"identity":"b9df4cd5-25aa-46f8-96aa-b3789ada536f","added_by":"auto","created_at":"2024-05-31 16:35:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":355700,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSDS-Page product of the recombinant protein pET30a(+)Def2. \u003c/strong\u003eLane 1: Thermo-scientific marker; Lane 2: pET30a(+) without insert; Lane 3: Expression supernatant. Lane 4: first elution step “Flow through”; Lane 5: elution with 40mM imidazole wash buffer; Lane 6: elution with 80mM imidazole wash buffer; Lane 7: pET30a(+)Def2 after elution with 300mM imidazole.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/2faf400fa19884cf0952901e.png"},{"id":57509907,"identity":"6758b1b6-0d2e-4733-ac27-6e6cb4c76a82","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":131018,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntifungal Activity of Defensin PgD1 Against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. gloeosporioides\u003c/strong\u003e\u003c/em\u003e. This figure illustrates fungal growth curves after 6 days treatment with varying concentrations of recombinant PgD1 defensin, ranging from 0.5 µM to 4.0 µM. A total of 2000 spores were cultured in 200 µL of potato dextrose medium either with PgD1 defensin at the specified concentrations or without defensin (control). Statistically significant differences in fungal growth inhibition are indicated, with a significance threshold set at p \u0026lt; 0.05. Analyses were performed using GraphPad Prism software, version 10.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/022ede9e90b95122edabfb3b.jpeg"},{"id":57509908,"identity":"283c83f5-5a85-4632-b384-b70e0905a57f","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":46961,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntifungal Activity of Defensin PgD1 Against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. gloeosporioides\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e Isolated from Various Plants. \u003c/strong\u003eThis figure displays growth curves of \u003cem\u003eC. gloeosporioides\u003c/em\u003e after 6 days treatment with 2 µM of recombinant PgD1 defensin. Each panel represents a different plant isolate: (A) onion, (B) guava, (C) apple, and (D) pepper. Statistically significant differences in fungal growth inhibition are indicated, with a significance threshold set at p \u0026lt; 0.05. Analyses were performed using GraphPad Prism software, version 10.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/f82238bf8701b49fa154d14c.png"},{"id":57509913,"identity":"5afd78db-447b-4862-b569-eaeda6e6e01a","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":25942,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntifungal Activity of Defensin PgD1 Against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. musae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. graminicola\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e This figure displays growth curves of (A) \u003cem\u003eC. musae\u003c/em\u003e and (B) \u003cem\u003eC. graminicola\u003c/em\u003e after 6 days treatment with 2 µM of recombinant PgD1 defensin. Statistically significant differences in fungal growth inhibition are indicated, with a significance threshold set at p \u0026lt; 0.05. Analyses were performed using GraphPad Prism software, version 10.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/d68a8e5769867ddb6e1e2b5a.png"},{"id":57509912,"identity":"aac940ec-1e2e-4f05-86d0-69abf76dccdc","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":119191,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntifungal Activity of Defensin PgD1 Against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. cinerea\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eF. oxysporum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e This figure depicts the antifungal effects of varying concentrations of recombinant PgD1 defensin (0.5 µM to 4 µM) on the growth of (A) \u003cem\u003eB. cinerea\u003c/em\u003e and (B) \u003cem\u003eF. oxysporum\u003c/em\u003e. Each assay utilized 2000 spores in 200 µL of potato dextrose medium, with a comparison to a control sample that did not contain PgD1 defensin. Differences in fungal growth inhibition were considered statistically significant at a p-value of less than 0.05. Data analysis was conducted using GraphPad Prism software, version 10.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/1102547af98158f5357450ee.png"},{"id":57509910,"identity":"74ce949a-a9ee-4478-8146-1a278b3a3a3b","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":27456,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntifungal Activity of Defensin PgD1 on Petri Dishes.\u003c/strong\u003e This figure demonstrates the antifungal effects of 2 µM recombinant PgD1 defensin against fungal growth in Petri dishes for (A) \u003cem\u003eC. gloeosporioides\u003c/em\u003e, (B) \u003cem\u003eB. cinerea\u003c/em\u003e, and (C)\u003cem\u003e F. oxysporum\u003c/em\u003e. A 0.5 cm disk of each fungus was placed on a plate containing potato dextrose agar medium, compared to a control sample without PgD1 defensin. Statistically significant differences in fungal growth inhibition were considered at a p-value of less than 0.05. Analyses were performed using GraphPad Prism software, version 10.\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/804592664462bbd24ab34ced.png"},{"id":57509909,"identity":"e6691d01-4906-4529-a300-bf26a554512c","added_by":"auto","created_at":"2024-05-31 16:19:00","extension":"jpeg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":67731,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssessment of the Thermal Resistance of Defensin PgD1\u003c/strong\u003e. This figure illustrates the effectiveness of PgD1 defensin after heat treatment by comparing the percentage of fungal growth inhibition at various temperatures to a control (25°C) with no heat treatment and assumed 100% growth. The results show that fungal growth inhibition was 98% at 50°C, 96% at 75°C, and 95% at 100°C. The statistical significance of differences was determined at a p-value less than 0.05. Data analysis was conducted using GraphPad Prism software, version 10.\u003c/p\u003e","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/11d96dd7930918e61e206368.jpeg"},{"id":57510410,"identity":"f6d18496-1538-44b3-8720-87f164f7ba1c","added_by":"auto","created_at":"2024-05-31 16:27:00","extension":"jpeg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":168266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of Defensin PgD1 treated with DTT.\u003c/strong\u003e Samples were treated with 0.1mM and 1mM DTT concentrations, with and without Defensin PgD1, compared to controls (without Def. and DTT; and with Def without DTT). Differences were considered significant at the level of \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05. The analyses were performed using the GraphPad Prism 10 software.\u003c/p\u003e","description":"","filename":"floatimage12.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/b22a9f456b8d597eb16f86cb.jpeg"},{"id":64185771,"identity":"2032fed1-11cd-4b45-bd6c-475fcf8439d6","added_by":"auto","created_at":"2024-09-09 16:21:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2782216,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/b12bf7ac-c9e0-4b61-b1bb-849145e93a36.pdf"},{"id":57510408,"identity":"21579193-b0e8-4446-a126-999f7dad4aeb","added_by":"auto","created_at":"2024-05-31 16:27:00","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":634356,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-4378807/v1/bfb56a74759832f512de98eb.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Plant defensin PgD1 a biotechnological alternative against plant pathogens","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePlant defensins are a class of small cationic proteins typically composed of 45\u0026ndash;54 amino acids. They are characterized by a high cysteine content and adopt a structural conformation featuring both mixed beta-sheet and alpha-helix motifs (da Silva Gebara et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Vriens et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Cornet et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Functionally, these proteins serve as antimicrobial peptides integral to the plant's immune defense system due to their small size (approximately 5 kDa) and antimicrobial activity (Lima et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; da Silva Gebara et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Lacerda et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), which manifests through various mechanisms of action (Vriens et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStudies by Vriens et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and Van Der Weerden et al. (2013) have categorized plant defensins into 11 distinct groups based on their specific targets. Cardillo (2018) has highlighted the potential of defensins in combating fungi and bacteria, serving as innate plant immunity factors. Additionally, Tetorya (2023) has demonstrated the application of these proteins in enhancing plant defense mechanisms.\u003c/p\u003e \u003cp\u003eDue to their non-toxicity to human cells (Cools et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Tavares et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), plant defensins present a promising biotechnological alternative to chemical control methods (Rojas et al., 2010; P\u0026eacute;rez et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These proteins exhibit activity against various pathogens, including \u003cem\u003eBotrytis cinerea\u003c/em\u003e, \u003cem\u003eAlternaria brassicae\u003c/em\u003e (Berk.), \u003cem\u003eFusarium culmorum\u003c/em\u003e (W.G. Smith) Sacc., \u003cem\u003eVerticillium dahliae\u003c/em\u003e (Kleb.), \u003cem\u003eRhizoctonia solani\u003c/em\u003e (K\u0026uuml;hn), and \u003cem\u003eMagnaporthe oryzae\u003c/em\u003e (B. Couch) (Rojas et al., 2010). They can serve as potential substitutes for chemical control or be utilized in combination with chemicals to mitigate environmental damage (P\u0026eacute;rez et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOne such promising defensin is PgD1 from \u003cem\u003ePicea glauca\u003c/em\u003e (Moench) Voss., which consists of 50 amino acids and operates through the mechanism of membrane permeabilization. Studies by Picart et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and Azmi et al. (2021) have demonstrated its efficacy against fungal pathogens such as \u003cem\u003eCylindrocladium floridanum\u003c/em\u003e (Sobers \u0026amp; C.P. Seym), \u003cem\u003eFusarium oxysporum\u003c/em\u003e (Schlecht.), and \u003cem\u003eNectria galligena\u003c/em\u003e (Bress.) (Picart et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePlant defensins are commonly isolated from various plant parts, including roots, seeds, leaves, flowers, and fruits, across a wide range of species (De Coninck et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Hoskin et al., 2008). However, the isolation of defensins from plant tissues may not be efficient, as it is subject to seasonal variations and cultivar flowering patterns, resulting in reduced productivity (Broekaert et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). In our study, we employed recombinant expression of PgD1 defensin in \u003cem\u003eE. coli\u003c/em\u003e followed by its purification. This method, as demonstrated by recent research such as that by Liu et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), has proven to be efficient and yield high quantities of the desired product.\u003c/p\u003e \u003cp\u003eIn light of the growing need for sustainable agricultural practices, this study aims to contribute by elucidating the expression, purification, and potent antifungal activity of PgD1 defensin, offering insights into its potential as a sustainable solution for plant disease management.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCloning and Bioinformatic analysis\u003c/h2\u003e \u003cp\u003eThe gene encoding the \u003cem\u003eP. glauca\u003c/em\u003e full-length PgD1 protein (83 amino acids) is deposited in the Gene Bank under the accession code AAR84643. In the present work we amplified and cloned the coding gene, which corresponds to the last amino acids of the PgD1 protein in its full-length, which was kindly provided by Dr. Armand Seg\u0026uacute;in from Natural Resources Canada and the Canadian Forest Service. Synthetic oligonucleotide primers were used to amplify the DNA fragment containing the PgD1 protein coding sequence using standard PCR conditions.\u003c/p\u003e \u003cp\u003eThe upstream primer (5'AAGGCC ATG GGTCGAACCTGCAAA ACCCCAAGC 3') included an Nco I restriction site (underlined) by adding two extra amino acids (Met and Gly) at the N-terminal end of PgD1, while the downstream primer (5'GGTGCTCGAGATCAAGGGCAGGGCTTGGAGACGTA3') included an Xho I restriction site (underlined).\u003c/p\u003e \u003cp\u003eFollowing purification using the PureLink Quick Gel Extraction Kit (Invitrogen\u0026reg;), the amplified fragments were adenylation-reacted with Taq DNA polymerase and ligated into pGEM-T-Easy\u0026reg; cloning vector using T4 DNA ligase. The ligation product was transformed into electrocompetent \u003cem\u003eE. coli\u003c/em\u003e DH10B cells. Recombinant clones were expanded in a liquid LB medium with antibiotic selection, and plasmidial DNA was purified using the PureLink Quick Plasmid Miniprep Kit (Invitrogen\u0026reg;).\u003c/p\u003e \u003cp\u003eThe purified fragment was cloned into a pET30a(+) expression vector between the Nco I and Xho I restriction sites, therefore the full-length expressed protein includes a histidine tag followed by an S tag at the N-terminal end of the protein.\u003c/p\u003e \u003cp\u003eTo confirm the identity of the cloned gene and ensure the absence of mutations, sequencing of the cloned gene was performed using the Sanger method, and the nucleotide sequence was compared to the PGD1 sequence present in the database using the BLAST tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Furthermore, the sequence was submitted to Phyre and Pymol software to predict the three-dimensional.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExpression and purification of PgD1 defensin\u003c/h2\u003e \u003cp\u003eThe recombinant plasmid pET30a(+): PgD1 previously produced, was electroporated into \u003cem\u003eE. coli\u003c/em\u003e Rosetta (DE3) cells and the transformed cells were inoculated into LB liquid medium containing kanamycin and chloramphenicol as selection markers and incubated at 37\u0026ordm;C until an OD600nm of 0.6 was achieved. Induction occurred in the presence of 0.05 mM IPTG at 17\u0026deg;C for 24 hours. For purification, cells were suspended in Tris-HCl pH 8.0; 300 mM NaCl and 1.5 mM imidazole (Buffer A), containing PMSF, lysozyme (20 mg/mL) and DNAse I (5 \u0026micro;g/mL), and sonication was performed. Cellular debris was removed by centrifugation and the supernatant was applied to a Ni-NTA Agarose pre-equilibrated with buffer A. The resin was washed with buffer B (50 mM Tris-HCl pH 8.0; 300 mM NaCl; 40 mM imidazole) and proteins were eluted in buffer C (500 mM imidazole; 50 mM Tris-HCl pH 8.0).\u003c/p\u003e \u003cp\u003eThe active fractions were dialyzed against buffer A, lyophilized, and stored at 4\u0026ordm;C. The last step of purification consisted of dialysis to remove excess imidazole with 50 mM Tris HCl buffer pH 7.0 at 4\u0026ordm;C. After dialysis, the protein concentration was measured using the Thermo Scientific nanodrop NanoDrop\u0026reg; 2000 spectrophotometer. Protein purification was confirmed by SDS-Page and Western Blotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIn Vitro Antifungal Activity Assay\u003c/h2\u003e \u003cp\u003eThe evaluation of the antifungal potential of PgD1 defensin was carried out using two techniques: the growth inhibition test in solid medium in a Petri dish, and in liquid medium in a 96-well plate.\u003c/p\u003e \u003cp\u003eFor the first technique, fungal growth was monitored by inoculating fungi (\u003cem\u003eB. cinerea\u003c/em\u003e, \u003cem\u003eC. gloeosporioides\u003c/em\u003e, \u003cem\u003eC. musae\u003c/em\u003e, \u003cem\u003eC. graminicola\u003c/em\u003e, and \u003cem\u003eF. oxysporum\u003c/em\u003e) on Petri dishes and inserting 0.5 cm paper discs containing 2 mM of PgD1 defensin into plates with Potato Dextrose Agar (PDA). The plates were stored at 28\u0026deg;C for 6 days. After this period, growth was measured.\u003c/p\u003e \u003cp\u003eFor the second technique, fungal growth was monitored in microtiter plates containing 200 \u0026micro;L of liquid Potato Dextrose medium, inoculated with 2000 spores of each fungus (\u003cem\u003eB. cinerea\u003c/em\u003e, \u003cem\u003eC. gloeosporioides\u003c/em\u003e, \u003cem\u003eC. musae\u003c/em\u003e, \u003cem\u003eC. graminicola\u003c/em\u003e, and \u003cem\u003eF. oxysporum\u003c/em\u003e), and supplemented with varying concentrations of PgD1 defensin (0.5 \u0026micro;M, 0.75 \u0026micro;M, 1 \u0026micro;M, 1.5 \u0026micro;M, 2 \u0026micro;M, and 4 \u0026micro;M). The plates were stored at 28\u0026deg;C, and absorbance was measured at 595 nm for 6 days. Percentages of growth inhibition were assessed by analyzing the area under the curve (AUC) of the growth curves for each replicate (three).\u003c/p\u003e \u003cp\u003eAll experiments were repeated at least twice. The means were subjected to statistical analysis using the Student's t-test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTemperature Variation Resistance Test*\u003c/h2\u003e \u003cp\u003eThe thermal stability of PgD1 defensin, at a final concentration of 2 \u0026micro;M against \u003cem\u003eC. gloeosporioides\u003c/em\u003e spores, was evaluated after pretreating the protein at 25\u0026deg;C, 50\u0026deg;C, 75\u0026deg;C, and 100\u0026deg;C for 30 minutes. The activity of PgD1 was then assessed in comparison to a control reaction conducted at 25\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDenaturation Assay Using Dithiothreitol (DTT)\u003c/h2\u003e \u003cp\u003eThe activity of PgD1 defensin at 2 \u0026micro;M, treated with 0.1 mM and 1 mM DTT, was tested against \u003cem\u003eC. gloeosporioides\u003c/em\u003e spores over three days and compared to a control reaction without DTT.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003eCloning and Bioinformatic Analysis\u003c/h2\u003e\n\u003cp\u003eA DNA fragment encompassing the PgD1 sequence was successfully amplified via PCR, resulting in a specific product of 154 bp. Post-amplification, the DNA fragment was ligated into the pGEM vector. The ligated construct was then transformed into \u003cem\u003eE. coli\u003c/em\u003e DH10B cells. Positive clones harboring the desired insert were identified through colony PCR screening, with five colonies confirming the presence of the PgD1 insert (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003es - supplementary material). Colony #3 was propagated in LB medium and subjected to plasmid extraction using the PureLink Quick Plasmid Miniprep kit (Invitrogen\u0026reg;). The extracted plasmid, designated pGEM::Def3, was further characterized by PCR as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003es (supplementary material). Subsequently, the pGEM::Def3 plasmid was subcloned into the pET30a(+) vector using Nco I and Xho I restriction sites, resulting in the construct pET30a(+)::Def. This construct was transformed into electrocompetent \u003cem\u003eE. coli\u003c/em\u003e DH10B cells. Colony PCR screening across these transformations demonstrated the ubiquity of the PgD1 gene within the colonies, as documented in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003es (supplementary material). Finally, the sequence of the recombinant vector pET30a(+)::Def2 was confirmed by sequencing, with the sequence data provided by the sequencing service displayed in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003eThe obtained sequence was analyzed using the BLAST tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003c/span\u003e) to observe the similarity between the pET30::Def2 clone sequence and the PgD1 defensin sequence present in the database under GenBank accession number AAR84643. The sequence obtained showed 100% identity with the PgD1 gene of \u003cem\u003eP. glauca\u003c/em\u003e, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003eThe defensin PgD1 amino acid sequence was submitted to Phyre and Pymol software to determine 3D structure which enabled analysis of specific regions of the proteins as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003eHydrogen bonds (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA), disulfide bonds (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC), and repulsive interactions (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB) play critical roles in shaping the structure and function of proteins. Hydrogen bonds and repulsive interactions contribute to the stability of protein secondary structures like alpha helices and beta sheets, while disulfide bonds provide additional stability to the tertiary structure, crucial for maintaining the protein's integrity amidst varying environmental conditions. In antimicrobial proteins, positive charges (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD), often attributed to amino acid residues like lysine or arginine, facilitate electrostatic interactions with negatively charged components on microbial cell surfaces. This interaction aids in membrane disruption and penetration into microbial cells, where the antimicrobial protein can exert its activity, targeting vital intracellular components and processes, ultimately leading to microbial cell death.\u003c/p\u003e\n\u003cp\u003eThe striking resemblance in sequence (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC) and conformation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and B) between the defensin PgD1 and RAsFP1 suggests a potential similarity in their antifungal properties. The shared structural characteristics, particularly in their 3D arrangements, likely represent the functional moiety responsible for their antimicrobial activity. This similarity underscores the importance of structural features in dictating the efficacy of antimicrobial proteins.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003eExpression and purification of PgD1 defensin\u003c/h2\u003e\n\u003cp\u003eFor the expression of the recombinant protein PgD1 (pET30a(+)::Def2), \u003cem\u003eE. coli\u003c/em\u003e BL21(DE3) was chosen. This strain contains the lambda DE3 prophage, which includes the gene for T7 RNA polymerase under the control of a lacUV5 promoter. This setup allows for the induction of T7 RNA polymerase expression with IPTG. During the expression, various optimization procedures were tested, including different concentrations of IPTG and various induction temperatures. The optimal conditions determined for our process were an induction temperature of 18\u0026deg;C, which resulted in enhanced expression of the protein in the soluble fraction. To identify the expressed PgD1 defensin, a 15% SDS-PAGE was utilized, allowing for the separation of proteins based on their molecular size. As depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, an intense band is visible in lane three, corresponding to a protein with a molecular mass of approximately 14 kDa\u0026mdash;matching the expected size for the protein. In lane seven, the presence of PgD1 is observed post-purification, confirming the effectiveness of the purification protocols employed. Lanes four, five, and six exhibit the absence of the 14 kDa band. This absence is attributed to the histidine tail of PgD1 defensin binding to the Ni-NTA agarose during the purification process, indicating successful adherence to the chromatographic column as anticipated.\u003c/p\u003e\n\u003cp\u003eThe Western Blot technique was used to demonstrate the presence of the protein through its histidine tail. The proteins were transferred to the nitrocellulose membrane and treated with a blocking solution, anti-His Tag primary antibody, and anti-mouse secondary antibodies anchored in the alkaline phosphatase enzyme, for detection of the target protein. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eS shows a band signaling a protein with approximately 14kDa, which indicates the presence of the PgD1 defensin (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003es - supplementary material).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vitro\u003c/strong\u003e \u003cstrong\u003eantifungal activity assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAntifungal activity assays were conducted in microtiter plates against plant pathogenic fungi using varying concentrations of recombinant PgD1, ranging from 0.5 \u0026micro;M to 4.0 \u0026micro;M. The results demonstrated that PgD1 defensin significantly inhibited the growth of \u003cem\u003eC. gloeosporioides\u003c/em\u003e at concentrations from 0.5 \u0026micro;M to 4.0 \u0026micro;M (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe inhibition of the growth of other strains of \u003cem\u003eC. gloeosporioides\u003c/em\u003e (isolated from different plants) was also tested. We can see that the PgD1 defensin promoted the inhibition of fungal growth for all strains of \u003cem\u003eC. gloeosporioides\u003c/em\u003e, corroborating the results of the previous experiment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe tests with \u003cem\u003eC. gloeosporioides\u003c/em\u003e showed very similar results at concentrations of 2 \u0026micro;M and 4 \u0026micro;M. Consequently, tests on other fungi were conducted using only the 2 \u0026micro;M concentration. In the inhibition test with \u003cem\u003eC. graminicola\u003c/em\u003e, PgD1 defensin reduced fungal growth but did not completely inhibit it (see Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eIn the test with \u003cem\u003eC. musae\u003c/em\u003e, total inhibition occurred at a concentration of 2\u0026micro;M throughout the experiment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eInhibition was also tested for the fungi \u003cem\u003eB. cinerea\u003c/em\u003e and \u003cem\u003eF. oxysporum\u003c/em\u003e, using defensin concentrations of 0.5\u0026micro;M to 4\u0026micro;M, measuring growth after 7 days. The results show that there was inhibition for the fungus \u003cem\u003eB. cinerea\u003c/em\u003e, however for the fungus \u003cem\u003eF. oxysporum\u003c/em\u003e there was a significative reduction in growth, but there was no total inhibition (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe antifungal activity assay, carried out in a Petry dish, against phytopathogenic fungi was carried out with a concentration of 2\u0026micro;M of recombinant PgD1. The results showed that PgD1 defensin reduces the growth of \u003cem\u003eC. gloeosporioides\u003c/em\u003e, \u003cem\u003eB. cinerea\u003c/em\u003e and \u003cem\u003eF. oxysporum\u003c/em\u003e, however only for the fungus \u003cem\u003eB. cinerea\u003c/em\u003e this reduction was significant (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eTemperature variation resistance test\u003c/h2\u003e\n\u003cp\u003eThe stability test at different temperatures showed that PgD1 defensin against \u003cem\u003eC. gloeosporioides\u003c/em\u003e is resistant to temperature variation. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e the antifungal activity remains above 90% even when the defensin is subjected to heating at 50\u0026ordm;C, 75\u0026ordm;C, and 100\u0026ordm;C.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eDenaturation assay using Dithiothreitol (DTT)\u003c/h2\u003e\n\u003cp\u003eDithiothreitol (DTT) is a denaturing agent as it cleaves the disulfide bonds formed between cysteine residues (Galdos-Riveros, 2010; Rocha et al., \u003cspan class=\"CitationRef\"\u003e2005\u003c/span\u003e). The PgD1 defensin denaturation test 2\u0026micro;M of the protein treated with DTT in two concentrations 0.1mM and 1mM. The results showed that in the presence of DTT in both concentrations, Defensin PgD1 was completely inhibited, with the growth of the fungus \u003cem\u003eC. gloeosporioides\u003c/em\u003e occurring at the same speed as the control sample (without defensin) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003e), as expected, as this defensin is rich in cysteines.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlmost 30 years ago, Broekaert and colleagues (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1995\u003c/span\u003e) published the first articles describing plant defensins as part of the innate immune system of plants. From this discovery, we've learned about the role of these proteins in protecting plants against invading agents like fungi and bacteria. Today, these defensins are isolated or expressed and purified in laboratories for use as antimicrobial proteins (AMPs) against numerous pathogens. This is exemplified in Koo's (2019) work, which demonstrates the use of plant defensins not only in treating plants but also in combating pathogens that affect both animals and humans.\u003c/p\u003e \u003cp\u003eIn our study, we expressed and purified PgD1, a defensin from \u003cem\u003eP. glauca\u003c/em\u003e. This protein is rich in cysteines and has a molecular weight of 13.752 kDa, which is comparable to other pine defensins. For instance, Liu and colleagues (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) found PaDef to have a molecular weight of 9.0665 kDa, while Picart and collaborators (2012) reported PgD5 at 18 kDa. Additionally, PsDef, another pine defensin, exhibits antifungal activity similar to PgD1. The work of Shalovylo and colleagues (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) illustrates a close genetic relationship between PsDef and PgD1, which may lead to similar functional characteristics.\u003c/p\u003e \u003cp\u003eThe similarity between these defensins is linked to their primary protein structures (Van Der Weerden et al., 2013). Research by Thomma (2002) and Shalovylo (2021) demonstrates that cysteine residues are essential for maintaining the stable conformation of plant defensins. The presence of disulfide bonds is also necessary for pore formation in membranes, which is fundamental to antimicrobial activity. Wang et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) confirmed that antimicrobial activity is closely associated with the stability of the β-hairpin structures, and removing disulfide bonds significantly diminishes their antimicrobial function. This was confirmed in our study through the DTT denaturation test (Fig.\u0026nbsp;\u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e12\u003c/span\u003e), which showed a complete loss of antifungal function after breaking disulfide bonds. Other amino acid residues in the primary protein structure are also crucial. Samblanx and collaborators (1997) observed that mutating specific amino acids in the RsAFP1 defensin led to the loss of function. Since PgD1 and RsAFP1 defensins share these residues (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003e), part of their antifungal properties can be attributed to these amino acids (Shalovylo et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe recombinant defensin PgD1 exhibited antifungal activity against five phytopathogenic fungi: \u003cem\u003eC. gloeosporioides, C. musae, C. graminicola, F. oxysporum, and B. cinerea.\u003c/em\u003e Pervieux and colleagues (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) found that PgD1 also has activity against F. \u003cem\u003eoxysporum\u003c/em\u003e. At the time of writing, no studies had examined PgD1 against \u003cem\u003eC.\u003c/em\u003e and \u003cem\u003eB.\u003c/em\u003e species. However, Liu et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) reported that PaDef, another pine defensin, also has antifungal activity against \u003cem\u003eC. gloeosporioides and B. cinerea\u003c/em\u003e. Kovalera and collaborators (2011) and Picart et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) showed that the pine defensins PsDef and PgD5, respectively, are effective against \u003cem\u003eB. cinerea and F. oxysporum\u003c/em\u003e. This confirms that pine defensins are effective antifungal agents. Further research (Parisi et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Shahmiri et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) suggests that pine defensins interact with fungal membranes, forming pores that lead to cell death.\u003c/p\u003e \u003cp\u003eIn this study, we've demonstrated the potent antifungal activity of plant defensins. However, large quantities are necessary for field applications. We opted for recombinant expression in \u003cem\u003eE. coli\u003c/em\u003e cells, a highly efficient protocol for protein expression and purification. This method provides a fast, cost-effective, and reliable means to produce recombinant proteins at scale, making it an ideal strategy for manufacturing bioinputs (Deo et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Kovalera, 2011).\u003c/p\u003e \u003cp\u003eBesides efficient expression, plant defensins are also resistant to degradation caused by temperature changes. This makes them suitable for various applications (Ermakova et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The PgD1 defensin has shown stability under varying temperatures, which aligns with findings from other studies, such as those by Kovalera (2020) and Wu (2022).\u003c/p\u003e \u003cp\u003eGiven its stability, relatively simple production, and excellent potential to inhibit phytopathogenic fungi, PgD1 defensin can be a viable alternative or complement to pesticides, reducing the socio-environmental impacts of food production. This potential is also seen in other plant defensins, such as MtDef4 (Tetorya \u0026amp; Li, 2023), PvDef (Mohamed et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and GMA4CG_V6 (Djami-Tchatchou et al., 2023). Using defensins as antifungals represents a promising biotechnological innovation that warrants further research for improving environmental health.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003ePartial financial support was received from Grant PAP2023011000003 FAPESC No 48/2022\u003c/p\u003e\n\u003ch2\u003eConflicts of interest/Competing interests\u003c/h2\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eThe data that support the findings of this study are available on request from the corresponding author, M.L.B.M.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eA. C.B. M. performed the antifungal experimentsE. M.P.T cloned expressed and purified defensinL. C. Camillo wrote the manuscript and assisted with antifungal experimentsG.F. D. S Wrote the manuscript, prepared the figures, and conceptualized the projectM. J. G isolated fungal speciesR. C. isolated fungal speciesL. R. isolated fungal speciesM.L.B. M. Wrote the manuscript, prepared the figures and conceptualize the project\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eAuthors acknowledge Dr. Armand Seg\u0026uacute;in from Natural Resources Canada and the Canadian Forest Service for providing PgD1 gene.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAzmi, S., \u0026amp; Hussain, M. K. (2021). Analysis of structures, functions, and transgenicity of phytopeptides defensin and thionin: a review. Beni-Suef Univ J Basic Appl Sci, 10(5). doi: https://doi.org/10.1186/s43088-020-00093-5\u003c/li\u003e\n\u003cli\u003eBroekaert, W. F., Terras, F. R. G., \u0026amp; Cammue, B. P. A. (1995). Plant Defensins: Novel Antimicrobial Peptides as Components of the Host Defense System. Plant Physiol, 1995.\u003c/li\u003e\n\u003cli\u003eCardillo, A. B., Ceron, M. C. M., \u0026amp; Romero, S. M. (2018). Antimicrobial peptides from plants. National Academy of Pharmacy and Biochemistry; Pharmaceutical Magazine, 160(1), 28-46. doi: https://ri.conicet.gov.ar/handle/11336/83586\u003c/li\u003e\n\u003cli\u003eCools, T. L., et al. (2017). Antifungal plant defensins: Increased insight into their mode of action as a basis for their use to combat fungal infections. Future Microbiology, 12(5), 441-454. doi: 10.2217/fmb-2016-0181.\u003c/li\u003e\n\u003cli\u003eCornet, B., Bonmatin, J. -M., Hetru, C., Hoffmann, J. A., Ptak, M., \u0026amp; Vovelle, F. (1995). Refined three-dimensional solution structure of insect defensin A. Structure, 3, 435\u0026ndash;448. https://doi.org/10.1016/S0969-2126(01)00177-0.\u003c/li\u003e\n\u003cli\u003eda Silva Gebara, R., Taveira, G. B., de Azevedo dos Santos, L., et al. (2020). Identifica\u0026ccedil;\u0026atilde;o e caracteriza\u0026ccedil;\u0026atilde;o de duas defensinas de frutos de Capsicum annuum que apresentam atividade antimicrobiana. Probi\u0026oacute;ticos e Antimicro. Prot., 12, 1253\u0026ndash;1265. https://doi.org/10.1007/s12602-020-09647-6.\u003c/li\u003e\n\u003cli\u003eDe Coninck, B., Cammue, B. P. A., \u0026amp; Thevissen, K. (2013). Modes of antifungal action and in planta functions of plant defensins and defensin-like peptides. Fungal Biol Rev, 26, 109\u0026ndash;120.\u003c/li\u003e\n\u003cli\u003eDeo, S., Turton, K.L., Kainth T., et al. (2022). Strategies for improving antimicrobial peptide production. Biotechnol Adv, 59, 107968. https://doi.org/10.1016/j.biotechadv.2022.107968. Djami-Tchatchou, A. T., Tetoria, M., Godwin, J., Codjoe, J. M., Li, H., \u0026amp; Shah, D. M. (2023). Small cationic cysteine-rich defensin-derived antifungal peptide controls white mold in soybeans. J. Fungi, 9, 873. https://doi.org/10.3390/jof9090873.\u003c/li\u003e\n\u003cli\u003eErmakova, E. A., Faizullin, D. A., Idiyatullin, B. Z., Khairutdinov, B. I., Mukhamedova, L. N., Tarasova, N. B., Toporkova, Y. Y., Osipova, E. V., Kovaleva, V., Gogolev, Y. V., Zuev, Y. F., \u0026amp; Nesmelova, I. V. (2016). Structure of Scots pine defensin 1 by spectroscopic methods and computational modeling. International Journal of Biological Macromolecules, 84, 142-152. ISSN 0141-8130. https://doi.org/10.1016/j.ijbiomac.2015.12.011.\u003c/li\u003e\n\u003cli\u003eGaldos-Riveros, G., Piza, A. T., Resende, L., Maria, D. A., \u0026amp; Miglino, M. A. (2010). Enciclop\u0026eacute;dia Biosfera, Centro Cient\u0026iacute;fico Conhecer - Goi\u0026acirc;nia, vol.6, N.11.\u003c/li\u003e\n\u003cli\u003eHoskin, D. W., \u0026amp; Ramamoorthy, A. (2008). Studies on anticancer activities of antimicrobial peptides. Biochim Biophys Acta, 1778, 357\u0026ndash;375. https://doi.org/10.1016/j.bbamem.2007.11.008.\u003c/li\u003e\n\u003cli\u003eKoo, H. B. \u0026amp; Seo, J. (2019). Antimicrobial peptides under clinical investigation. Pept Sci. doi: https://doi.org/10.1002/pep2.24122\u003c/li\u003e\n\u003cli\u003eKovalera, V., Bukhteeva, I., Kit, O. Y. et al. Plant Defensins from a structural perspective. Int J Mol Sci. 2020 Jul 26. doi: 10.3390/ijms21155307.\u003c/li\u003e\n\u003cli\u003eKovalera, V., Krynytskyy, H., Gout, I., et al. (2011). Recombinant expression, affinity purification and functional characterization of Scots pine defensin 1. Appl Microbiol Biotechnol, 89, 1093-1101. https://doi.org/10.1007/s00253-010-2935-2.\u003c/li\u003e\n\u003cli\u003eLacerda, A. F., Vasconcelos, \u0026Atilde;. R. A. R., Pelegrini, P. C. B., \u0026amp; Grossi De S\u0026aacute;, M. F. (2014). Antifungal defensins and their role in plant defense. Front Microbiol, 5, 116.\u003c/li\u003e\n\u003cli\u003eLima, A. M., Azevedo, M. I. G., Souza, L. M., et al. (2022). Plant antimicrobial peptides: An overview about classification, toxicity and clinical applications. International Journal of Biological Macromolecules, 214, 10-21. doi: https://doi.org/10.1016/j.ijbiomac.2022.06.043.\u003c/li\u003e\n\u003cli\u003eLiu, Y., Liu, L., Yang, C., et al. (2022). Identifica\u0026ccedil;\u0026atilde;o molecular e atividade antif\u0026uacute;ngica de uma defensina (PaDef) de Spruce. J Plant Growth Regul, 41, 494\u0026ndash;506. https://doi.org/10.1007/s00344-021-10316-3.\u003c/li\u003e\n\u003cli\u003eMohamed, S. S., El-Mahdy, M. M., Mabrouk, A. M., Salem, R., Shehata, M. M., El-Kholy, I. M. A., \u0026amp; Abouseadaa, H. H. (2023). Molecular Characterization, Heterologous Expression and Antimicrobial Activity of Phaseolus vulgaris L. Defensin Peptide (Pv-Def) against various Human MDR Pathogens. Egypt. J. Bot., 63(3), 841-849. http://ejbo.journals.ekb.eg/\u003c/li\u003e\n\u003cli\u003eParisi, K., McKenna, J. A., Mais baixo, Harris, K. S., Shafee, T., Guarino, R., Lee, E., van der Weerden, Pa\u0026iacute;ses Baixos, Bleckley, M. R., \u0026amp; Anderson, M. A. (2024). Hyperpolarisation of Mitochondrial Membranes Is a Critical Component of the Antifungal Mechanism of the Plant Defensin, Ppdef1. J. Fungos, 10, 54. https://doi.org/10.3390/jof10010054.\u003c/li\u003e\n\u003cli\u003eP\u0026eacute;rez, N. S., Obreg\u0026oacute;n, G. A. E., Avera, Y. H., et al. (2022). Transgenic soybean modification event for greater resistance to Asian rust. Anais do ACC, Havana, 12(3). doi:http://scielo.sld.cu/scielo.php?script=sci_arttext\u0026amp;pid=S2304-01062022000300007\u0026amp;lng=es\u0026amp;nrm=iso. acesso em 09 fev. 2024. Epub 01 de novembro de 2022.\u003c/li\u003e\n\u003cli\u003ePervieux, I., Bourassa, M., Laurans, F., et al. (2004). A spruce defensin showing strong antifungal activity and increased transcript accumulation after wounding and jasmonate treatments. Physiological and Molecular Plant Pathology, 64, 331-341. Doi: https://doi.org/10.1016/j.pmpp.2004.09.008.\u003c/li\u003e\n\u003cli\u003ePicart, P., Pirttila, A. M., Raventos, D., Kristensen, H. H., \u0026amp; Sahl, H. G. (2012). Identification of spruce defensin encoding genes: Characterization of PgD5, a conserved spruce defensin with strong antifungal activity. BMC Plant Biol, 12, 180.\u003c/li\u003e\n\u003cli\u003eRocha, T. L., Costa, P. H. A., Magalh\u0026atilde;es, J. C. C., Evaristo, R. G. S., Vasconcelos, E. A. R., Coutinho, M. V., Paes, N. S., Silva, M. C. M., \u0026amp; Grossi-de-S\u0026aacute;, M. F. (2005). Eletroforese bidimensional e an\u0026aacute;lise de proteomas. Comunicado T\u0026eacute;cnico, Embrapa Recursos Gen\u0026eacute;ticos e Biotecnologia, n. 136, p. 1-12.\u003c/li\u003e\n\u003cli\u003eRojas Arias, A. C. R., \u0026amp; Espitia, H. M. Z. (2010). Plant defensins and their potential use as pest controllers in agriculture. Acta Biol\u0026oacute;gica Colombiana, 15(3), 33-46.\u003c/li\u003e\n\u003cli\u003eSamblanx, G. W., Goderis, I. J., Thevissen, K., Raemaekers, R., Fant, F., Borremans, F., et al. (1997). Mutational analysis of a plant defensin from radish (Raphanus sativus L.) reveals two adjacent sites important for antifungal activity. J Biol Chem, 272, 1171\u0026ndash;1179.\u003c/li\u003e\n\u003cli\u003eSchr\u0026ouml;dinger, L. \u0026amp; DeLano, W., 2020. PyMOL, Available at: http://www.pymol.org/pymol.\u003c/li\u003e\n\u003cli\u003eShahmiri, M., Bleackley, M. R., Dawson, C. S., van der Weerden, N. L., Anderson, M. A., \u0026amp; Mechler, A. (2023). Membrane-binding properties of plant defensins. Phytochemistry, 209, 113618. ISSN 0031-9422. https://doi.org/10.1016/j.phytochem.2023.113618.\u003c/li\u003e\n\u003cli\u003eShalovylo, Y. I., Yusypovych, Y. M., Hrunyk, N. I., Roman, I. I., Zaika, V. K., Krynytskyy, H. T., Nesmelova, I. V., \u0026amp; Kovaleva, V. A. (2021, November 24). Seed-derived defensins from Scots pine: structural and functional features. Planta, 254(6), 129. doi: 10.1007/s00425-021-03788-w. PMID: 34817648.\u003c/li\u003e\n\u003cli\u003eTavares, L. S., et al. (2008). Biotechnological potential of antimicrobial peptides from flowers. Peptides, 29(10), 1842-1851. doi: 10.1016/j.peptides.2008.06.003.\u003c/li\u003e\n\u003cli\u003eTetorya, M., Li, H., Djami-Tchatchou, A. T., Buchko, G. W., Czymmek, K. J., \u0026amp; X\u0026aacute;, D. M. (2023). Plant defensin MtDef4-derived antifungal peptide with multiple modes of action and potential as a bio-inspired fungicide. Publicado em Molecular Plant Pathology. DOI: 10.1111/mpp\u003c/li\u003e\n\u003cli\u003eThomma, B. P. H. J., Thevissen, K., \u0026amp; Cammue, B. P. (2002). Plant defensins. Plant, 216, 193-202.\u003c/li\u003e\n\u003cli\u003eVan Der Weerden, N. L., \u0026amp; Anderson, M. A. (2013). Plant defensins: Common fold, multiple functions. Fungal Biology Reviews, 26(4), 121-131. doi: https://doi.org/10.1016/j.fbr.2012.08.004.\u003c/li\u003e\n\u003cli\u003eVriens, K., Cammue, B., \u0026amp; Thevissen, K. (2014). Antifungal plant defensins: mechanisms of action and production. Molecules, 19, 12280\u0026ndash;12303.\u003c/li\u003e\n\u003cli\u003eWang, J., Dou, X., Can\u0026ccedil;\u0026atilde;o, J., \u0026amp; outros. (2019). Antimicrobial peptides: promising alternatives in the post-antibiotic era. Med Res Rev, 39, 831-859. https://doi.org/10.1002/med.21542.\u003c/li\u003e\n\u003cli\u003eWu, J., Zhou, X., Chen, Q. et al. Defensins as a promising class of tick antimicrobial peptides: a scoping review. Infect Dis Poverty. 2022 Jun 20. doi: 10.1186/s40249-022-00996-8. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4378807/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4378807/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePlant defensins are antimicrobial proteins (AMP) with a molecular weight of approximately 5 kDa that participate in the immune defense of plants through their antimicrobial, antiviral and antifungal activities. PgD1 is a defensin from \u003cem\u003ePicea glauca\u003c/em\u003e (Canadian Pine) and presents antifungal activity against plant pathogens. This activity positions it as an alternative biotechnological route to pesticides commonly used against these diseases. The present study aimed to recombinantly produce PgD1 in \u003cem\u003eEscherichia coli\u003c/em\u003e to report its \u003cem\u003ein vitro\u003c/em\u003e antifungal potential against different phytopathogens. To achieve this, the coding gene was amplified and cloned into pET30a(+). Recombinant plasmid was subsequently introduced into \u003cem\u003eE. coli\u003c/em\u003e for the soluble expression defensin PgD1. To evaluate the antifungal activity of the expressed protein, the growth inhibition test was used in solid and liquid media for approximately 7 days against significant plant pathogens: \u003cem\u003eBotrytis cinerea\u003c/em\u003e, \u003cem\u003eColletotrichum gloeosporioides\u003c/em\u003e, \u003cem\u003eColletotrichum musae\u003c/em\u003e, \u003cem\u003eColletotrichum graminicola\u003c/em\u003e and \u003cem\u003eFusarium oxysporum\u003c/em\u003e. Additionally, stability assessments involved temperature variation experiments and inhibition tests using dithiothreitol (DTT). The results show that there was significant inhibition of the fungal species tested when in the presence of PgD1. Furthermore, defensin proved to be resistant to temperature variations and demonstrated that part of its stability is due to its primary structure rich in cysteine ​​residues through the denaturation test with dithiothreitol (DTT) where the antifungal activity of PgD1 defensin was inhibited.\u003c/p\u003e","manuscriptTitle":"Plant defensin PgD1 a biotechnological alternative against plant pathogens","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-31 16:18:55","doi":"10.21203/rs.3.rs-4378807/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-23T16:30:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-23T16:26:31+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-22T09:49:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"257541032809898860107700914171076697893","date":"2024-05-21T14:41:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"157881046738231594863513978255668703084","date":"2024-05-17T01:32:28+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-16T22:27:15+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-14T10:19:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-14T10:19:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Probiotics and Antimicrobial Proteins","date":"2024-05-06T19:22:44+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"28567e21-fbce-43af-b410-397e54c4828e","owner":[],"postedDate":"May 31st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-09T16:10:26+00:00","versionOfRecord":{"articleIdentity":"rs-4378807","link":"https://doi.org/10.1007/s12602-024-10333-0","journal":{"identity":"probiotics-and-antimicrobial-proteins","isVorOnly":false,"title":"Probiotics and Antimicrobial Proteins"},"publishedOn":"2024-09-07 15:57:01","publishedOnDateReadable":"September 7th, 2024"},"versionCreatedAt":"2024-05-31 16:18:55","video":"","vorDoi":"10.1007/s12602-024-10333-0","vorDoiUrl":"https://doi.org/10.1007/s12602-024-10333-0","workflowStages":[]},"version":"v1","identity":"rs-4378807","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4378807","identity":"rs-4378807","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00